Embed Size (px)
Citation preview
Research Collection
Doctoral Thesis
Approach to the gene controlling the porcine receptor forEscherichia coli with fimbriae F4ab/F4ac and inheritance of thereceptor for F4ad
Author(s): Rampoldi, Antonio
Publication Date: 2013
Permanent Link: https://doi.org/10.3929/ethz-a-009907149
Rights / License: In Copyright - Non-Commercial Use Permitted
This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.
ETH Library
- 1 -
DISS. ETH No. 21052
Approach to the gene controlling the porcine receptor for Escherichia coli with
fimbriae F4ab/F4ac and inheritance of the receptor for F4ad
A dissertation submitted to
ETH ZURICH
for the degree of
Doctor of Sciences
presented by
Antonio Rampoldi
Master’s Degree in Veterinary Biotechnology, University of Milan
Born March 26, 1983
Citizen of Italy
accepted on the recommendation of
Prof. Dr. P. Vögeli, examiner
Prof. Dr. M. Kreuzer, co-examiner
PD Dr. S. Neuenschwander, co-examiner
Prof. Dr. H.U. Bertschinger, co-examiner
2013
- 2 -
"I like pigs. Dogs look up to us. Cats look down on us.
Pigs treat us as equals."
Sir Winston Churchill, UK Prime Minster (1874-1965)
- 3 -
ACKNOWLEDGEMENTS
I would like to thank Prof. Dr. Peter Vögeli, former head of our group at the Institut für
Agrarwissenschaften (IAS) ETH Zurich, for giving me the opportunity to perform my doctorate in his
group and for supervising my work.
Sincere thanks go to PD Dr. Stefan Neuenschwander for his advice, supervision, solving
problems in the lab, and helping revise the publication.
I am very grateful to Prof. Dr. Hans Ulrich Bertschinger for his huge amount of work in
phenotyping of the intestinal samples and reviewing my thesis.
I thank Dr. Esther Bürgi and her staff from the Faculty of Veterinary Medicine, Vetsuisse
Faculty, University of Zurich, for taking care of the pigs, managing the piggery, and organizing the
slaughtering.
I thank also Andreas Hofer, Henning Luther and all the people from SUISAG for their interest in
financing our project on ETEC F4 susceptibility in pigs, and for providing the animals for our research.
A sincere thank you to Prof. Dr. Gaudenz Dolf of the Institute of Genetics, University of Bern
for the support in statistics on F4ad adhesion.
I would like to thank also Dr. Claus B. Jørgensen, Mette J. Jacobsen, and their group at the
University of Copenhagen for their collaboration in the E. coli F4 project, for sharing the results and data
of their research on pig susceptibility to ETEC F4 with our group.
I am also grateful for the help I received from the people working at the Genetic Diversity Centre
(GDC), ETH Zurich, and the Functional Genomics Center Zurich (FGCZ), a joint state-of-the-art facility
of the ETH Zurich and the University of Zurich.
I want to thank all the people who are or were part of our group:
• Gerda Bärtschi and Elisabeth Wenk for taking care of the house,
• Anna Bratus, Benita Pineroli, Bruno Dietrich and Monika Haubitz for their support and
interesting conversations,
• David Joller for the technical and personal assistance,
• Dr. Michael Goe for his English correction,
• Dr Markus Schneeberger,
- 4 -
• Dr Johannes Kaiser,
• Dr Claude Schelling and Dr Aldona Pienkowska-Schelling,
• The student apprentices, especially Martin Stüssi, to whom I wish good luck on his future career.
I want also to thank my family, especially my parents and brother, and also my friends, both the
ones in Italy and the new ones I made in Zurich, for always encouraging me to keep going forward.
This project was financed by the Swiss National Science Foundation (no. 3100A0-120255/1), the
ETH Zurich and the SUISAG.
- 5 -
CONTENTS
ACKNOWLEDGEMENTS 3
SUMMARY 8
SOMMARIO 10
1. INTRODUCTION 12
1.1 Diarrhoea 12
1.2 Escherichia coli 12
1.3 ETEC 14
1.3.1 Enterotoxins 14
1.3.2 Fimbriae 15
1.3.2.1 Fimbriae F4 15
1.3.2.2 Prevalence of ETEC F4 16
1.4 Determination of F4 receptor phenotypes 16
1.4.1 Alternative methods 17
1.5 ETEC F4 RECEPTORS 18
1.5.1 ETEC F4 receptor phenotypes in pigs 18
1.5.2 ETEC F4ab and ETEC F4ac receptor 18
1.5.3 ETEC F4ad receptors 19
1.5.4 ETEC F4ac susceptibility among breeds 19
1.6 Methods for preventing F4 diarrhoea 20
1.6.1 Antibiotics 20
1.6.2 Homeopathy 20
1.6.3 Immune protection by colostrum and milk 21
1.6.4 Vaccine 22
1.7 Genetic mapping of F4bcR 23
1.8 Candidate genes for F4bcR 24
1.8.1 Positional candidate gene 25
1.8.1.1 SLC12A8 25
1.8.2 Positional and functional candidate genes 25
1.8.2.1 HEG1 25
1.8.2.2 MUC13 26
1.8.2.3 ITGB5 26
1.9 Objectives 27
2. MATERIALS AND METHODS 28
2.1 Pigs 28
2.2 Determination of the ETEC F4 receptor phenotype 29
2.2.1 Preparation of ETEC F4 strains 29
- 6 -
2.2.2 Sampling of intestinal tissues 29
2.2.3 Preparation of enterocytes 30
2.2.4 Microscopic adhesion test 30
2.2.5 Positive and negative control of bacterial adhesion 31
2.3 DNA methods 32
2.3.1 DNA extraction from blood 32
2.3.2 Polymerase chain reaction 33
2.3.2.1 Primer design 33
2.3.2.2 Standard PCR 33
2.3.2.3 Long-range PCR 37
2.3.2.4 PCR for pyrosequencing 39
2.3.3 Agarose gel electrophoresis 40
2.3.4 Genescan analysis 40
2.3.5 Pyrosequencing 41
2.3.6 SNP chip 42
2.3.7 PCR restriction 43
2.3.8 High throughput sequencing 45
2.3.8.1 Illumina HiSeq 2000 45
2.3.8.2 PacBio RS 46
2.3.9 PCR purification 47
2.4 RNA methods 48
2.4.1 RNA extraction 48
2.4.2 RNA quantification 48
2.4.3 Reverse Transcription PCR 49
2.4.4 PCR and sequencing 50
2.4.5 High throughput sequencing 50
2.5 Computational methods 51
2.5.1 Linkage analysis 51
2.5.2 Statistics of F4ad adhesion 51
2.5.3 In silico mapping 52
3. RESULTS 53
3.1 Exclusion of gene MUC4 as locus for F4bcR 53
3.2 Exclusion of interval ZDHHC19-LMLN as locus for F4bcR 56
3.3 SNPs chip results 59
3.4 Exclusion of interval LMLN-ZNF148 as locus for F4bcR 61
3.5 Exclusion of interval SLC12A8-KVL1293 as locus for F4bcR 63
3.6 Partial exclusion of MUC13 as locus for F4bcR 65
3.7 Sequencing and mRNA expression of candidate genes 67
3.7.1 SLC12A8 68
- 7 -
3.7.2 HEG1 68
3.7.3 MUC13 69
3.7.4 ITGB5 70
3.8 Sequencing of intergenic regions 70
3.8.1 Interval of HEG1-MUC13 70
3.8.1 Interval of MUC13-ITGB5 71
3.9 Validation of alternative markers for ETEC F4ab/F4ac susceptibility 73
3.10 F4ad susceptibility 75
3.10.1 Two receptors for E. coli F4ad 75
3.10.2 Inheritance of phenotype 77
3.10.3 Statistical pedigree analysis 79
4. DISCUSSION 83
4.1 F4bcR mapping on SSC13 83
4.2 Exclusion of genes SLC12A8 and HEG1 83
4.3 Exclusion of genes ITGB5 84
4.3 MUC13 84
4.5 F4adR inheritance 85
4.6 Conclusions and perspectives 86
REFERENCES 87
ABBREVIATIONS 102
List of figures 103
List of tables 104
Appendix 105
Media and solutions 105
Chemicals 106
Restriction enzymes 107
Labware 107
SNPs nomenclature 109
CURRICULUM VITAE 111
- 8 -
SUMMARY
The ability to colonise the intestine is a common feature of both pathogenic and non-pathogenic
bacteria. Enterotoxigenic E. coli (ETEC) is the major cause of diarrhoea and death among piglets. The
bacteria adhere to specific receptors on the brush borders of enterocytes by adhesive fimbriae, and they
subsequently produce toxins that stimulate diarrhoea. There are no more than five fimbrial types
described worldwide in vivo, among which F4 is the most prevalent in the world. The F4 fimbrial type
has three antigenic variants—F4ab, F4ac and F4ad—that vary in their receptor specificities.
In pigs, resistant or susceptible phenotypes for fimbriae F4ac are inherited as monogenetic traits,
the susceptible allele being dominant over the resistant one. The receptor for F4ac binds F4ab as well.
Genome scans with microsatellites have localised the ETEC F4ab/F4ac receptor gene (F4bcR) to a region
of pig chromosome 13 (SSC13), SSC13q41-q44. Mucin 4 (MUC4) and mucin 13 (MUC13) genes have
been mapped in SSC13q41-q44, and they co-segregate mostly with the F4bcR alleles. SNPs derived from
these two genes are being used in breeding programs to reduce the frequency of the susceptible allele for
ETEC F4ab/F4ac in the pig population.
In this study, selected pigs from the Swiss Performing Station (SPS) in Sempach and from the
university experimental herd (UEH) at the University of Zurich were found to be recombinant in the
MUC4-F4bcR or F4bcR-MUC13 intervals.
A three-generation study was performed on 32 selected pigs from UEH, recombinant in the
MUC4-F4bcR interval, with the use of the Porcine SNP60 DNA BeadChip. DNA of a pig recombinant in
the F4bcR-MUC13 interval was sequenced with high throughput techniques, using HiSeq 2000 and
PacBio RS platforms.
RNA samples of pigs resistant and susceptible to ETEC F4ab/F4ac were sequenced with a
SOLiD platform. Analyses were performed to investigate the expression and possible mRNA variation of
candidate genes’ HEG homolog 1 (HEG1), solute carrier family 12 member 8 (SLC12A8), MUC13, and
integrin β-5 (ITGB5) in the region SSC13q41-q44 in the small intestine.
Markers were tested in both susceptible and resistant pigs, looking for a linkage disequilibrium
(LD) with F4bcR. GeneScan analyses were performed on microsatellites. PCR-RFLP and pyrosequencing
were performed on SNPs with possible LD with F4bcR.
