Embed Size (px)
Citation preview
Roles for the Cohibin complex and its associated factors in the maintenance of several silent chromatin domains in S. cerevisiae
by
Betty Po Kei Poon
A thesis submitted in conformity with the requirements for the degree of Master of Science
Laboratory Medicine and Pathobiology University of Toronto
© Copyright by Betty Po Kei Poon 2012
ii
Roles for the Cohibin complex and its associated factors in the
maintenance of several silent chromatin domains in S. cerevisiae
Betty Po Kei Poon
Master of Science
Laboratory Medicine and Pathobiology University of Toronto
2012
Abstract
In Saccharomyces cerevisiae, the telomeres and rDNA repeats are repetitive silent chromatin
domains that are tightly regulated to maintain silencing and genome stability. Disruption of the
Cohibin complex, which maintains rDNA silencing and stability, also abrogates telomere
localization and silencing. Cohibin-deficient cells have decreased Sir2 localization at telomeres,
and restoring telomeric Sir2 concentrations rescues the telomeric defects observed in Cohibin-
deficient cells. Genetic and molecular interactions suggest that Cohibin clusters telomeres to the
nuclear envelope by binding inner nuclear membrane proteins. Futhermore, telomeric and rDNA
sequences can form G-quadruplex structures. G-quadruplexes are non-canonical DNA structures
that have been linked to processes affecting chromosome stability. Disruption of the G-
quadruplex stabilizing protein Stm1, which also interacts with Cohibin, increases rDNA stability
without affecting silent chromatin formation. In all, our findings have led to the discovery of new
processes involved in the maintenance of repetitive silent chromatin domains that may be
conserved across eukaryotes.
iii
Acknowledgments
I wish to thank my supervisor, Dr. Karim Mekhail, for all his support and mentorship throughout
my graduate studies. I also want to thank my committee members, Dr. Jeremy Mogridge, Dr.
Corey Nislow, and Dr. Marc Meneghini, who gave me valuable feedback on my research project
and guided me in the right direction.
I would like to thank all the members of the Mekhail lab, past and present. Many thanks to Janet
Chan, Jayesh Salvi, Sasha Ebrahimi, Chris Pettigrew, Chen Xi Li, Jackie Tang, Tony Liu, and
Jane Wu. You have made my Master’s an unforgettable experience, and I will miss working with
all of you.
Last, but definitely not least, I want to thank my parents, my brother, and all my friends who
have given me their unconditional support and encouragement these past few years. Without all
of you, I would not have been able to get through this.
iv
Table of Contents
Abstract ........................................................................................................................................... ii
Acknowledgments .......................................................................................................................... iii
Table of Contents ........................................................................................................................... iv
List of Tables ............................................................................................................................... viii
List of Figures ................................................................................................................................ ix
List of Abbreviations ..................................................................................................................... xi
Chapter 1 Introduction .................................................................................................................... 1
1 Introduction ................................................................................................................................ 2
1.1 Spatial organization of eukaryotic chromatin ..................................................................... 2
1.1.1 Genome organization, maintenance, and stability .................................................. 4
1.1.2 Yeast as a genetic model for spatial genome organization ..................................... 4
1.2 Repetitive silent chromatin domains in S. cerevisiae ......................................................... 5
1.2.1 The histone deacetylase Sir2 in silent chromatin formation ................................... 5
1.3 Telomeres ............................................................................................................................ 6
1.3.1 SIR complex in telomere maintenance ................................................................... 6
1.3.2 Perinuclear proteins in telomere maintenance ........................................................ 9
1.3.3 Conservation of Mps3 and SUN-domain containing proteins .............................. 10
1.4 Ribosomal DNA (rDNA) repeats ...................................................................................... 12
1.4.1 RENT and Tof2 in rDNA maintenance ................................................................ 12
1.4.2 The Cohibin complex in rDNA maintenance ....................................................... 15
1.4.3 Conservation of Heh1 and LEM-domain containing proteins in genome organization and chromosome stability ................................................................ 24
1.5 G-quadruplex (G4) DNA .................................................................................................. 26
1.5.1 Characterization of G4 DNA ................................................................................ 26
1.5.2 G4 DNA in vitro versus in vivo ............................................................................ 28
v
1.5.3 Distribution of G4 DNA across the eukaryotic genome ....................................... 28
1.5.4 G-quadruplex helicases and chromosome instability ........................................... 31
1.6 Stm1, a G-quadruplex binding protein .............................................................................. 32
1.6.1 Localization of Stm1 ............................................................................................. 33
1.6.2 Potential function of Stm1 at telomeres ................................................................ 34
1.7 Rationale and Hypothesis ................................................................................................. 36
Chapter 2 Materials and Methods ................................................................................................. 37
2 Materials and Methods ............................................................................................................. 38
2.1 Strains and Materials ......................................................................................................... 38
2.2 Yeast Transformation ........................................................................................................ 38
2.3 Silencing Assay ................................................................................................................. 39
2.4 RNA extraction ................................................................................................................. 39
2.5 Liquid 5FOA and/or HU treatments ................................................................................. 40
2.6 Semi-quantitative and quantitative RT-PCR .................................................................... 40
2.7 Imaging ............................................................................................................................. 40
2.8 Immunofluorescence ......................................................................................................... 41
2.9 Western Blotting ............................................................................................................... 41
2.10 Genomic DNA preparation ............................................................................................... 42
2.11 Southern Blotting .............................................................................................................. 42
2.12 ChIP .................................................................................................................................. 43
2.13 Immunoprecipitation ......................................................................................................... 43
2.14 Unequal Sister Chromatid Exchange Assay ..................................................................... 44
2.15 Telomere capping assay .................................................................................................... 44
Chapter 3 Cohibin mediates telomere silencing and localization ................................................. 49
3 Cohibin mediates telomere silencing and localization ............................................................. 50
3.1 Introduction ....................................................................................................................... 50
vi
3.2 Results ............................................................................................................................... 51
3.2.1 Cohibin is required for the silencing of foreign telomere-proximal reporter genes ..................................................................................................................... 51
3.2.2 Cohibin and CLIP are involved in silencing of exogenous and endogenous telomere-distal genes ............................................................................................ 57
3.2.3 Cohibin physically interacts with SIR at telomeres, and links SIR-bound telomeres to Heh1 ................................................................................................. 59
3.2.4 Cohibin cooperates with LEM and SUN domain INM proteins to maintain telomeric silencing ................................................................................................ 61
3.2.5 Cohibin is required for telomere anchoring to the INM during S phase .............. 67
3.2.6 Cohibin plays a lesser role in telomere anchoring during G1 ............................... 73
3.2.7 Cohibin can artificially induce partial perinuclear localization and silencing of an internal locus under certain conditions ............................................................ 75
3.2.8 Increased SIR recruitment to telomeres can rescue telomere silencing in Cohibin deficient cells .......................................................................................... 77
3.3 Discussion ......................................................................................................................... 79
Chapter 4 Function of Stm1/G4 DNA in rDNA maintenance ...................................................... 85
4 Function of Stm1/G4 DNA in rDNA maintenance .................................................................. 86
4.1 Introduction ....................................................................................................................... 86
4.2 Results ............................................................................................................................... 89
4.2.1 Stm1 is involved in the regulation of rDNA stability ........................................... 89
4.2.2 Stm1 is not required for rDNA silencing within IGS1 and IGS2 ......................... 91
4.2.3 Stm1 is not required for telomere stability or silencing ........................................ 94
4.2.4 Cohibin does not function in Stm1-mediated telomere capping ........................... 96
4.3 Discussion ......................................................................................................................... 98
Chapter 5 Future Directions ........................................................................................................ 104
5 Future Directions .................................................................................................................... 105
5.1 The role of Cohibin in telomere localization and silencing ............................................ 105
5.2 Function of Stm1/G4 DNA in rDNA maintenance ......................................................... 106
vii
References ................................................................................................................................... 109
viii
List of Tables
Chapter 1
Table 1.1. Key functions for coiled-coil domain-containing complexes in genome organization ............................................................................................................................. 18
Chapter 2
Table 2.1. List of strains used in this study ................................................................................... 45
Table 2.2. List of primers used for RT-PCR and ChIP ................................................................. 48
Chapter 3
Table 3.1. P values for χ2 test on S-phase telomere localization data .......................................... 72
Table 3.2. P values for χ2 test on G1-phase telomere localization data ....................................... 74
Table 3.3. P values for χ2 test on RIF1-rescue telomere localization data ................................... 77
Chapter 4
Table 4.1. Results of LC-MS/MS analysis of TAP purifications ................................................. 88
Table 4.2. Rates of ADE2 marker loss from the rDNA repeats .................................................... 90
ix
List of Figures
Chapter 1
1.1 General features of DNA packaging and genome organization ......................................... 3
1.2 Protein network that maintains telomere silencing and localization .................................. 8
1.3 Conservation of SUN-domain containing proteins ........................................................... 11
1.4 The rDNA repeats and rDNA silencing ............................................................................ 14
1.5 Structural features of the Cohibin complex ...................................................................... 16
1.6 The Cohibin-containing Monopolin complex mediates kinetochore attachment to microtubules in meiosis .................................................................................................... 21
1.7 The Cohibin complex maintains rDNA silencing and physically links the rDNA repeats to the nuclear periphery through interactions with CLIP ..................................... 23
1.8 Conservation of LEM-domain containing proteins. ......................................................... 23
1.9 Structure of G-quadruplexes ............................................................................................. 27
1.10 Distribution of G4 motifs across the S. cerevisiae genome .............................................. 30
1.11 Model for the function of Stm1 and G4 DNA in telomere capping ................................. 35
Chapter 3
3.1 Cohibin is required for silencing of a telomeric URA3 reporter ....................................... 52
3.2 5FOA sensitivity of Cohibin deficient cells is not due to RNR hyperactivity .................. 54
3.3 Telomeric silencing defects of Cohibin deficient cells is not specific to the URA3 reporter gene ..................................................................................................................... 56
3.4 Cohibin and CLIP is required for silencing of endogenous subtelomeric genes .............. 58
3.5 Cohibin links SIR-bound telomeres to Heh1 and requires Sir4 to physically interact with telomeres ................................................................................................................... 60
3.6 Cohibin-mediated telomere silencing is at least partly independent of Esc1 ................... 62
3.7 Cohibin cooperates with INM proteins Heh1 and Mps3 to silence telomeres ................. 64
3.8 Cohibin physically interacts with Mps3 and mediates the interaction between Mps3 and SIR-bound telomeres .................................................................................................. 65
x
3.9 The role of Cohibin at telomeres is not as broad as yKu .................................................. 65
3.10 Deletion of LRS4, but not HEH1, disrupts telomeric foci ................................................ 68
3.11 Cohibin is required for telomere anchoring during S phase of the cell cycle ................... 71
3.12 Cohibin plays a lesser role in telomere anchoring during G1 phase of the cell cycle ...... 74
3.13 Lrs4 is able to target an internal locus to the nuclear periphery and silence a TRP1 reporter inserted at HMR only in the absence of Heh1 .................................................... 76
3.14 Deletion of RIF1, which increases SIR recruitment to telomeres, rescues telomere silencing in lrs4∆ cells without fully rescuing telomere localization ............................... 78
3.15 Model for the role of Cohibin in telomere silencing, anchoring, and clustering .............. 80
Chapter 4
4.1 Stm1 is involved in the regulation of rDNA stability ....................................................... 90
4.2 Stm1 is not required for rDNA silencing .......................................................................... 93
4.3 Stm1 is not required for telomeric stability or silencing ................................................... 95
4.4 Cohibin is not required for Stm1/G-quadruplex-dependent telomere capping ................. 97
4.5 Putative model for the function of Stm1 in obstructing leading strand replication ........ 101
4.6 Model for the function of Stm1/G4 DNA in regulating rDNA stability by cooperating with co-transcriptionally formed RNA/DNA hybrids .................................................... 103
xi
List of Abbreviations
3AT; 3-amino-1,2,4-triazole
5FOA; 5-fluoro-orotic acid
Abf1; ARS-binding factor 1
ATP; adenosine triphosphate
BAH; bromo-associated homology
BLM; Bloom
bp; base pair
BSA; bolvine albumin serum
CAF-1; Chromatin Assembly Factor-1
Cdc13; cell division cycle
ChIP; chromatin immunoprecipitation
CLIP; Chromosome Linkage INM Protein
Csm1; chromosome segregation in meiosis 1
Csm4; chromosome segregation in meiosis 4
CST; Cdc13/Stn1/Ten1
DAPI; 4,6-diamidino-2-phenylindole dihydrochloride
DEPC; diethylpyrocarbonate
diAcH3K9/K14; histone 3 acetylated at lysine 9 and lysine 14
DMSO; dimethyl sulfoxide
Dot1; disruptor of telomeric silencing 1
DSB; double strand break
Dsn1; dosage suppressor of NNF1
DTT; dithiothreitol
EDTA; ethylenediaminetetraacetic acid
xii
Esc1; establishes silent chromatin 1
EtBr; ethidium bromide
EtOh; ethanol
Fob1; fork block 1
G4 DNA; G-quadruplex
G4BP; G4-binding protein
GFP; green fluorescent protein
H3K9/K14; histone 3 lysine 9 and lysine 14
H4K16; histone 4 lysine 16
Heh1; helix extension helix 1
HMR/HML; mating-type loci
HRP; horseradish peroxidase
HU; hydroxyurea
IGS; intergenic spacer
IP; immunoprecipitation
INM; inner nuclear membrane
KASH; Klarsicht, ANC-1, Syne Homology
LacI; lactose repressor
LacO; lactose operator
LC-MS/MS; liquid chromatography coupled to tandem mass spectrometry
LEM; Lap2β-Emerin-Man1
lexA-O; LexA-binding lexA operator
Lrs4; loss of rDNA silencing 4
Mif2; mitotic fidelity of chromosome transmission 2
MMLV; moloney murine leukemia virus
Mps3; monopolar spindle 3
xiii
NAD+; nicotinamide adenine dinucleotide
Ndj1; nondisjunction 1
Nur1; nuclear rim 1
ONM; outer nuclear membrane
PBS; phosphate buffered saline
Pif1; petite integration frequency 1
PMSF; phenylmethanesulfonylfluoride
Pol; polymerase
Pol30; polymerase 30
Rap1; repressor activator protein 1
rDNA; ribosomal DNA
RENT; Regulator of Nucleolar Silencing and Telophase exit
Rif1; Rap1-interacting factor 1
RNR; Ribonucleoside Reductase
RPM; rapid prophase movements
RT; room temperature
RT-PCR; reverse transcriptase PCR
SC; synthetic complete
SDS; sodium dodecyl sulfate
SDS-PAGE; sodium dodecyl sulfate polyacrylamide gel electrophoresis
Sgs1; slow growth suppressor 1
SIR; Silent Information Regulator
SMC; structural maintenance of chromosomes
SPB; spindle pole body
Spc24/25; spindle pole component 24/25
Stn1; suppressor of Cdc13 1
xiv
SUN; Sad1-UNC-84
TAP; tandem affinity purification
TBS; tris-buffered saline
Tlc1; telomerase component 1
Tof2; topoisomerase I-interacting factor 2
TPE; telomere position effect
USCE; unequal sister chromatid exchange
WRN; Werner
WT; wild-type
YEP; yeast extract peptone
YEPD; yeast extract peptone dextrose
1
Chapter 1 Introduction
Portions of this Chapter are modified from the following publications:
Chan, J. N., B. P. Poon, et al. (2011). "Perinuclear cohibin complexes maintain replicative life
span via roles at distinct silent chromatin domains." Dev Cell 20(6): 867-879
Poon, B. P. and K. Mekhail (2011). "Cohesin and related coiled-coil domain-containing
complexes physically and functionally connect the dots across the genome." Cell Cycle 10(16):
2669-2682
2
1 Introduction
1.1 Spatial organization of eukaryotic chromatin
Eukaryotic genomes reside within a relatively small nucleus. This is achieved through several
levels of DNA packaging (Figure 1.1 a) (Felsenfeld and Groudine 2003). The nucleosome is
formed by the wrapping of 147 bp of double helical DNA around core histone proteins, giving a
“beads on a string” appearance, and is the basic unit of chromatin (Kornberg 1974; Felsenfeld
and Groudine 2003). Chromatin is packaged into fibres that can be further assembled into higher
order structures, or chromosomes (Felsenfeld and Groudine 2003) (Figure 1.1 a). The
organization and dynamics of chromosomes within the nucleus are crucial to the maintenance
and inheritance of a stable genome (Schneider and Grosschedl 2007). During interphase, spatial
genome organization is critical as the positioning of chromosomal domains relative to nuclear
structures is not random, from yeast to human (Mekhail and Moazed 2010). One of these main
structures is the nuclear envelope, which is constituted of an outer nuclear membrane (ONM)
and an inner nuclear membrane (INM) that are present in all eukaryotes (Mekhail and Moazed
2010). Highly transcribed regions of the genome that are known as euchromatin tend to be more
centrally located within the nucleus while transcriptionally repressed regions, which are termed
silent chromatin or heterochromatin, are preferentially located at the INM (Mekhail and Moazed
2010). The organization of chromosomal domains relative to each other is also not random. For
example, recent work in human cells has revealed that chromosomal domains tend to have
preferred locations within the three dimensional genomic structure known as the fractal globule
(Lieberman-Aiden, van Berkum et al. 2009). Yet, this very compact structure is flexible enough
and allows for the easy folding and unfolding of any genetic locus (Lieberman-Aiden, van
Berkum et al. 2009). Thus, eukaryotic genomes are non-random three-dimensional structures in
which DNA loci occupy preferred locations relative to each other and to nuclear landmarks.
3
a
b
Figure 1.1. General features of DNA packaging and genome organization. (a) Eukaryotic genomes are packaged into a relatively small nucleus. The nucleosome, which is the basic unit of chromatin, is constituted of 147 bp of DNA wrapped around core histone proteins. Chromatin is packaged into higher order structures that ultimately form chromosomes. (b) Nuclear organization of silent chromatin domains in Saccharomyces cerevisiae. The rDNA repeats are located within the nucleolus while all 32 telomeres (TEL) are clustered into 4-8 foci at the nuclear periphery.
4
1.1.1 Genome organization, maintenance, and stability
The relative positioning of the eukaryotic genome to different nuclear landmarks is critical to
chromosome stability. In particular, new findings in yeast indicate that the association of highly
repetitive silent chromosomal domains with the nuclear envelope can suppress aberrant
recombination events within repetitive DNA regions (Mekhail and Moazed 2010). Also critical
to genome stability is the actual structure of DNA itself. Nucleic acids normally engage in
Watson-Crick base pairing, leading to the formation of the classic double helix. However, DNA
can assemble into other secondary structures. These non-canonical DNA structures can affect
cellular processes such as transcription, replication, and genome stability (Zhao, Bacolla et al.
2010). Therefore, the processes involved in the maintenance of the structure and spatial
organization of DNA within the nucleus are important for the stable inheritance of the eukaryotic
genome. The first part of the thesis will focus on emerging factors affecting genome structure
and function via organization of DNA loci relative to the nuclear envelope and to each other. The
second part of the thesis will investigate potential impacts/roles for non-canonical DNA
structures in the maintenance of genome organization and stability.
1.1.2 Yeast as a genetic model for spatial genome organization
The budding yeast Saccharomyces cerevisiae is an ideal organism for use in genetic studies. S.
cerevisiae is a unicellular eukaryote that has a relatively small genome (1.2 × 107 base pairs)
packaged into 16 chromosomes. It grows rapidly, with a short generation time of approximately
90 minutes and has a limited cellular lifespan. Also, the entire S. cerevisiae genome has been
sequenced and is easily accessible via online databases. Furthermore, the homologous
recombination machinery of S. cerevisiae is very active, allowing for versatile transformations
and making it easy to knock-in or knock-out specific genes. Not surprisingly, this organism was
central to several Nobel Prize winning discoveries, including the discovery of cell cycle
regulation (Hartwell, Hunt, and Nurse; 2001) and telomeres (Blackburn, Greider, and Szostak;
2009). Thus, the budding yeast offers a robust genetic model system for discovering and
studying many different cellular processes, including genome maintenance and organization.
5
1.2 Repetitive silent chromatin domains in S. cerevisiae
In general, silent chromatin domains in eukaryotes are characterized by very low levels of
histone acetylation, or histone hypoacetylation. There are two major repetitive silent chromatin
domains in S. cerevisiae, which are the telomeres and the ribosomal DNA (rDNA) repeats. Both
of these domains are tightly regulated to maintain proper silencing and stability, and they are
both physically linked to the nuclear envelope (Figure 1.1 b). In addition, telomeres and rDNA
employ similar mechanisms that rely on the histone deacetylase Sir2 (silent information regulator
2) to generate silent chromatin, repress gene transcription, and modulate DNA recombination.
1.2.1 The histone deacetylase Sir2 in silent chromatin formation
The yeast protein Sir2 is a NAD+-dependent histone deacetylase that is highly conserved from
yeast to human. Sir2 is the founding member of the sirtuin protein deacetylase family, which also
contains seven mammalian sirtuins (SIRT1 to SIRT7) (Landry, Sutton et al. 2000; Dai and Faller
2008; Haigis and Sinclair 2010). Sir2 removes acetyl groups from lysine residues on the tails of
histone H3 and H4 proteins (Imai, Armstrong et al. 2000; Moazed 2001). Specifically, in vitro
experiments showed that Sir2 acts on the residues lysine 16 of histone H4 (H4K16) and lysines 9
and 14 of histone H3 (H3K9/K14) (Imai, Armstrong et al. 2000; Moazed 2001). Deacetylation of
histone tails by Sir2 generates a more compact form of chromatin, which limits the accessibility
of nearby genes to RNA polymerase (Pol) II transcription, thus resulting in gene silencing. Sir2
does not interact with chromatin directly, but instead is recruited to silent chromatin domains
through other chromatin associated proteins. Furthermore, Sir2 forms complexes with other
proteins that facilitate its spreading along neighbouring histones in order to maintain large
regions of silent chromatin at telomeres and rDNA repeats. Although this is not the focus of my
thesis, it is important to note that Sir2 also ensures silent chromatin formation at the mating-type
loci HMR and HML.
6
1.3 Telomeres
Telomeres are highly repetitive genomic loci located at the ends of linear chromosomes.
Telomeres are required for the complete replication of linear chromosomes and play various
roles in chromosome end protection by preventing chromosome ends from being recognized as
DNA double-strand breaks, as well as functioning in silent chromatin regulation (Blackburn
1991). Proper maintenance of telomeres is crucial for genome stability, and disruption of the
processes regulating telomere function has been implicated in aging and cancer (Kim Sh,
Kaminker et al. 2002). The general structure and function of telomeres is highly conserved from
yeast to mammals. In fact, telomeres were originally discovered in the ciliate Tetrahymena and
in the budding yeast Saccharomyces cerevisiae (Blackburn and Gall 1978; Szostak and
Blackburn 1982). Thus, studies conducted in S. cerevisiae have given insight into understanding
how telomeres are maintained (Blasco 2007).
1.3.1 SIR complex in telomere maintenance
In S. cerevisiae, repressor activator protein 1 (Rap1) binds to the telomeric non-nucleosomal TG-
rich repeats and initiates the recruitment of the Silent Information Regulator (SIR) complex. SIR
is composed of Sir2 and the structural proteins Sir3 and Sir4 (Figure 1.2 a) (Longtine, Wilson et
al. 1989; Moretti, Freeman et al. 1994; Buck and Shore 1995; Luo, Vega-Palas et al. 2002). Rap1
physically interacts with Sir4, and this interaction is independent of the other SIR proteins, as
Sir4 is able to bind telomeric regions in the absence of Sir2 or Sir3 (Hoppe, Tanny et al. 2002).
Once recruited to telomeres, Sir2 actively removes acetyl groups from nearby histones H3 and
H4 proteins. Stable assembly of the SIR complex at telomeres is dependent on Sir3, which
directly binds to a histone surface within nucleosomes through its conserved N-terminal BAH
(bromo-associated homology) domain (Onishi, Liou et al. 2007; Armache, Garlick et al. 2011).
Sir3 has a higher binding affinity for deacetylated histones. Thus, histone deacetylation by Sir2
results in increased SIR complex binding to nearby histones, leading to the binding and
spreading of SIR away from telomeres and into the nucleosomal subtelomeric regions. Iterative
cycles of histone deacetylation by SIR compact nearby chromatin and render the DNA less
accessible to RNA Pol II, thus silencing RNA Pol II-transcribed subtelomeric genes
(Gottschling, Aparicio et al. 1990; Moazed 2001). This process generates a reversible and
7
heritable form of silencing known as the telomere position effect (TPE) or telomeric silencing
(Gottschling, Aparicio et al. 1990). The histone acetyltransferase Sas2 opposes the indefinite
spreading of SIR complexes to more internal locations along the chromosome resulting in a
gradient of telomeric silencing (Suka, Luo et al. 2002). Thus, TPE is strongest in the telomeric
region directly adjacent to telomeres and diminishes with increased distance from telomeres into
the subtelomeric region (Renauld, Aparicio et al. 1993). Disruption of any of the SIR proteins
abolishes telomeric silencing, resulting in the upregulation of subtelomeric genes (Aparicio,
Billington et al. 1991).
8
Figure 1.2. Protein network that maintains telomere silencing and localization. (a) The SIR complex, which contains the histone deacetylase Sir2, silences the Pol II transcribed subtelomeric genes in a process known as TPE or telomeric silencing. Telomeres are then anchored to the nuclear periphery through at least three known perinuclear proteins, yKu, Mps3, and Esc1. Dashed arrows represent possibly indirect interactions. (b) S. cerevisiae telomeres cluster into 4-8 foci at the nuclear periphery. It was not known how telomeres may be linked to each other or what may link telomeres to INM proteins such as Mps3.
a b
9
1.3.2 Perinuclear proteins in telomere maintenance
In S. cerevisiae, telomeres are anchored to the INM and clustered into 4 to 8 foci (Mekhail and
Moazed 2010). Anchoring of telomeres to the nuclear envelope is achieved via several pathways
that act through the SIR proteins (Figure 1.2 a). As such, disruption of any of the SIR proteins
abolishes perinuclear telomere recruitment (Palladino, Laroche et al. 1993). The first pathway
involves interactions between Sir4 and a large acidic protein called Esc1 (Figure 1.2 a)
(establishes silent chromatin 1) (Andrulis, Zappulla et al. 2002). The second pathway is through
the SUN (Sad1-UNC-84)-domain containing protein Mps3 (monopolar spindle 3) (Figure 1.2 a)
(Bupp, Martin et al. 2007). Mps3 is thought to anchor telomeres to the nuclear envelope in part
through interactions with telomerase (Schober, Ferreira et al. 2009). A third pathway involves
the dimeric yKu complex (yKu70, yKu80) (Figure 1.2 a) (Laroche, Martin et al. 1998). During
S phase of the cell cycle, telomere anchoring is thought to rely more on Sir4 interactions with
Mps3 and Esc1, while the yKu pathway is dominant during the G1 phase of the cell cycle
(Hediger, Neumann et al. 2002).
Disruption of the three known perinuclear telomere anchors disrupts telomeric anchoring and
silencing to varying degrees. Deletion of yKU70 or yKU80 results in a partial loss of anchoring
that is accompanied by a complete loss of TPE (Boulton and Jackson 1998; Laroche, Martin et
al. 1998). Strong loss of telomeric silencing in yku70∆ or yku80∆ cells is compounded by
additional involvement of the yKu complex in telomere length maintenance (Boulton and
Jackson 1998). Telomeres in yku∆ cells are shorter, which decreases SIR complex recruitment to
telomeres and contributes to a strong loss of telomeric silencing. On the other hand, disruption of
the other telomere anchors Esc1 or Mps3 results in a relatively mild phenotype that shows partial
loss of silencing and anchoring (Andrulis, Zappulla et al. 2002; Bupp, Martin et al. 2007).
Tethering and clustering of telomeres is speculated to maintain a high local concentration of SIR
complexes to ensure efficient telomere silencing and maintenance (Maillet, Boscheron et al.
1996). However, how telomeres may be attached to one another or what mediates the
interaction between telomere-bound SIR complexes and INM proteins is still unclear (Figure 1.2
b).
.
10
1.3.3 Conservation of Mps3 and SUN-domain containing proteins
The SUN-domain of Mps3 is conserved across eukaryotes (Figure 1.3 a). The SUN-domain
family consists of proteins that mostly localize to the nuclear periphery and are embedded within
the INM through one or more transmembrane domains (Tzur, Wilson et al. 2006). The topology
of these proteins places the SUN-domain within the luminal space in between the INM and
ONM (Tzur, Wilson et al. 2006; Sosa, Rothballer et al. 2012). The SUN domain interacts with
the KASH (Klarsicht, ANC-1, Syne Homology) domain of ONM positioned proteins and the
atomical structure of the SUN/KASH interaction at the nuclear membrane was recently shown
(Figure 1.3 b) (Sosa, Rothballer et al. 2012). The SUN-KASH interactions act as a bridge that
spans across the nuclear envelope and connects the nucleus to the cytoskeleton (Tzur, Wilson et
al. 2006). In fact, SUN-domain containing proteins were originally shown to regulate nuclear
positioning within the cell by cooperating with KASH-domain containing proteins (Starr and
Han 2002; McGee, Rillo et al. 2006). SUN proteins also control other cellular processes such as
germ-cell development and centrosome organization (Tzur, Wilson et al. 2006).
More recent studies have found that SUN-domain proteins are also critical to the spatial
organization of chromosomal domains relative to each other and to nuclear landmarks. In
particular, S. cerevisiae and S. pombe SUN-domain proteins were discovered to interact with
telomeres through chromosome-associated proteins and cluster telomeres in a bouquet formation
at the spindle pole body (SPB; the yeast microtubule-organizing centre) during meiosis
(Chikashige, Tsutsumi et al. 2006; Conrad, Lee et al. 2007). The positioning of the telomere
bouquet at the SPB requires SUN-KASH interactions, which further implicates this physical
bridge in nuclear organization (Niwa, Shimanuki et al. 2000). Similarly, the mammalian SUN-
domain protein Sun2 is also involved in tethering and clustering telomeres at the nuclear
periphery during meiosis (Schmitt, Benavente et al. 2007). Given that the S. cerevisiae protein
Mps3 is also involved in telomere positioning in mitotic cells, it is possible that SUN-domain
proteins may have similar functions in other eukaryotes (Bupp, Martin et al. 2007). Thus,
anchoring of telomeres to the nuclear periphery by SUN-domain proteins is a conserved
mechanism and may function in the organization of other silent chromatin domains.
11
Figure 1.3. Conservation of SUN-domain containing proteins. (a) INM proteins containing the conserved SUN domain. TM, transmembrane domain; SUN, Sad1-UNC-84 domain; S. c., Saccharomyces cerevisiae; S. p., Schizosaccharomyces pombe; C. e., Caenorhabditis elegans; H. s., Homo sapiens. (b) Model showing the interaction of the SUN-domain with the KASH-domain in between the inner and outer nuclear membranes. Figure adapted from (Sosa, Rothballer et al. 2012).
a
b
12
1.4 Ribosomal DNA (rDNA) repeats
The ribosomal DNA (rDNA) repeats reside in the nucleolus, which is the most prominent
nuclear compartment and is the site of the majority of ribosome manufacturing steps (Warner
1990). The rDNA repeats consist of ~190 rDNA units arranged in tandem on chromosome XII
(Figure 1.4 a) (Mekhail, Seebacher et al. 2008). Each rDNA unit harbours rRNA-coding DNA
sequences that are transcribed by RNA Pol I and Pol III. The sequestering of the rDNA repeats
within the nucleolus allows for rapid and coordinated changes in rRNA synthesis and ribosome
manufacturing. Within the rRNA-coding genes are intergenic spacers (IGS1 and IGS2) that
encode non-coding RNA (ncRNA) transcripts that are transcribed by RNA Pol II (Figure 1.4 a)
(Houseley, Kotovic et al. 2007). Binding of the Fob1 (fork block 1) protein to key sequences
within IGS1 can induce DNA double strand breaks (DSB) and trigger recombination within the
repeats (Kobayashi and Horiuchi 1996) (Figure 1.4 b). This allows for rDNA repeat expansion or
contraction under stress (Johzuka and Horiuchi 2002). However, if not properly regulated, hyper-
recombination within the repeats can lead to genome instability. Cells have therefore evolved
mechanisms, discussed below, to tightly control recombination with the rDNA repeats.
1.4.1 RENT and Tof2 in rDNA maintenance
Nucleolar factors, Tof2 (TOpoisomerase I-interacting Factor) and the complex RENT (Regulator
of Nucleolar Silencing and Telophase exit), are recruited by Fob1 to the IGS1 region (Figure 1.4
b) (Huang and Moazed 2003; Huang, Brito et al. 2006). RENT contains Cdc14, Net1/Cfi1, and
the histone deacetylase Sir2 (Huang and Moazed 2003). Tof2 and RENT can suppress
recombination within the highly repetitive rDNA locus (Huang and Moazed 2003; Huang, Brito
et al. 2006). This is seemingly linked, at least in part, to the ability of these nucleolar factors to
induce rDNA silencing, a process in which histone deacetylation by Sir2 generates a more
compact form of chromatin structure. This compact structure can limit access of RNA Pol II to
promoters located within IGS1, thus silencing the IGS1 RNA Pol II transcribed non-coding RNA
transcripts. Maintenance of a more compact structure within rDNA may also hinder interactions
with the general recombination machinery, thus decreasing recombination and ensuring more
13
stable rDNA repeats (Torres-Rosell, Sunjevaric et al. 2007). Disruption of RENT or Tof2 leads
to a loss of rDNA silencing at IGS1 and also decreases rDNA repeat stability, as revealed by an
increase in the rate of unequal sister chromatid exchange (USCE) within the repeats (Huang,
Brito et al. 2006). In addition, the RENT complex can be recruited to IGS2 and also functions to
maintain rDNA silencing within IGS2 in a Fob1 independent manner that does not seem to
impact rDNA repeat stability (Huang and Moazed 2003; Huang, Brito et al. 2006).
14
Figure 1.4. The rDNA repeats and rDNA silencing. (a) The rDNA repeats are located on chromosome XII with intergenic spacers (IGS1 and IGS2) located in between the rRNA genes. (b) Fob1 binds to specific sequences within IGS1, and can induce double strand breaks triggering recombination within the repeats. Fob1 recruits the RENT complex and Tof2 to IGS1. RENT contains the histone deacetylase Sir2 which acts to silence Pol II-transcribed non-coding RNA originating from IGS1. The rDNA repeats are then linked to the nuclear periphery through molecular networks that will be discussed later on.
a
b
15
1.4.2 The Cohibin complex in rDNA maintenance
1.4.2.1 Structure of the Cohibin complex
Cohibin is a “V”-shaped complex composed of Csm1 (chromosome segregation in meiosis 1) as
well as Lrs4 (loss of rDNA silencing 4) proteins (Huang, Brito et al. 2006; Mekhail, Seebacher et
al. 2008; Corbett, Yip et al. 2010). Csm1 contains a coiled-coil N-terminus domain and a
globular C-terminus domain, while Lrs4 contains an N-terminus coiled-coil domain (Figure 1.5
a) (Corbett, Yip et al. 2010). Both proteins can homodimerize through interactions between their
coiled-coil domains. Cohibin is composed of an Lrs4 homodimer and two Csm1 homodimers
interacting through their N-terminal regions (Figure 1.5 b) (Corbett, Yip et al. 2010). Csm1
proteins constitute the arms and tops of the “V” while Lrs4 proteins form the bottom of the “V”
(Figure 1.5 b, c) (Corbett, Yip et al. 2010). The S. pombe Pcs1 and Mde4, which are the
respective orthologues of Csm1 and Lrs4, also form a similar “V” shaped structure (Gregan,
Riedel et al. 2007; Corbett, Yip et al. 2010).
Csm1 is the most conserved of the Cohibin proteins. The Csm1 homodimer is a structural
analogue of the Spc24-Spc25 (spindle pole component) heterodimer, which constitutes the inner
half of the conserved Ndc80 kinetochore complex (Figure 1.5 d) (Wei, Sorger et al. 2005;
Joglekar, Bouck et al. 2006; Corbett, Yip et al. 2010). Despite the low sequence identity between
Csm1 and Spc24/Spc25, their similar tertiary and quaternary structures suggest that these
proteins may have a common evolutionary origin (Corbett, Yip et al. 2010). Spc24/Spc25
proteins contain a C-terminal globular domain, which is thought to be responsible for the
interaction between the Ndc80 complex and the proteins of the inner kinetochore (Wei, Sorger et
al. 2005; Joglekar, Bouck et al. 2006). Interestingly, the Csm1 globular domain contains a
conserved surface patch found across 41 fungal Csm1/Pcs1 orthologues (Corbett, Yip et al.
2010). Given that the Spc24/Spc25 globular domains interact with inner kinetochore proteins, it
is possible that the globular domain of Csm1 may have a similar function as a protein interaction
module (Corbett, Yip et al. 2010).
16
a
b
c
d
Figure 1.5. Structural features of the Cohibin complex. (a and b) Domain organization of Lrs4 and Csm1 proteins showing the N-terminal coiled-coil motifs (spirals) within Lrs4 and Csm1, as well as the globular domain (almond shape) at the C-terminal of Csm1. Only the N-terminal region of Lrs4 is shown because the rest of the protein was too disordered. Lrs4 and Csm1 interact through their coiled-coil domains and form the “V”-shaped Cohibin complex in mitotic cells. (c) Two electron micrographs of the Cohibin complex. Figure adapted from (Corbett, Yip et al. 2010). (d) The globular domain of Csm1 is a structural analog of Spc25, which binds Spc24 to form the inner half of the conserved Ndc80 kinetochore complex.
17
1.4.2.2 Comparison of Cohibin to other coiled-coil domain containing chromosomal complexes
Although poorly conserved, the coiled-coil domain central to the Cohibin subunits is found in
many other proteins including transcription factors and signaling molecules. The coiled-coil is a
motif constituted of α-helices that are coiled together like the strands of a rope. Interestingly,
coiled-coils have recently emerged as a unifying structural feature of several protein complexes
that maintain spatial genome organization (Poon and Mekhail 2011). In particular, structural
maintenance of chromosomes (SMC) proteins is a group of conserved coiled-coil-containing
proteins that make up the Cohesin and Condensin complexes. Importantly, Cohesin and
Condensin are structurally similar to Cohibin in that they all contain coiled-coil interactions at
one end of the complex with globular domains present at the other end (Poon and Mekhail 2011).
Cohesin and Condensin were both originally discovered to function in sister chromatid cohesion
and chromatin condensation, respectively (Hudson, Marshall et al. 2009; Nasmyth and Haering
2009). However, recent findings show that both complexes also have additional roles in
maintaining genome structure and function (see Table 1.1 for a summary). Specifically, Cohesin
and Condensin can be targeted to multiple genomic loci through regulatory elements, such as
insulators and transcription factors, to regulate cellular processes by influencing the relative
spatial positioning of chromosomal domains to each other and to nuclear landmarks (Table 1.1).
Given the structural similarities between Cohibin, Cohesin, and Condensin complexes, it is not
surprising that Cohibin can be targeted to multiple genetic loci to regulate different cellular
functions. Cohibin proteins were originally discovered to function as part of the larger
Monopolin complex which tethers sister kinetochores to each other during meiosis I to ensure
homologous chromosome segregation (Rabitsch, Petronczki et al. 2003). Cohibin was later
found to be critical to rDNA repeat maintenance in mitotic cells (Huang, Brito et al. 2006). It is
highly likely then, that Cohibin may have additional undiscovered functions at other
chromosomal domains as well.
18
Table 1.1. Key functions for Cohesin and Condensin complexes in genome organization and function. Complex Organism DNA Loci Function at DNA loci Refs Cohesin H. sapiens CCTF bound
loci IGF2-H19, IFNG, APO
CTCF/Cohesin-dependent DNA looping in transcriptional control
(Hadjur, Williams et al. 2009; Mishiro, Ishihara et al. 2009; Nativio, Wendt et al. 2009; Hou, Dale et al. 2010)
DNA replication origins
Stabilize loops at replication origins to maintain rosette structures ensuring efficient replication
(Guillou, Ibarra et al. 2010)
M. musculus Cell-type specific promoters and enhancers
Mediator/Cohesin-dependent DNA looping controls pluripotency genes in ES cells and a different set of genes in embryonic fibroblasts
(Kagey, Newman et al. 2010)
Telomeres Maintenance of telomere length and structure
(Adelfalk, Janschek et al. 2009)
S. cerevisiae Silent mating-type locus HMR
Delineate boundary of silent chromatin
(Valenzuela, Dhillon et al. 2008)
rDNA Inhibition of repeat number expansion
(Kobayashi and Ganley 2005)
S. pombe Telomeres Formation of heterochromatic domains within subtelomeres
(Dheur, Saupe et al. 2011)
Condensin S. cerevisiae rDNA rDNA clustering, segregation and condensation
(Freeman, Aragon-Alcaide et al. 2000; Johzuka and Horiuchi 2009)
tRNA genes Cluster tRNA genes at nucleolus
(Haeusler, Pratt-Hyatt et al. 2008)
19
1.4.2.3 Original discovery of Lrs4 and Csm1 complexes
The Cohibin subunits Lrs4 and Csm1 were originally discovered in meiotic cells (Rabitsch,
Petronczki et al. 2003). During prophase I, it was found that the Lrs4 and Csm1 proteins would
exit the nucleolus to associate with the meiosis I-specific protein Mam1 as well as its
ubiquitously expressed kinase Hrr25, thereby forming the Monopolin complex (Rabitsch,
Petronczki et al. 2003). Monopolin mediates attachment of sister chromatids to microtubules
extending from the same SPB during meiosis I, thus promoting sister chromatid co-orientation
(Figure 1.6 a) (Rabitsch, Petronczki et al. 2003; Corbett, Yip et al. 2010). Since the Cohibin
subunits form the core of Monopolin, it is expected that Monopolin also forms a “V”-shaped
complex (Figure 1.6 a) (Corbett, Yip et al. 2010). Given that the globular domain of Csm1
contains a conserved surface patch that is structurally similar to the conserved kinetochore
proteins Spc24 and Spc25, it is proposed that Csm1 mediates the interaction between Monopolin
and kinetochore proteins (Figure 1.6 b) (Corbett, Yip et al. 2010). Consistent with this notion,
Csm1 can physically interact with kinetochore proteins Dsn1 (dosage suppressor of NNF1) and
Mif2 (mitotic fidelity of chromosome transmission 2) (Corbett, Yip et al. 2010). Also, mutations
within the conserved surface patch within the globular domain of Csm1 disrupted these
interactions and compromised sister chromatid co-orientation (Wong, Nakajima et al. 2007;
Tanaka, Chang et al. 2009; Corbett, Yip et al. 2010). Furthermore, the globular domain of Csm1
interacts with Mam1, which may direct binding of Monopolin to kinetochores during meiosis.
Therefore, to ensure sister chromatid co-segregation, it is proposed that Csm1 binds kinetochore
proteins from two sister chromatids to clamp them together while Lrs4 mediates microtubule
attachment (Figure 1.6 b) (Corbett, Yip et al. 2010).
The S. pombe proteins Pcs1 and Mde4, the respective orthologues of Csm1 and Lrs4, also
modulate kinetochore-microtubule attachment, but the Cohibin orthologue functions during
meiosis II and mitosis instead of meiosis I (Figure 1.6 c) (Rabitsch, Petronczki et al. 2003;
Gregan, Riedel et al. 2007; Corbett, Yip et al. 2010). Unlike S. cerevisiae kinetochores that only
have one single microtubule attachment site, S. pombe kinetochores can capture multiple
microtubules. Therefore, there is a chance that a single S. pombe kinetochore captures
microtubules extending from opposite spindle poles in a process known as merotelic attachment.
Pcs1 and Mde4 are thought to clamp multiple binding sites on the same kinetochore to ensure
their attachment to the same spindle pole during meiosis II and mitosis (Figure 1.6 c) (Rabitsch,
20
Petronczki et al. 2003; Gregan, Riedel et al. 2007). Thus, even though Monopolin and its
Pcs1/Mde4 orthologue function during different phases of the cell cycle, the two complexes
perform similar functions in clamping together microtubule binding sites on kinetochores. The
“V”-shaped structure of Lrs4/Csm1 containing complexes offer a versatile mechanism to bring
different chromosomal domains close together and may be a universal mechanism used in the
spatial organization of the eukaryotic genome.
21
Figure 1.6. The Cohibin-containing Monopolin complex mediates kinetochore attachment to microtubules in meiosis. (a) Comparison between the Monopolin and Cohibin complexes. The Lrs4 and Csm1 proteins of Cohibin form the core of Monopolin. (b) Monopolin ensures sister chromatid co-orientation during meiosis I in S. cerevisiae. Monopolin interacts with kinetochores at centromeres through the Csm1 globular domains and clamps sister kinetochores ensuring their attachment to one microtubule extending from the same spindle pole. This results in sister chromatid co-segregation during the first round of meiotic division. MT, microtubule; MT-BS, microtubule binding site. (c) In S. pombe, Pcs1/Mde4 complexes prevent the merotelic attachment of kinetochores during meiosis II and mitosis. Pcs1/Mde4 complexes clamp microtubule binding sites on the same kinetochore to prevent its attachment to microtubules extending from opposite spindle poles. This ensures sister chromatid segregation during both mitosis and the second meiotic division. MT, microtubule; MT-BS, microtubule binding site.
a
b c
22
1.4.2.4 Function of Cohibin in rDNA maintenance
In mitotic cells, the Cohibin complex localizes to the nucleolus and participates in rDNA
maintenance (Huang, Brito et al. 2006; Mekhail, Seebacher et al. 2008). Specifically, Cohibin
physically interacts with RENT and Tof2 and is recruited by Tof2 to the IGS1 regions within
rDNA (Figure 1.7 a) (Huang, Brito et al. 2006; Mekhail, Seebacher et al. 2008). Disruption of
Cohibin by deleting either CSM1 or LRS4 also results in loss of IGS1 silencing and decreases
rDNA stability as evidenced by an increase in USCE within the repeats (Huang, Brito et al.
2006; Mekhail, Seebacher et al. 2008). Genetic interactions and chromatin immunoprecipitation
(ChIP) experiments suggest that RENT and Cohibin regulate rDNA through at least partly
independent processes (Mekhail, Seebacher et al. 2008). This has led to a model in which
Cohibin, through interactions of the globular domains of its Csm1 subunits with rDNA-bound
nucleolar factors, may align corresponding rDNA units on sister chromatids during replication to
prevent unequal DNA crossovers (Huang, Brito et al. 2006; Mekhail, Seebacher et al. 2008;
Corbett, Yip et al. 2010; Mekhail and Moazed 2010).
Aside from aligning sister chromatids, Cohibin may also form chromosome loops by physically
interacting with and clustering interspersed IGS1 regions within rDNA repeats (Mekhail,
Seebacher et al. 2008) (Figure 1.7 b). Thus, the role of Cohibin in rDNA silencing and the
suppression of recombination may be at least partly separable. Consistent with this, point
mutations in the conserved surface patch of the globular domain of Csm1 disrupted interactions
with Tof2 and affected rDNA silencing without increasing the rate of USCE (Corbett, Yip et al.
2010). This also confirms the notion that the globular domain of Csm1 is responsible for
interactions with chromatin associated proteins (Corbett, Yip et al. 2010). Thus, Cohibin-Tof2
interactions may be important for IGS1 clustering and not the alignment of sister chromatids
during replication. Instead, the function of Cohibin in regulating rDNA recombination may be
dependent on another mechanism, such as anchoring of the rDNA repeats to the nuclear
envelope (discussed below in section 1.4.2.5).
23
Figure 1.7. The Cohibin complex maintains rDNA silencing and physically links the rDNA repeats to the nuclear periphery through interactions with CLIP. (a) The Cohibin complex is recruited to the rDNA repeats by Tof2 and physically interacts with RENT and Tof2. Cohibin anchors the rDNA repeats to the nuclear envelope by interacting with the CLIP (Chromosome Linkage INM Protein) complex. Disruption of RENT, Tof2, or Cohibin results in loss of silencing and decreased rDNA stability, while disruption of CLIP decreases rDNA stability without affecting silencing. (b) Cohibin may form chromosome loops by physically interacting with and clustering interspersed IGS1 regions within rDNA repeats.
a b
Figure 1.8. Conservation of LEM-domain containing proteins. INM proteins containing the conserved LEM domain. MSC, Man1-Src1p-C-terminal domain; TM, transmembrane domain; S.c.; Saccharomyces cerevisiae; S.p., Schizosaccharomyces pombe; X.l., Xenopus laevis; H.S., Homo sapiens.
24
1.4.2.5 Cohibin and perinuclear proteins in rDNA maintenance
The Cohibin complex physically links the rDNA repeats to the nuclear periphery through
interactions with the nuclear envelope-embedded CLIP (Chromosome Linkage INM Protein)
complex (Figure 1.7 a) (Mekhail, Seebacher et al. 2008). CLIP is composed of the LEM (Lap2β-
Emerin-Man1) domain-containing protein Heh1 (helix extension helix 1; also Src1) as well as
the multi-transmembrane domain protein Nur1 (nuclear rim 1) (Mekhail, Seebacher et al. 2008).
Unlike the Cohibin complex or the nucleolar factors RENT and Tof2, disruption of CLIP by
deleting either HEH1 or NUR1 decreases rDNA repeat stability without affect rDNA silencing
(Figure 1.7 a) (Mekhail, Seebacher et al. 2008). It is proposed that disrupting CLIP releases the
rDNA repeats from the nuclear envelope. This allows the rDNA to exit the nucleolus and enter
the nucleoplasm, where there is a high concentration of functional recombination machinery that
can promote recombination events and result in decreased rDNA repeat stability (Torres-Rosell,
Sunjevaric et al. 2007; Mekhail, Seebacher et al. 2008; Mekhail and Moazed 2010). Thus,
anchoring rDNA repeats to the nuclear envelope is crucial to maintain rDNA repeat stability.
The interaction between Cohibin and CLIP may be providing the structural stability and support
needed to align sister chromatids during replication in order to prevent aberrant recombination
(Mekhail, Seebacher et al. 2008; Mekhail and Moazed 2010).
1.4.3 Conservation of Heh1 and LEM-domain containing proteins in genome organization and chromosome stability
The LEM-domain of Heh1 is highly conserved across eukaryotes, and consists of a family of
proteins that localize to the INM (Figure 1.8). All members of the LEM-domain family in higher
eukaryotes interact with lamins, which consist of A and B type lamin proteins that make up the
nuclear lamina. Aside from the ONM and INM, the nuclear lamina is also a major structural
element of the nuclear envelope present in animals but is absent in plants and fungi. The nuclear
lamina provides the structural support needed to maintain the spherical geometry of nuclei that
contain large genomes (Dechat, Adam et al. 2010). Recent studies have implicated lamins in the
maintenance of genome organization and chromosome stability in mammals. In human cells,
telomeres are mostly localized internally. However, it was discovered that subtelomeres
25
harbouring D4Z4 macrosatellite repeat sequences were recruited to the nuclear periphery by A-
type lamins (Ottaviani, Schluth-Bolard et al. 2009). In addition, there appears to be a lower
number of subtelomeric D4Z4 repeats in patients with facio-scapulo-humeral muscular dystrophy
(Ottaviani, Schluth-Bolard et al. 2009). Furthermore, approximately 20% of telomeres in mouse
embryonic fibroblasts localize to the nuclear envelope (Gonzalez-Suarez, Redwood et al. 2009).