- 9 -
The data obtained in this study have led to a further narrowing down of the locus of F4bcR to
exon 2 of MUC13 and to the discovery of several markers with high LD with F4bcR, to be used in
breeding programs: ALGA0072075, KVL1293, ALGA0106330, MUC13-226, and MUC13-813.
The inheritance of the receptor or receptors for F4ad instead is not well understood. Aside from
the fully resistant and susceptible adhesion phenotypes, such as the ones seen in F4ac and F4ab, some of
the UEH pigs showed a third phenotype in the adhesion tests, in which only some of the enterocytes
examined were without bacteria. In this weak susceptible phenotype, the enterocytes seem to become
more susceptible to F4ad the closer they get to the ileocaecal valve.
Analyses revealed that there is more than one receptor for ETEC F4ad fimbriae on the surface of
the enterocytes—a strong receptor, responsible for full adhesion phenotype (E1), and a weak receptor,
responsible for the low adhesion phenotype (E2).
Adhesion tests were performed on 489 pigs from UEH to determine the receptor phenotype for
ETEC F4ad. Statistical analyses were performed with Pedigree Analysis Package v. 4.0 software to
evaluate possible models of inheritance for ETEC F4ad receptor.
Results indicate that the E1 phenotype might be encoded by two complementary or epistatic
genes, while the E2 phenotype is inherited as a dominant monogenetic trait.
- 10 -
SOMMARIO
L’abilità di colonizzare l’intestino è una caratteristica comune di batteri patogeni e non-patogeni.
Enterotoxigenic E. coli (ETEC) è la maggior causa di diarrea e morte fra i lattonzoli. I batteri
aderiscono a specifici recettori sull’orletto a spazzola degli enterociti tramite fimbrie adesive, e
successivamente producono tossine che stimolano la diarrea. Esitono non più di cinque tipi di fimbrie nel
mondo, tra cui F4 è la più prevalente. La fimbria F4 possiede tre varianti antigeniche—F4ab, F4ac e
F4ad—che differiscono nella loro specificità verso i recettori.
Nei maiali, i fenotipi di resistenza o suscettibilità alle fimbrie F4ac sono ereditati come un
carattere monogenetico, l’allele per la suscettibilità è dominante verso quello per la resistenza. Il recettore
per le fimbrie F4ac lega anche le F4ab. Genome scan di microsatelliti hanno localizzato il gene recettore
per ETEC F4ab/F4ac (F4bcR) in una regione del cromosoma 13 del maiale (SSC13), SSC13q41-q44. I
geni mucin 4 (MUC4) e mucin 13 (MUC13) sono stati mappati in SSC13q41-q44, e co-segregano
generalmente con gli alleli di F4bcR. SNP derivati da questi due geni sono utilizzati in programmi di
riproduzione per ridurre la frequenza dell’allele per la suscettibilità all’ETEC F4ab/F4ac nella
popolazione suina.
In questo studio, maiali selezionati dalla Swiss Performing Station (SPS) in Sempach e da una
mandria sperimentale (UEH) dell’Università di Zurigo sono risultati ricombinanti negli intervalli MUC4-
F4bcR o F4bcR-MUC13.
Uno studio su tre generazioni è stato fatto con 32 maiali selezionati dalla UEH, ricombinanti
nell’intervallo MUC4-F4bcR, tramite l’uso del Porcine SNP60 DNA BeadChip. Il DNA di un maiale
ricombinante nell’intervallo F4bcR-MUC13 è stato sequenziato con tecniche high throughput, usando le
piattaforme HiSeq 2000 e PacBio RS.
Campioni di RNA da maiali resistenti e suscettibili all’ETEC F4ab/F4ac sono stati sequenziati
usando la piattaforma SOLiD. Le analisi sono state condotte per investigare l’espressione dell’mRNA e
possibili sue variazioni nell’intestino tenue sui geni candidati HEG homolog 1 (HEG1), solute carrier
family 12 member 8 (SLC12A8), MUC13, ed integrin β-5 (ITGB5) mappati nella regione SSC13q41-q44.
- 11 -
I marker sono stati testati sia in maiali suscettibili che resistenti, cercando un disequilibrium da
linkage (LD) con F4bcR. GeneScan sono state eseguite su microsatelliti. PCR-RFLP e pyrosequencing
sono state eseguite su SNP con un possible LD con F4bcR.
I dati ottenuti in questo studio hanno ristretto il locus di F4bcR nell’esone 2 di MUC13 e portato
alla scoperta di diversi marker con un alto LD con F4bcR, da poter essere usati nei programmi di
riproduzione: ALGA0072075, KVL1293, ALGA0106330, MUC13-226, e MUC13-813.
L’eredità del recettore o dei recettori per F4ad invece non è ancora compresa. A parte i fenotipi
completamente resistenti o suscettibili all’adesione, come quelli osservati in F4ac e F4ab, alcuni maiali
dell’UEH mostravano un terzo fenotipo nei test di adesione, in cui solo alcuni degli enterociti esaminati
erano senza batteri. In questo fenotipo debolmente suscettibile, gli enterociti sembrano diventare più
suscettibili a F4ad più vicino sono alla valvola ileocecale.
Le analisi hanno rilevato che vi è più di un recettore per le fimbrie ETEC F4ad sulla superficie
degli enterociti—un recettore forte, responsabile per il fenotipo con una completa adesione (E1), e un
recettore debole, responsabile per il fenotipo con una bassa adesione (E2).
Test di adesione sono stati effettuati su 489 maiali dell’UEH per determinare il fenotipo del
recettore per ETEC F4ad. Le analisi statistiche sono state effettuate con il software Pedigree Analysis
Package v. 4.0 per valutare possibili modelli di ereditarietà per il recettore ETEC F4ad.
I risultati indicano che il fenotipo E1 può essere codificato da due geni complementari o
epistatici, mentre il fenotipo E2 è ereditato come un tratto dominante monogenetico.
- 12 -
1. INTRODUCTION
1.1 Diarrhoea
The human body is composed of almost 100 trillion cells, and carries about 10 times as many
bacteria in the intestines (Björkstén et al., 2001; Steinhoff, 2005). At least 400 different bacterial species
are present in the gastrointestinal tract (Dunn, 1990; Moore & Holdeman, 1974).
The flora of the proximal small intestine differs significantly from that of the terminal ileum and
colon (Huijsdens et al., 2002). The most frequently identified anaerobic bacteria are Bacteroides spp.,
Bifidobacterium spp., Eubacterium spp., Peptostreptococcus spp., and Fusobacterium spp. (Simon &
Gorbach, 1986). These bacteria have a mostly a symbiotic relationship (Sears, 2005), contributing to the
host’s health through biotin, vitamin K, and hormones production (Guarner & Malagelada, 2003). In
certain conditions, pathogenic bacteria are able to replace the normal flora, causing diseases such as
diarrhoea.
Diarrhoea is a common problem for children in developing countries, for travellers (Clarke,
2001; Qadri et al., 2005), and in animal production. Pigs are susceptible to diarrhoea mainly in the first
five days after birth (neonatal period) and at four weeks (post-weaning period). The mortality rate of
piglets is 10%, and can be up to 25% if not treated (Kjaersgard et al., 2002; Li et al., 2007). The piglets
that survive grow more slowly and have poorer performance (Fairbrother & Gyles, 2006).
During the neonatal period, diarrhoea is associated with Escherichia coli, Clostridium
perfringens, or Isospora suis. In weaning piglets, diarrhoea is associated with Salmonella, Lawsonia
intracellularis, and Escherichia coli. Several viruses (e.g. rotavirus, calicivirus, astrovirus and
adenovirus) and parasites (nematodes, protozoa) can also cause water flow in the intestine. In addition,
diarrhoea can have other, non-related causes (e.g. digestive tract surgery, medications and malabsorption).
1.2 Escherichia coli
Escherichia coli (E. coli), a gram-negative bacterium from the Enterobacteriaceae family found
in the lower intestine, represent 0.1% of gut flora (Eckburg et al., 2005). Most E. coli strains are
- 13 -
symbiotic to the host, producing vitamin K2 (Bentley & Meganathan, 1982) and preventing pathogenic
strains from colonising the intestine (Hudault et al., 2001; Reid et al., 2001).
The principal transmission means of pathogenic E. coli are faecal-oral. Pathogenic E. coli cause
severe infections and are occasionally responsible for food product recalls (Vogt & Dippold, 2005), as
occurred recently in Germany with a new strain resistant to antibiotics (Turner, 2011). Pathogenic E. coli
are responsible for 50% of all diarrhoea cases in post-weaning pigs (Gyles, 1994).
The pathogenic E. coli that causes diarrhoea is commonly divided into seven different
categories: enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), enterohaemorrhagic E. coli
(EHEC), vero cytotoxin-producing E. coli (VTEC), enteroaggregative E. coli (EAEC), enteroinvasive E.
coli (EIEC), and diffusely adherent E. coli (DAEC) (Nataro & Kaper, 1998). E. coli possess fimbrial
antigens that allow the bacteria to adhere to the enterocytes and colonise the intestine (MacKinnon, 1998)
(Figure 1.1).
Pigs are mostly affected by the ETEC, VTEC and EPEC strains. The ETEC strains contribute to
the majority of diarrhoea cases, while EPEC only contribute to 6% (Fairbrother, 1999; Markwalder,
2001).
Figure 1.1: E. coli bacterium with fimbriae (Gross, 2006)
- 14 -
1.3 ETEC
ETEC carries adhesive fimbriae that attach to receptors on the brush border of the enterocytes
and produces enterotoxins that cause diarrhoea (Figure 1.2).
Figure 1.2: Small intestinal brush border with strong ETEC F4 adhesion (Bertschinger et al., 1972)
1.3.1 Enterotoxins
Enterotoxins produced by ETEC are divided into heat-labile enterotoxin (LT) and heat-stable
enterotoxin (ST). Enteroaggregative Escherichia coli heat-stable enterotoxin 1 (EAST1) produced by
EAEC is also associated with ETEC (Toledo et al., 2012; Zhao et al., 2009).
Heat-labile enterotoxins (LT-I and LT-II) are inactivated at high temperatures (Wagner et al.,
2004; Glenn et al., 2007). Subtype LT-I is found in animals and humans, and subtype LT-II is found only
in animals. The LT mechanism of action is similar to that of the cholera toxin (Brown & Hardwidge,
2007). LT raise cyclic AMP levels, increasing the secretion of chloride (Cl-) and the concentration of
calcium (Ca2+) and sodium (Na+) ions in the cells. The ion imbalance stimulates the flow of water into the
lumen, causing diarrhoea (Moon, 1978). Heat-stable enterotoxins (ST-a, ST-b, and EAST1) are resistant
to hydrolysis by gastric and jejunal enzymes and remain active at 100°C for 30 minutes (Kapitany et al.,
1979). EAST1 and ST raise cyclic GMP levels, which stimulate ion secretion, causing diarrhoea (Hughes
et al., 1978). Only the ETEC strains producing LT, EAST1, and ST-a are sufficiently pathogenic to cause
diarrhoea (Berberov et al., 2004; Zhang et al., 2006).
- 15 -
1.3.2 Fimbriae
ETEC colonises the intestine by adhering to the enterocytes with its fimbriae. Only five fimbrial
types, F4 (formerly K88), F5 (K99), F6 (987P), F18 (F107), and F41, occur worldwide in pigs. Adhesin
involved in diffuse adherence (AIDA), an adhesin produced by DAEC, is also associated with ETEC
(Ngeleka et al., 2003; Zhao et al., 2009).
Fimbriae F6, F18, and F41 have a carbohydrate-binding protein site at their extremity that acts as
a binding site to the intestinal receptors (Moon, 1997). F4 and F5 have binding sites along their entire
length. ETEC expressing F5, F6, and F41 fimbriae are found mainly in the neonatal period, and ETEC
F18 is found mostly in the post-weaning period (Fairbrother et al., 2005; Nagy & Fekete, 2005). ETEC
expressing F4 fimbriae (ETEC F4) are responsible for diarrhoea in both periods. ETEC F4 and ETEC F18
are the most prominent worldwide. Genes controlling F4 and F18 fimbrial types were identified in 92.7%
of post-weaning ETEC diarrhoea cases (Frydendahl, 2002).
Pigs can be either susceptible or resistant to ETEC fimbriae adhesion, due to mutations in the
receptor proteins on the brush border (Sweeney, 1968). The mutation that makes pigs susceptible to
ETEC F18 is known (Meijerink et al., 1997; Meijerink et al., 2000). Elimination of the susceptible allele
for ETEC F18 from the porcine population is currently carried out in Switzerland and in other countries
(Luther et al., 2009).
1.3.2.1 Fimbriae F4
The F4 fimbriae are long, polymeric appendages composed of several hundred identical major
FaeG subunits (27.5 kDA each) with some minor subunits interspersed through the structure. One
bacterium can contain 100 to 300 fimbriae.
The F4 fimbriae are divided into three antigenic variants: F4ab, F4ac, and F4ad (previously
known as K88ab, K88ac, and K88ad). The variants share a common antigen (a) and express a specific
antigen (b, c, or d). The variants are distinguished by amino-acid substitutions in the major adhesive
subunit FaeG (Van Den Broeck et al., 2000; Guinée & Jansen, 1979) (Figure 1.3).
- 16 -
Figure 1.3: Gene cluster encoding F4 fimbriae (Van der Broeck et al., 2000)
1.3.2.2 Prevalence of ETEC F4
Differences in fimbrial prevalence have been observed among neonatal, suckling, and weaning
piglets. ETEC F4 is the most important cause of diarrhoea in newborn and weaned piglets worldwide
(Frydendahl, 2002). In a report on 115 Swiss suckling piglets with diarrhoea, 50.5% of the samples were
positive for ETEC F4 (Sarrazin et al., 2000). In Denmark, ETEC F4 was present in 41% of all isolates
from 141 piglets with diarrhoea (Ojeniyi et al., 1994). In Hungary, ETEC F4 was present in 60% of all
isolates from 88 weaned pigs with diarrhoea (Nagy et al., 1990). In South Korea, 60% of 191 isolates
from piglets with diarrhoea were positive for genes of ETEC F4 (Kim et al., 2010). In North America,
65% of 175 piglets with diarrhoea were positive for genes of ETEC F4 (Zhang et al., 2007). In
Zimbabwe, of 67 neonatal piglets with diarrhoea, 28.4% were positive for genes of ETEC F4 (Madoroba
et al., 2009).
Recent vaccination programs for ETEC F4 and breeding selection may have changed the
fimbriae prevalence in ETEC, increasing the presence of other fimbrial types. In a report on 341 Saxonian
isolates from weaning piglets with diarrhoea, 15% of the samples were positive for F4 fimbriae (Wittig et
al., 1995). In Mexico, 3% of 935 isolates from suckling and weaned piglets with diarrhoea were positive
for ETEC F4 fimbriae (Toledo et al., 2012). In China, 9.8% of 215 isolates from pigs with post-weaning
diarrhoea were positive for ETEC F4 fimbriae (Chen et al., 2004a).
1.4 Determination of F4 receptor phenotypes
Three adhesion test methods have been reported for the determination of F4 phenotypes: 1)
screening for bacteria adhesion on brush border membrane vesicles prepared from enterocytes (Baker et
al., 1997; Sellwood et al., 1975); 2) screening of entire isolated enterocytes (Edfors-Lilja et al., 1986;
- 17 -
Rapacz & Hasler-Rapacz, 1986); and 3) screening of intact intestinal villi (Cox & Houvenaghel, 1993;
Rasschaert et al., 2007). Bacterial adhesion to the brush border of the enterocytes was detected in all three
methods by light microscopy or phase contrast microscopy.
The threshold used in phenotyping for susceptibility to F4 fimbriae can affect the results of the
studies as well. Baker et al. (1997) prepared brush border vesicles, and specimens in which at least 10%
of 20 selected brush borders bound more than two bacteria were considered adhesive. Li et al. (2007)
used intact epithelial cells, and a cell was considered adhesive when more than five bacteria adhered to
the brush border and four degrees of adhesion strength were distinguished. Engel (1998) and Engel et al.
(1998) prepared epithelial cells, and pigs yielding not more than two of 10─60 cells binding more than
two bacteria were regarded as resistant.
An ELISA method can be used to determine the susceptibility or resistance to ETEC F4. The F4
fimbriae are bound to microtiter plates and then exposed to brush border vesicles, and adhesion is
revealed by antibodies against the brush borders (Chandler et al., 1994). This method results in 95%
correlation with the classical adhesion tests.
The adhesion test is an invasive method, usually conducted on dead piglets. Biopsies performed
on living pigs are time-consuming, expensive, and stressful for the pigs. As such, it is difficult to
incorporate these tests into breeding programs to select pigs resistant to ETEC expressing F4 fimbriae.
1.4.1 Alternative methods
Atroshi et al. (1983) showed a correlation between sow milk and susceptibility to ETEC F4.
Milk contains large quantities of fat globule membrane that may express receptors similar to those present
on the brush borders of intestinal cells. Alternatively, ETEC F4 may also bind to the immunoglobulins
(IgA) present on the globule membrane.
Valpotic et al. (1992) performed an enzyme immunoassay on brush borders collected from pig
faeces. The sensitivity of the assay was low in adult pigs, compared to neonatal and weaned piglets. The
faecal samples from adult pigs contained less receptor material than necessary for comparable
phenotyping.
- 18 -
1.5 ETEC F4 RECEPTORS
1.5.1 ETEC F4 receptor phenotypes in pigs
Bijlsma et al. (1982) identified five ETEC F4 adhesion patterns in pigs, designated A-E. In
phenotype A, the three F4 fimbrial variants bind to the brush borders, and in phenotype E, none of the
variants bind (Table 1.1). Subsequently, new phenotypes were reported: phenotype F (Baker et al., 1997)
and phenotypes G and H, observed mainly in eastern breeds (Yan et al., 2009).
In phenotypes C and F, ETEC shows weak ETEC F4ab adhesion (Python et al., 2005). The weak
adhesion seen in the C and F phenotypes could be caused by an epistatic effect of some modifier genes,
by a case of RNA interference, or by an artefact. Similar conclusions regarding ETEC F4ac may apply in
phenotypes G and H.
Table 1.1: Phenotypes observed in pigs according to the binding of ETEC F4 variants A through H;
bacterial adhesion is marked with ● (Jacobsen, 2011-modified version).
Phenotypes Fimbrial variants
F4ab F4ac F4ad
A ● ● ●
B ● ●
C ● ●
D ●
E
F ●
G ●
H ● ●
1.5.2 ETEC F4ab and ETEC F4ac receptor
Early studies postulated the existence of three different receptors: bcd, which binds to all ETEC
F4 variants; bc, which binds only to ETEC F4ab and ETEC F4ac; and d, which binds only to ETEC F4ad
(Billey et al., 1998).
- 19 -
A recent hypothesis suggests a one-locus model―a common receptor for ETEC F4ab and ETEC
F4ac (F4bcR) that is inherited as an autosomal monogenetic trait (Python et al., 2002; Jørgensen et al.,
2003)—or a two-loci model―two different receptors, but with closely linked loci for F4ab and F4ac
(Guérin et al., 1993; Peng et al., 2007).
1.5.3 ETEC F4ad receptors
The inheritance of receptors for fimbriae F4ad (F4adR) is not well understood. Bijlsma & Bouw
(1987) suggested a dominant receptor locus for F4adR that is inherited independently, but is closely
linked to the receptors for ETEC F4ab/F4ac. Enterocytes adhesive for ETEC F4ad have been found in
offspring of resistant parents, indicating a non-persistent inheritance of F4adR. The study postulated the
existence of an “intermediate” phenotype, caused by epistatic inhibitor genes, to explain the discrepancies
observed in F4adR inheritance. Hu et al. (1993) postulated, for ETEC F4ad, the existence of a high-
affinity receptor co-segregating with F4bcR and a low-affinity receptor expressed only in pigs under 16
weeks of age. In the high-affinity receptor, bacterial adhesion to the enterocytes is close to 100%, while in
the low-affinity receptor, the enterocytes can be either susceptible or resistant to ETEC F4ad in variable
percentages.
1.5.4 ETEC F4ac susceptibility among breeds
Among the three F4 fimbriae variants isolated in pigs with diarrhoea, F4ac is the most
predominant (Westerman et al., 1988). Susceptibility to ETEC F4ac varies largely among pig breeds.
European breeds, such as Large White and Landrace are highly susceptible with a rate of 40─88%
(Snodgrass et al., 1981; Edfors-Lilja et al., 1986). American breeds, such as Hampshire and Duroc, have
similar high susceptibility, with a rate of 46─62% (Baker et al., 1997; Yan et al., 2009)
Chinese breeds, such as Meishan and Fengjing, have been reported to be resistant to ETEC F4ac.
Minzhu and Songliao Black breeds have a low susceptibility, with a rate of 8─28% to F4ac (Chappuis et
al., 1984; Duchet-Suchaux et al., 1991; Michaels et al., 1994; Li et al., 2007). It is possible that, like wild
boars that are naturally resistant to ETEC F4ac, Chinese breeds have been isolated from the rest of the
world and have been subjected to disease pressure without strict selection by swine producers.