Thus, the recruitment of some telomeres to the nuclear periphery in mammalian cells appears to
be important for cellular functions.
Although lamins are absent from yeast, the presence of LEM-domain containing proteins may
point to the conservation of function for these proteins in maintaining nuclear structure and
genome organization. In particular, the localization of Heh1 at the nuclear envelope is not
exclusive to the nucleolus and instead localizes evenly around the entire nuclear periphery. This
points to possible additional roles of Heh1 in the structural maintenance of perinuclear genetic
loci other than rDNA (Grund, Fischer et al. 2008). Indeed, Heh1 can be physically cross-linked
to chromosome ends, which cluster at the nuclear periphery, and the disruption of Heh1 resulted
in the upregulation of certain subtelomeric genes (Grund, Fischer et al. 2008). These data point
to a possible role for Heh1 in the maintenance of telomeres, similar to that of A-type lamins in
mammals. Because Heh1 cooperates with Cohibin to physically link rDNA repeats to the nuclear
periphery, it is conceivable that Heh1 may also cooperate with Cohibin to maintain perinuclear
anchoring of telomeres.
26
1.5 G-quadruplex (G4) DNA
1.5.1 Characterization of G4 DNA
DNA molecules are made up of four nucleic acids: adenine, guanine, cytosine, and thymine.
These four DNA bases participate in complementary base pairing—adenine with thymine and
guanine with cytosine—to form antiparallel strands. This is known as classical or Watson-Crick
base-pairing, and is achieved through the formation of hydrogen bonds between the bases. DNA
formed by classical pairing was shown to take the shape of a right-handed double helix, known
as B DNA (Watson and Crick 1953). Now, it is known that nucleic acids can also participate in
non-Watson-Crick base pairing, leading to the formation of non-canonical DNA structures.
Recent studies are showing that these structures are implicated in many cellular processes, such
as replication, transcription, and genome stability (Zhao, Bacolla et al. 2010).
One such non-canonical structure is the G-quadruplex (or G4 DNA), which was first discovered
in 1962 (Gellert, Lipsett et al. 1962). The G-quadruplex structure is formed by G-rich DNA
strands that contain at least four G-runs with each G-run containing at least two guanines
(Gellert, Lipsett et al. 1962; Maizels 2006). Each unit of G4 DNA is a tetrad of four Hoogsteen-
bonded guanines arranged in a square planar conformation that is often stabilized by a
monovalent cation at the centre (Gellert, Lipsett et al. 1962) (Figure 1.9 a). G4 planes stack on
top of each other to form a G4 structure containing a varying number of tetrads (Figure 1.9 b).
G4 DNA can be formed from intermolecular or intramolecular G-rich strands that can either be
parallel or anti-parallel (Maizels 2006). G-quadruplexes have been found to be very stable upon
formation in vitro, and it is expected that, should they form in vivo, they would exhibit the same
structural stability (Lane, Chaires et al. 2008).
27
a b
Figure 1.9. Structure of G-quarduplexes. (a) A planar G4 tetrad consisting of four Hoogsteen bonded guanines that are stabilized by a central monovalent cation. (b) Schematic of G-quadruplex structures formed by stacks of planar G4 tetrads. Intermolecular parallel and intramolecular anti-parallel structures are shown. [Figure adapted from (Maizels 2006)]
28
1.5.2 G4 DNA in vitro versus in vivo
Since the discovery of G-quadruplex structures in vitro, there was much debate about whether
these structures actually exist in vivo. A breakthrough in providing evidence for the in vivo
existence of G-quadruplex structures came from studies in the ciliate Stylonychia lemnae
(Schaffitzel, Berger et al. 2001). The authors generated monoclonal antibodies in vitro against
anti-parallel G4 structures. Indirect immunofluorescence staining of the S. lemnae macronucleus
revealed binding of the antibodies in a pattern consistent with the localization of the G-rich
telomeres, and this binding was later discovered to require the expression of telomere end-
binding proteins (Schaffitzel, Berger et al. 2001; Paeschke, Simonsson et al. 2005). These data
point to a role for telomere end-binding proteins in the formation of G-quadruplex structures and
shows that visualization of G4 structures in S. lemnae is due to the existence of G-quadruplexes
in vivo, and not stabilization of quadruplex structures by the antibody (Paeschke, Simonsson et
al. 2005). Furthermore, plasmid genomes transcribed in Escherichia coli were found to readily
form G4 DNA that could be visualized by electron microscopy, providing further support for the
in vivo existence of G-quadruplexes (Duquette, Handa et al. 2004). However, the question
remained whether G4 DNA can exist in vivo in yeast or mammals, since studies have not been
able to directly detect G-quadruplex structures in these organisms. However, more and more
studies have emerged that provide indirect support for G-quadruplexes forming in vivo in yeast
or mammals, and these are discussed later on.
1.5.3 Distribution of G4 DNA across the eukaryotic genome
Although direct in vivo evidence for G-quadruplexes in eukaryotes other than S. lemnae has
remained elusive, there is ample data looking at the possible existence of eukaryotic G-
quadruplexes in silico. Eukaryotic genomes can be searched for the presence of putative
quadruplex sequences based on algorithms that look for G4 motifs (Huppert and
Balasubramanian 2005; Hershman, Chen et al. 2008). Although many algorithms have been
formulated by different groups, a general G4 motif is any sequence that contains at least four G-
runs, each G-run containing at least three guanines, with loops of 1-7 bases in between the G-
29
runs. Any sequence that meets these criteria can theoretically fold into a G-quadruplex structure.
Notably, searches based on G4 motifs only look for sequences that could potentially form
intramolecular G4 structures and does not indicate the possible existence of intermolecular
structures. Although G4 motif algorithms are a useful tool for predicting the presence of G-
quadruplexes, whether or not these G-rich sequences actually form G-quadruplexes in vivo under
physiological conditions is not known. Still, database searches of yeast and mammalian genomes
using slightly different G4 motif algorithms have given relatively similar results and found the
localization of G4 motifs to be evolutionarily conserved (Figure 1.10 a) (Huppert and
Balasubramanian 2005; Capra, Paeschke et al. 2010). In particular, the TG-rich repeats at
chromosome ends are hotspots for potential G-quadruplex structures, especially given the single-
stranded nature of telomeres (Huppert and Balasubramanian 2005; Capra, Paeschke et al. 2010).
In addition, G4 motifs can be found within the G-rich rDNA repeats of human and S. cerevisiae
genomes (Figure 1.10 b) (Huppert and Balasubramanian 2005; Hershman, Chen et al. 2008).
30
Figure 1.10. Distribution of G4 motifs across the S. cerevisiae genome. (a) Distribution of G4 motifs maps G-quadruplexes to the subtelomeric regions and to the rDNA repeats located on chromosome XII. Each circle represents the location of a G4 motif. (Figure adapted from Capra, J.A., et al. 2010 [23]). Red circles represent G4 motifs that are conserved across the sensu stricto species. (b) Distribution of G4 motifs (upward lines) within one rDNA repeat. Arrows pointing left and right denote the promoters for the 5S rRNA and 35S transcript, respectively. The origin of replication and replication fork block region are indicated by an open circle and closed triangle, respectively. Figure adapted from (Hershman, Chen et al. 2008)
a
b
31
1.5.4 G-quadruplex helicases and chromosome instability
The conversion from double-stranded DNA to G4 DNA is not thermodynamically favoured and
is not expected to occur spontaneously (Lane, Chaires et al. 2008). Therefore, the formation of
G-quadruplexes within G-rich sequences is predicted to occur upon opening of the DNA double
helix, an event that occurs during transcription, replication, or DNA repair. Given that G-
quadruplexes are predicated to be relatively stable once they are formed, it is expected that their
presence would cause problems for the cell if they are not properly resolved. Conceivably,
quadruplex structures can create blocks that induce double-strand breaks, leading to an increase
in genome instability. Consistent with this notion and providing support for the in vivo existence
of G4 DNA, a number of DNA helicases have been characterized in yeast and mammals that
specifically unwind G-quadruplex structures, such as the conserved RecQ helicase family and
Pif1 (petite integration frequency 1) (Bochman, Sabouri et al. 2010; Sharma 2011).
1.5.4.1 RecQ helicase family
The proteins in the RecQ helicase family are 3’-5’ helicases and include the mammalian BLM
(Bloom) and WRN (Werner) proteins, as well as the S. cerevisiae orthologue Sgs1 (slow growth
suppressor 1) (Sharma 2011). All three helicases have been shown to unwind G4 DNA in vitro
(Sun, Karow et al. 1998; Fry and Loeb 1999; Sun, Bennett et al. 1999). BLM and Sgs1 both
localize to the nucleolus, which correlates with the location of G4 motifs found within rDNA and
suggests the existence of G4 structures in vivo at the G-rich rDNA repeats (Sinclair, Mills et al.
1997; Yankiwski, Marciniak et al. 2000). Disruption of BLM, WRN, or Sgs1 results in an
unstable genome in mammalian and yeast cells (Sun, Karow et al. 1998; Fry and Loeb 1999;
Sun, Bennett et al. 1999). Mutations in the BLM or WRN genes leads to the manifestation of
Bloom’s syndrome or Werner’s syndrome, respectively, which are two genetic diseases
characterized by hyper-recombination and genomic instability. Similarly, disruption of Sgs1
results in nucleolar fragmentation, as well as an increase in the presence of extrachromosomal
rDNA circles, signifying unstable rDNA repeats (Sinclair and Guarente 1997; Sinclair, Mills et
al. 1997). Furthermore, in the absence of telomerase, Sgs1 may function in the maintenance of
32
telomeres, another G-rich region that harbours G4 motifs (Cohen and Sinclair 2001; Huang,
Pryde et al. 2001; Johnson, Marciniak et al. 2001). This provides further support for the
existence of G-quadruplex structures in vivo, and also points to a potential role for G4 DNA in
telomere maintenance which will be further discussed in a later section. These data all point to
the possible contribution of G4 DNA in genome stability.
1.5.4.2 Pif1 helicase
Pif1 is a 3’-5’ DNA helicase that is conserved across many species, from yeast to human
(Bochman, Sabouri et al. 2010). It was recently discovered that human and S. cerevisiae Pif1 can
unwind G-quadruplex DNA in vitro (Ribeyre, Lopes et al. 2009; Sanders 2010). A recent study
found that disruption of Pif1 slows down progression of replication forks near sequences
harbouring G4 motifs in S. cerevisiae (Paeschke, Capra et al. 2011). These G-rich sequences
were also found to be more prone to DNA breakage in cells depleted of Pif1. In a similar study,
the absence of Pif1 resulted in increased G-quadruplex formation in cells treated with the G-
quadruplex ligand Phen-DC3, and these cells exhibited increased rearrangement frequencies and
aberrant recombination intermediates during leading-strand replication (Lopes, Piazza et al.
2011). These two studies suggest that the disruption of processes that unwind G-quadruplex
structures can be harmful for the cell, thus implicating the possible existence of G4 DNA in
genome stability. Aside from proteins that unwind G4 DNA, there are also proteins that
specifically bind G-quadruplex structures and it is likely that interplay between these G4 binding
and unwinding proteins play a role in the maintenance of G-rich chromosomal domains.
1.6 Stm1, a G-quadruplex binding protein
Stm1 (suppressor of tom1; also G4p2) was first identified biochemically as a G-quadruplex
binding protein (Frantz and Gilbert 1995; Utsugi, Toh-e et al. 1995). Stm1 was one of two major
proteins (the other protein was identified as G4p1) from whole cell yeast extract that bound to G-
quadruplexes (Frantz and Gilbert 1995). Treatment of Stm1 with proteases and nucleases
revealed that Stm1 did not contain a nucleic acid component (Frantz and Gilbert 1995). The
same experiment conducted using different yeast strains to detect G4 binding proteins identified
33
the same Stm1 protein, indicating that the ability of Stm1 to bind G-quadruplexes is not yeast
strain specific (Frantz and Gilbert 1995). It was later discovered that the G4 binding domain of
Stm1 is located at its N-terminus (Katayama, Inoue et al. 2007).
In competition experiments, Stm1 had the highest affinity for molecules with multiple G4
domains compared to similar molecules with only one domain. Stm1 also had a slightly higher
preference for anti-parallel compared to parallel G-quadruplexes, while it did not have any
binding affinity for double-stranded DNA or non-G4 single stranded DNA (Frantz and Gilbert
1995). Stm1 does not have any other activities, such as G4-cleaving or unwinding activity, based
on incubations of Stm1 with parallel G4 DNA along with various divalent cations and ATP
(adenosine triphosphate) (Frantz and Gilbert 1995). Thus, the function of Stm1 appears to stem
from its sole ability to bind G-quadruplex structures.
1.6.1 Localization of Stm1
Stm1 contains a putative nuclear localization sequence located at the N-terminus, and given that
Stm1 binds G-quadruplex DNA in vitro, it is likely that Stm1 localizes to the nucleus (Nakai and
Horton 1999). Indeed, immunofluorescence experiments confirmed that Stm1 resides in the
nucleus, although it is also present in the cytoplasm (Ligr, Velten et al. 2001). Intense staining of
Stm1 could be seen in the perinuclear region, while there was no Stm1 present in the nuclear
lumen. Importantly, the Stm1 signal remained in a ring-shaped arrangement at the nuclear
periphery even after material not directly associated with DNA was removed, suggesting that
Stm1 may strongly associate with DNA at the nuclear periphery (Ligr, Velten et al. 2001).
Similar experiments conducted by another group confirmed that Stm1 resides both in the nucleus
and the cytoplasm (Van Dyke, Nelson et al. 2004). In addition, there were no substantial changes
in the distribution of Stm1 across the cell cycle. It is important to note that recent studies have
highlighted a role for cytoplasmic Stm1 in protein translation and elongation, although this is not
the focus of my thesis and will not be discussed further (Van Dyke, Pickering et al. 2009;
Balagopal and Parker 2011).
Since immunofluorescence experiments revealed that Stm1 localizes to the periphery of the
nucleus, it is likely that Stm1 binds to DNA sequences that normally associate with the nuclear
34
periphery. ChIP experiments were conducted to elucidate where Stm1 binds across the genome
and the recovered DNA was then analyzed by probe hybridization (Van Dyke, Nelson et al.
2004). ChIP revealed that HA3-Stm1 was strongly enriched at the terminal telomeric tracts, at the
telomeric Y’ repeats, and also at the rDNA repeats, all three are highly repetitive silent genetic
loci that harbor G4 motifs and are located at the nuclear periphery (Van Dyke, Nelson et al.
2004). These ChIP data point to a possible role for Stm1 in the maintenance of silent chromatin
at telomeres and rDNA, possibly by binding the potential G-quadruplex structures that may form
at these silent chromatin domains.
1.6.2 Potential function of Stm1 at telomeres
Recently, Stm1 was shown to be involved in telomere capping in cells deficient in Cdc13 (Cell
Division Cycle 13), a protein that is part of the CST (Cdc13/Stn1/Ten1) complex, which forms a
telomere cap and protects telomere ends from exonuclease activity (Grandin, Damon et al. 2001;
Smith, Chen et al. 2011). Overexpression of Stm1 in cdc13-1 or stn1-154 (suppressor of Cdc13
1) mutants rescued growth of these mutants at non-permissive temperature (Smith, Chen et al.
2011). This led to a model where overexpression of Stm1 stabilizes telomeric G4 structures that
can then act as a protective telomere cap in the absence of the CST complex (Figure 1.11).
Consistent with the notion that Stm1 is acting through G-quadruplexes to protect chromosome
ends, deletion of the G4-unwinding helicase Sgs1, or expression of the single chain antibody
HF1, which binds G-quadruplexes, was also able to rescue the growth of cdc13-1 mutants at non
permissive temperature (Smith, Chen et al. 2011). To further elucidate the role of G-
quadruplexes in forming a telomere cap, the CCC portion of the TLC1 (telomerase component)
telomerase RNA template was mutated to lower its G-quadruplex forming potential. The
resultant telomeric tracts from the cells carrying the mutated telomerase RNA template were
unable to form G-quadruplexes (Smith, Chen et al. 2011). These results are the first to provide
evidence for the in vivo existence of telomeric G-quadruplexes and support a model where
stabilization of these G4 structures formed at telomeres is able to act as a telomere cap in the
absence of the CST complex. To date, this is the only known role for Stm1 at telomeres.
However, the physiological relevance of this study, and whether Stm1 has other roles at
telomeres, is still unclear.
35
Figure 1.11. Model for the function of Stm1 and G4 DNA in telomere capping. In the absence of the CST telomere capping complex, telomere ends are unprotected and are vulnerable to exonucleolytic digestion (top). Overexpression of G4-binding proteins (G4BP), such as Stm1, may be stabilizing G4 structures that form at uncapped telomeres to form a rudimentary telomere cap that protects telomeres from degradation, thus rescuing growth of CST-deficient cells. Figure adapted from (Smith, Chen et al. 2011).
36
1.7 Rationale and Hypothesis
Previously, the Cohibin subunit Lrs4 was purified by tandem affinity purification from wild-type
or fob1∆ cells to identify potential functions of Cohibin aside from rDNA maintenance (Chan,
Poon et al. 2011). Interestingly, unique peptides for Sir4 were pulled-down with Lrs4-TAP in
fob1∆ cells but not wild-type cells (Chan, Poon et al. 2011). Also, purification from both wild-
type cells and fob1∆ cells revealed unique peptides for Stm1 (Chan, Poon et al. 2011). Sir4 is
part of the SIR complex that maintains telomere silencing and anchoring to the nuclear
periphery. Given that the Cohibin-associated protein Heh1 can also be cross-linked to telomeres
and functions in subtelomeric silencing, it is possible that Cohibin may also function to
physically link telomeres to the nuclear envelope and silence telomeres. In addition, the Stm1
protein localizes to telomeres and rDNA repeats, and may exert functions through binding to G-
quadruplex structures that can form at these two G-rich regions. It is therefore conceivable that
Cohibin may also be cooperating with Stm1 and G4 DNA to mediate both rDNA and telomere
maintenance.
Hypothesis
Cohibin mediates telomere silencing and localization, and cooperates with Stm1/G4 DNA to
maintain rDNA and/or telomeres.
We started by first investigating the potential function of Cohibin in telomere silencing and
localization, and then initiated an investigation into the possible cooperation between Cohibin
and Stm1/G4 DNA in telomere and rDNA maintenance.
37
Chapter 2 Materials and Methods
Portions of this Chapter are modified from the following publication:
Chan, J. N., B. P. Poon, et al. (2011). "Perinuclear cohibin complexes maintain replicative life
span via roles at distinct silent chromatin domains." Dev Cell 20(6): 867-879
38
2 Materials and Methods
2.1 Strains and Materials
Yeast strains are listed in Table 2.1. Antibodies: anti-Actin (Abcam), anti-diAcH3-K9-K14
(Millipore), anti-Sir2 was a kind gift from D. Moazed and was previously generated (Moazed
and Johnson 1996), anti-Mps3/Nep98 (Nishikawa, Terazawa et al. 2003), HRP-conjugated anti-
rabbit IgG (GE), HRP-conjugated anti-mouse IgG (GE), Alexa488-labeled goat anti-rabbit
(Molecular Probes), Rhodamine-tagged goat anti-mouse (Jackson Laboratories). Plasmids
pKM133 (2 µm, LEU2) and pKM135 (CDC21/pRS425 = ORF + 124 bp 5’ + 21 bp 3’) were a
kind gift from B. Stillman (Rossmann, Luo et al. 2011). Plasmids pKM100 (pAT4-LexA) and
pKM103 (pAT4-LexAEsc1c) were a kind gift from S. Gasser (Taddei, Hediger et al. 2004).
pKM102 (pAT4-LexALrs4) was obtained by cloning full length Lrs4 into pKM100 at the C-
terminus of LexA using Sal-I and Pst-I restriction enzymes. The mps3∆75-150 mutant was
generated by cloning the mps3∆75-150 transcript into PRS314 at the C-terminus of TRP using
Pst-I and Sal-I restriction enzymes. Positive clones were confirmed by plasmid digestion and
standard DNA sequencing. Primers for RT-PCR and ChIP are listed in Table 2.2.
2.2 Yeast Transformation
Endogenous genes were deleted via PCR (Mekhail, Seebacher et al. 2008). Cells were grown to
log phase. 1 mL of cell culture was centrifuged, washed with sterilized water and then
resuspended in 100 µl LiOAc mix (100 mM LiOAc pH7.3, 10 mM Tris-Cl pH 8.0, 1mM
EDTA). 14 µl of precipitated transformation DNA generated via PCR, or expression vector
purified from E. coli QIAprep Spin Mini-prep kit (Qiagen), was added to each sample, followed
by the addition of 700 µl PEG (21 g PEG3350, 100 mM LiOAc pH7.3, 10 mM Tris-Cl pH 8.0,
1mM EDTA) and 30 µl salmon sperm single-stranded DNA (10 mg/mL; Invitrogen). The
transformation mixture was incubated in a 30°C water bath for 45 min. 100 µl of DMSO was
then added to the mixture and the cells were subjected to heat shock at 45°C for 15 min. Cells
were pelleted via centrifugation and resuspended in 200 µl SOS mix (1 M sorbitol, 1/3 v/v YEP
39
media, 6.5 mM CaCl2). Cells transformed with DNA using a drug selection marker was then
plated onto YEPD media and replica plated the next day onto the respective drug selection
plates. Cells transformed with DNA using a prototrophic marker was plated directly onto the
respective drop-out media.
2.3 Silencing Assay
Cells were grown to log phase (OD600 ≈ 1.0) and washed once with YEPD media. Telomere VII-
L and V-R URA3 reporter cells were spotted in ten or five fold serial dilutions onto SC or
SC+5FOA media (Bupp, Martin et al. 2007). To assess silencing of the URA3 reporter located
3.5 kb from telomere V-R, the rate of colony formation on SC+5FOA relative to SC media was
determined. For the treatment of cells with sublethal concentrations of hydroxyurea, cells were
spotted in ten-fold serial dilutions onto SC, SC+10mM HU, SC+30mM HU, SC+5-FOA, SC+5-
FOA+10mM HU, and SC+5-FOA+30mM HU media. Strains harboring the HIS3 reporter at
telomere VII-L were spotted on SC, SC-HIS, SC-HIS+5mM 3AT, SC-HIS+10mM 3AT, SC-
HIS+30mM 3AT, and SC+50mM 3AT media. For the LexA system, cells were spotted onto
SC-LEU or SC-LEU-TRP media (Taddei, Hediger et al. 2004). Following spotting of serial
dilutions, cells were incubated at 30°C for 2-3 days. Cells containing the ADE2 reporter gene at
telomere VR were spotted onto SC plates containing low adenine and incubated for 2 days at
30°C followed by 1 day at 4°C for full colour development (Buchberger, Onishi et al. 2008).
2.4 RNA extraction
Total RNA was prepared from logarithmically growing cells (OD600 ≈ 1.0) via hot phenol
extraction. Cells were centrifuged and resuspended in 400 µl of AE buffer (50 mM NaOAc pH
5.3 and 10 mM EDTA in 0.1% DEPC). 40 µl of 10% SDS and 440 µl of acidic phenol (pH 4.5)
was added to each sample and incubated at 65°C for 4 min. The samples were rapidly chilled in a
dry ice/EtOH bath until phenol crystals appeared. The samples were then centrifuged for 2 min at
max speed at 4°C, and the upper phase was transferred to fresh tubes. One volume of
phenol:chloroform (pH 4.5) was added to each sample, followed by centrifugation and
transferring of the upper phase to a fresh tube. 40 µl of 3 M NaOAc (pH 5.3) and 2.5 volumes of
40
cold 100% EtOH was added to each tube prior to centrifugation to precipitate the RNA. The
resultant RNA pellet was washed with 2.5 volumes of cold 80% EtOH. The pellet was left to dry
and then resuspended in 0.1% DEPC and quantified. Subsequently, 100 µg of the precipitated
RNA was cleaned-up using RNeasy Mini Kit (Qiagen) with on-column DNase digestion. 1 µg of
total RNA was treated with 1 unit DNase I (Invitrogen) to further remove genomic DNA
contaminations.
2.5 Liquid 5FOA and/or HU treatments
Treatment of cells were conducted as previously described (Rossmann, Luo et al. 2011). Cells
were cultured overnight in SC medium containing 20 mg/l uracil and then diluted 1:50 and
grown to log phase (OD600 ≈ 1.0). After which, 20 mL of culture was taken for RNA extraction,
while the remainder of the culture was split and treated with 100x 5FOA solution to a final
concentration of 1 g/l or the equivalent amount of DMSO. For HU rescue experiments, HU was
added to the corresponding cell cultures to a final concentration of 10 mM.
2.6 Semi-quantitative and quantitative RT-PCR
Semi quantitative reverse transcriptase PCR was performed as described with modifications (Xu,
Zhang et al. 2007). A 20 µl RT reaction was carried out using 10 mM dNTPs, 50 µM random
nonamers (Sigma), 500 ng total RNA, 5X First-Strand Buffer (Invitrogen), 100mM DTT, 40
U/µl RNaseOUT (Invitrogen), and 200 U/µl M-MLV reverse transcriptase (Invitrogen) at 23°C
for 10 min, 37C for 60 min, and 70C for 15 min. From this RT reaction, 1 µl was used in the
subsequent PCR amplification. Linearity tests were performed and primers are listed in Table S6.