- 20 -
1.6 Methods for preventing F4 diarrhoea
Several strategies are used worldwide to prevent diarrhoea caused by ETEC F4. One method is
to select resistant pigs for breeding by using genetic markers, such as SNPs or microsatellites, that exhibit
LD with F4bcR. The simplest methods of preventing E. coli infection are improving the condition of the
pigs, decreasing the density on the farms, having better hygiene and rooms with controlled temperature
and ventilation, and using prebiotics and probiotics in the diet. In addition, Lactobacillus seems to reduce
ETEC F4 adhesion to the intestinal cells (Blomberg et al., 1993; Roselli et al., 2007), and chelated zinc
and mannanoligosaccharides not only prevent diarrhoea in pigs, but are also growth promoters (Castillo et
al., 2008).
1.6.1 Antibiotics
Antibiotics used as growth promoters have been administered at low, sub-therapeutic doses for
long periods of time to control the microbial population of the intestine (NOAH, 2001). In the intestine,
almost 6% of the energy in the diet is lost due to microbial fermentation (Jensen, 1998).
However, pathogenic bacteria are becoming resistant against antibiotics or tolerant to high doses
due to the abuse as a growth promoter, thereby compromising their therapeutic use (Delsol et al., 2005;
Holt et al., 2011). The appearance of multi-drug resistant (MDR) phenotypes has led to the use of newer
antibiotics that are chemically similar to those used in human disease treatments (Rosengren et al., 2008;
Smith et al., 2010). Swiss legislation on animal nutrition has banned the use of antibiotics for growth
promotion in animal feed since 1999 in order to reduce antimicrobial resistance; the EU passed a similar
ban in 2006 (EFSA, 2007). Antibiotics used for disease prevention are administered at high doses for a
short period of time and are still used routinely on many farms.
1.6.2 Homeopathy
Homeopathic treatments have been studied as a replacement for the use of antibiotics in
livestock (Camerlink et al., 2010). Homeopathic treatments are highly-diluted preparations made with
- 21 -
substances that produce symptoms similar to those of the disease being treated. The use of homeopathic
treatments on humans and animals has no scientific evidence of efficacy (ECH, 2005; Mathie, 2003).
In the Camerlink et al. (2010) study, pregnant sows were treated twice a week with a nosode, a
diluted preparation made from various strains of E. coli, during the last month of their pregnancies. The
homeopathic litters had slightly fewer cases of E. coli diarrhoea than the placebo groups.
1.6.3 Immune protection by colostrum and milk
Natural protection against ETEC F4 is provided by immunoglobulin type A (IgA), which inhibits
adhesion and colonisation of the gut (De Geus et al., 1998). During pregnancy in humans, primates, and
rodents, immunoglobulin type G (IgG) produced by the mother crosses the placenta (Pentsuk & Van Der
Laan, 2009). However, in cattle, sheep, horses, and pigs, there is no transplacental transfer of
immunoglobulins (Sterzl et al., 1966). The foetus is devoid of circulating antibodies until birth, and the
newborn is unable to produce its own immunoglobulins for several weeks and is vulnerable to bacterial
infections.
Piglets must absorb the immunoglobulins from the mother via colostrum, which contains high
levels of IgG, creating the first systemic immunoprotection against bacterial infection in the newborn
(Frenyó et al., 1981). Milk contains IgA, which is barely absorbed by the suckling pig, maintaining local
immunoprotection of the intestinal mucosa for the entire lactating period (Curtis & Bourne, 1971).
Effective immunisation against neonatal diarrhoea from F4 E. coli is achieved if piglets can
drink colostrum and milk from an ETEC F4 susceptible sow that has developed IgG and IgA antibodies
against the bacteria from previous infections. Resistant sows cannot be infected by ETEC F4; therefore,
they cannot produce antibodies to be secreted in the colostrum (Sellwood, 1979; Sellwood, 1982). As a
result, if newborns are susceptible to ETEC F4 they can develop neonatal diarrhoea.
In an experimental study, capsules containing anti F4 egg yolk immunoglobulins (IgY) were able
to reduce cases of diarrhoea in piglets (Li et al., 2009). IgY can be an alternative method of achieving
effective immunisation against E. coli in piglets.
- 22 -
1.6.4 Vaccine
To protect newborn piglets, pregnant sows are vaccinated intramuscularly with an injection
containing F4 fimbriae or LT enterotoxins, so that the antibodies will be secreted in the colostrum and
milk (Jones & Rutter, 1972; Fürer et al., 1982). The maternal immunity helps to prevent diarrhoea during
the neonatal period, but it is lost during the weaning period. The lack of immunoglobulins from the milk
and the stress induced by the sudden diet changes make the piglets vulnerable to E. coli infections. Piglets
can be vaccinated with F4 antigens only during the weaning period; some vaccines will not work if
maternally-derived antibodies from the sow are still present in the piglets.
Vaccination can be achieved with purified F4 fimbriae, formalin-inactivated ETEC, engineered
bacteria containing the gene cluster expressing F4 fimbriae, or transgenic plants expressing fimbrial
subunit FaeG (Liang et al., 2006; Floss et al., 2007). Intramuscularly administered vaccines stimulate only
systemic immunity in piglets, blocking disease development only when the bacteria have crossed the
mucosal barrier of the intestine (McCluskie & Davis, 2000). Oral administration of antigens better
stimulates the production of IgA in the intestinal mucosa; however, the vaccine must resist the acid
environment and the digestive enzymes of the gastro-intestinal tract. The vaccine needs to cross the
intestinal barrier to stimulate the intestinal mucosal system and induce a protective immune response
instead of oral tolerance in the piglets (Van Den Broeck et al., 1999).
Antigens can be encapsulated to protect them from degradation (Galindo-Rodriguez et al., 2005).
In an experimental study, capsules made of methyl vinyl ether and maleic anhydride copolymer were able
to reduce cases of diarrhoea in piglets compared to non-capsulated antigens (Vandamme et al., 2011).
These vaccine treatments are still experimental and not yet commercially used on farms.
The vaccination procedures require the herding and restraint of the pigs and are quite stressful
for the pigs and time-consuming for the veterinarian or farmer. Furthermore, vaccines are expensive, not
optimal for stimulating intestinal immunity, and must be repeated for each new litter (Lee et al., 2001).
Breeding pigs for resistance to ETEC F4ab/F4ac adhesion is more economical, and the effects are lasting.
- 23 -
1.7 Genetic mapping of F4bcR
An LD was observed between F4bcR and the transferrin gene (TF) by linkage analyses on three-
generation Wild Boar/Swedish Large White crossbreeds (Guérin et al., 1993; Edfors-Lilja et al., 1995). In
these studies, F4bcR was mapped to a 69 cM region on porcine chromosome 13 (SSC13) (Figure 1.4).
The F4bcR was refined by fine mapping in the interval between microsatellites S0068 and SW1030
(Python et al., 2002), and then to a 6 cM interval between microsatellites SW207 and SW225 (Python,
2003; Jørgensen et al., 2003).
Recently, a comparison of pedigree data from Swiss Large White and Landrace purebred pigs
and Large White/Landrace crossbreds have additionally refined the F4bcR locus in a 10 Mb interval (5.7
cM) between microsatellites SW207 and S0075 (Joller et al., 2009). Jacobsen et al. (2010), through
haplotype mapping the Swedish three-generation material from Edfors-Lilja, further refined the F4bcR
locus to a 3.1 Mb interval, between gene zinc finger DHHC type containing 19 protein (ZDHHC19) and
microsatellite S0075.
A transversion in intron 7 of the mucin 4 gene, MUC4_g.8227 G>C, co-segregates with the
F4bcR alleles (Jørgensen et al., 2004). This SNP is currently used by Danish breeding programs;
however, subsequent observations in Switzerland (Joller, 2009; Rampoldi et al., 2011) have raised doubts
as to whether this mutation in the MUC4 gene is useful for eliminating ETEC F4ab/F4c susceptible pigs
from herds, as this mutation is not in full LD with F4bcR. Recently, a patent application was filled for a
SNP in the mucin 13 gene (MUC13), transition A157G (named MUC13-813 in this study) (Zhang et al.
2008) that co-segregates with the F4bcR alleles (Huang et al., 2006). However, a subsequent study by
Ren et al. (2012) showed that the SNP, in some rare cases, is not in full LD with the F4bcR locus.
Other studies have investigated polymorphisms in candidate gene transferrin receptor (TFRC)
(Wang et al., 2007; Jacobsen et al., 2011), lactosylceramide 1,3-N-acetyl-beta-D-glucosaminyl transferase
(B3GNT5) (Ouyang et al., 2012), mucin 20 (MUC20) (Jacobsen et al., 2011; Ji et al., 2011), solute carrier
family 12 member 8 (SLC12A8), myosin light chain kinase (MYLK), karyopherin alpha 1 (KPAN1)
(Huang et al., 2008), non-receptor tyrosine kinase 2 (ACK1; TNK2 in this study), beclin-1 associated
RUN domain containing protein (KIAA0226), and MUC4 (Jacobsen et al., 2011). In all these studies,
haplotypes were associated with ETEC F4ab/F4ac susceptibility, but none of the polymorphisms were
causative.
- 24 -
Figure 1.4: Location of candidate genes for F4bcR on SSC13. The gene order and the scale are deduced
from Sscrofa assembly 9, the positions of the microsatellites are shown to the right of the SSC13
ideogram, and the approximate positions of candidate genes are indicated on the right side (Rampoldi et
al., 2011 [modified version]).
1.8 Candidate genes for F4bcR
A candidate gene is a gene suspected of being involved with a particular disease or condition,
and it can be positional or functional. A functional candidate gene is involved in a specific function that
could be related to the condition investigated. In this study, functional candidate genes for F4bcR are
involved in the expression of receptors on the epithelial cell membrane. A positional candidate gene is
located in the chromosome area believed to be involved in the condition investigated. In this study,
positional candidate genes for F4bcR are located in the interval ZDHHC19-S0075 (Section 1.7) in the
reference sequence Sscrofa assembly 10.2.
- 25 -
1.8.1 Positional candidate gene
1.8.1.1 SLC12A8
The solute carriers (SLC) are a group of membrane transport proteins that include over 300
members, organized into 51 families (Hediger et al., 2004). Solute carrier family 12 member 8
(SLC12A8) is a cation/chloride co-transporter. The human SLC12A8 gene (ENSG00000221955) contains
13 exons, possesses five isoforms, and encodes for a 714 amino-acid membrane protein of 78 kDa. The
SLC12A8 gene is conserved in chimpanzee, pig, dog, cow, mouse, rat, zebrafish, fruit fly, mosquito, and
C. elegans. It maps between 144625000 and 144760000 bp in SSC13 on the reference sequence 10.2. The
SLC12A8 protein exhibits low expression in normal skin, small intestine, stomach, testis, thyroid, and
colon. SLC12A8 protein may play a role in the control of keratinocyte proliferation, and it is a candidate
gene for psoriasis susceptibility in humans (Hewett et al., 2002; Hüffmeier et al., 2005). In pigs, SNP
SLC12A8_159 A>G has been shown to be in LD with F4bcR (Huang et al., 2008).
1.8.2 Positional and functional candidate genes
1.8.2.1 HEG1
Heart of glass (HEG) is a regulating protein for heart growth in zebrafish (Mably et al., 2003).
HEG homolog 1 (HEG1) protein is an orphan receptor in mammals, related to the mucin family (Lang et
al., 2006). The human HEG1 gene (ENSG00000173706) possesses two isoforms and encodes for a 1381
amino-acid protein of 147.5 kDa with calcium-binding EGF-like domains. These domains are composed
of 30─40 amino-acids with six cysteine residues involved in three disulphide bonds (Downing et al.,
1996; Bork et al., 1996) and are normally found in extracellular proteins. The HEG1 gene has been
reported to be expressed in human, chimpanzee, cattle, mouse, and pig. It maps between 144760000 and
144830000 bp in SSC13 on the reference sequence 10.2. A recent genome-wide association study on 301
Landrace, Yorkshire, and Songliao Black piglets showed a possible LD with F4bcR (Fu et al., 2012).
- 26 -
1.8.2.2 MUC13
Mucins are glycoproteins on the membranes of mucosal epithelial cells (Williams et al., 2001).
They form gels and are used for lubrication, cell signalling, and forming chemical barriers (Marin et al.,
2008). Mucins contain EGF domains and oligosaccharide structures used as binding sites for bacteria.
Mucin 13 (MUC13) is a transmembrane glycoprotein involved in cell cycle regulation. The human
MUC13 gene (ENSG00000173702) encodes for a 511 amino-acid protein of 54 kDa. MUC13 protein is
highly expressed in a variety of epithelial carcinomas (Maher et al., 2011). The MUC13 gene maps
between 144992000 and 145021000 bp in SSC13 on the reference sequence 10.2. Quantitative PCRs
have shown no difference in gene expression between pigs resistant and susceptible to ETEC F4ac
adhesion (Schroyen et al., 2012). A recent study by Ren et al. (2012) showed two isoforms of MUC13 in
pigs, MUC13A and MUC13B, each with distinct tandem repeats in exon 2. The repeats in MUC13B
encode for a heavily O-glycosylated region in the protein, a possible binding site for ETEC F4ab/F4ac.
The O-glycosylation binding site is not present in MUC13A. Pig SNP A157G (SNP MUC13-813 in this
study) has been shown to be in LD with F4bcR and was recently patented as a marker for selecting pigs
resistant to ETEC F4ac (Huang et al., 2006).
1.8.2.3 ITGB5
Integrins are protein receptors that mediate attachment between cells or between a cell and the
extracellular matrix (ECM). Integrins give information from the ECM to the cells and reveal the status of
the cells to the outside, enabling rapid responses to sudden changes in the environment. Integrins are
involved in several biological activities, such as immune patrolling and cell migration, and they can be
used by viruses for binding to cells. The integrin β-5 (ITGB5) protein is a receptor for fibronectin. The
human ITGB5 gene (ENSG00000082781) encodes for a 799 amino-acid protein of 88 kDa. The ITGB5
gene maps between 145042000 and 145114000 bp in SSC13 on the reference sequence 10.2. Recent
studies have shown a possible LD with F4bcR (De Greve et al., 2007; Shahriar et al., 2006; Fu et al.,
2012). In pigs, SNPs ITGB5_c.920 C>T, ITGB5_c.1580 G>A, ITGB5_c.1715 C>T, ITGB5_c.2744 G>A,
ITGB5_g.31420 C>A, and ITGB5_g.31487 G>A were shown to be in LD with F4bcR (Huang et al.,
2011).
- 27 -
1.9 Objectives
The aims of this study were threefold:
1) Analyse the porcine sequence in candidate genes for differences that are associated with ETEC
F4ab/F4ac adhesion phenotypes in informative families.
2) Develop a reliable genetic test that discriminates between pigs susceptible and resistant to ETEC
F4ab/F4ac.
3) Produce informative matings to elucidate the inheritance of the F4ad receptor (F4adR) allele(s).
- 28 -
2. MATERIALS AND METHODS
2.1 Pigs
The pigs used in this study originated from a university experimental herd (UEH) at the
Department of Farm Animals, Faculty of Veterinary Medicine, University of Zurich. The UEH was
studied in several papers in collaboration with Jørgensen’s group from the Department of Basic Animal
and Veterinary Sciences, University of Copenhagen, Denmark, to identify the receptors for E. coli
F4ab/F4ac adhesion (F4bcR) and the F4ad fimbrial receptor (F4adR) inheritance mechanisms (Joller et
al., 2009; Jacobsen et al., 2010; Rampoldi et al., 2011).
In 1998, a Large White purebred family and a Large White/Landrace crossbred family were
originally bred for eight generations. In the UEH 249 matings were performed, generating 2565 offspring.
Since the year 2000, the E. coli F4 microscopic adhesion test (standard MAT), performed on one
intestinal site, was used routinely to determine the inheritance of the resistant and susceptible alleles to
the three different variants of E. coli F4 fimbriae; 2372 pigs were phenotyped with the standard MAT.
Since the year 2009, together with the standard MAT, 537 pigs were tested in four intestinal sites to
determine the F4ad fimbrial receptor phenotype (F4ad MAT).
Jørgensen’s group provided haplotype information based on 10 Nordic Experimental Herd
(NEH) pigs and 10 Swiss pigs used in this study for selecting SNPs and candidate genes to investigate.
This study also performed analyses on a representative sample of the Swiss porcine population,
initially with 78 pigs from 38 litters from the Landrace and Large White breeds, randomly selected at the
Swiss Performing Station of Sempach (SPS) (Joller, 2009), and later with 40 other pigs that were
randomly selected to test newly discovered markers.
- 29 -
2.2 Determination of the ETEC F4 receptor phenotype
2.2.1 Preparation of ETEC F4 strains
The Escherichia coli F4 strains E68I (O141:K85ab:F4ab), G4 (O45:K(E65):F4ac), and Guinée
(O8:K87:F4ad) (Thorns et al., 1987) were obtained from the Veterinary Laboratories Agency Weybridge,
Surrey, GB. Stock bacteria from confluent growth on agar plates were harvested and frozen at -70°C in
0.5 ml trypticase soy broth (TSB) containing 10% glycerine. Each batch of frozen stock suspension was
confirmed by slide agglutination with OK antisera. The antisera were produced at the Institute of
Veterinary Bacteriology, University of Zurich.
Bacteria were grown on Columbia Sheep blood agar plates (Appendix) and stored at 4°C. Every
second month, material was taken from five colonies and plated on fresh agar plates. After three transfers
to blood agar plates, the cultures were renewed from frozen stock. After each transfer to new blood agar,
the expression of F4 fimbriae bacterial subculture was confirmed by slide agglutination of confluent
growth with polyvalent F4 antiserum or by F4 strain-specific PCR (Table 2.1) (Alexa et al., 2001). The
antisera were provided by the Bundesinstitut für Risikobewertung (BfR), Berlin, Germany.
Colonies from confluent growth from the blood agar plates were picked and grown at 37°C for
24 h in TSB (Appendix) test tubes one day before use. Shortly before use, 1 ml of bacterial culture was
diluted 1:10 in pre-warmed TSB and incubated at 37°C for 90 min to achieve maximal density of the
culture and maximal fimbriation of the bacteria.
2.2.2 Sampling of intestinal tissues
The pigs were slaughtered routinely, at the age of two months, at the age of seven months (~ 100
Kg), or when they were eliminated from breeding. Usually, feed was withheld for 16 hours before the
pigs were slaughtered; water and straw were always offered. Blood samples and tissue samples of the
intestine were taken at the time the pigs were slaughtered. The interval between exsanguination and
sampling of intestine was between 20 and 40 min.
For the standard MAT, starting at the cranial mesenteric artery, the intestine was separated from
the mesentery, and a 10─20 cm empty segment of jejunal intestine was taken anywhere between 3.5 and
- 30 -
7.5 m distal from the cranial mesenteric artery. For the F4ad MAT, four segments were usually taken: one
was taken 2 m distal from the cranial mesenteric artery (A); another one 2 m proximal to the ileocaecal
valve (D); and the other two segments at 1/3 (B) and 2/3 (C) of the distance between A and D. All
segments were opened longitudinally, placed in wide-necked bottles containing 80 ml of 4°C PBS-
EDTA, and stored at 4°C until further processing.
Intestinal samples for RNA extraction were taken after the pigs were slaughtered. Intestinal
scrapings were removed with glass slides from an intestinal segment free of contents. The scrapings were
wrapped in aluminium foil or put in 1.5 ml tubes and frozen in liquid nitrogen. Samples were stored at
-70°C until RNA extraction.
2.2.3 Preparation of enterocytes
The enterocytes were prepared for the MAT according to Sellwood et al. (1975), with
modifications of Vögeli et al. (1996) and Python et al. (2002). All four segments were tested for F4ad,
while segment B or C usually was tested for F4ab and F4ac.
The superficial layer of the intestinal segment was scraped off the surface with a microscope
slide and collected in 50 ml centrifuge tubes containing 30 ml of PBS-formaldehyde. The suspension was
stirred vigorously with forceps for 1 min and stored at 4°C for 15 min, letting large tissue fragments
sediment. The supernatant was decanted and stored at 4°C again, for 20 min, to sediment the remaining
large tissue fragments. Subsequently, the supernatant was centrifuged at 200 g for 10 min, and the pellet
was carefully resuspended in 10 ml of PBS and centrifuged again. The enterocytes were resuspended in 5
ml mannose buffer and diluted to a concentration, judged by eye, of 105─106 cells/ml.
2.2.4 Microscopic adhesion test
One millilitre of resuspended enterocytes was incubated in a 6-well macroplate at 37°C for 30
min with 1 ml freshly grown culture from each of the three ETEC F4 strains. Subsequently, 20 well-
separated and intact enterocytes were scored for each sample under a light microscope with 400x
magnification.
- 31 -
Adhesion strength was expressed as the percentage of adhesive enterocytes. An enterocyte was
classified as adhesive if more than five bacteria adhered to the brush border (Figure 2.1). Twenty
additional enterocytes were scored if adhesion of more than five bacteria were observed in >0%─30% of
the scored enterocytes. Initially, pigs with more than 15% E. coli F4ac adhesive enterocytes and pigs with
more than 2.5% F4ab and F4ad adhesive enterocytes were considered to be susceptible. Changes in
classification were made for F4ad adhesive enterocytes, as described in Section 3.8.1. The same person
performed the jejunum sampling and purification and classification of the enterocytes.
Figure 2.1: Determination of the ETEC F4 receptor phenotype in the MAT after preparation of
enterocytes. Cell without adhesion (top left) and cell with multiple ETEC F4 adhering to the brush border
(bottom right) (Python, 2003).