Quantitative real-time PCR was performed using the Biorad CFX Connect Real-Time system. A
10 µl qPCR reaction using 2X Power SYBR Green PCR Master Mix (Applied Biosystems), 1
µM each forward and reverse primer, and 1 µl of cDNA prepared from the RT reaction.
2.7 Imaging
Cells were grown to log phase (OD600 ≈ 1.0) and resuspended in 1X PBS prior to mounting on
microscope slides. For three-dimensional imaging, Z stacks were collected using either a Zeiss
LSM 510 confocal microscope (Carl Zeiss) or a structured light illumination-coupled Olympus
41
microscope (Quorum). Images were deconvolved with Huygens (Scientific Volume Imaging)
then nuclear reconstruction and measurements were conducted in Imaris (Bitplane). For standard
imaging, data were collected with an Eclipse TI-E microscope (Nikon) coupled to a Retiga SRV
cooled monochrome camera (Qimaging). Positions of GFP-marked telomeres were determined
as described during the S and G1 phase of the cell cycle with ImageJ (National Institutes of
Health) and representative images were adjusted for background using levels and contrast in
Photoshop (Adobe) (Hediger, Neumann et al. 2002). Other software programs handling data
were Office (Microsoft), FreeHand (Macromedia) and ImageJ (National Institutes of Health).
2.8 Immunofluorescence
5 ml of log phase cells (OD600 ≈ 1.0) were cross-linked with 700 µl of 37% formaldehyde for 1
hr and then pelleted by centrifugation (3500 rpm, 2 min). Cells were washed twice with 5 ml of
sterile water and then resuspended in 0.5 ml SP buffer (1.2 M Sorbitol, 0.1 M potassium
phosphate pH 7.0). 100 µl of cells were centrifuged (4500 rpm, 2 min) and resuspended in 100 µl
of Digestion Mix (95.8 µl SP buffer, 0.2 µl β-Mercaptoethanol, 4 µl 1 mg/ml Lyticase). Cells
were spheroblasted for 1 hr in a 23°C water bath, then washed with 0.5 ml SP buffer and
resuspended in 100 µl SP buffer. 15 µl of cells were adhered to wells (pre-coated with 15 µl of 1
mg/ml PolyK) for 5 min, then washed three times with 30 µl PBS and dried for 10 min. Wells
were blocked with 30 µl freshly prepared blocking solution (895 µl PBS, 100 µl of 10% BSA, 5
µl 20% Triton) for 1 hr at RT in humid chamber. Wells were then washed three times with 30 µl
PBS. Cells were incubated with 30 µl primary antibody (anti-Sir3 or anti-Mps3/Nep98, 1:500 in
1% BSA in PBS) for 1 hr, 30 µl of secondary antibody (Alexa488-labeled goat anti-rabbit, 1:500
in 1% BSA in PBS) for 1 hr, and DAPI (1ng/ml in sterile water) for 5 min. Cells were washed
three times with 30 µl PBS in between incubations. Coverslip was mounted with 30 µl of
Vectashield mount and sealed with nail polish. Slides were stored at 4°C.
2.9 Western Blotting
Cells (OD600 ≈ 1.0) were washed with wash buffer (0.05 M Tris-HCl pH7.5, 0.15 M NaCl) and
then subjected to bead beating with an equal volume of silica beads and lysis buffer (50mM
42
HEPES-KOH pH7.5, 150mM NaCl, 10% glycerol, 0.5% NP-40, 1mM EDTA, complete tablet
protease inhibitor (Roche), and 1mM PMSF) for 2 × 30s with an intermittent 2min incubation on
ice. Lysates were clarified by two consecutive rounds of centrifugation at 16,000rcf for 5 and 15
min. Samples were sheared through a 26G½ needle and boiled at 95°C for 5min prior to SDS-
PAGE.
2.10 Genomic DNA preparation
Cells were grown to saturation, centrifuged and washed with 500 µl sterilized water. 200 µl of
Genomic Lysis Solution (2% Triton X-100, 1% SDS, 100 mM NaCl, 10 mM Tris-HCl pH 8.0, 1
mM EDTA), 200 µl of phenol:chloroform:isoamyl alcohol (25:24:1), and 300 µl of glass beads
were added to cells followed by bead-beating for 8 min at room-temperature. The samples were
centrifuged (top speed, 4°C, 5 min) and DNA was precipitated by adding 1/10 volume of 3 M
NaOAc pH 5.2 and 2 volumes of cold 100% EtOH and centrifuged. The resultant DNA pellet
was washed with 2 volumes of cold 70% EtOH and let dry overnight. The dried DNA pellet was
resuspended in 200 µl TE (10 mM Tris-Cl pH 8.0, 1mM EDTA) and treated with 3 µl RNAase
(10 mg/ml).
2.11 Southern Blotting
Genomic DNA was digested using XhoI digestion enzyme overnight at 37°C. 10 µg of digested
genomic DNA was resolved on a 1% agarose gel (125 V, 95 min). EtBr-stained gels were
imaged, destained, and submitted to standard Southern blotting. Blots were UV-crosslinked and
probed (65°C, 16 h) with [α-32P]dCTP-labeled IGS1. For the analysis of subtelomeric DNA
stability, labeled probes were prepared using previously described primers
(ACACACTCTCTCACATCTACC and TTGCGTTCCATGACGAGCGC; ((Craven and Petes
1999)).
43
2.12 ChIP
For standard ChIP assays, yeast cultures (50 ml) were grown to an OD600 of 1.8 and cross-
linked with 1% formaldehyde at room temperature (RT) for 15 min. The reaction was quenched
with glycine at a final concentration of 125 mM for 5 min at RT. Cells were washed with cold
TBS (20 mM Tris-HCl pH 7.6 and 150 mM NaCl). Cell pellets were resuspended in 400 µl of
lysis buffer (50 mM HEPES-KOH pH 7.5, 500 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1%
sodium deoxycholate, 0.1% SDS, 1 mM PMSF, 1 tablet of complete protease inhibitor (Roche).
Cells were bead-beated with an equal volume of glass beads 2 30 s with intermittent 2 min
incubation on ice. Lysates were sonicated 3 20 s at 40% amplitude with intermittent incubations
on ice. Lysates were clarified by 2 consecutive rounds of centrifugation at 16,000 rcf for 5 and
15 min. 150 µl of lysate was incubated at 4°C for 2 h with 2.0 µg of polyclonal anti-Sir2 or anti-
AcK9/AcK14 H3 and further incubated with 30 µl of 50% slurry of pre-washed Protein A-
Sepharose beads at 4°C for 1 h. Beads were washed 3X with lysis buffer, 1X with LiCl buffer
(10 mM Tris-HCl pH 8.0, 250 mM LiCl, 0.5% NP-40, 0.5% sodium deoxycholate, 1 mM
EDTA), and 1X with TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA), and eluted with 50 mM Tris-
HCl pH 8.0, 10 mM EDTA, and 1% SDS. The eluant was incubated at 65°C overnight. RNase
was added at a final concentration of 0.2 µg/µl and incubated at 37°C for 30 min, followed by
proteinase K (to 0.2 µg/µl) and glycogen (to 0.03 µg/µl) treatment for 2 h at 37°C. The IP and
input DNA was subsequently precipitated. Dilutions for IP and input DNA were 1:2 and 1:1000,
respectively. PCR parameters were 1 cycle of 95°C for 2 min, 55°C for 30 sec, and 72°C for 1
min, followed by 27 cycles of 95°C for 30 sec, 55°C for 30 sec, and 72°C for 1 min, and a final
step of 72°C for 4 min. Primers are listed in Table 2.2. The PCR products were ethidium
bromide (EtBr)-stained. Relative fold enrichment for the anti-diAcH3K9/K14 IP reactions is
defined as the ratio of the various deletion strains values relative to wild-type value according to
the following calculation: [IGS1IP / IGS1IP] / [IGS1Input / IGS1Input].
2.13 Immunoprecipitation
10 ml of overnight yeast cultures were diluted and cultured in 50 ml of YEP supplemented with
2% glucose, 1% adenine, and 1% tryptophan until OD600 ~1.6. Cells were washed with 50 mM
Tris-HCl pH 7.5 and 150 mM NaCl. Cells were bead-beated with 400 µl of lysis buffer (50 mM
44
HEPES-KOH pH 7.5, 150 mM NaCl, 10% glycerol, 0.5% NP-40, 1 mM EDTA, 1 mM PMSF,
and 1 tablet of complete protease inhibitor (Roche)) and glass beads 2 x 30 s with intermittent 2
min incubation on ice. Clarified extract was incubated with 30 µl of a 50% slurry of pre-washed
IgG Sepharose beads (GE) for 2 h at 4°C. Beads were washed with 1 ml of lysis buffer twelve
times for Figures 3.7 a, b. 95% of Lrs4-TAP, Csm1-TAP, or Sir4-TAP bound fractions for
Figures 3.7 a, b. Membranes were probed at 1:1000 dilutions of HRP-conjugated anti-TAP,
rabbit anti-Mps3/Nep98, or mouse anti-actin in TBS with 0.1% Tween-20 and 5% milk.
2.14 Unequal Sister Chromatid Exchange Assay
Assays were performed essentially as described (Huang, Brito et al. 2006; Mekhail, Seebacher et
al. 2008). Cells were grown to OD600 = 0.4–0.8, resuspended in sterilized water, sonicated briefly
(15% amplitude for 5 s), and spread (about 400 cells per plate) on thick low adenine plates (5
mg/l adenine). Incubation was at 30°C for 5 days, at 4°C for 2 days, then at RT for 3 days. Rates
were obtained by dividing the number of half-sectored colonies by the total number of colonies
excluding completely red colonies.
2.15 Telomere capping assay
Assays were performed essentially as described (Smith, Chen et al. 2011). Ten fold serial
dilutions of cells were spotted onto non-selective synthetic complete media lacking leucine (SC-
LEU) and grown at either permissive temperature (20°C) or semi-permissive temperature (30°C)
for 3-6 days.
45
Table 2.1. List of strains used in this study.
Strain Genotype Source
KMY368 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1
(Gottschling, Aparicio et al. 1990; Buchberger, Onishi et al. 2008)
KMY416 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 sir2∆::NATR
(Buchberger, Onishi et al. 2008)
KMY369 MATa (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 with sir3∆::KANR
(Buchberger, Onishi et al. 2008)
KMY74 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 lrs4∆::KANR
This work
KMY525 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 lrs4∆::HPHR
This work
KMY77 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 csm1∆::KANR
This work
KMY59 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 heh1∆::KANR
This work
KMY80 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 nur1∆::HPHR
This work
KMY404 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 esc1∆::HPHR
This work
KMY389 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 yku80∆::HPHR
This work
KMY148 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 lrs4∆::KANR csm1∆::NATR
This work
KMY107 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 heh1∆::KANR nur1∆::HPHR
This work
KMY492 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 lrs4∆::KANR esc1∆::HPHR
This work
KMY489 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 heh1∆::KANR esc1∆::HPHR
This work
KMY390 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 lrs4∆::KANR yku80∆::HPHR
This work
KMY399 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 heh1∆::KANR yku80∆::HPHR
This work
KMY531 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 sir2∆::NATR rif1∆::KANR
This work
KMY554 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 lrs4∆::HPHR rif1∆::KANR
This work
KMY534 W303a (ade2-1 can1-100 his3-11 leu2-3,112 trp1 ura3-1 GAL) TELVII-L::URA3 HMR∆E::TRP1 esc1∆::HPHR rif1∆::KANR
This work
KMY984 W303 MATalpha his3∆::natMX4 adh4∆::URA3-HIS3-VII-L (spore 20-3) (Rossmann, Luo et al. 2011)
KMY986 W303 MATalpha sir3∆::kanMX6 his3∆::natMX4 adh4∆::URA3-HIS3-VII-L (spore 4-1)
(Rossmann, Luo et al. 2011)
KMY985 W303 MATalpha dot1∆::hphMX4 his3∆::natMX4 adh4∆::URA3-HIS3-VII-L (spore 30-1)
(Rossmann, Luo et al. 2011)
KMY1303 W303 MATalpha his3∆::natMX4 adh4∆::URA3-HIS3-VII-L (spore 20-3)lrs4∆::KanR
This study
KMY1307 W303 MATalpha his3∆::natMX4 adh4∆::URA3-HIS3-VII-L (spore 20-3) csm1∆::KanR
This study
46
KMY380 (=SLJ2514) MATa mps3∆::MPS3-LEU2 hmrE∆::TRP1 rdn1::ADE2-CAN1 telV-R::URA3
(Bupp, Martin et al. 2007)
KMY382 (=SLJ2520) MATa mps3∆::MPS3-LEU2 sir2∆::KANMX hmrE∆::TRP1 rdn1::ADE2- CAN1 telV-R::URA3
(Bupp, Martin et al. 2007)
KMY381 (=SLJ2516) MATa hmrE∆::TRP1 rdn1::ADE2-CAN1 telV-R::URA3 mps3∆::mps3∆75-150-LEU2
(Bupp, Martin et al. 2007)
KMY406 MATa mps3∆::MPS3-LEU2 hmrE∆::TRP1 rdn1::ADE2-CAN1 telV-R::URA3 lrs4∆::HPHR
This work
KMY405 MATa mps3∆::MPS3-LEU2 hmrE∆::TRP1 rdn1::ADE2-CAN1 telV-R::URA3 heh1∆::HPHR
This work
KMY414 MATa hmrE∆::TRP1 rdn1::ADE2-CAN1 telV-R::URA3 mps3∆::mps3∆75-150-LEU2 lrs4∆::HPHR
This work
KMY407 MATa hmrE∆::TRP1 rdn1::ADE2-CAN1 telV-R::URA3 mps3∆::mps3∆75-150-LEU2 heh1∆::HPHR
This work
KMY385 (=SLJ2499) MATa mps3∆::NATMX leu2::MPS3-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telXIV-L::256xLacOR-TRP1
(Bupp, Martin et al. 2007)
KMY386 (=SLJ2501) MATa mps3∆::NATMX leu2::mps3∆75-150-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telXIV-L::256xLacOR-TRP1
(Bupp, Martin et al. 2007)
KMY462 MATa mps3∆::NATMX leu2::MPS3-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telXIV-L::256xLacOR-TRP1 heh1∆::HPHR
This work
KMY478 MATa mps3∆::NATMX leu2::MPS3-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telXIV-L::256xLacOR-TRP1 lrs4∆::HPHR
This work
KMY502 MATa mps3∆::NATMX leu2::MPS3-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telXIV-L::256xLacOR-TRP1 esc1∆::HPHR
This work
KMY559 MATa mps3∆::NATMX leu2::MPS3-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telXIV-L::256xLacOR-TRP1 rif1∆::KANR
This work
KMY868 MATa mps3∆::NATMX leu2::MPS3-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telXIV-L::256xLacOR-TRP1 yku80∆::KanR
This work
KMY425 MATa mps3∆::NATMX leu2::mps3∆75-150-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telXIV-L::256xLacOR-TRP1 lrs4∆::HPHR
This work
KMY426 MATa mps3∆::NATMX leu2::mps3∆75-150-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telXIV-L::256xLacOR-TRP1 heh1∆::HPHR
This work
KMY505 MATa mps3∆::NATMX leu2::MPS3-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telXIV-L::256xLacOR-TRP1 esc1∆::HPHR heh1∆::HPHR
This work
KMY522 MATa mps3∆::NATMX leu2::MPS3-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telXIV-L::256xLacOR-TRP1 esc1∆::HPHR lrs4∆::KANR
This work
KMY562 MATa mps3∆::NATMX leu2::MPS3-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telXIV-L::256xLacOR-TRP1 lrs4∆::HPHR rif1∆::KANR
This work
KMY944 MATa mps3∆::NATMX leu2::MPS3-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telXIV-L::256xLacOR-TRP1 lrs4∆::HphR yku80∆::KanR
This work
KMY383 (=SLJ2491) MATa mps3∆::NATMX leu2::MPS3-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telVIII-L::256xLacOR-TRP1
(Bupp, Martin et al. 2007)
KMY428 MATa mps3∆::NATMX leu2::MPS3-LEU2 NUP49::NUP49-GFP his3::GFP-LacI-HIS3 telVIII-L::256xLacOR-TRP1 lrs4∆::HPHR
This work
KMY751 W303 MATa ade2-1 can1-100 his3-11,-15::GFP-LacI-HIS3 trp1-1, ura3-1, leu2-3,-112 nup49::NUP49-GFP-URA3 Chr6int::lacop-lexAop-TRP1 fob1∆::KanR
This work
KMY774 W303 MATa ade2-1 can1-100 his3-11,-15::GFP-LacI-HIS3 trp1-1, ura3-1, leu2-3,-112 nup49::NUP49-GFP-URA3 Chr6int::lacop-lexAop-TRP1 fob1∆::KanR heh1∆::HphR
This work
KMY772 W303 MATa ade2-1 can1-100 his3-11,-15::GFP-LacI-HIS3 trp1-1, ura3-1, leu2-3,-112 nup49::NUP49-GFP-URA3 Chr6int::lacop-lexAop-TRP1 fob1∆::KanR csm1∆::HphR
This work
47
KMY776 W303 MATa ade2-1 can1-100 his3-11,-15::GFP-LacI-HIS3 trp1-1, ura3-1, leu2-3,-112 nup49::NUP49-GFP-URA3 Chr6int::lacop-lexAop-TRP1 fob1∆::KanR sir4∆::HphR
This work
KMY755 W303 MATα ura3 leu2 his3-11 his3-15 trp1-1 hmr Aeb 4lexAop hmr::TRP1 fob1∆::KanR
This work
KMY775 W303 MATα ura3 leu2 his3-11 his3-15 trp1-1 hmr Aeb 4lexAop hmr::TRP1 fob1∆::KanR heh1∆::HphR
This work
KMY773 W303 MATα ura3 leu2 his3-11 his3-15 trp1-1 hmr Aeb 4lexAop hmr::TRP1 fob1∆::KanR csm1∆::HphR
This work
KMY777 W303 MATα ura3 leu2 his3-11 his3-15 trp1-1 hmr Aeb 4lexAop hmr::TRP1 fob1∆::KanR sir4∆::HphR
This work
KMY326 W303a RAD5+ RDN1::ADE2 L. Guarente KMY327 W303a RAD5+ RDN1::ADE2 sir2∆::TRP1 L. Guarente KMY337 W303a RAD5+ RDN1::ADE2 lrs4∆::KanR (Huang, Brito et al.
2006) KMY328 W303a RAD5+ RDN1::ADE2 fob1∆::URA3 (Huang, Brito et al.
2006) KMY1039 W303a RAD5+ RDN1::ADE2 stm1∆::KanR This work KMY307 W303a RDN1-IGS1::mURA3 (Huang and Moazed
2003) KMY310 W303a RDN1-IGS1::mURA3 sir2∆::KanR (Tanny, Kirkpatrick et
al. 2004) KMY339 W303a RDN1-IGS1::mURA3 lrs4∆::KanR (Tanny, Kirkpatrick et
al. 2004) KMY688 W303a RDN1-IGS1::mURA3 heh1∆::KanR (Mekhail, Seebacher
et al. 2008) KMY992 W303a RDN1-IGS1::mURA3 stm1∆::KanR This work KMY306 W303a RDN1-IGS2::mURA3 (Huang and Moazed
2003) KMY309 W303a RDN1-IGS2::mURA3 sir2∆::KanR (Tanny, Kirkpatrick et
al. 2004) KMY340 W303a RDN1-IGS2::mURA3 lrs4∆::KanR (Tanny, Kirkpatrick et
al. 2004) KMY1421 W303a RDN1-IGS2::mURA3 stm1∆::KanR This work KMY1448 Matα ade2-101 his3∆200 leu2-3, 2-112 lys2 ura3-52 cdc13-1 YEplac181 (Smith, Chen et al.
2011) KMY1449 Matα ade2-101 his3∆200 leu2-3, 2-112 lys2 ura3-52 cdc13-1 YEplac181 (Smith, Chen et al.
2011) KMY1451 Matα ade2-101 his3∆200 leu2-3, 2-112 lys2 ura3-52 cdc13-1 YEplac181-
STM1 (Smith, Chen et al. 2011)
KMY1452 Matα ade2-101 his3∆200 leu2-3, 2-112 lys2 ura3-52 cdc13-1 YEplac181-STM1
(Smith, Chen et al. 2011)
KMY1457 Matα ade2-101 his3∆200 leu2-3, 2-112 lys2 ura3-52 cdc13-1 lrs4∆::KanR YEplac181
This work
KMY1458 Matα ade2-101 his3∆200 leu2-3, 2-112 lys2 ura3-52 cdc13-1 lrs4∆::KanR YEplac181
This work
KMY1460 Matα ade2-101 his3∆200 leu2-3, 2-112 lys2 ura3-52 cdc13-1 lrs4∆::KanR YEplac181-STM1
This work
KMY1461 Matα ade2-101 his3∆200 leu2-3, 2-112 lys2 ura3-52 cdc13-1 lrs4∆::KanR YEplac181-STM1
This work
48
Table 2.2. List of primer pairs used for RT-PCR and ChIP.
Location (Application)
Size (bp) Sequence 1 Sequence 2
YFR057W (RT-PCR)
197 CTAGTGTCTATAGTAAGTGCTCGG GGTATATTGCCACGCAAAGAAAGG
YHR219W (RT-PCR)
215 GAAGCACTAGCTGTGGAGAG CCTCTTGTCGAATCCAATAC
YIR042C (RT-PCR)
201 CCTGCGGGACCATTCACTAA CGTCTTCTGTAATTCTGGTG
YGR295C (RT-PCR)
225 GGAGCCCTGTTGGCCTGGAA CGATCATCCTCATATTCCGG
SCR1 (RT-PCR)
239 GCTGGTAAAGACTGAAACTGGGCC GAAACTTGTAAGGGACTTTCGTCG
IGS1 (RT-PCR and ChIP)
243 AGGGCTTTCACAAAGCTTCC TCCCCACTGTTCACTGTTCA
IGS2 (RT-PCR)
253 AGAGGAAAAGGTGCGGAAAT TTTCTGCCTTTTTCGGTGAC
ACT1 (RT-PCR)
153 GCCTTCTACGTTTCCATCCA GGCCAAATCGATTCTCAAAA
CUP1 (ChIP)
163 TGAAGGTCATGAGTGCCAAT TTCGTTTCATTTCCCAGAGCA
RNR4 (qRT-PCR)
94 GCTACCGCTGGTAAGACCAC CCTCTTGTCGAATCCAATAC
URA3 (qRT-PCR)
93 TAAAGGCATTATCCGCCAAG CCCGCAGAGTACTGCAATTT
49
Chapter 3 Cohibin mediates telomere silencing and localization
Statement of Contribution:
I performed all of the experimental work described in this Chapter except for Figures 3.5, 3.8,
and 3.14 a, which were performed by Janet Chan.
Portions of the text and figures presented in this Chapter are modified from the following
publication:
Chan, J. N., B. P. Poon, et al. (2011). "Perinuclear cohibin complexes maintain replicative life
span via roles at distinct silent chromatin domains." Dev Cell 20(6): 867-879
50
3 Cohibin mediates telomere silencing and localization
3.1 Introduction
The telomeres of S. cerevisiae are silenced by the SIR complex and anchored to the nuclear
periphery through the perinuclear proteins Esc1 and Mps3, as well as the yKu complex
(Aparicio, Billington et al. 1991; Laroche, Martin et al. 1998; Andrulis, Zappulla et al. 2002;
Bupp, Martin et al. 2007). S. cerevisiae telomeres are clustered into four to eight foci at the
nuclear envelope, and it is thought that clustering increases the local concentration of SIR
complexes in order to maintain proper telomere silencing (Maillet, Boscheron et al. 1996).
However, it is unclear how telomeres may be linked to each other or what may link telomeres to
INM proteins such as Mps3.
Since Sir4 co-purifies with Lrs4, it is possible that Cohibin may play a role in telomere function
and maintenance (Chan, Poon et al. 2011). In addition, the Cohibin-associated protein Heh1 has
been previously shown to affect subtelomeric silencing whereby deleting HEH1 resulted in
upregulation of certain subtelomeric genes (Grund, Fischer et al. 2008). Thus, we set out to
determine whether the Cohibin complex functions to maintain telomere silencing and anchoring.
We first characterized the potential role of Cohibin in telomere silencing. Then we sought to
investigate whether the Cohibin complex maintains TPE by modulating telomere localization.
Finally, we aimed to rescue the loss of telomere silencing in Cohibin-deficient cells.
51
3.2 Results
3.2.1 Cohibin is required for the silencing of foreign telomere-proximal reporter genes
We first wanted to know whether Cohibin plays a role in telomere silencing, so we tested the
ability of Cohibin deficient cells to silence Pol II-transcribed prototrophic reporter genes
positioned at telomeric chromosomal regions. We used a strain harbouring a URA3 reporter
proximal to the left arm telomere of chromosome VII (URA3-TELVII-L), as well as another
strain harbouring the URA3 reporter proximal to the right arm telomere of chromosome V
(URA3-TELV-R) (Figure 3.1 a). Loss of silencing was assayed by comparing the growth of cells
on non-selective synthetic complete (SC) media with growth on media supplemented with 5-
fluoro-orotic acid (SC+5FOA). Less growth on 5FOA-containing media indicates loss of
telomeric silencing since 5FOA is toxic to cells expressing URA3. Deletion of SIR2 or SIR3
abrogated silencing at telomeres, as expected (Figure 3.1 b). Importantly, there is less growth of
lrs4∆ or csm1∆ cells on SC+5FOA for both reporter strains, indicating that Cohibin is involved
in silencing of the telomeric URA3 reporter and that the TPE defect of Cohibin deficient cells is
not specific to a single telomere (Fig. 3.1 b). On the other hand, deletion of HEH1 or NUR1 did
not result in loss of silencing of URA3 in either reporter strain (Fig. 3.1 b). Disruption of Cohibin
or CLIP did not alter Sir2 protein levels (Figure 3.1 c), indicating that loss of telomeric silencing
is not due to a change in the expression of SIR2.