2.2.5 Positive and negative control of bacterial adhesion
Beginning in July 2006, adhesive and non-adhesive enterocytes were kept for further use as
positive and negative controls for F4 adhesion. After scoring, the remaining enterocytes in mannose
buffer and the cells of the second decantation were pooled, supplemented with 10 ml of PBS, and stored
at 4°C for 5 min for sedimentation of large tissue fragments. After a centrifugation step at 200 g for 10
min, the pellet was resuspended in 5 ml of DMSO-Hanks medium (Bosi et al., 2004). Aliquots of the
suspension were frozen in cryotubes at -70°C.
- 32 -
Control cells were included in each test series. Before use, the cells were thawed at room
temperature, diluted in 10 ml of PBS-formaldehyde, and centrifuged. The pellet was washed in PBS,
centrifuged, resuspended in 1 ml of mannose buffer, and was ready for incubation with bacterial strains.
2.3 DNA methods
2.3.1 DNA extraction from blood
Blood was collected in Vacuette or Venosafe tubes containing EDTA and stored at 4°C or 20°C
until processing. DNA extraction from blood samples was performed using a lysis method, as described
by Vögeli et al. (1994). In brief, 600 µl of blood were mixed with 500 µl of lysis buffer (Appendix), left
at room temperature for 15 min, and then centrifuged at 13,000 g for 30 s. The pellet was resuspended in
1 ml of lysis buffer, vortexed, and left at room temperature for another 15 min. The mixture was then
centrifuged at 13,000 g for 30 s. The resuspension and centrifugation were repeated two more times. The
pellet was resuspended in 200─400 µl of PCR turbo buffer, and 20─40 µl of Proteinase K (20 mg/ml)
were added to the suspension. After incubation at 55°C for 2 h and deactivation of the Proteinase K at
95°C for 10 min, the samples were stored at -20°C until further use.
As an alternative, a column-based purification for the DNA was made with the GenElute
Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich); 500 µl of blood were mixed with 1400 µl of
cold ECL buffer, then centrifuged for 10 min at 13,000 g. The washing step was repeated one more time,
and the pellet was resuspended in 200 µl of resuspension solution from the kit. The next steps followed
the white blood cell (WBC) preparation protocol of the kit. After the elution of the DNA from the
column, the samples were stored at -20°C until further use.
The DNA concentration was measured using a Qubit® (1.0) fluorometer with a Qubit® dsDNA
HS (high sensitivity) assay kit (Invitrogen). Alternatively, a NanoDrop ND-1000 spectrophotometer
(Thermo Scientific) was used.
- 33 -
2.3.2 Polymerase chain reaction
2.3.2.1 Primer design
Primers for PCRs and sequencing were based on porcine DNA or RNA sequences or on
homologous and conserved DNA sequences of Homo sapiens published on the EMBL/GenBank
databases. Primer sequences were usually 20─24 bp in length, with a GC content of 40─60% and one or
two G/C clamps at the 3’ end. The primers were designed with the web-based software Primer3 v. 0.4
(Rozen & Skaletsky, 2000; http://frodo.wi.mit.edu). All the primers were tested for hairpins and self- and
hetero-dimers with the web-based software Oligo Analyzer v. 3.1 (Owczarzy et al., 2008;
http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/default.aspx) (Tables 2.1, 2.2.1, 2.2.2, and
2.5). Primers for pyrosequencing were designed with Pyrosequencing Assay Design v. 1.0 software by
Biotage (Table 2.3).
2.3.2.2 Standard PCR
PCRs were generally performed in a 25 µl reaction volume containing 50─250 ng of DNA, 200
µM of each dNTP, standard PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001%
gelatine), 10 pmol of each forward and reverse primer, up to 0.5 mM additional MgCl2, and 1.5 U Taq
DNA polymerase or 0.75 U Taq DNA JumpStart polymerase. Amplification was carried out in 200 µl
single tubes, 8-tube strips, or 96-well plates on a PTC100 (MJ Research, Bioconcept, Allschwil) or a
TPersonal thermocycler (Biometra, Biolabo, Châtel-St-Denis). After an initial denaturation at 94°C for 2
min, the samples were cycled 30─38 times, as follows: denaturation at 94°C for 30 s, annealing at
50─65°C for 30 s, and extension at 72°C for 30─45 s. At the end, the samples were extended at 72°C for
5 min (Tables 2.1 and 2.5).
- 34 -
Table 2.1: Primers for standard PCR are given with the SNPs, DNA fragment size, annealing temperature,
and position of SNPs or amplicon according to the reference sequence Sscrofa 10.2.
Gene
Primers Forward and Reverse
Annealing
temperature
(°C)
Amplicon
length
Position on
Sscrofa
10.2 Position of SNPs
F4ab1 K88ab-F: TTGCTACGCCAGTAAGTGGT
K88ab-R: CGAAACAGTCGTCGTCAAA 65 296 ---
F4ac1 K88ac-F: TTTGCTACGCCAGTAACTG
K88ac-R: TTTCCCTGTAAGAACCTGC 54 436 ---
F4ad1 K88ad-F: GGCACTAAAGTTGGTTCA
K88ad-R: CACCCTTGAGTTCAGAATT 50 169 ---
ACTB2 BACT-F: TCCCTGGAGAAGAGCTACGA
BACT-R: CGCACTTCATGATCGAGTTG 54
250
cDNA
150
---
TNK2
g.7075 TNK2e6-7-Fc2: GGAACCACTTTGATTGTTCTC
TNK2e6-7-R: GACAGGGACACCAACAGCTAA 61 625 143654201
g.7717 TNK2e9j-F: GAAGAGCTGGGTGCTCTGCTT
TNK2e9j-R: AGCGGCAGCTGCATACTTGA 61 551 143654843
g.11142 TNK2e12b-Fv2: CCTGTGAGTGAAGACCAAGACC
TNK2e12b-Rv2: CCCCATCTCCTCCTCACTTGA 61 751 143663677
MUC4
g.6242; g.6308;
g.6317; g.6321;
g.6609; g.6616;
g.6634; g.6675;
g.6690; g.6745;
g.6770; g.6862
MUC4-6136-F: GTTACTGGCCTCGACTCTCC
MUC4-6887-R: AGGTTGTACCCTTGGCATTC 61 749
143818524-
143819273
g.7947 MUC4-7741-F: GGTCCTACGCCTTGTTTCTC
MUC4-8202-R: CCTTCATGGGGTTGTTGTAATA 61 462 143820333
g.8227 MUC4-8012-F: CACTCTGCCGTTCTCTTTCC
MUC4-8378-R: GTGCCTTGGGTGAGAGGTTA 56 367 143820613
LRCH3
212; 213; 214;
215; 2163
LRCH3-F1: TGCCTGACATTTTGCTAACG
LRCH3-R1: CTGCACTTGTGGTGGAGAAC 52 643
144104687-
144105329
217; 218; 2193 LRCH3-F2: TTGAGGAGAGTTGCATGTTGTT
LRCH3-R2: TCCTGCTCAGTGGATTAAAGG 52 405
144109773-
144110177
LMLN
g.15920 LMLN-I4F: GGCACTATCTTACTTAGCAG
LMLN-I4R: TGGTTTGTTGCACATTGT 50 528
144201963/
144255122
ZNF148
g.96828 ZNF-INF1: TGTGCTTTAACCCTTATACTCTGC
ZNF-INR1: TCTTCATTCATACAGGTATTTCTTGA 53 668 144544700
SLC12A8
SLC-C1F: GCCCAGATGTCTCAAGTGCAGG
SLC-C1R: GACTCTCCGGGGCTGTAATCTG 60
cDNA
690
144499474-
144717264
- 35 -
Continued from previous page
Gene
Primers Forward and Reverse
Annealing
temperature
(°C)
Amplicon
length
Position on
Sscrofa
10.2 Position of SNPs
SLC12A8
SLC-C2F: GCCATGTACATCACCGGCTTTGC
SLC-C2R: TGGCCTTCTTGGTCTTCCCCTTC 61
cDNA
1087
144644897-
144751894
SLC-C3F: CATCGCGGTGGATTACTCTT
SLC-C3R: TGCATATGCGGGTGTAGAAA 53
cDNA
742
144751590-
144861506
g.1365 SLC-D4F: CCTAACCTGGGAACCTCCAT
SLC-D4R: GCCTTGTCTGGTTGAGAGGA 57 335 144499531
g.22157 SLC-D3F: CTGTGAAGAGGCTGGGAAAG
SLC-D3R: TGTGGGATACACAAGGGTGA 57 457 144631142
1594 SLC-E10-11-F: AGAAATACACAATGGCAGCAA
SLCE10-11-R: TTCCTAAAGTCCAGGCTCCA 53
728
cDNA
177
144862026
g.129502; c.1990 SLC12A8-13F: AAAACCTCTGAGGGCCAGAT
SLC12A8-13R: CACACCACAATTCACCCAAG 57 677
144853837-
144853159
SLC-C4F: CTCCCAAGAGCAGATCATTTTG
SLC-C4R: CATAACAAAATGCGGGGAGTAT 54 641
144849975-
144849335
c.2947 SLC-C5F: TTTGTTATTGTCATGGTTCCAAAC
SLC-C5R: ATTAAAAAGGCCTTCACTAAACAA 51 521 144849048
HEG1
g.5244 HEG1-F: CCCATCGTAGCTCACAGG
HEG1-R: CCTCCACGTCTGCATGTG 57 353 144823489
c.321 HEG-E2F: GCATCTCCTTCTCCACTGGTAT
HEG-E2R: AGCTATAGCAAGCCACAGGTGA 57 569 144800514
HEG-E5F: TGGCCTTACATCTTCCAAGG