52
a
Figure 3.1. Cohibin is required for silencing of a telomeric URA3 reporter. (a) Schematic of the URA3 reporter gene inserted proximal to TEL VII-L or V-R. (b) Disruption of Cohibin proteins results in loss of silencing of a URA3 reporter placed next to TEL VII-L or V-R, while disruption of CLIP has no effect. Ten-fold serial dilutions of cells were plated on synthetic complete (SC) media or media supplemented with 5-fluoro-ortic acids (SC+5FOA). Loss of silencing is indicated by less growth on SC+5FOA. WT, wild-type. (c) Western blot indicating that the disruption of Cohibin or CLIP subunits does not alter Sir2 protein levels.
b c
53
Recently, a study showed that sensitivity to 5FOA in URA3-TEL-VII-L cells may not be due to
loss of telomeric silencing, but can instead reflect changes to nucleotide metabolism in certain
mutants (Rossmann, Luo et al. 2011). In particular, Pol30 (polymerase 30) or Dot1 (disruptor of
telomeric silencing 1) mutants were originally thought to be involved in TPE maintenance based
on the telomeric URA3 assay, but it was later discovered that decreased growth of these mutants
on 5FOA-containing media was not due to increases in URA3 expression (Rossmann, Luo et al.
2011). Instead, these mutants exhibited increases in the levels of Ribonucleoside Reductase
(RNR), a complex that generates deoxyribonucleoside triphosphates needed for DNA synthesis.
Pharmacological inhibition of RNR function by adding sublethal concentrations of hydroxyurea
(HU) was able to restore 5FOA resistance to pol30-8 cells (Rossmann, Luo et al. 2011). In
addition, Pol30 physically interacts with the histone chaperone complex Chromatin Assembly
Factor-1 (CAF-1; consisting of Cac1, Cac2, and Cac3) (Moggs, Grandi et al. 2000). Sublethal
concentrations of HU were also able to restore the 5FOA resistance of cells depleted of Cac1 in
the telomeric URA3 reporter assay (Rossmann, Luo et al. 2011). Thus, we tested whether the
5FOA sensitivity of Cohibin deficient cells harboring a telomeric URA3 reporter is affected by
nucleotide metabolism. Inhibition of RNR function by adding sublethal concentrations of HU
restored 5FOA resistance to cac1∆ cells, but not sir2∆, lrs4∆, or csm1∆ cells, indicating that
5FOA sensitivity of telomeric URA3-habouring cells that lack Cohibin proteins is not due to
RNR hyperactivity (Figure 3.2 a). Indeed, we found that 5FOA treatment increases RNR4
transcript levels in dot1∆ and cac1∆ cells, as expected (Rossmann, Luo et al. 2011), but not wild-
type, lrs4∆, or heh1∆ cells (Figure 3.2 b). Moreover, quantitative reverse-transcriptase PCR
(qRT-PCR) analysis revealed that the expression of URA3 at TELVII-L was indeed increased in
lrs4∆ and sir3∆ cells (Figure 3.2 c). Thus, these results indicate that the 5FOA sensitivity of
cells deficient in Cohibin-dependent telomere tethering does indeed reflect changes to TPE.
54
a
Figure 3.2. 5FOA sensitivity of Cohibin deficient cells is not due to RNR hyperactivity. (a) Pharmacological inhibition of RNR function restores FOA-resistance in cac1∆ cells but not Sir2 or Cohibin-deficient cells harboring a telomeric URA3 reporter gene. Serial dilutions of cells were plated on SC media or media supplemented with sublethal concentrations of the RNR inhibiting hydroxyurea (SC+10mM HU, SC+30mM HU) and/or 5-FOA (SC+5-FOA+10mM HU, SC+5FOA+30mM HU). WT, wild-type. (b) RNR4 transcript levels (normalized to ACT1) as measured by quantitative reverse transcriptase PCR (qRT-PCR) following a 4-hour treatment with 5FOA or DMSO. Error bars represent the SEM for three independent experiments. WT, wild-type. (c) URA3-TELVII-L transcript levels (normalized to ACT1) as measured by qRT-PCR. Error bars represent the SEM for three independent runs.
b
c
55
To ensure that the telomeric silencing defects seen in Cohibin deficient cells is not specific to the
URA3 reporter gene, we monitored TPE via the use of the HIS3 reporter gene, which is a
prototrophic marker that is seemingly free from the effects of nucleotide metabolism (Figure 3.3
a) (Rossmann, Luo et al. 2011). Loss of HIS3 silencing can be positively selected for on media
containing 3-amino-1,2,4-triazole (3AT), which is a competitive inhibitor of the HIS3 gene
product (Brennan and Struhl 1980). Wild-type and mutant cells were grown on either SC media,
media lacking histidine (SC-HIS), and media lacking histidine but supplemented with increasing
amounts of 3AT (SC-HIS+3AT). Importantly, sir3∆, lrs4∆, and csm1∆ cells grew much more
than wild-type cells on 3AT-containing media (Figure 3.3 a). In addition, the difference in
growth phenotypes of sir3∆, lrs4∆, and csm1∆ relative to wild-type cells steadily increased in a
3AT dose-dependent fashion (Figure 3.3 a). We also monitored TPE via the use of the ADE2
reporter gene, where loss of silencing of ADE2 is demonstrated by change in colony colour from
red to white (Figure 3.3 b). Consistent with our URA3 and HIS3 silencing data, disruption of
SIR or Cohibin, but not CLIP, compromised silencing of the ADE2 reporter (Figure 3.3 b).
Thus, these findings indicate that Cohibin proteins are required for the silencing of the HIS3-VII-
L and ADE2-V-R reporter genes and suggest that results obtained via the use of URA3 or other
exogenous reporter genes does indeed reflect changes to TPE and not changes to nucleotide
metabolism.
56
Figure 3.3. Telomeric silencing defects of Cohibin deficient cells is not specific to the URA3 reporter gene. (a) Cohibin is required for silencing of the telomeric HIS3 reporter gene. Serial dilutions of cells were plated on SC media or SC media without histidine (-HIS) and with increasing concentrations of 3-amino-1,2,4-triazole (+3AT). Loss of silencing is indicated by more growth on +3AT media. Schematic of the HIS3 reporter gene inserted proximal to TEL VII-L is shown above. WT, wild-type. (b) Cohibin is required for silencing of the telomeric ADE2 reporter gene. Cells turn from red to white upon loss of silencing. Schematic of the ADE2 reporter gene inserted proximal to TEL V-R is shown above. WT, wild-type.
a
b
57
3.2.2 Cohibin and CLIP are involved in silencing of exogenous and endogenous telomere-distal genes
TPE is strongest in the telomeric region directly adjacent telomeres and diminishes with
increased distance from telomeres into the subtelomeric region (Renauld, Aparicio et al. 1993).
Since Cohibin is involved in silencing of telomeric reporters placed proximal to the TG repeats,
we next tested whether Cohibin or CLIP is involved in silencing of genes in the subtelomeric
region further away from telomeres. First, we monitored the expression of a URA3 reporter gene
inserted 3.5 kb away from TELV-R. Loss of silencing of URA3 was assessed by counting the rate
of colony formation on 5FOA-containing media relative to SC media. Consistent with silencing data,
SIR- or Cohibin-deficient cells had less colonies on 5FOA-containing media, indicating a loss of
URA3 silencing (Fig. 3.4 a). Although deletion of HEH1 or NUR1 had no effect on telomere-
proximal reporter genes, there were less heh1∆ or nur1∆ colonies on media containing 5FOA
compared to wild-type, indicating that CLIP is required for telomere-distal silencing (Figure 3.4
a). We then examined expression of endogenous subtelomeric genes in cells lacking Cohibin or
CLIP proteins. We conducted semi-quantitative RT-PCR measuring expression of subtelomeric
genes located at various distances from different telomeres. Deletion of SIR2 or LRS4 resulted in
increased expression of all four subtelomeric genes, consistent with the notion that Cohibin is
required for TPE (Fig. 3.4 b). Similarly, heh1∆ or nur1∆ cells showed a slight increased
expression of the subtelomeric genes, consistent with the notion that CLIP is involved in
silencing genes that are further away from telomeres (Fig. 3.4 b). This is also consistent with
previous studies implicating Heh1 in subtelomeric gene expression (Grund, Fischer et al. 2008).
These results indicate that the observed changes to the expression of foreign reporter genes
recapitulate endogenous gene expression patterns within subtelomeres of Cohibin and CLIP
mutants. Thus Cohibin plays a key role in telomeric silencing and the role of CLIP at telomeres
is either relatively small or shared with other telomere-associated factors.
58
Figure 3.4. Cohibin and CLIP is required for silencing of endogenous subtelomeric genes. (a) Disruption of Cohibin or CLIP abrogates telomere-distal TPE as revealed by the loss of silencing of a URA3 reporter gene inserted 3.5 kb from TELV-R. Graph shows mean ± SD relative to the rate of silencing observed in sir3∆ cells. (b) Disrupting Cohibin or CLIP results in upregulation of subtelomeric genes as revealed by semi-quantitative RT-PCR. Distances to indicated telomeres are in brackets and the internal gene SCR1 served as control.
a b
59
3.2.3 Cohibin physically interacts with SIR at telomeres, and links SIR-bound telomeres to Heh1
Since Cohibin is required for telomeric silencing, we next wanted to investigate how Cohibin
physically interacts with telomeres. In the nucleolus, Cohibin physically links the rDNA repeats
to the nuclear envelope through interactions with Heh1 (Huang, Brito et al. 2006; Mekhail,
Seebacher et al. 2008). We wanted to test whether these same interactions exist at telomeres. We
conducted chromatin immunoprecipitation (ChIP) experiments using endogenously expressed
TAP-tagged Cohibin or CLIP proteins (Figure 3.5 a). We observed over 4.5-fold enrichment of
telomeric sequences in immunoprecipitations of TAP-tagged Cohibin proteins, indicating that
Cohibin physically interacts with telomeres (Figure 3.5 a). Similarly, we saw over 3.1-fold
enrichment of telomeric sequences in immunoprecipitations of TAP-tagged CLIP proteins,
consistent with previous studies showing that Heh1 can be physically cross-linked to
chromosome ends across the entire genome (Figure 3.5 a) (Grund, Fischer et al. 2008). Deletion
of LRS4 abolished the interaction between Heh1-TAP and telomeres, indicating that Cohibin is
required for the association of Heh1 with telomeres (Figure 3.5 a).
Since the Cohibin subunits do not appear to contain chromatin-binding domains, Cohibin may
rely on other chromatin-associated proteins to associate with telomeres. Consistent with this
notion, Cohibin is recruited to the rDNA repeats through rDNA-associated chromosomal
complexes. Therefore, Cohibin may be recruited to telomeres through interactions with telomere-
associated proteins, such as the SIR complex. Indeed, ChIP experiments revealed that deletion of
SIR3 or SIR4 strongly disrupts the recruitment of Csm1-TAP to telomeres (Figure 3.5 b).
Importantly, Csm1-TAP protein levels were unchanged in sir3∆ or sir4∆ cells (Chan, Poon et al.
2011). Altogether, these results suggest that Cohibin may be recruited to telomeres through
interactions with the SIR complex, and that Cohibin is required for linking SIR-bound telomeres
to Heh1.
60
Figure 3.5. Cohibin links SIR-bound telomeres to Heh1 and requires Sir4 to physically interact with telomeres. (a) ChIP analysis reveals that Cohibin links INM proteins to telomeres. PCR products for DNA sequences (0.07 kb from telomeres, and at ACT1) were amplified from input and TAP-immunoprecipitated chromatin. Fold enrichments for telomeric sequences (normalized to ACT1) are shown relative to untagged control. (b) ChIP analyses show that deletion of SIR3 or SIR4 strongly compromises the recruitment of Csm1-TAP 0.07 kb away from telomeres.
a b
61
3.2.4 Cohibin cooperates with LEM and SUN domain INM proteins to maintain telomeric silencing
Based on our results so far, we have discovered that Cohibin is required for the maintenance of
TPE, and that it physically links SIR-bound telomeres to the INM protein Heh1. If the Cohibin
mediated telomere silencing pathway involves only interactions between Cohibin and Heh1, then
it would be expected that cells depleted of Heh1 would show a similar silencing defect compared
to Cohibin-deficient cells. However, heh1∆ cells show a relatively weak silencing defect
compared to the strong loss of silencing exhibited by lrs4∆ cells, suggesting that Cohibin may be
interacting with another protein in addition to Heh1 to silence telomeres. Thus, we wanted to test
whether there is interplay between Cohibin and the rest of the perinuclear telomere silencing
network, which implicates Esc1, Mps3, and the yKu complex.
We first investigated a potential cooperation between Cohibin and Esc1 in telomeric silencing
using the URA3-TELVII-L reporter assay. Deleting ESC1 results in a partial loss of silencing of
telomeric URA3, as expected (Figure 3.6 a) (Andrulis, Zappulla et al. 2002). Interestingly, loss of
URA3 silencing upon deletion of LRS4 and ESC1 together is additive, showing a more severe
silencing defect compared to the lrs4∆ mutant alone without changes in Sir2 protein levels
(Figure 3.6 b). This suggests that the roles of Cohibin and Esc1 in telomeric silencing are at least
partly independent, and that these two proteins may work in parallel to silence telomeres through
interactions with SIR proteins. On the other hand, deletion of HEH1 in esc1∆ cells does not
result in an increased loss of telomeric silencing (Figure 3.6 a). These results suggest that
Cohibin is interacting with another perinuclear protein to mediate telomeric silencing.
62
Figure 3.6. Cohibin mediated telomere silencing in URA3-TELVII-L cells is at least partly independent of Esc1. (a) Deletion of LRS4 in esc1∆ cells results in an additive loss of silencing, indicating that the two proteins act at least partially in parallel pathways to maintain telomeric silencing. Ten-fold serial dilutions of cells were plated on synthetic complete (SC) media or media supplemented with 5-fluoro-ortic acids (SC+5FOA). Loss of silencing is indicated by less growth on SC+5FOA. WT, wild-type. (b) Western blot indicating that disruption of Lrs4 and/or Esc1 does not alter Sir2 protein levels.
a b
63
We next tested whether Cohibin may be interacting with Mps3 to maintain telomeric silencing.
Deleting amino acid residues 75-150 of Mps3 (mps3∆75-150; full deletion is lethal) results in a
partial loss of silencing of a URA3 reporter inserted at telomere V-R, as expected (Figure 3.7 a)
(Bupp, Martin et al. 2007). Deletion of LRS4 in mps3∆75-150 mutant cells resulted in a similar
loss of silencing compared to lrs4∆ cells alone. (Figure 3.7 a). On the other hand, silencing
defects of mps3∆75-150 heh1∆ cells were additive compared to the single mutants, becoming
more like lrs4∆ cells (Figure 3.7 a). We also confirmed that the heh1∆ mps3∆75-150 double
mutant does result in an additive loss of silencing compared to the single mutants by conducting
semi-quantitative RT-PCR examining an endogenous subtelomeric gene (Figure 3.6 b).
These data indicate that the disruption of Heh1 and Mps3 proteins together may be equivalent to
disrupting Lrs4, suggesting that Heh1 and Mps3 could function in parallel by feeding through the
Cohibin-mediated telomere silencing pathway. Importantly, deleting either LRS4 or HEH1 in
mps3∆75-150 cells does not affect Sir2 or Mps3∆75-150 protein levels as revealed by Western
blot (Figure 3.7 c, d). These results strongly suggest that Cohibin cooperates with Mps3, in
addition to Heh1, to silence telomeres. Indeed, we were able to co-immunoprecipitate TAP-
tagged Cohibin proteins with endogenous Mps3 (Figure 3.8 a). In addition, deletion of LRS4
decreased the amount of Mps3 co-immunoprecipitating with Sir4-TAP (Figure 3.8 b). These
results confirm that Cohibin physically interacts with Mps3, and that Mps3 relies partly on
Cohibin to interact with Sir4.
64
Figure 3.7. Cohibin cooperates with INM proteins Heh1 and Mps3 to silence telomeres. (a) Silencing defects of mps3∆75-150 heh1∆ cells were additive compared to the single mutants, becoming more like lrs4∆ cells, while deletion of LRS4 in mps3∆75-150 mutant cells resulted in similar loss of silencing compared to lrs4∆ cells alone. Ten-fold serial dilutions of cells were plated on synthetic complete (SC) media or media supplemented with 5-fluoro-ortic acids (SC+5FOA). Loss of silencing is indicated by less growth on SC+5FOA. WT, wild-type. (b) Confirmation of an additive loss of silencing upon disrupting both Heh1 and Mps3, as revealed by semi-quantitative RT-PCR on the YFR057W subtelomeric gene. Internal gene SCR1 served as control. (c) Western blot indicating that disruption of Mps3 and Heh1 does not alter Sir2 protein levels. (d) Deletion of LRS4 or HEH1 does not affect Mps3∆75-150 levels as indicated by immunoblotting. A non-specific band served as loading control. All lanes were run and transferred from the same gel.
a b
d c
65
Figure 3.9. The role of Cohibin at telomeres is not as broad as that of yKu. Loss of telomeric silencing in yku80∆ cells is stronger compared to lrs4∆ cells. Ten-fold serial dilutions of cells were plated on synthetic complete (SC) media or media supplemented with 5-fluoro-ortic acids (SC+5FOA). Loss of silencing is indicated by less growth on SC+5FOA. WT, wild-type.
Figure 3.8. Cohibin physically interacts with Mps3 and mediates the interaction between Mps3 and SIR-bound telomeres. (a) Western blots revealing that TAP-tagged Lrs4 and Csm1 co-immunoprecipitates with endogenous Mps3. (b) Western blots revealing that deletion of LRS4 partly disrupts the interaction between Sir4-TAP and Mps3.
a b
66
To complete the characterization of the Cohibin-mediated telomere silencing network, we
investigated possible genetic interactions between Cohibin and the yKu complex. Using the
telomeric URA3 reporter silencing assay, we deleted LRS4 or HEH1 in yku80∆ cells. Deletion of
yKU80 results in a severe loss of TPE (Figure 3.9), as expected due to compounding effects from
the multiple roles of the yKu complex in telomere length maintenance (Laroche, Martin et al.
1998). The loss of telomeric silencing in yku80∆ cells is dominant, such that any potential
additive effects of deleting LRS4 or HEH1 on TPE maintenance is masked (Figure 3.9). Because
loss of silencing in yku80∆ cells is much stronger compared to lrs4∆ cells (Figure 3.9), this
suggests that the role of Cohibin at telomeres is not as broad as that of the yKu complex. Indeed,
deletion of LRS4 does not have an effect on telomere length unlike that of disrupting the yKu
complex (Chan, Poon et al. 2011).
In summary, data from telomeric reporter silencing assays looking at possible interactions
between Cohibin and other known perinuclear telomere silencing proteins reveal that Cohibin
interacts with both Heh1 and Mps3 to maintain telomeric silencing. The Cohibin silencing
pathway is at least partly independent from Esc1 and does not have as broad a function as the
yKu complex.
67
3.2.5 Cohibin is required for telomere anchoring to the INM during S phase
The association of telomeres with the nuclear periphery is speculated to maintain a high
concentration of SIR complexes to ensure proper telomere silencing and maintenance (Maillet,
Boscheron et al. 1996). Consistent with this notion, disruption of any of the known perinuclear
telomere anchors affects telomere tethering as well as TPE (Laroche, Martin et al. 1998;
Andrulis, Zappulla et al. 2002; Bupp, Martin et al. 2007). Since Cohibin is required for telomeric
silencing and cooperates with perinuclear proteins Heh1 and Mps3 to silence telomeres, we next
asked whether Cohibin maintains TPE by mediating perinuclear telomere localization.
We first assessed whether Cohibin is required for the spatial organization of telomeres by
examining telomere localization in Cohibin-deficient cells. In S. cerevisiae, telomeres are
clustered at the nuclear periphery into 4-8 foci, which can be visualized by immunostaining for
Sir3. In asynchronously cultured fixed wild-type cells, immunostained endogenous Sir3 appear
as bright dots along the outer edges of DAPI (4,6-diamidino-2-phenylindole dihydrochloride )
stained DNA (Figure 3.10). Disruption of Cohibin, but not CLIP, changed Sir3 localization from
perinuclear clusters to several foci coupled to diffuse signal overlapping bulk nuclear DNA,
suggesting a dispersal of the telomere clusters (Figure 3.10). This suggests that the Cohibin
complex is required for perinuclear telomere recruitment, and may also be involved in mediating
interaction between telomeres to form telomeric clusters.
68
Figure 3.10. Deletion of LRS4, but not HEH1, disrupts telomeric foci. Deconvolved images of immunolabeled endogenous Sir3 reveal that its localization is changed from perinuclear clusters to several foci coupled to diffuse signal in lrs4∆, but not heh1∆, cells. Cells were stained with 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) to reveal bulk nuclear DNA.
69
Thus, we next set out to assess whether Cohibin is involved in telomere anchoring to the nuclear
envelope. To do this, we examined the localization of individual telomeres via the use of live cell
fluorescence microscopy. We used a strain with tandem repeats of the lactose operator (lacO)
inserted at either telomere XIV-L or telomere VIII-L (Figure 3.11 a). Visualization of the tagged
telomere was achieved through the expression of GFP fused to the lactose repressor (GFP-LacI)
(Figure 3.11 a). Coexpression of nucleoporin Nup49 fused to GFP (Nup49-GFP) allowed
visualization of TELXIV-L or TELVIII-L with respect to the nuclear periphery (Figure 3.11 a).
The nucleus was divided into three concentric zones of equal volume, with Zone 1 being the
most peripheral (Figure 3.11 a). Cells were categorized according to whether the center of the
GFP-LacI focus localizes to Zone I, II, or III.
During S phase of the cell cycle, telomere anchoring is thought to rely more on Sir4 interactions
with Mps3 and Esc1 (Hediger, Neumann et al. 2002). Given the genetic interaction data from the
telomeric URA3 reporter silencing assays, we first tested whether Cohibin plays a role in
telomere anchoring during S phase. Cells were grown asynchronously and S-phase cells were
assessed by morphology. As expected, most wild-type cells displayed peripheral telomere
localization during S phase (Figure 3.11 b, c, d). Deletion of LRS4 decreases telomere
localization to the nuclear periphery and results in a random telomere distribution, indicating that
Lrs4 is required for S-phase telomere anchoring (Figure 3.11 b, c, d; Table 3.1). Deletion of
HEH1 or NUR1 does not affect perinuclear localization, results that are not surprising given the
weak telomeric silencing defect exhibited by heh1∆ or nur1∆ cells (Figure 3.11 b, c; Table 3.1).
Disruption of either ESC1 or MPS3 decreased telomere localization to the INM, as expected
(Figure 3.11 b, c; Table 3.1) (Andrulis, Zappulla et al. 2002; Bupp, Martin et al. 2007).
Consistent with the telomeric URA3 reporter silencing data, deletion of both LRS4 and ESC1
rendered telomere localization completely random, further suggesting that the involvement of
Cohibin in telomeric anchoring and silencing is at least partially independent of Esc1 (Figure
3.11 b; Table 3.1). Also consistent with the silencing data, telomere distribution in heh1∆
mps3∆75-150 double mutants is similar to that of lrs4∆ cells (Figure 3.11 b; Table 3.1), which
further supports the notion that Cohibin interacts with both Heh1 and Mps3 to tether and silence
telomeres to the nuclear periphery. To ensure that the effects on telomere localization in lrs4∆
cells is not due to delocalization of Mps3, we looked at Mps3 localization in Lrs4 or Heh1
mutants and found that Mps3 was localized along the nuclear envelope like that of wild-type
70
cells (Figure 3.11 e). Thus, Cohibin maintains telomere silencing at least in part by affecting
perinuclear telomere recruitment.
71
a c
b
e
d
Figure 3.11. Cohibin is required for telomere anchoring during S phase of the cell cycle. (a) Schematic of telomere localization assay. Telomeres XIV-L or VIII-L was tagged with tandem repeats of LacO in cells expressing GFP-LacI and Nup49-GFP. Telomere position with respect to the nuclear periphery in a single plane was assigned into one of three concentric zones of equal volume. Representative images of the telomere in each zone are shown. (b, c) The distribution of telomere XIV-L (b) or telomere VIII-L (c) in S phase cells across Zone 1 (black), Zone 2 (grey), and Zone 3 (white) was determined in 100 cells of each strain. The dotted line at 33% corresponds to a random distribution. P values are shown in Table 3.1 (n = 100; three independent experiments) (d) 3D reconstruction of confocal Z-stacks images acquired as in (b). Sides and top views of the nuclear envelope in red and telomeres in yellow are shown. The average telomere-to-nuclear-envelope distances relative to WT are shown below. (e) Deconvolved images of immunolabeled endogenous Mps3 reveal that its localization is unaltered in lrs4∆ or heh1∆ cells. Cells were stained with 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) to reveal bulk nuclear DNA.
72
Table 3.1. P values for χχχχ2 test on S-phase telomere localization data.