HEG-E5R: GGCTGAAACGTAGGTGTGGT 53
cDNA
1131
144791443-
144783842
HEG-E5F1: TGTACCCCCTGTAGTGGATTTT
HEG-E5R1: CCTATGTGGAGACTCACTCAAGT 55
799
144790922-
144790128
HEG-E5F2: ATTGTGGCTCAGTGGGTTTAAG
HEG-E5R1: CCTATGTGGAGACTCACTCAAGT 55 895
144789427-
144788577
HEG-NEF: GTTCTGAATCGGAGGAAGGAG
HEG-NER: GAGAATGTGCAAAAAGATGCTG 54 287
144784843-
144784557
c.1905; c.1917 HEG-E6F: ACCTACGTTTCAGCCCCTTT
HEG-E6R: GCTTGGGAGCTTTGATTCTG 55 696
144783856-
144783161
g.49379 HEG-E7F: TTTCCTGGGTGATTAACTGCTT
HEG-E8R: TGCAAATAAAGTGGAGGAAGAA 52 735 144779899
HEG-C1F: TTCCACAGCTGAAGTGGTGA
HEG-C1R: CTGCAGGCATTGACACATTT 53
cDNA
603
144782675-
144771912
HEG-C2F: ATGCTTCTAGGGAGCCCAGT
HEG-C2R: TTCGTTCAAGTTCGGGATTC 53
cDNA
684
144772271-
144704755/
144928236
c.6955 HEG-INF: TGTTAAGCTGACTCTCTCATGCTC
HEG-INR: CACTCCTGCCTGAGGTAAAAATAC 57 408
144707761/
144931242
- 36 -
Continued from previous page
Gene
Primers Forward and Reverse
Annealing
temperature
(°C)
Amplicon
length
Position on
Sscrofa
10.2 Position of SNPs
HEG1-MUC13
(JN613413)
23529 MCL23-F: CCACGAAATACCATTCAGCA
MCL23-R: GTTGAACTGGGAATCGAACC 53 547 144935458
34623; 34996;
35253; 35314
HEG1-24F: CCCTGGACCTTTATCCCAAC
HEG1-24R: ATGGAGCTTTGAGGCCATTA 53 781
144946486-
144947266
53252; 53277;
53373; 53494;
53612
HEG1-22F: CTGGGGAGACAACCTACCAA
HEG1-22R: CCATTGGTGGATGGGTAAAC 55 472
144965707-
144965236/
160909987-
160910454
61641; 61768;
62196
HEG1-25F: CAGCAAGCATCGTCATTTTC
HEG1-25R: TGGGAACGTCCTCCAATAAA 53 699
144973759-
144974381
MUC13
g.207 MUC13-MF: TTGGCGAGGAAATCTACAAAAT
MUC13-MR: GGGAAATCATTTTCTCTCTGGA 54 221 144986614
g.791; g.1248;
g.1345
MCL25-F1: GAGTAGGGATCTGGTTTGATGC
MCL25-R1: GCAGAATTTGGCTCTTCACC 55 675
144987144-
144987818
g.1412; g.1414;
g.1945; g.1974
MCL25-3F: AAGAAAACTGGCTTATGAATGAT
MCL25-3R: TGTCAATCTGAGTTTAATATTCCTC 51 815
144987753-
144988561
g.8951; g.8981 MUC13-E2F: AAAGCATGTTTCTGGGTGCT
MUC13-E2R: AGTGTGGATCCCCAAAATGA 53 745
144996366-
144997115
c.232 MUC13-E3F: GCGTGTATGTGTAACTGGGTCA
MUC13-E3R: TGGGGTCATGTTTTTCCTATTC 54 394 144997797
g.15150 MUC13-B2F: GGGGAGCTCTGCATTGTATC
MUC13-B2R: TACAAAGAGGGGGAAACGTG 55 208/162 145003209
g.15376;
g.15379; g.15381
MUC13-E4F: ACCATGTGTGTAAGTCGCTGAG
MUC13-E4R: ACGTTTCCCCCTCTTTGTAGTT 55 361
145003308-
145003668
227; 226; 225;
224; 2233
MUC13-F: TGAGCAAGATGAGTGCCCCAGT
MUC13-R: TAGCCAGGCAGGCACAAGCA 58
536
cDNA
186
145010233-
145010768
813; 814; 829;
895; 905; 908;
920; 933; 9355
MUC13-7F: ATGTGGAAGAACAGAACTTGATTGAG
MUC13-7R: ATAGTCAGGGCGGGGTATACTACC 59 176
145016886-
145017061
c.1243; c.1289;
c.1290; c.1702
MUC13-C2F: AGCATGCTCTGATACCTGCAATGC
MUC13-C2R: TCCTTCCTGAAAGCTGGGAGACAT 63 1061
145010679-
145019845
c.1788; c.1842;
c.1930; c.1986;
c.2014; c.2068
MUC13-ED2F: CAGGGAAGGCTGAGACTTTG
MUC13-ED2R: ATGTCTCCCAGCTTTCAGGA 57 696
145019822-
145020517
MUC13-ITGB5
(JN613413)
107599; 107649 MUC13-3AF: ACACATTTTTGGCTGGTTCC
MUC13-3AR: GGATGCTCTCACCTGCAAA 53 717
145020893-
145021609
- 37 -
Continued from previous page
Gene
Primers Forward and Reverse
Annealing
temperature
(°C)
Amplicon
length
Position on
Sscrofa
10.2 Position of SNPs
MUC13-ITGB5
(JN613413)
115242; 115364;
115460
M13IT-F3: TTTCAGGCTTGTTTTCCTCAA
M13IT-R3: TCAGCTGTGTTACCGAATGC 51 774
145028422-
145029195
ITGB5
c.246 ITGB5-E2F: GCTCAGCTTCCCTCATGAAC
ITGB5-E2R: GGGGTGGGGTTTATCCTCT 57 389 145064038
g.65464; c.917;
c.9206
ITGB5-E5F: GTCCCTAGCCCTCACCATCT
ITGB5-E5R: AGTCAGGCTGGGTCTCTCCT 59 363
145108252-
145107890/
160895287-
160894925
g.115393 ITGB5-F: CTTGGGGTAGAGGAAGTTGATG
ITGB5-R: CAGGTTGCTGAGACAGACTTTG 57 725 ---7
c.1580; c.17156 ITGB5-E9F: AGGTAACGGGAGTCCCAGAC
ITGB5-E9R: AGGACCATGGCAGTTGGTAG 57 588 ---7
c.27446 ITGB5-E14F: CCTCCAACCCTGTGTGAACT
ITGB5-E14R: AGGAACGGGCACGTCATAA 55 667 ---7
1 Alexa et al., 2001. 2 NCBI accession no. AJ312193. 3 Jacobsen et al., 2010. 4 Huang et al., 2008.
5 Zhang et al., 2008. 6 Huang et al., 2011. 7 SNPs were not found in reference sequence Sscrofa 10.2.
SNPs in the intergenic regions HEG1-MUC13 and MUC13-ITGB5 were named according to the position
in BAC clone CH242-101B19 and its accession no. JN613413 on NCBI. All the SNPs are enlisted
according to their physical positions in the genomic DNA, which sometimes do not correspond with their
supposed mapped positions in SSC13 due to errors in the reference sequence 10.2.
2.3.2.3 Long-range PCR
Standard PCR was used for DNA fragments up to 1000 bp. To amplify longer fragments, the
SequalPrep™ Long PCR with dNTPS kit (Invitrogen) was used. This kit was designed to amplify DNA
fragments of up to 15 kb in length, for use in next-generation sequencing applications. The kit included
all components for PCR except template, primers, and water. The long-range PCRs were carried out in a
20 µl reaction volume containing 2 µl of SequalPrep™ 10 X reaction buffer (which included MgCl2 and
dNTPs), 0.4 µl of DMSO, 1 µl of SequalPrep™ 10 X Enhancer (A or B), and 0.36 µl of SequalPrep™
Long Polymerase (5 U/µl). The DNA and primer amounts were the same as in the standard PCR. In GC-
- 38 -
rich DNA samples, betaine was added to the master mix (1 M final concentration) in order to improve the
PCR (Chen et al., 2004b).
Amplification was carried out in 8-tube strips or 96-well plates. After an initial denaturation at
94°C for 2 min, the samples were cycled 30─40 times, as follows: denaturation at 94°C for 10 s,
annealing at 56─60°C for 30 s, and extension at 68°C. The extension time depends on the amplicon
length, generally 1 minute/Kb. After the first 10 cycles, the extension phase was prolonged for 20 s in
each cycle. At the end, the samples were extended at 72°C for 5 min (Tables 2.2.1 and 2.2.2).
Table 2.2.1: Primers for long-range PCR are given with the annealing temperature, expected DNA
fragment size, and position of the amplicon according to the reference sequence Sscrofa 10.2. These
primers were used to amplify the intergenic region HEG1-MUC13.
Primers Forward and Reverse Annealing
temperature (°C)
Amplicon
length Position on Sscrofa 10.2
HEG1-MUC13
L1F: GTAATGTAGCTTGGGACATGAAGGT
L1R: CTCTAGGAACCATCAGATCCATCA 58 7823 144933006-144940829
L2F: GCCACAGTTATCTTAATTCCCTGTC
L2R: GACAAGCAATGAGGTCCTTCTCTAT 60 8023 144940638-144948661
L3F: ACCCCACAGTGATACAGATATAACC
L3R: AGACCAGCCACTAGAAGTGAAGTAG 57 7914 144948335-144956354
L4F: GTATTTTGGGAGTGTTTCCTCCTAT
L4R: GACCACCAATCTACTTTCTGTCACT 57 7838 144956163-144964000
L5F: AGCATAGAATTACCATGAGATCCAG
L5R: AATACCTAACAACAGGAGAACAACG 56 8055 144963639-144971845
L6F: GAGAGTGTTTCAAAGTCAGGTCTTC
L6R: ATTCCCTTCTAGGACTTTACCCTAAG 58 7825 144971547-144979371
L7F: GATTTGTCCAGAGATAAGCCTCAAT
L7R: AAACAATGGTGTAGAGAGGAGAACC 57 8486 144979097-144987582
AF: TTTCTCCAGATATATGCCAAGAGTG
AR: CCATCTCCAAGATACACAATGCTT 56 5722 144978702-144984424
BF: ATAGGATTTGAGACTCTGCAGCTAA
BR: TTGAGGCTTATCTCTGGACAAATC 56 5015 144982886-144987900
L8F: CTGTGATGAAAGCAGGTAGAACATT
L8R: GATACTAGTTGGGTTCTTAACCTGTTG 60 7212 144986968-144994180
L9F: CCACCTCAGGTAAGAGAGATTCC
L9R: GTACCACCCGAATATCAGTCTAACA 57 7219 144992780-144998686
- 39 -
Table 2.2.2: Primers for long-range PCR are given with the annealing temperature, expected DNA
fragment size, and position of the amplicon according to the reference sequence Sscrofa 10.2. These
primers were used to amplify the intergenic region MUC13-ITGB5.