(Part A) Significance relative to random telomere localization:
(Part B) Significance of differences between key strains: Figure Strain A Strain B P value 3.11 b lrs4∆ WT 1.23×10-7 heh1∆ WT 0.83 nur1∆ WT 0.35 mps3∆75-150 WT 5.92×10-3 mps3∆75-150 heh1∆ mps3∆75-150 1.14×10-3 esc1∆ WT 6.49×10-5 esc1∆ heh1∆ esc1∆ 0.97 esc1∆ lrs4∆ esc1∆ 3.72×10-2
Figure Strain P value 3.11 b WT 2.93×10-11 lrs4∆ 0.48 heh1∆ 1.37×10-9 mps3∆75-150 7.55×10-5 mps3∆75-150 heh1∆ 0.36 esc1∆ 0.04 esc1∆ heh1∆ 0.08 esc1∆ lrs4∆ 0.99
73
3.2.6 Cohibin plays a lesser role in telomere anchoring during G1
Telomere localization to the nuclear periphery during G1 phase of the cell cycle is thought to
rely more on SIR interactions with the yKu complex (Hediger, Neumann et al. 2002). To assess
the contribution of Cohibin in telomere anchoring during G1, cells were first arrested in G1 using
alpha factor. As expected, deletion of yKU80 rendered telomere distribution random in G1
(Figure 3.12; Table 3.2) (Hediger, Neumann et al. 2002). Although there was loss of anchoring
in lrs4∆ cells, telomere distribution was not random, indicating that there is still a significant
portion of telomeres recruited to the nuclear envelope. This suggests that Cohibin plays a lesser
role in perinuclear telomere anchoring during G1 phase of the cell cycle (Figure 3.12; Table 3.2).
Consistent with Cohibin interacting with Heh1 and Mps3 to anchor telomeres, the heh1∆
mps3∆75-150 double mutant showed telomere distribution similar to that of lrs4∆ cells (Figure
3.12; Table 3.2). Thus, the role of Cohibin in telomere anchoring during G1 phase of the cell
cycle is secondary to telomere recruitment by the yKu complex.
74
Table 3.2. P values for χχχχ2 test on G1-phase telomere localization data.
(Part A) Significance relative to random telomere localization:
(Part B) Significance of differences between key strains: Figure Strain A Strain B P value 3.10 lrs4∆ WT 8.60×10-5 heh1∆ WT 0.37 mps3∆75-150 WT 2.79×10-3 mps3∆75-150 heh1∆ WT 1.39×10-4 lrs4∆ mps3∆75-150 heh1∆ 0.86 lrs4∆ ku80∆ 9.01×10-3
Figure Strain P value 3.10 WT 2.92×10-11 lrs4∆ 0.04 heh1∆ 9.96×10-8 mps3∆75-150 6.96×10-4 mps3∆75-150 heh1∆ 0.03 ku80∆ 0.88 ku80∆ lrs4∆ 0.99
Figure 3.12. Cohibin plays a lesser role in telomere anchoring during G1 phase of the cell cycle. The distribution of telomere XIV-L in G1 phase cells across Zone 1 (black), Zone 2 (grey), and Zone 3 (white) was determined in 100 cells of each strain. The dotted line at 33% corresponds to a random distribution. P values are shown in Table 3.2. Cells were arrested in G1 using alpha factor. Telomere localization was monitored as in Figure 3.11.
75
3.2.7 Cohibin can artificially induce partial perinuclear localization and silencing of an internal locus under certain conditions
Perinuclear S. cerevisiae proteins fused to the bacterial LexA protein can artificially recruit
internal loci marked with LexA-binding lexA operator (lexA-O) sequences to the nuclear
envelope (Taddei, Hediger et al. 2004). Since Cohibin is involved in recruiting telomeres to the
nuclear periphery, we next asked whether Lrs4 is able to mediate the perinuclear anchoring and
silencing of internal loci in live asynchronous cells. First, we used a strain harbouring lexA-O
sequences inserted next to a lacO array located at an internal ARS607 locus on chromosome VI
(Figure 3.13 a). Expression of different proteins fused to LexA would target the fusion proteins
to this locus. Co-expression of LacI-GFP and Nup49-GFP allowed visualization of this locus
with respect to the nuclear periphery (Figure 3.13 a). Second, we used a strain in which the Rap1
and Abf1 (ARS-binding factor 1) sites of the E silencer at HMR are replaced with lexA-O, and a
TRP1 reporter gene is inserted downstream of this crippled silencer (Figure 3.13 b). We tested
whether a LexA-Lrs4 fusion could target ARS607 to the nuclear periphery as well as silence the
TRP1 reporter. We used strains harbouring a FOB1 deletion to prevent recruitment of the Lrs4
fusion protein to rDNA. Fusion of the C-terminus of Esc1 to LexA (LexA-Esc1C) efficiently
targeted the internal locus to the nuclear periphery as well as silence TRP1, as expected (Figure
3.13 a, b) (Taddei, Hediger et al. 2004). On the other hand, LexA-Lrs4 was able to target
ARS607 to the nuclear periphery and silence TRP1 only in the absence of Heh1 (Figure 3.13 a,
b). These findings suggest that, in addition to its role in perinuclear telomere localization and
silencing, Heh1 may provide specificity by preventing Cohibin from erroneously recruiting
active internal loci for silencing to the nuclear periphery, at least within artificial settings.
76
a b
Figure 3.13. Lrs4 is able to target an internal locus to the nuclear periphery and silence a TRP1 reporter inserted at HMR only in the absence of Heh1. (a) The internal locus ARS607 was marked by a lacO array inserted next to lexA-O sites. Co-expression of Nup49-GFP and GFP-LacI allowed visualization of the internal locus with respect to the nuclear periphery. Cells were transformed to express indicated LexA fusion proteins or the LexA alone control. Localization of the tagged locus within the nucleus was quantified as in Figure X. (b) Expression of a TRP1 reporter gene at an HMR locus, in which lexA-O sequences were inserted at a defective E silencer, was assessed following transformation with plasmids encoding LexA fusion proteins or LexA alone control.
77
3.2.8 Increased SIR recruitment to telomeres can rescue telomere silencing in Cohibin deficient cells
Given that Cohibin is required for the maintenance of telomere silencing and anchoring, we
wanted to investigate whether we could rescue the silencing and anchoring defects in Cohibin-
deficient cells. Even though SIR proteins were required to recruit Cohibin to telomeres, ChIP
data revealed that loss of Cohibin in turn reduced Sir2 concentrations at telomeres (Figure 3.14
a). Therefore, we wanted to test whether loss of silencing and anchoring in lrs4∆ cells could be
rescued by increasing Sir2 recruitment to telomeres. We tested this by deleting RIF1 (Rap1-
interacting factor 1), which encodes a protein that competes with Sir4 for binding to the C-
terminus of Rap1 (Figure 3.14 a) (Buck and Shore 1995). Indeed, deletion of RIF1 was able to
restore Sir2 concentrations at telomeres in lrs4∆ cells (Figure 3.14 a). Importantly, depletion of
RIF1 rescued the growth of lrs4∆ or esc1∆ cells, but not sir2∆ cells, on 5FOA-containing media,
consistent with the mechanism of rescue requiring Sir2 (Figure 3.14 b). Sir2 protein levels were
unchanged in lrs4∆ rif1∆ or esc1∆ rif1∆ cells (Figure 3.14 c). Interestingly, deletion of RIF1 did
not fully restore the localization of TELXIV-L in lrs4∆ cells (Figure 3.14 d; Table 3.3). The fact
that increasing SIR recruitment to telomeres can fully rescue silencing but not localization
suggests that telomere silencing can be maintained away from the nuclear periphery provided a
threshold level of Sir2-telomere interactions is present.
Table 3.3. P values for χχχχ2 test on RIF1-rescue telomere localization data.
(Part A) Significance relative to random telomere localization:
(Part B) Significance of differences between key strains: Figure Strain A Strain B P value 3.12 rif1∆ WT 0.06 lrs4∆ rif1∆ WT 7.19×10-6 lrs4∆ rif1∆ lrs4∆ 6.36×10-7
Figure Strain P value 3.12 WT 2.93×10-11 lrs4∆ 0.48 rif1∆ 9.10×10-16 lrs4∆ rif1∆ 4.85×10-8
78
a b
c d
Figure 3.14. Deletion of RIF1, which increases SIR recruitment to telomeres, rescues telomere silencing in lrs4∆ cells without fully rescuing telomere localization. (a) ChIP analyses for sequences 0.07 kb from telomeres indicates deletion of LRS4 decreases the local concentration of Sir2 at telomeres, and that Rif1 deletion in lrs4∆ cells rescues telomere-Sir2 interactions. Relative fold enrichments are shown. (b) Telomere proximal URA3 reporter gene silencing assay shows deletion of RIF1 rescues growth of lrs4∆ or esc1∆ cells on +5FOA containing media without rescuing sir2∆ cells. Ten-fold serial dilutions of cells were plated on synthetic complete (SC) media or media supplemented with 5-fluoro-ortic acids (SC+5FOA). All mutants were spotted on the same plate. Loss of silencing is indicated by less growth on SC+5FOA. WT, wild-type. (c) Western blot indicating that disruption of Rif1 and Lrs4 does not alter Sir2 protein levels. (d) RIF1 deletion partially rescues TELXIV-L localization in lrs4∆ cells. Localization of TEL XIV-L within the nucleus was quantified as in Figure 3.11 with P values shown in Table 3.3.
79
3.3 Discussion
Our data suggest that Cohibin cooperates with INM proteins to maintain telomere anchoring and
silencing. We show that loss of Cohibin results in decreased SIR levels at telomeres leading to a
dispersal of telomeres away from the nuclear periphery, as well as a loss of silencing. Therefore,
we propose a model where the Cohibin complex interacts with SIR bound telomeres and acts to
cluster and silence them at the nuclear periphery through interactions with Heh1 and Mps3
(Figure 3.15 a) (Chan, Poon et al. 2011). This Cohibin-mediated telomere tethering and silencing
pathway is at least partly independent of Esc1. Telomere recruitment to the nuclear periphery by
Cohibin is also important for the maintenance of telomere stability. Loss of Cohibin results in
changes in the number of Y’ subtelomeric repeats, indicating an increase in telomere
recombination and destabilized telomeres (Chan, Poon et al. 2011). In addition, Cohibin-
deficient cells have a shorter replicative lifespan, which reflects the number of times that a
mother cell can replicate its DNA and yield progeny before reaching senescence (Chan, Poon et
al. 2011).
Increasing telomeric levels of SIR complexes by deleting RIF1 rescued telomere silencing,
stability, and replicative lifespan, without fully restoring perinuclear localization (Chan, Poon et
al. 2011). This is consistent with previous studies indicating that telomere silencing can be
maintained away from the periphery provided there are sufficient local SIR concentrations
(Gartenberg, Neumann et al. 2004). Thus, our data support the notion that telomere clustering at
the nuclear periphery helps sustain high local concentrations of SIR proteins in order to maintain
telomeric silencing. Since the globular domains of Csm1 bind to chromatin-associated proteins at
rDNA, it is conceivable that these same domains interact with telomeric SIR proteins while Lrs4
proteins anchor the telomeres to INM proteins. This presents a Cohibin-mediated network for
telomere silencing and tethering that is very similar to the interactions implicated in Cohibin’s
role in rDNA maintenance.
80
a b
Figure 3.15. Model for the role of Cohibin in telomere silencing, anchoring, and clustering. (a) Cohibin anchors telomeres to the INM through interactions with Heh1 and Mps3, and this pathway is at least partially independent of Esc1. (b) A putative model for Cohibin mediated genesis of telomere clusters. Telomeres are initially bound by low amounts of SIR complexes that recruit Cohibin. Cohibin initiates clustering of telomeres, and this increases local SIR concentrations that in turn recruit more Cohibin. Continuation of this cycle generates telomere clusters that are anchored to the nuclear periphery through INM proteins. Increased darkness of circle depicts increases in the local concentration of SIR complexes at telomeres.
81
Given that SIR complexes are required to recruit Cohibin to telomeres and that loss of Cohibin
results in decreased telomeric SIR concentrations, we further postulate a model for the genesis of
telomere clusters (Figure 3.15 b) (Poon and Mekhail 2011). In this model, telomeres are first
bound by low amounts of SIR complexes. Recruitment of Cohibin by SIR initiates telomere
clustering. Clustering in turn increases the local concentration of SIR complexes, which can then
further promote the recruitment of Cohibin. Continuation of this cycle clusters telomeres
together and Cohibin is then able to tether telomere clusters to the nuclear periphery. Our data
showed that in the absence of Cohibin, there is a dispersal of Sir3 foci and partial release of Sir3
proteins from telomeres. These are in support of our proposed model for the role of the Cohibin
complex in mediating telomere clustering at the nuclear periphery. However, our
immunofluorescence data looks at telomeres indirectly by staining for Sir3. Future experiments
will need to be conducted to directly assay whether relative distances between telomeres is
increased in Cohibin-deficient cells. These experiments will be discussed in Future Directions
and will help to solidify our model and provide further insight into the mechanisms involved in
maintaining telomere localization.
Our data showed that the defects in telomere silencing and localization are very similar between
Cohibin-deficient cells and cells lacking the two Cohibin-associated proteins Heh1 and Mps3.
However, one major difference between lrs4∆ cells and mps3∆75-150 heh1∆ cells is that
Cohibin is present in the latter. Based on our model of Cohibin functioning to cluster telomeres,
Cohibin can potentially still cluster telomeres away from the nuclear periphery in the absence of
its associated INM proteins. Consistent with this notion, a previous study found that
overexpression of Sir3 can induce hyper clustering of telomeres and that these telomere clusters
localize internally away from the nuclear envelope (Ruault, De Meyer et al. 2011). It would be
interesting to see whether Cohibin maintains interactions with SIR bound telomeres in the
absence of Heh1 and Mps3, and whether telomere clustering is preserved. Alternatively,
attachment to the nuclear periphery may be required to provide a structural scaffold for Cohibin
to efficiently cluster telomeres together, similar to the structural stability provided by the nuclear
envelope for Cohibin to maintain rDNA repeat stability.
82
Our results point to another role for the Cohibin complex in mediating cellular functions through
cooperation with INM proteins. The interaction between Cohibin and Heh1 may be a common
theme in Cohibin-associated molecular networks, given that Cohibin links both rDNA and
telomeres to the nuclear periphery in part through Heh1. It is possible that Lrs4-Csm1 complexes
may be cooperating with Heh1 to regulate other processes as well. In particular, the Cohibin-
containing Monopolin complex localizes to kinetochores and is involved in proper sister
chromatid cohesion (Rabitsch, Petronczki et al. 2003; Corbett, Yip et al. 2010). Disruption of
Monopolin results in delayed meiosis, premature sister chromatid segregation, and low spore
viability (Rabitsch, Petronczki et al. 2003; Corbett, Yip et al. 2010). It is proposed that
Monopolin functions to clamp sister kinetochores together to ensure proper co-orientation, and
mediate their attachment to microtubules extending from the same SPB (Corbett, Yip et al.
2010). However, the exact mechanism and other associated proteins are still unknown.
Interactions between kinetochores with the SPB and other perinuclear proteins are also vital in
regulating homolog segregation. Interestingly, a genome-wide screen for genes involved in
centromere cohesion picked up HEH1, where disruption of Heh1 resulted in poor spore viability
and improper chromosome segregation (Marston, Tham et al. 2004). The interactions between
Cohibin and Heh1 in mitotic cells suggest these proteins may also interact in meiosis to establish
proper chromosome segregation and stability.
Thus, our data further highlight the importance of genome organization and the preferential
localization of certain chromosomal domains to nuclear landmarks, such as the nuclear envelope.
Another process that requires chromosome association with the nuclear periphery is the
clustering of telomeres into a bouquet formation at the SPB in meiosis I. Telomere bouquet
formation and telomere-led rapid prophase movements (RPM) are essential for meiotic
recombination between homologous chromosomes. In S. cerevisiae, three perinuclear proteins,
Ndj1 (nondisjunction 1), Csm4 (chromosome segregation in meiosis 4), and Mps3 interact with
each other and are required for telomere bouquet formation and regulation of RPMs (Trelles-
Sticken, Dresser et al. 2000; Conrad, Lee et al. 2007; Conrad, Lee et al. 2008). Disruption of
these proteins decreases the mobility and SPB-proximal clustering of telomeres (Conrad, Lee et
al. 2008). However, how telomeres cluster together and with the SPB during telomere bouquet
formation is unclear. Since molecular interactions between Cohibin and telomeric Sir3 occur in
mitotic cells, similar interactions may occur in meiosis. In addition, our data suggest that Cohibin
83
cooperates with Mps3 to link telomeres to the nuclear periphery in mitotic cells. Therefore, a
similar interaction may also exist in meiosis during telomere bouquet formation. Thus, Cohibin
may be interacting with INM proteins to control RPMs, link telomeres to each other at the
nuclear envelope, and ensure telomere bouquet formation.
In all, interactions between Cohibin and INM proteins may help connect chromosomal domains
to each other and to nuclear landmarks in order to exert several functions across the genome. Our
data highlight how Cohibin can exert multiple biological functions across the genome in meiotic
and mitotic cells. While the Lrs4-Csm1-containing Monopolin complex links kinetochores to
each other in meiosis I, Cohibin aligns rDNA repeats on sister chromatids to prevent USCE and
ensures perinuclear telomere clustering and regulate subtelomeric chromatin in mitotic cells.
Therefore, Lrs4-Csm1 is an adaptable core complex that can be directly or indirectly targeted to
telomeres via SIR, rDNA via nucleolar complexes, and kinetochores via meiosis-specific factors.
Furthermore, our findings in S. cerevisiae may point to similar processes in other organisms.
Mde4 and Pcs1 of S. pombe, the respective orthologues of Lrs4 and Csm1, may control
perinuclear telomere clustering in mitotic or meiotic cells. In addition, repetitive DNA sequences
are abundant in eukaryotic genomes and are commonly assembled into perinuclear silent
chromatin. Thus, both yeast and mammalian cells may have preferred locations for telomeres
within the nucleus.
In addition to expanding the functional repertoire of Cohibin and uncovering molecular
connections impacting telomeres, our work indicates that perinuclear protein-silent chromatin
networks ensure spatial genome organization. Therefore, it is expected that functional analogues
of Cohibin exist in mammals. The coiled-coil domains central to the Cohibin subunits is a major
feature of other proteins and complexes involved in the maintenance of spatial genome
organization. Cohibin is structurally related to Cohesin and Condensin, which are highly
conserved coiled-coil-containing complexes that maintain genome structure and function.
Importantly, recent work shows that Cohesin maintains telomeres in mammalian meiocytes as
well as subtelomeric heterochromatin in S. pombe (Adelfalk, Janschek et al. 2009; Dheur, Saupe
et al. 2011). Thus, it is conceivable that Cohesin may substitute for the telomeric role of Cohibin
or cooperate with Cohibin analogues in higher eukaryotes. In addition, Cohibin exerts its
functions across the genome by cooperating with conserved LEM and SUN-domain containing
proteins, which also function to maintain the perinuclear localization of some mammalian
84
telomeres, leading to the prospect that coiled-coil containing analogues of Cohibin may be
cooperating with these conserved INM proteins to regulate telomere localization in mammals.
85
Chapter 4 Function of Stm1/G4 DNA in rDNA maintenance
Statement of contribution:
I performed all of the experimental work described in this Chapter.
86
4 Function of Stm1/G4 DNA in rDNA maintenance
4.1 Introduction
G-quadruplex (G4) DNA are non-canonical DNA structures that are formed by stacks of planar
tetrads made up of Hoogsteen-bonded guanines (see Figure 1.7 in Introduction). G-quadruplexes
have been mapped in silico across many genomes based on algorithms looking for the presence
of G4 motifs. These G-rich DNA strands can readily form G-quadruplexes in vitro and recently,
more and more studies are providing evidence for the in vivo existence of G4 DNA (Schaffitzel,
Berger et al. 2001; Duquette, Handa et al. 2004; Paeschke, Simonsson et al. 2005; Smith, Chen et
al. 2011). Since DNA is normally in the form of a double helix, G-quadruplexes are expected to
form when double-stranded DNA is opened to reveal single-stranded DNA, such as during
transcription or replication. Given that G-quadruplexes are stable once they are formed, it is
expected that their presence would cause genomic instability. Consistent with this notion,
genomic regions harbouring G4 motifs have been shown to be prone to DSBs, as well as increase
rearrangement frequencies and aberrant recombination intermediates, leading to a decrease in
genome stability (Lopes, Piazza et al. 2011; Paeschke, Capra et al. 2011). In the budding yeast S.
cerevisiae, G4 motifs are found at the ends of all 16 chromosomes, in the telomeric and
subtelomeric regions, and at a region on Chromosome XII which harbours the rDNA encoding
genes. Stm1 is a G-quadruplex binding protein that localizes to telomeres and rDNA. However,
our understanding of Stm1 roles in the cell is very limited.
Interestingly, we discovered that Stm1 physically interacts with the Cohibin complex, which
functions in the maintenance of telomere and rDNA silencing and stability (Table 4.1) (Mekhail,
Seebacher et al. 2008; Chan, Poon et al. 2011). The physical interaction between Stm1 and
Cohibin suggests that crosstalk between the two factors may modulate silent chromatin domains.
In addition, since Stm1 is a G4-binding protein, Stm1 may be maintaining telomeres and rDNA
through G-quadruplex structures. We wanted to test whether Stm1 would affect the stability
and/or silencing of chromosomal regions harbouring G4 motifs, specifically at Cohibin-
maintained rDNA and telomeres. We first assessed the potential function of Stm1 in the
maintenance of rDNA stability and silencing. After which, we tested whether Stm1 functions in
87
telomeric silencing and stability.
88
Purification A - Lrs4-TAP Purification B - Lrs4-TAP 0.5% NP40:
0.2% NP40:
ORF NP ID ORF NP ID YDR439W 47 LRS4 YDR439W 42 LRS4 YCR086W 14 CSM1 YCR086W 11 CSM1 YML034W 6 HEH1 YLR150W 7 STM1 YLR150W 4 STM1 YML034W 3 HEH1 YMR043W 3 MCM1 YBR017C 2 KAP104 YDL089W 3 NUR1 YDR054C 2 CDC34 YBL002W 2 H2B YFL037W 2 TUB2 YBR009C 2 H4 YGL207W 2 SPT16 YJL076W 2 NET1 YIL115C 2 NUP159 YFL037W 2 TUB2 YJL076W 2 NET1 YHR121W 2 LSM12 YMR043W 2 MCM1 YBR017C 2 KAP104 YDL089W 2 NUR1 YDL088C 2 ASM4 YBR245C 1 ISW1 YHR045W 2 YHR045W YDL072C 1 YDL072C YDL072C 1 YDL072C YDR483W 1 KRE2 YPL200W 1 CSM4 YER105C 1 NUP157
YGL238W 1 CSE1 YOL006C 1 TOP1
Table 4.1. Results of LC-MS/MS analysis of TAP purifications. (proteins in untagged cells were removed)
89
4.2 Results
4.2.1 Stm1 is involved in the regulation of rDNA stability
Given that G-quadruplexes have been linked to genome stability, we first assessed whether Stm1
is involved in the regulation of rDNA stability. The rDNA repeats are normally subjected to a
certain level of recombination in order to allow expansion or contraction of the repeats in
response to stress (Johzuka and Horiuchi 2002). Fob1 binds to specific sequences within IGS1
and causes a replication fork block which induces DNA double strand breaks (Figure 4.1 a)
(Kobayashi and Horiuchi 1996). Restoration of the broken fork by homologous recombination
can result in an increase (Figure 4.1 a) or decrease in the number of rDNA repeats on one sister
chromatid if the sister chromatids are not aligned leading to an USCE event. To test whether
Stm1 is involved in regulating rDNA stability, we used a strain harbouring an ADE2 reporter
inserted within the rDNA repeats and measured the rate of loss of the ADE2 reporter in different
mutant strains. Cells that have lost the ADE2 marker appear red when grown on low ADE media.
For this assay, we counted the frequency of half-sectored colonies, which indicate that the cell
had lost the ADE2 marker upon the first cell division after plating. Fully red colonies are
excluded since these cells have already lost the marker prior to plating. As shown previously,
deletion of SIR2 or LRS4, two proteins involved in rDNA maintenance, results in an increase in
the rate of marker loss, indicating an increase in USCE and more unstable rDNA repeats (Figure
4.1 b; Table 4.2) (Mekhail, Seebacher et al. 2008). On the other hand, deletion of FOB1, which is
known to forcibly stabilize rDNA, greatly lowers recombination (Figure 4.1 b; Table 4.2)
(Mekhail, Seebacher et al. 2008). Interestingly, deleting STM1 also significantly decreased
rDNA recombination compared to wild-type cells (Figure 4.1 b; Table 4.2). These data suggest
that Stm1 may actually function to promote low levels of recombination within the rDNA
repeats.
90
Table 4.2. Rates of ADE2 marker loss from the rDNA repeats.
Genotype ADE2 loss
Rate relative to wild-type Rate of loss x10-3 a P-value b Half-sectored
over total c Wild-type 1.7 (±0.67) n/a 24/13,733 1.0 sir2� 12.0 (±1.32) <0.0001 139/11,596 6.9 lrs4� 7.1 (±0.59) <0.0001 61/8,624 4.0 fob1� 0.3 (±0.2) 0.003 3/10,246 0.2 stm1� 0.5 (±0.4) 0.01 6/13,207 0.3 a Standard deviations are shown between brackets b P values as calculated using Student’s T-test, obtained by comparison with wild-type rate of marker loss c Total numbers exclude completely red colonies
*
*
* *
Figure 4.1. Stm1 is involved in the regulation of rDNA stability. (a) An example of an unequal sister chromatid exchange event leading to a gain of four rDNA repeats on one sister chromatid. (b) Cells depleted of Stm1 show more stable rDNA repeats. Relative rates of loss of ADE2 marker gene from rDNA repeats reveal that disrupting Stm1 decreases recombination within rDNA, indicating more stable rDNA repeats. Error bars denote SEM. Asterisk = p value < 0.05 compared to WT; see table 4.2 for detailed counts and stats. Representative images are shown.
a b
91
4.2.2 Stm1 is not required for rDNA silencing within IGS1 and IGS2
Since deletion of Stm1 increases rDNA repeat stability by decreasing the occurrence of USCE,
we next tested whether Stm1 is involved in silencing of Pol II-transcribed reporter genes
positioned within rDNA. We used strains harbouring a URA3 reporter inserted within the IGS1
or IGS2 regions (Figure 4.2 a). Because rDNA is normally subject to recombination, a LEU2
reporter is inserted next to URA3 and all cells are plated on SC–LEU to prevent cells from
recombining out the URA3 reporter (Figure 4.2 a). We compared growth on SC–LEU media with
growth on media lacking both leucine and uracil (SC–LEU–URA; loss of URA3 silencing allows
growth). As expected, deletion of SIR2 abrogated rDNA silencing at both IGS1 and IGS2, while
deletion of LRS4 disrupted rDNA silencing only at IGS1 (Figure 4.2 a) (Huang and Moazed
2003; Huang, Brito et al. 2006; Mekhail, Seebacher et al. 2008). Deletion of STM1 only slightly
increased growth on SC–LEU–URA media in the IGS1 reporter strain, while there was no
difference in growth between stm1∆ cells and wild-type cells in the IGS2 reporter strain (Figure
4.2 a). These data suggest that Stm1 may play a minor role in maintaining rDNA silencing within
IGS1.
However, the silencing defect at IGS1 is very weak, and these silencing assays only reflect the
ability of cells to silence the exogenous Pol II-transcribed reporter gene. Thus, we next tested
whether Stm1 plays a role in silencing the endogenous non-coding RNA transcripts originating
from IGS1 or IGS2 by conducting qRT-PCR (Figure 4.2 b). Consistent with the URA3 silencing
data and as expected, disrupting Sir2 greatly increases both IGS1 and IGS2 non-coding RNA
transcripts, while disrupting Lrs4 only increases non-coding RNA transcripts from IGS1 (Figure
4.2 b) (Huang and Moazed 2003; Huang, Brito et al. 2006; Mekhail, Seebacher et al. 2008). This
time, deletion of STM1 did not significantly increase nor decrease the levels of non-coding RNA
transcripts compared to that of wild-type cells (Figure 4.2 b). Therefore, Stm1 does not appear to
affect endogenous Pol II transcription within IGS1 or IGS2.
To further confirm that Stm1 does not function in endogenous rDNA silencing, we tested
whether Stm1 affects histone acetylation within rDNA. Specifically, we conducted ChIP
experiments using an antibody against histone 3 acetylated at lysine 9 and lysine 14
(diAcH3K9/K14), a histone mark that signifies more open chromatin and thus indicates loss of
silencing (Figure 4.2 c). We observed a 14.3 and 5.3 fold enrichment of IGS1 sequences in
92
immunoprecipitations of diAcH3K9/K14 in sir2∆ or lrs4∆ cells, respectively (Figure 4.2 c). On
the other hand, no enrichment was observed in either of the two stm1∆ clones (Figure 4.2 c).
Therefore, our data suggests that Stm1 does not play a role in silencing IGS1 or IGS2 within the
rDNA repeats.
93
a b
c
Figure 4.2. Stm1 is not required for rDNA silencing. (a) Deletion of STM1 does not affect the silencing of a URA3 reporter placed within IGS1 or IGS2. Ten-fold serial dilutions of cells were plated on synthetic complete (SC) media or media lacking uracil (SC-URA). All mutants were spotted on the same plate. Loss of silencing is indicated by more growth on SC-URA media. WT, wild-type. (b) Deletion of STM1 does not affect endogenous non-coding RNA transcripts originating from IGS1 or IGS2 as evidenced by quantitative RT-PCR. Error bars denote SEM of three replicates. Two independent stm1∆ clones were tested. (c) ChIP results show that deleting STM1 does not affect H3K9/K14 acetylation within IGS1. PCR products for DNA sequences (within IGS1 and at CUP1) were amplified from input and αH3K9/K14ac immunoprecipitated chromatin. Relative fold enrichments for IGS1 sequences (normalized to CUP1) are shown relative to WT control.
94
4.2.3 Stm1 is not required for telomere stability or silencing
Since Stm1 localizes to the subtelomeric Y’ repeats as well as to the TG-rich telomere tracts, and
given the presence of G4 motifs within subtelomeric regions, it is possible for Stm1 to function
in subtelomeric chromatin maintenance (Van Dyke, Nelson et al. 2004; Hershman, Chen et al.
2008). Therefore, we wanted to test whether Stm1 plays a role in maintaining telomere stability
or silencing.
To assess telomeric stability, we conducted a southern blot on XhoI-digested genomic DNA
using a Y’ subtelomeric DNA probe (Figure 4.3 a). Telomere instability is assessed by a change
in the intensity of the digested Y’ DNA. Deletion of SIR3 resulted in an increase in Y’
fragments, indicating instability within the subtelomere, as expected (Figure 4.3 a) (Chan, Poon
et al. 2011). On the other hand, deletion of STM1 did not result in detectable differences in the
intensity of Y’ fragments, suggesting that Stm1 is not involved in the maintenance of telomere
stability (Figure 4.3 a). We next tested whether Stm1 is required for telomeric silencing. To do
this, we monitored the growth of URA3-VII-L cells on SC compared to 5FOA-containing media
(Figure 4.3 b). Cells depleted of Sir2 or Lrs4 exhibited loss of URA3 silencing as revealed by
decreased growth on SC+5FOA media (Figure 4.3 b). Conversely, cells deficient in Stm1 had
similar growth compared to wild-type cells (Figure 4.3 b). Similar results were observed using
the telomeric HIS3 reporter gene silencing assay, indicating that these results are not reporter
specific (Figure 4.3 c). We confirmed our silencing assay data by conducting semi-quantitative
RT-PCR on the subtelomeric YFR057W gene, which showed no increase in expression upon
deletion of STM1 (Figure 4.3 d). Altogether, our data suggest that Stm1 does not function to
maintain telomeric stability or silencing.
95
a
b
c d
Figure 4.3. Stm1 is not required for telomeric stability or silencing. (a) Stm1 does not affect subtelomeric stability. Southern blot of XhoI-digested genomic DNA, from two different clones per genotype, probed with radiolabeled Y’ subtelomeric DNA (top). Ethidium bromide staining of digested DNA prior to transfer acts as loading control (bottom). (b, c) Deletion of STM1 does not affect the silencing of telomeric URA3 (b) or HIS3 (c) reporters. Ten-fold serial dilutions of cells were plated on the respective media. Loss of silencing is indicated by less growth on +5FOA media or more growth on –HIS+3AT media. dot1∆ cells were used as a control for mutants deficient in nucleotide metabolism (refer to text and Ref. 26). WT, wild-type. (d) Depletion of Stm1 does not result in loss of subtelomeric silencing as evidenced by semi-quantitative RT-PCR on the YFR057W endogenous subtelomeric gene. The internal SCR1 gene acts as a control.
96
4.2.4 Cohibin does not function in Stm1-mediated telomere capping
Tandem affinity purification of Lrs4-TAP pulled down unique peptides for Stm1, which is what
originally led us to the hypothesis that Stm1 may function in processes related to the Cohibin-
mediated maintenance of telomeres. However, based on our data so far, it does not appear that
Stm1 plays a role in telomere silencing or stability. Alternatively, it is possible that the
cooperation between Cohibin and Stm1 may not function in telomere silencing or stability, but
rather this interaction is involved in the function of Stm1 in telomere capping in the absence of
the CST complex. The CST complex forms a telomere cap and is composed of proteins Cdc13,
Stn1, and Ten1 (Grandin, Damon et al. 2001). CST protects the single stranded telomeres from
exonucleolytic degradation. Studies looking at the function of the CST complex have relied on
the generation of temperature sensitive mutants since deletion of any of the CST subunits is
lethal. It was recently shown that overexpression of Stm1 was able to rescue growth of CST
disrupted mutants at semi-permissive temperature (Smith, Chen et al. 2011). Interestingly,
mutations within the telomeric repeats that eliminated G-quadruplex formation also eliminated
the rescue effect of Stm1 overexpression. These findings led to a model where overexpression of
Stm1 stabilizes telomeric G4 structures that can then act as a protective telomere cap in the
absence of CST (Smith, Chen et al. 2011). Cohibin may play a role by cooperating with Stm1 to
facilitate the formation and stabilization of telomeric quadruplex structures. To test this, we
looked at whether overexpression of Stm1 would be able to rescue growth of mutants deficient in
both the CST and Cohibin complexes. We overexpressed Stm1 in cdc13-1 mutants, with or
without lrs4∆, and compared growth on permissive (23°C) and semi-permissive temperatures
(30°C) (Figure 4.4). Cells with non-functional CST and Cohibin complexes were able to grow at
semi-permissive temperature with the overexpression of Stm1, indicating that the Cohibin
complex is not required for Stm1/G-quadruplex-dependent telomere capping (Figure 4.4).
97
Figure 4.4. Cohibin is not required for Stm1/G-quadruplex-dependent telomere capping. Overexpression of Stm1 is able to rescue growth of cdc13-1 cells deficient in telomere capping even in the absence of Lrs4. Ten-fold serial dilutions of cells were plated onto synthetic complete media lacking leucine and grown at permissive (PT; 23°C) and semi-permissive (SPT; 30°C) temperatures. All cells were plated on the same respective plates. The cdc13-1 lrs4∆ cells were taken at a later time point due to slower growth.
98
4.3 Discussion
Based on southern blots, telomeric reporter gene silencing assays and semi-quantitative RT-PCR,
our data suggest that Stm1 does not play a role in telomere stability and silencing. Similarly,
Cohibin is not involved in the function of Stm1 in forming a protective telomere cap in the
absence of the CST complex. On the other hand, our data suggest that Stm1 depleted cells have
more stable rDNA repeats, pointing to a role for Stm1 in the regulation of rDNA stability. This
potential role for Stm1 in maintaining rDNA stability is independent of rDNA silencing, as
deletion of STM1 did not affect the expression of Pol II-transcribed exogenous reporters or
endogenous non-coding RNA genes within IGS1 or IGS2. Since deletion of STM1 results in
either no effect or an opposite phenotype at telomeres and rDNA, respectively, compared to
disruption of Cohibin, Stm1 most likely does not directly cooperate with Cohibin to maintain
telomeres and rDNA. Our results are consistent with previous studies showing that the presence
of G-quadruplex structures causes genome instability.
A drawback to our work so far, like that of previous studies looking at G4 DNA, does not look
directly at the G-quadruplex structures themselves. Thus, although Stm1 is a G-quadruplex
binding protein, there is no evidence that Stm1 is functioning through G4 DNA at the rDNA
repeats. This is due to the limitations of the techniques available, since the visualization of G-
quadruplex structures in vivo has only been achieved in S. lemnae and E. coli. Even though G4
DNA has not been detected directly in vivo in yeast or mammalian cells, it is still possible to
increase the evidence that G-quadruplex structures are playing a role in regulating rDNA
stability. For example, support for the presence of G4 structures can be solidified by studying the
effects of other G4-associated proteins, such as G4 helicases. These approaches will be discussed
in Future Directions.
In S. cerevisiae, approximately 190 rDNA genes are located in tandem on Chromosome XII.
The number of rDNA genes is tightly regulated by binding of Fob1 to specific sequences within
IGS1 (Kobayashi and Horiuchi 1996). Fob1 can induce DSB and trigger recombination within
the repeats, which allows for rDNA repeat expansion or contraction in response to stress
(Johzuka and Horiuchi 2002). Thus, a certain degree of rDNA recombination is present in wild-
type cells and deletion of FOB1 forcibly stabilizes the rDNA repeats and decreases rDNA
recombination rates. Since the absence of Stm1 results in more stable rDNA repeats, our data
99
point to a new potential mechanism that the cell can employ to regulate rDNA repeat expansion
or contraction. Based on our data obtained so far, we propose three possible models for the
function of Stm1 in the maintenance of rDNA stability. Experiments that can be conducted to
test all three models will be discussed in Future Directions.
First, since the disruption of Fob1 or Stm1 both result in more stabilized rDNA repeats, the
function of Fob1 and Stm1 may be interdependent. Disruption of Stm1 could be interfering with
the ability of Fob1 to induce double strand breaks, thus resulting in more stable rDNA repeats.
Alternatively, the presence of Stm1 may be enhancing the function of Fob1 in regulating rDNA
repeat stability. Since deletion of STM1 does not affect rDNA silencing, this would be achieved
by Stm1 without impacting Fob1’s function in recruiting Sir2 and ensuring rDNA silencing.
Second, Stm1 and its bound G-quadruplex structures may be interfering with DNA replication by
obstructing replication forks (Figure 4.5). During DNA replication, the DNA double helix is
opened up to reveal single stranded DNA. This allows for the G-rich DNA strand within rDNA
to fold and form G-quadruplexes. In wild-type cells, Stm1 may be binding to and stabilizing
these G-quadruplex structures within rDNA. The added stability of these structures renders them
less susceptible to unwinding by G4 helicases. The persistent presence of the G-quadruplexes
may then cause fork blocks and stall the advancing replication machinery, preventing passage of
the DNA polymerase. The G-quadruplex structures will then have to be processed, and cleavage
of the G-quadruplex could turn the stalled fork into a broken fork. Alternatively, the broken fork
could be caused by an accidental single strand break of the leading strand. The cell will then
have to repair the broken fork and restore replication by homologous recombination. This can
lead to an addition or subtraction of the number of rDNA repeats if they are not properly aligned,
resulting in an USCE exchange event and thus a decrease in rDNA stability (Figure 4.5). In the
absence of Stm1, the G4 structures would be less stable and are easily unwound by G4 helicases,
which would allow for a smooth progression during replication and thus lead to more stable
rDNA repeats (Figure 4.5). Consistent with this model, it was recently discovered that G-
quadruplex DNA does impede leading strand replication in cells deficient of Pif1, a 5’-3’ DNA
helicase that unwinds G4 DNA, and that the resultant genomic instability is dependent on the
homologous recombination pathway (Lopes, Piazza et al. 2011). Furthermore, cells deficient of
the Sgs1 orthologue WRN helicase showed defective telomere lagging strand synthesis (Crabbe,
Verdun et al. 2004). Importantly, the 21 G4 motifs found within the rDNA repeats are located on
100
either the leading or lagging strand, suggesting that potential G-quadruplex structures formed
within the rDNA could impede replication (Hershman, Chen et al. 2008).
101
Figure 4.5. Putative model for the function of Stm1/G4 DNA in
obstructing leading strand replication. We propose a model in which Stm1 binds to and stabilizes G-quadruplexes that form within rDNA in wild type cells (left) upon opening of the double helix during replication fork progression. The stability of these structures causes fork stalling during replication, which can cause the fork to collapse due to cleavage of the G-quadruplex or an accidental single strand break. Restoration of the fork by homologous recombination can result in an USCE event. In the absence of Stm1 (right), the G4 structures are destabilized, thus allowing smooth replication through the rDNA repeats.
102
Third, Stm1 and its bound G-quadruplex structures may be causing double strand breaks by
blocking an advancing replication fork during DNA replication. This could occur if these
quadruplex structures are forming co-transcriptionally on the G-rich non-template strand while
the C-rich template strand is being transcribed (Figure 4.6). During transcription, the DNA
double helix is opened up to reveal single stranded DNA, just like during DNA replication.
There is now evidence in the literature showing that transcription of genomic regions containing
a C-rich template strand has high occurrences of RNA/DNA hybrids forming while the G-rich
non-template strand has the potential to form G-quadruplex structures (Duquette, Handa et al.
2004). It is not known which forms first, the RNA/DNA hybrid or the G4 DNA, but it is
proposed that the two structures reinforce the presence of each other by preventing the DNA
from resolving back to a double helix. The generation of these structures in front of an advancing
replication fork would cause a fork block, and without being properly resolved, this could lead to
the formation of a double strand break (Figure 4.6). The DSB would then need to be repaired by
homologous recombination, and could increase the incidence of USCE within the rDNA repeats.
Consistent with this model, all of the G4 motifs found within the rDNA repeats are located on
the non-template strand with respect to either transcription of the rRNA encoding genes or the
non-coding RNA transcripts, suggesting the possibility of G-quadruplex structures forming co-
transcriptionally with RNA/DNA hybrids (Hershman, Chen et al. 2008).
The second and third models would imply that Stm1 does not necessarily act through Fob1. This
would mean that Stm1 can regulate rDNA stability at regions other than IGS1. Consistent with
this notion, unlike Fob1 which is only recruited to IGS1 through binding to specific sites, Stm1
likely binds to G-quadruplex structures and G4 motifs that have been mapped to multiple places
across the rDNA repeats (Hershman, Chen et al. 2008). In addition, Stm1 has been previously
shown to localize to rDNA sequences other than IGS1 (Van Dyke, Nelson et al. 2004). This
highly suggests that Stm1 can bind to potential G-quadruplex structures throughout the rDNA
repeats and exert its function at multiple regions other than IGS1 within rDNA.
103
Figure 4.6. Putative model for the function of Stm1/G4 DNA in regulating rDNA stability by cooperating with co-transcriptionally formed RNA/DNA hybrids. We propose a model where transcription within the rDNA repeats could allow for the co-transcriptional formation of G-quadruplex structures on the G-rich non-template strand with RNA/DNA hybrids on the template strand. In wild-type cells (left), Stm1 binds to and stabilizes the G quadruplexes which could in turn stabilize the RNA/DNA hybrids. An advancing replication fork is unable to pass, leading to DNA double strand breaks. The fork will need to be repaired through homologous recombination, which can result in an USCE event. In the absence of Stm1 (right), the G4 structures are easily unwound by helicases, which would allow for a smooth fork progression.
104
Chapter 5 Future Directions
105
5 Future Directions
5.1 The role of Cohibin in telomere localization and silencing
This study presents a new role for the Cohibin complex in silencing telomeres by anchoring them
to the nuclear periphery through INM proteins. Our results suggest that Cohibin may mediate
the interaction between chromosome ends and help cluster telomeres together, but this remains to
be tested. Future experiments will need to be conducted to determine whether the distance
between telomeres is increased in Cohibin deficient cells. To test this, two different telomeres
can be tagged, one with the tetracycline operator/tetracycline repressor and the other with the
lactose operator/lactose repressor systems. Coexpression of CFP and GFP fused to the
tetracycline repressor and the lactose repressor, respectively, will allow visualization of the two
telomeres with respect to each other by live cell imaging. If the distance between the two
telomeres is increased in the absence of Cohibin, this would provide further support that Cohibin
is required for linking telomeres together and for the generation of telomere clusters.
Along with previously described roles at rDNA and centromeres, Cohibin interactions with
perinuclear proteins may be a universal mechanism by which cells link chromatin domains to
each other and to different cellular structures. These findings suggest the need for more studies
to be conducted on the impact of Cohibin on other chromosomal domains across the genome.
As mentioned in the discussion, one future direction would be to further characterize the role of
the Cohibin-containing Monoplin complex in sister chromatid co-segregation. It would be
interesting to examine whether Lrs4 or Csm1 cooperates with INM proteins to mediate
attachment of sister kinetochores to microtubules extending from the same spindle pole. Similar
to their role at telomeres and rDNA, it is conceivable that Lrs4 and Csm1, as part of Monopolin
in meiosis I, may interact with Heh1 proteins to link kinetochores to the spindle pole at the
nuclear periphery. Experiments will need to be conducted to determine whether Monopolin
indeed interacts with Heh1 during meiosis. If Monopolin-Heh1 interactions do indeed exist in
meiosis, then ChIP experiments can be used to test for the association of Heh1 with centromeres
and to determine whether this association is dependent on Monopolin. In addition, simultaneous
imaging of the spindle pole body and centromeres could be employed to test if sister chromatid
segregation is affected in Heh1 mutants.
106
Another possible future direction would be to determine whether Cohibin plays a potential role
in telomere bouquet formation in meiosis I. Given that Cohibin interacts with SIR-bound
telomeres and the telomere bouquet protein Mps3 in mitosis, Cohibin, as a stand-alone complex
or as part of Monopolin, may interact with these same proteins in meiosis to control telomere
clustering and bouquet formation. Experiments will need to be conducted to determine whether
Cohibin interacts with telomeres and the telomere bouquet proteins in meiosis. Should these
interactions exist, further characterization of the molecular network in the formation of the
telomere bouquet can be examined by looking at requirements for Cohibin/Monopolin
interactions with telomeres. Importantly, experiments should look at whether telomere bouquet
formation is disrupted in Cohibin/Monoplin deficient cells, as well as whether rapid prophase
movements are affected as well. In addition, experiments can be conducted to determine whether
disrupting Cohibin affects telomere attachment to the nuclear envelope and spindle pole body
during bouquet formation.
5.2 Function of Stm1/G4 DNA in rDNA maintenance
Our work shows that the depletion of Stm1 results in more stable rDNA repeats as evidenced by
a decrease in unequal sister chromatid exchange. Given that Stm1 is a G-quadruplex binding
protein and that G4 motifs are present within rDNA, it is likely that Stm1 exerts its function at
the rDNA repeats through binding to G4 DNA structures that can potentially form within the
repeats.
As mentioned in the discussion, our study has no direct evidence that Stm1 is indeed acting via
G-quadruplex structures at rDNA. Thus, future work for this project should be directed towards
gaining evidence for the existence of G-quadruplexes at rDNA and determining whether Stm1 is
affecting rDNA stability by binding to these G-quadruplex structures. Support for our model
comes from experiments showing that the disruption of the G4 helicase Sgs1 results in nucleolar
fragmentation and rDNA instability, suggesting the existence of cellular processes that maintain
rDNA stability through factors that regulate G-quadruplex structures (Sinclair, Mills et al. 1997).
Another previous study has also shown that deletion of PIF1 results in increased genome
instability near G4 motifs, although the study did not look specifically at the rDNA repeats
(Paeschke, Capra et al. 2011). It is therefore expected, based on these studies, that deletion of
PIF1 or SGS1 would greatly increase USCE within rDNA since these mutants can no longer
107
unwind G-quadruplex structures that may form. Experiments looking at USCE within the rDNA
repeats in Sgs1 or Pif1 mutants should be conducted to confirm data from previous studies and
provide further support for our model. In addition, ChIP experiments should be conducted to
determine whether Stm1 binding within the rDNA repeats correlates with the position of the G4
motifs. If this is the case, then a follow-up experiment could be to screen for the existence of
Stm1 mutants that cannot bind to G-quadruplex structures. This can be achieved by mutating the
sequences within the G4 binding domain of Stm1. Should these mutants exist, the above rDNA
stability and ChIP experiments can then be conducted with cells disrupted of the Stm1-G4-
binding function. Data from these experiments would give further insight into the mechanisms
of Stm1 and whether Stm1 is indeed acting through G-quadruplexes.
As per the discussion of Chapter 4, three different models were proposed for the role of Stm1 in
regulating rDNA stability. The future directions to test each of the models are discussed below.
Model 1: Stm1 is regulating rDNA repeat stability in a Fob1-dependent manner. To test this,
rDNA stability can be assessed in cells depleted of both proteins. If the two proteins are working
together to regulate rDNA stability, then it is expected that there would be no significant
difference between the rate of unequal sister chromatid exchange in fob1∆ stm1∆ cells compared
to fob1∆ cells alone. If this is the case, then further work can be conducted to determine the
requirements for Stm1 recruitment to the rDNA repeats. ChIP experiments will allow
investigation into whether Fob1 is required for the localization of Stm1 within rDNA. In
addition, even though it was discussed earlier that it is not likely that Stm1 is cooperating with
Cohibin to regulate rDNA maintenance, it is still possible that Cohibin may be required for the
recruitment of Stm1. Although Cohibin localizes primarily to IGS1 regions while Stm1 is likely
located at multiple G4s scattered across the rDNA repeats, Cohibin does cluster IGS1 regions of
rDNA repeats and this could impact Stm1/G4 functions beyond just IGS1. This would be similar
to the ability of Fob1 to recruit its own suppressors RENT and Tof2. Therefore, it would be
interesting to see whether other nucleolar factors, such as Cohibin, RENT, or Tof2, is required
for Stm1 recruitment to rDNA.
Model 2: Stm1 is binding to G-quadruplex structures that form during replication after the
replication fork has moved past. DNA polymerase is stalled at the unresolved quadruplex
structure, leading to a possible fork collapse caused by cleavage of the G-quadruplex or an
108
accidental single strand break. The broken fork is then repaired through homologous
recombination. This model would imply that the replication machinery does not progress
smoothly through the rDNA repeats, leading to the formation of aberrant replication
intermediates. Replication intermediates can be visualized by 2D gel analysis. Is it expected that
there would be an accumulation of aberrant X-shaped intermediates, which was discovered to be
linked to DNA recombination (Bzymek, Thayer et al. 2010). If this is the case, then disruptiong
of the G4 binding protein Stm1 would be expected to decrease the amount of aberrant replication
intermediates. Further work can also be conducted to test whether the recombination machinery
does play a part in facilitating replication through sequences harbouring potential G-
quadruplexes. Depletion of proteins involved in the homologous recombination pathway, such as
Rad52 (radiation sensitive 52), would be expected to abolish recombination events as well as
replication intermediates associated with DNA recombination.
Model 3: Stm1 is binding to G-quadruplex structures that form co-transcriptionally on the G-rich
non-template strand, with the presence of RNA/DNA hybrids forming on the C-rich template
strand. These structures could form blocks in front of an advancing replication fork, leading to
the generation of DNA double-strand breaks that must be repaired by recombinational
machinery. Similar to Model 2, it is expected that this model will also accumulate aberrant
replication intermediates that can be visualized by 2D gel analysis. But more importantly, it
would be crucial to this model to test the existence of RNA/DNA hybrids. This can be done by
conducting ChIP experiments using an antibody specific for RNA/DNA hybrids (Hu, Zhang et
al. 2006), and screening the rDNA repeat sequences to determine whether there is enrichment for
hybrid formation near the G4 motifs. In addition, ChIP experiments can be conducted using an
antibody against phosphorylated H2A, which is a marker for DNA double strand breaks, to see if
there are increased incidences of DSBs near the G4 motifs. It would also be interesting to see
whether overexpression of RNAse H, which specifically cleaves RNA/DNA hybrids, would be
able to alleviate the potential rDNA stability defects exhibited in cells deficient in G4 helicases
(Wahba, Amon et al. 2011).
109
References
Adelfalk, C., J. Janschek, et al. (2009). "Cohesin SMC1beta protects telomeres in meiocytes." J Cell Biol 187(2): 185-199.
Andrulis, E. D., D. C. Zappulla, et al. (2002). "Esc1, a nuclear periphery protein required for Sir4-based plasmid anchoring and partitioning." Mol Cell Biol 22(23): 8292-8301.
Aparicio, O. M., B. L. Billington, et al. (1991). "Modifiers of position effect are shared between telomeric and silent mating-type loci in S. cerevisiae." Cell 66(6): 1279-1287.
Armache, K. J., J. D. Garlick, et al. (2011). "Structural basis of silencing: Sir3 BAH domain in complex with a nucleosome at 3.0 A resolution." Science 334(6058): 977-982.
Balagopal, V. and R. Parker (2011). "Stm1 modulates translation after 80S formation in Saccharomyces cerevisiae." RNA 17(5): 835-842.
Blackburn, E. H. (1991). "Structure and function of telomeres." Nature 350(6319): 569-573.
Blackburn, E. H. and J. G. Gall (1978). "A tandemly repeated sequence at the termini of the extrachromosomal ribosomal RNA genes in Tetrahymena." J Mol Biol 120(1): 33-53.
Blasco, M. A. (2007). "The epigenetic regulation of mammalian telomeres." Nat Rev Genet 8(4): 299-309.
Bochman, M. L., N. Sabouri, et al. (2010). "Unwinding the functions of the Pif1 family helicases." DNA Repair (Amst) 9(3): 237-249.
Boulton, S. J. and S. P. Jackson (1998). "Components of the Ku-dependent non-homologous end-joining pathway are involved in telomeric length maintenance and telomeric silencing." EMBO J 17(6): 1819-1828.
Brennan, M. B. and K. Struhl (1980). "Mechanisms of increasing expression of a yeast gene in Escherichia coli." J Mol Biol 136(3): 333-338.
Buchberger, J. R., M. Onishi, et al. (2008). "Sir3-nucleosome interactions in spreading of silent chromatin in Saccharomyces cerevisiae." Mol Cell Biol 28(22): 6903-6918.
Buck, S. W. and D. Shore (1995). "Action of a RAP1 carboxy-terminal silencing domain reveals an underlying competition between HMR and telomeres in yeast." Genes Dev 9(3): 370-384.
Bupp, J. M., A. E. Martin, et al. (2007). "Telomere anchoring at the nuclear periphery requires the budding yeast Sad1-UNC-84 domain protein Mps3." J Cell Biol 179(5): 845-854.
Bzymek, M., N. H. Thayer, et al. (2010). "Double Holliday junctions are intermediates of DNA break repair." Nature 464(7290): 937-941.
110
Capra, J. A., K. Paeschke, et al. (2010). "G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae." PLoS Comput Biol 6(7): e1000861.
Chan, J. N., B. P. Poon, et al. (2011). "Perinuclear cohibin complexes maintain replicative life span via roles at distinct silent chromatin domains." Dev Cell 20(6): 867-879.
Chikashige, Y., C. Tsutsumi, et al. (2006). "Meiotic proteins bqt1 and bqt2 tether telomeres to form the bouquet arrangement of chromosomes." Cell 125(1): 59-69.
Cohen, H. and D. A. Sinclair (2001). "Recombination-mediated lengthening of terminal telomeric repeats requires the Sgs1 DNA helicase." Proc Natl Acad Sci U S A 98(6): 3174-3179.
Conrad, M. N., C. Y. Lee, et al. (2008). "Rapid telomere movement in meiotic prophase is promoted by NDJ1, MPS3, and CSM4 and is modulated by recombination." Cell 133(7): 1175-1187.
Conrad, M. N., C. Y. Lee, et al. (2007). "MPS3 mediates meiotic bouquet formation in Saccharomyces cerevisiae." Proc Natl Acad Sci U S A 104(21): 8863-8868.
Corbett, K. D., C. K. Yip, et al. (2010). "The monopolin complex crosslinks kinetochore components to regulate chromosome-microtubule attachments." Cell 142(4): 556-567.
Crabbe, L., R. E. Verdun, et al. (2004). "Defective telomere lagging strand synthesis in cells lacking WRN helicase activity." Science 306(5703): 1951-1953.
Craven, R. J. and T. D. Petes (1999). "Dependence of the regulation of telomere length on the type of subtelomeric repeat in the yeast Saccharomyces cerevisiae." Genetics 152(4): 1531-1541.
Dai, Y. and D. V. Faller (2008). "Transcription Regulation by Class III Histone Deacetylases (HDACs)-Sirtuins." Transl Oncogenomics 3: 53-65.
Dechat, T., S. A. Adam, et al. (2010). "Nuclear lamins." Cold Spring Harb Perspect Biol 2(11): a000547.
Dheur, S., S. J. Saupe, et al. (2011). "Role for cohesin in the formation of a heterochromatic domain at fission yeast subtelomeres." Mol Cell Biol 31(5): 1088-1097.
Duquette, M. L., P. Handa, et al. (2004). "Intracellular transcription of G-rich DNAs induces formation of G-loops, novel structures containing G4 DNA." Genes Dev 18(13): 1618-1629.
Felsenfeld, G. and M. Groudine (2003). "Controlling the double helix." Nature 421(6921): 448-453.
Frantz, J. D. and W. Gilbert (1995). "A yeast gene product, G4p2, with a specific affinity for quadruplex nucleic acids." J Biol Chem 270(16): 9413-9419.
111
Freeman, L., L. Aragon-Alcaide, et al. (2000). "The condensin complex governs chromosome condensation and mitotic transmission of rDNA." J Cell Biol 149(4): 811-824.
Fry, M. and L. A. Loeb (1999). "Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n." J Biol Chem 274(18): 12797-12802.
Gartenberg, M. R., F. R. Neumann, et al. (2004). "Sir-mediated repression can occur independently of chromosomal and subnuclear contexts." Cell 119(7): 955-967.
Gellert, M., M. N. Lipsett, et al. (1962). "Helix formation by guanylic acid." Proc Natl Acad Sci U S A 48: 2013-2018.
Gonzalez-Suarez, I., A. B. Redwood, et al. (2009). "Novel roles for A-type lamins in telomere biology and the DNA damage response pathway." EMBO J 28(16): 2414-2427.
Gottschling, D. E., O. M. Aparicio, et al. (1990). "Position effect at S. cerevisiae telomeres: reversible repression of Pol II transcription." Cell 63(4): 751-762.
Grandin, N., C. Damon, et al. (2001). "Ten1 functions in telomere end protection and length regulation in association with Stn1 and Cdc13." EMBO J 20(5): 1173-1183.
Gregan, J., C. G. Riedel, et al. (2007). "The kinetochore proteins Pcs1 and Mde4 and heterochromatin are required to prevent merotelic orientation." Curr Biol 17(14): 1190-1200.
Grund, S. E., T. Fischer, et al. (2008). "The inner nuclear membrane protein Src1 associates with subtelomeric genes and alters their regulated gene expression." J Cell Biol 182(5): 897-910.
Guillou, E., A. Ibarra, et al. (2010). "Cohesin organizes chromatin loops at DNA replication factories." Genes Dev 24(24): 2812-2822.
Hadjur, S., L. M. Williams, et al. (2009). "Cohesins form chromosomal cis-interactions at the developmentally regulated IFNG locus." Nature 460(7253): 410-413.
Haeusler, R. A., M. Pratt-Hyatt, et al. (2008). "Clustering of yeast tRNA genes is mediated by specific association of condensin with tRNA gene transcription complexes." Genes Dev 22(16): 2204-2214.
Haigis, M. C. and D. A. Sinclair (2010). "Mammalian sirtuins: biological insights and disease relevance." Annu Rev Pathol 5: 253-295.
Hediger, F., F. R. Neumann, et al. (2002). "Live imaging of telomeres: yKu and Sir proteins define redundant telomere-anchoring pathways in yeast." Curr Biol 12(24): 2076-2089.
Hershman, S. G., Q. Chen, et al. (2008). "Genomic distribution and functional analyses of potential G-quadruplex-forming sequences in Saccharomyces cerevisiae." Nucleic Acids Res 36(1): 144-156.
112
Hoppe, G. J., J. C. Tanny, et al. (2002). "Steps in assembly of silent chromatin in yeast: Sir3-independent binding of a Sir2/Sir4 complex to silencers and role for Sir2-dependent deacetylation." Mol Cell Biol 22(12): 4167-4180.
Hou, C., R. Dale, et al. (2010). "Cell type specificity of chromatin organization mediated by CTCF and cohesin." Proc Natl Acad Sci U S A 107(8): 3651-3656.
Houseley, J., K. Kotovic, et al. (2007). "Trf4 targets ncRNAs from telomeric and rDNA spacer regions and functions in rDNA copy number control." EMBO J 26(24): 4996-5006.
Hu, Z., A. Zhang, et al. (2006). "An antibody-based microarray assay for small RNA detection." Nucleic Acids Res 34(7): e52.
Huang, J., I. L. Brito, et al. (2006). "Inhibition of homologous recombination by a cohesin-associated clamp complex recruited to the rDNA recombination enhancer." Genes Dev 20(20): 2887-2901.
Huang, J. and D. Moazed (2003). "Association of the RENT complex with nontranscribed and coding regions of rDNA and a regional requirement for the replication fork block protein Fob1 in rDNA silencing." Genes Dev 17(17): 2162-2176.
Huang, P., F. E. Pryde, et al. (2001). "SGS1 is required for telomere elongation in the absence of telomerase." Curr Biol 11(2): 125-129.
Hudson, D. F., K. M. Marshall, et al. (2009). "Condensin: Architect of mitotic chromosomes." Chromosome Res 17(2): 131-144.
Huppert, J. L. and S. Balasubramanian (2005). "Prevalence of quadruplexes in the human genome." Nucleic Acids Res 33(9): 2908-2916.
Imai, S., C. M. Armstrong, et al. (2000). "Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase." Nature 403(6771): 795-800.
Joglekar, A. P., D. C. Bouck, et al. (2006). "Molecular architecture of a kinetochore-microtubule attachment site." Nat Cell Biol 8(6): 581-585.
Johnson, F. B., R. A. Marciniak, et al. (2001). "The Saccharomyces cerevisiae WRN homolog Sgs1p participates in telomere maintenance in cells lacking telomerase." EMBO J 20(4): 905-913.
Johzuka, K. and T. Horiuchi (2002). "Replication fork block protein, Fob1, acts as an rDNA region specific recombinator in S. cerevisiae." Genes Cells 7(2): 99-113.
Johzuka, K. and T. Horiuchi (2009). "The cis element and factors required for condensin recruitment to chromosomes." Mol Cell 34(1): 26-35.
Kagey, M. H., J. J. Newman, et al. (2010). "Mediator and cohesin connect gene expression and chromatin architecture." Nature 467(7314): 430-435.
113
Katayama, T., N. Inoue, et al. (2007). "Location of the triplex DNA-binding domain of Saccharomyces cerevisiae Stm1 protein." Nucleic Acids Symp Ser (Oxf)(51): 123-124.
Kim Sh, S. H., P. Kaminker, et al. (2002). "Telomeres, aging and cancer: in search of a happy ending." Oncogene 21(4): 503-511.
Kobayashi, T. and A. R. Ganley (2005). "Recombination regulation by transcription-induced cohesin dissociation in rDNA repeats." Science 309(5740): 1581-1584.
Kobayashi, T. and T. Horiuchi (1996). "A yeast gene product, Fob1 protein, required for both replication fork blocking and recombinational hotspot activities." Genes Cells 1(5): 465-474.
Kornberg, R. D. (1974). "Chromatin structure: a repeating unit of histones and DNA." Science 184(4139): 868-871.
Landry, J., A. Sutton, et al. (2000). "The silencing protein SIR2 and its homologs are NAD-dependent protein deacetylases." Proc Natl Acad Sci U S A 97(11): 5807-5811.
Lane, A. N., J. B. Chaires, et al. (2008). "Stability and kinetics of G-quadruplex structures." Nucleic Acids Res 36(17): 5482-5515.
Laroche, T., S. G. Martin, et al. (1998). "Mutation of yeast Ku genes disrupts the subnuclear organization of telomeres." Curr Biol 8(11): 653-656.
Lieberman-Aiden, E., N. L. van Berkum, et al. (2009). "Comprehensive mapping of long-range interactions reveals folding principles of the human genome." Science 326(5950): 289-293.
Ligr, M., I. Velten, et al. (2001). "The proteasomal substrate Stm1 participates in apoptosis-like cell death in yeast." Mol Biol Cell 12(8): 2422-2432.
Longtine, M. S., N. M. Wilson, et al. (1989). "A yeast telomere binding activity binds to two related telomere sequence motifs and is indistinguishable from RAP1." Curr Genet 16(4): 225-239.
Lopes, J., A. Piazza, et al. (2011). "G-quadruplex-induced instability during leading-strand replication." EMBO J 30(19): 4033-4046.
Luo, K., M. A. Vega-Palas, et al. (2002). "Rap1-Sir4 binding independent of other Sir, yKu, or histone interactions initiates the assembly of telomeric heterochromatin in yeast." Genes Dev 16(12): 1528-1539.
Maillet, L., C. Boscheron, et al. (1996). "Evidence for silencing compartments within the yeast nucleus: a role for telomere proximity and Sir protein concentration in silencer-mediated repression." Genes Dev 10(14): 1796-1811.
Maizels, N. (2006). "Dynamic roles for G4 DNA in the biology of eukaryotic cells." Nat Struct Mol Biol 13(12): 1055-1059.
114
Marston, A. L., W. H. Tham, et al. (2004). "A genome-wide screen identifies genes required for centromeric cohesion." Science 303(5662): 1367-1370.
McGee, M. D., R. Rillo, et al. (2006). "UNC-83 IS a KASH protein required for nuclear migration and is recruited to the outer nuclear membrane by a physical interaction with the SUN protein UNC-84." Mol Biol Cell 17(4): 1790-1801.
Mekhail, K. and D. Moazed (2010). "The nuclear envelope in genome organization, expression and stability." Nat Rev Mol Cell Biol 11(5): 317-328.
Mekhail, K., J. Seebacher, et al. (2008). "Role for perinuclear chromosome tethering in maintenance of genome stability." Nature 456(7222): 667-670.
Mishiro, T., K. Ishihara, et al. (2009). "Architectural roles of multiple chromatin insulators at the human apolipoprotein gene cluster." EMBO J 28(9): 1234-1245.
Moazed, D. (2001). "Common themes in mechanisms of gene silencing." Mol Cell 8(3): 489-498.
Moazed, D. (2001). "Enzymatic activities of Sir2 and chromatin silencing." Curr Opin Cell Biol 13(2): 232-238.
Moazed, D. and D. Johnson (1996). "A deubiquitinating enzyme interacts with SIR4 and regulates silencing in S. cerevisiae." Cell 86(4): 667-677.
Moggs, J. G., P. Grandi, et al. (2000). "A CAF-1-PCNA-mediated chromatin assembly pathway triggered by sensing DNA damage." Mol Cell Biol 20(4): 1206-1218.
Moretti, P., K. Freeman, et al. (1994). "Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP1." Genes Dev 8(19): 2257-2269.
Nakai, K. and P. Horton (1999). "PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization." Trends Biochem Sci 24(1): 34-36.
Nasmyth, K. and C. H. Haering (2009). "Cohesin: its roles and mechanisms." Annu Rev Genet 43: 525-558.
Nativio, R., K. S. Wendt, et al. (2009). "Cohesin is required for higher-order chromatin conformation at the imprinted IGF2-H19 locus." PLoS Genet 5(11): e1000739.
Nishikawa, S., Y. Terazawa, et al. (2003). "Nep98p is a component of the yeast spindle pole body and essential for nuclear division and fusion." J Biol Chem 278(11): 9938-9943.
Niwa, O., M. Shimanuki, et al. (2000). "Telomere-led bouquet formation facilitates homologous chromosome pairing and restricts ectopic interaction in fission yeast meiosis." EMBO J 19(14): 3831-3840.
Onishi, M., G. G. Liou, et al. (2007). "Role of the conserved Sir3-BAH domain in nucleosome binding and silent chromatin assembly." Mol Cell 28(6): 1015-1028.
115
Ottaviani, A., C. Schluth-Bolard, et al. (2009). "Identification of a perinuclear positioning element in human subtelomeres that requires A-type lamins and CTCF." EMBO J 28(16): 2428-2436.
Paeschke, K., J. A. Capra, et al. (2011). "DNA replication through G-quadruplex motifs is promoted by the Saccharomyces cerevisiae Pif1 DNA helicase." Cell 145(5): 678-691.
Paeschke, K., T. Simonsson, et al. (2005). "Telomere end-binding proteins control the formation of G-quadruplex DNA structures in vivo." Nat Struct Mol Biol 12(10): 847-854.
Palladino, F., T. Laroche, et al. (1993). "SIR3 and SIR4 proteins are required for the positioning and integrity of yeast telomeres." Cell 75(3): 543-555.
Poon, B. P. and K. Mekhail (2011). "Cohesin and related coiled-coil domain-containing complexes physically and functionally connect the dots across the genome." Cell Cycle 10(16): 2669-2682.
Rabitsch, K. P., M. Petronczki, et al. (2003). "Kinetochore recruitment of two nucleolar proteins is required for homolog segregation in meiosis I." Dev Cell 4(4): 535-548.
Renauld, H., O. M. Aparicio, et al. (1993). "Silent domains are assembled continuously from the telomere and are defined by promoter distance and strength, and by SIR3 dosage." Genes Dev 7(7A): 1133-1145.
Ribeyre, C., J. Lopes, et al. (2009). "The yeast Pif1 helicase prevents genomic instability caused by G-quadruplex-forming CEB1 sequences in vivo." PLoS Genet 5(5): e1000475.
Rossmann, M. P., W. Luo, et al. (2011). "A common telomeric gene silencing assay is affected by nucleotide metabolism." Mol Cell 42(1): 127-136.
Ruault, M., A. De Meyer, et al. (2011). "Clustering heterochromatin: Sir3 promotes telomere clustering independently of silencing in yeast." J Cell Biol 192(3): 417-431.
Sanders, C. M. (2010). "Human Pif1 helicase is a G-quadruplex DNA-binding protein with G-quadruplex DNA-unwinding activity." Biochem J 430(1): 119-128.
Schaffitzel, C., I. Berger, et al. (2001). "In vitro generated antibodies specific for telomeric guanine-quadruplex DNA react with Stylonychia lemnae macronuclei." Proc Natl Acad Sci U S A 98(15): 8572-8577.
Schmitt, J., R. Benavente, et al. (2007). "Transmembrane protein Sun2 is involved in tethering mammalian meiotic telomeres to the nuclear envelope." Proc Natl Acad Sci U S A 104(18): 7426-7431.
Schneider, R. and R. Grosschedl (2007). "Dynamics and interplay of nuclear architecture, genome organization, and gene expression." Genes Dev 21(23): 3027-3043.
Schober, H., H. Ferreira, et al. (2009). "Yeast telomerase and the SUN domain protein Mps3 anchor telomeres and repress subtelomeric recombination." Genes Dev 23(8): 928-938.
116
Sharma, S. (2011). "Non-B DNA Secondary Structures and Their Resolution by RecQ Helicases." J Nucleic Acids 2011: 724215.
Sinclair, D. A. and L. Guarente (1997). "Extrachromosomal rDNA circles--a cause of aging in yeast." Cell 91(7): 1033-1042.
Sinclair, D. A., K. Mills, et al. (1997). "Accelerated aging and nucleolar fragmentation in yeast sgs1 mutants." Science 277(5330): 1313-1316.
Smith, J. S., Q. Chen, et al. (2011). "Rudimentary G-quadruplex-based telomere capping in Saccharomyces cerevisiae." Nat Struct Mol Biol 18(4): 478-485.
Sosa, B. A., A. Rothballer, et al. (2012). "LINC Complexes Form by Binding of Three KASH Peptides to Domain Interfaces of Trimeric SUN Proteins." Cell 149(5): 1035-1047.
Starr, D. A. and M. Han (2002). "Role of ANC-1 in tethering nuclei to the actin cytoskeleton." Science 298(5592): 406-409.
Suka, N., K. Luo, et al. (2002). "Sir2p and Sas2p opposingly regulate acetylation of yeast histone H4 lysine16 and spreading of heterochromatin." Nat Genet 32(3): 378-383.
Sun, H., R. J. Bennett, et al. (1999). "The Saccharomyces cerevisiae Sgs1 helicase efficiently unwinds G-G paired DNAs." Nucleic Acids Res 27(9): 1978-1984.
Sun, H., J. K. Karow, et al. (1998). "The Bloom's syndrome helicase unwinds G4 DNA." J Biol Chem 273(42): 27587-27592.
Szostak, J. W. and E. H. Blackburn (1982). "Cloning yeast telomeres on linear plasmid vectors." Cell 29(1): 245-255.
Taddei, A., F. Hediger, et al. (2004). "Separation of silencing from perinuclear anchoring functions in yeast Ku80, Sir4 and Esc1 proteins." EMBO J 23(6): 1301-1312.
Tanaka, K., H. L. Chang, et al. (2009). "CENP-C functions as a scaffold for effectors with essential kinetochore functions in mitosis and meiosis." Dev Cell 17(3): 334-343.
Tanny, J. C., D. S. Kirkpatrick, et al. (2004). "Budding yeast silencing complexes and regulation of Sir2 activity by protein-protein interactions." Mol Cell Biol 24(16): 6931-6946.
Torres-Rosell, J., I. Sunjevaric, et al. (2007). "The Smc5-Smc6 complex and SUMO modification of Rad52 regulates recombinational repair at the ribosomal gene locus." Nat Cell Biol 9(8): 923-931.
Trelles-Sticken, E., M. E. Dresser, et al. (2000). "Meiotic telomere protein Ndj1p is required for meiosis-specific telomere distribution, bouquet formation and efficient homologue pairing." J Cell Biol 151(1): 95-106.
Tzur, Y. B., K. L. Wilson, et al. (2006). "SUN-domain proteins: 'Velcro' that links the nucleoskeleton to the cytoskeleton." Nat Rev Mol Cell Biol 7(10): 782-788.
117
Utsugi, T., A. Toh-e, et al. (1995). "A high dose of the STM1 gene suppresses the temperature sensitivity of the tom1 and htr1 mutants in Saccharomyces cerevisiae." Biochim Biophys Acta 1263(3): 285-288.
Valenzuela, L., N. Dhillon, et al. (2008). "Long-range communication between the silencers of HMR." Mol Cell Biol 28(6): 1924-1935.
Van Dyke, M. W., L. D. Nelson, et al. (2004). "Stm1p, a G4 quadruplex and purine motif triplex nucleic acid-binding protein, interacts with ribosomes and subtelomeric Y' DNA in Saccharomyces cerevisiae." J Biol Chem 279(23): 24323-24333.
Van Dyke, N., B. F. Pickering, et al. (2009). "Stm1p alters the ribosome association of eukaryotic elongation factor 3 and affects translation elongation." Nucleic Acids Res 37(18): 6116-6125.
Wahba, L., J. D. Amon, et al. (2011). "RNase H and multiple RNA biogenesis factors cooperate to prevent RNA:DNA hybrids from generating genome instability." Mol Cell 44(6): 978-988.
Warner, J. R. (1990). "The nucleolus and ribosome formation." Curr Opin Cell Biol 2(3): 521-527.
Watson, J. D. and F. H. Crick (1953). "Molecular structure of nucleic acids; a structure for deoxyribose nucleic acid." Nature 171(4356): 737-738.
Wei, R. R., P. K. Sorger, et al. (2005). "Molecular organization of the Ndc80 complex, an essential kinetochore component." Proc Natl Acad Sci U S A 102(15): 5363-5367.
Wong, J., Y. Nakajima, et al. (2007). "A protein interaction map of the mitotic spindle." Mol Biol Cell 18(10): 3800-3809.
Xu, F., Q. Zhang, et al. (2007). "Sir2 deacetylates histone H3 lysine 56 to regulate telomeric heterochromatin structure in yeast." Mol Cell 27(6): 890-900.
Yankiwski, V., R. A. Marciniak, et al. (2000). "Nuclear structure in normal and Bloom syndrome cells." Proc Natl Acad Sci U S A 97(10): 5214-5219.
Zhao, J., A. Bacolla, et al. (2010). "Non-B DNA structure-induced genetic instability and evolution." Cell Mol Life Sci 67(1): 43-62.