Primers Forward and Reverse Annealing
temperature (°C)
Amplicon
length Position on Sscrofa 10.2
MUC13-ITGB5
L1F: CTTCATTCCATGTAACCCAAGTTC
L1R: AGCCAAGCCCTTTTAGTTAGTTGT 56 8283 145028579-145036861
L2F: ATTCTTTGGGTCTCTCTGAGTGTGAT
L2R: GCTGGAGTAAACACACAGATGAAAG 58 8039 145036439-145044477
L3F: ATTCAACAGTACCTAGAGACCCAAC
L3R: GAGTTTGTTTCCGTCTTGCTACTA 56 8285 145044740-145053024
L4F: CACAAAGGCTATTTTTGATGGACA
L4R: GTTGTGCAGAAAAAGTGTGCAGAT 56 8446 145052603-145061048
L5F: GGCAAAGGAGAAGACACAAAAGTAT
L5R: CAGGAGTAAAGAGCAATAAGGGAAA 56 7863 145060619-145068481
L6F: TCCTTAACTACGAAATGACAACAGG
L6R: AATGGTCTGTCACAGGTAGCAATAG 56 5629 145068329-145073958
L7F: AAGGAGAAGAAGGACTAAACATCCA
L7R: TGAACATTCCTCTGTTTGAGTCAG 56 8359 145073682-145082120
L8F: AAAAGTCTGTCTGAAGGATATGGAG
L8R: GTGTTGGAGCTTCTCATTCTAAACT 56 8393 145081837-145090229
L9F: CAGGAAATTACTGGGCAAGAGAATA
L9R: GACTCTCTAGAAGTTGCCTCTGAGTT 56 8681 145089847-145098527
L10F: AGGAAGAGAAAGGGTTTGAAGAGAA
L10R: TCTTTTAATGAGCCGTTCTGATCC 56 8420 145098283-145106702
L11F: AGGGTAGGAAAAGAAACACTGACTT
L11R: GTAGGCTTTTTAAGGTCTGGAACA 56 5439 145106518-145111956
2.3.2.4 PCR for pyrosequencing
The PCRs for pyrosequencing were performed in a 40 µl reaction volume. The amount of DNA,
dNTPs, PCR buffer, primers, MgCl2, and Taq polymerase were comparable to a standard PCR. One of the
primers was biotinylated at the 5’ end. Amplification was carried out in 96-well plates. After an initial
denaturation at 95°C for 5 min, the samples were cycled 45─50 times, as follows: denaturation at 95°C
for 15 s, annealing at 53─59°C for 30 s, and extension at 72°C for 15 s. At the end, samples were
extended at 72°C for 4 min. These PCRs were designed to amplify fragments no longer than 300 bp
(Table 2.3). The sequencing primers annealed to the opposite strands of the biotinylated primers.
- 40 -
Table 2.3: Primers for pyrosequencing are given with the SNPs, DNA fragment size, and annealing
temperature. The biotinylated primers are written in bold.
Gene SNPs
F: forward-, R: reverse-,
S: sequencing primers
Annealing
temperature (°C)
Amplicon
length Position of SNPs
ZDHHC19
g.4043 T/C
F: TCCTACGAGGGCAAGGTATGTG
R: GAACTGAATCTGGTCTGGAATAGC
S: GCAAGGTATGTGGGGA
53 171
KIAA0226
g.62250 A/G
F: GCGGGAGCTGCTAGCCAA
R: GGGCTTCGGTGGGTTCCT
S: CCTCGTAGTCCGACA
59 70
MUC13
813 T/C F: AAAGAGGTTTCCTGCTCCTAGGT
R: GCCATTGTCAGATCCTAATTCC
S: TTGCAGGTTTTGAAAGT
55 148 814 G/T
ALGA0072075 C/T
F: TCGTTTTCATCTCTGGCAGATTG
R: CAGCCACTCAGGTCTCCATACTCT
S: CATGCGTTGGAGAAT
56 105
ALGA0106330 A/G
F: TTGGGCCCCATCTTTGGA
R: CCTCCCCTTTGACTGTCACATCT
S:AGGTAGCTGAGCCCC
55 184
2.3.3 Agarose gel electrophoresis
The PCR products were run on 0.8─1.5% agarose gels in 0.5 X TBE buffer containing 100 µg/l
EtBr at 75─100 mA for 0.5 to 1 h. A 6 X DNA loading dye was added to the PCR products prior to
loading. Depending on the size of the fragments, a 50 bp, 100 bp, or 1 Kb size standard was used. DNA
was visualized after the run under UV lights.
2.3.4 Genescan analysis
Microsatellite polymorphisms of labelled PCR products were visualized by genescan analysis
(Table 2.4). A mixture of 0.5 µl PCR product, 2.5 µl formamide, and 0.5 µl genescan 350 size standard
was denatured at 95°C for 5 min, and 1─2 µl were loaded on a 4.5% polyacrylamide gel. The samples
were run on an ABI Prism377 DNA Analyzer.
- 41 -
Table 2.4: Microsatellite markers used for genescan analyses shown with the accession number,
fluorescent labelling at the 5’ end of the forward primer, and annealing temperature of the microsatellite,
as well as size range of the PCR product (1Fredholm et al., 1993; 2Winterø & Fredholm, 1995; 3Davies et
al., 1994; 4Rohrer et al., 1994; 5Alexander et al., 1996; 6Joller et al., 2009; 7Karlskov-Mortensen et al.,
2007).
Microsatellite
marker
Accession
no.
Modification at
the 5’ end
Annealing
temperature (°C) Size range (bp)
1S0068 M97244 TET 62 211-260
2S0075 AF044970 FAM/HEX 62 134-162
3S0283 X79925 FAM 62 132-148
4SW207 AF235238 FAM 58 170-188
4SW698 AF235339 TET/FAM 58 194-224
5SW1876 AF253726 FAM 65 204-258
6HSA125gt FM877810 HEX 59 200-240
6MUC4gt FM877809 FAM 59 210-250
7KVL1293 EF131094 HEX 55 249-253
8HEG1T4A --- HEX 53 258-257
8 Microsatellite HEG1T4A (TTTTA repeats) was discovered while sequencing candidate gene HEG1 and
was later registered in dbSNP (NCBI). This microsatellite mapped twice on SSC13, due to an error in the
reference sequence 10.2 at 144695707/144920548 bp.
2.3.5 Pyrosequencing
Pyrosequencing relies on the detection of pyrophosphate release following nucleotide
incorporation (Ronaghi et al., 1998). The analyses were performed using a PyroMark Q24 (Qiagen) at the
Genetic Diversity Centre (GDC), ETH Zurich. To make the templates for pyrosequencing, a single-strand
DNA (ssDNA) is immobilised with the use of streptavidin-coated magnetic beads that bind to the
biotinylated primer incorporated in the sequence, as described in Section 2.3.2.4.
The ssDNA template is hybridised with a sequencing primer and incubated with DNA
polymerase, ATP sulfurylase, luciferase, apyrase, adenosine 5´ phosphosulfate (APS), and luciferin. The
addition of a dNTP starts the sequencing process. The DNA polymerase incorporates the dNTPs into the
template. Pyrophosphate (PPi) is released and then converted in the presence of adenosine 5´
phosphosulfate in ATP by enzyme ATP sulfurylase. The ATP is used by luciferase to convert luciferin
- 42 -
into oxyluciferin, generating visible light in an amount proportional to the ATP generated. The light is
detected by a camera and converted to sequence data by software. Unincorporated nucleotides and ATP
are degraded by the apyrase, and the reaction restarts with another nucleotide, until the ssDNA sequence
is determined (Figure 2.2).
Figure 2.2: Example of a pyrogram showing the nucleotide sequence in a specific section of DNA. The
tops represent light emission and nucleotide binding; the height of each peak is proportional to the
number of nucleotides incorporated. SNPs are in the yellow band. A heterozygous SNP has half the signal
strength of a homozygous SNP.
2.3.6 SNP chip
The Porcine SNP60 DNA BeadChip (Illumina, Inc., San Diego, CA, USA) possesses 62,163
probes. It offers comprehensive coverage of the porcine genome for whole-genome association studies,
estimation of genetic breeding value, identification of quantitative trait loci, and comparative genetic
studies (Gunderson et al., 2005; Steemers & Gunderson, 2007; Ramos et al., 2009). Each chip contains 12
independent arrays and can be used to determine genetic variation in porcine breeds such as Duroc,
Landrace, Piétrain, and Large White. The BeadChip was developed through Illumina's iSelect program, in
collaboration with leading porcine researchers from both US and international universities and research
institutes, including Iowa State University, the University of Illinois, Cambridge University, and
Wageningen University. All the SNPs have been deposited in dbSNP (NCBI) under accession numbers
ss131027063 to ss131629651 (Table 2.5).
For our project, we organized a three-generation study on 32 pigs selected from UEH. A blood
sample was taken from all the pigs, after which the DNA was extracted, purified with a GenElute
Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich), and the concentration measured with the
- 43 -
Qubit (Invitrogen), as described in Section 2.3.1. The DNA was then used for the SNP arrays at the
NCCR "Frontiers in Genetics", University of Geneva.
Table 2.5: Selected SNPs belonging to the Illumina Porcine SNP60 BeadChip (Illumina, Inc., San Diego,
CA, USA) (Ramos et al., 2009). Primers are given with the SNPs, DNA fragment size, annealing
temperature, and position of SNPs according to the reference sequence Sscrofa 10.2.
SNPs name Primers Forward and Reverse
Annealing
temperature
(°C)
Amplicon
length
Position
on Sscrofa
10.2
MARC0067282 MARC-1F: TGGGTTAAGGATCCAGCACT
MARC-1R: GTCAAGGACAGGCCAACATT 55 490 144611608
ALGA0072075 ALGA-5F: ATCACCTCCTGGAACCACAG
ALGA-5R: AAAGCTGCGGACAGTGAGAT 57 692 144832256
ALGA0122555 ALGA-1F: CCTTTGACCTACCTGCCTGT
ALGA-1R: GGAGGGTTCCTTTTTCTCCA 54 489 144946317
ALGA0106330 ALGA-4F: CGATCAAGTTCAAGATCTCTTCTG
ALGA-4R: TGACTGTCACATCTTCCTTATCTT 55 249 145009805
ALGA0106230 ALGA-3F: CTGAGACCTGCTGCTGTCC
ALGA-3R: ATCTCCCCCAGCTTCACAAT 55 273 145023374
H3GA0037348 H3GA-1F: CTGAGCTGATGGGGAAGAAC
H3GA-1R: GATCTCAGGCTGATCCCAGA 55 497 ---1
DIAS0000584 DIAS-1AF: TCGGTAAAAGAGTGAGCCTTG
DIAS-1AR: ACTGGGCATGCTGACGTT 56 244 145414267
H3GA0037371 H3GA-2F: CCAGCCATCTCGATTTGC
H3GA-2R: CAGAGCTGATGGGAGAAAGG 55 334 145473321
MARC0006918 MARC-4F: ATTCGGCAATGCCTCTCC
MARC-4R: CCTGCTCACACAGCTTCC 55 400 ---1
MARC0045417 MARC-5F: CAAGAGGGGTGATGCAGAAT
MARC-5R: CTGGTTTTTGTTTGGGGATG 53 396 146679892
ALGA0072168 ALGA-7F: GGCTGAGTACATATCATCCATCC
ALGA-7R: CAATGTAACATCCAAATCTGTTTTT 54 397 147489986
ALGA0072286 ALGA-10F: TGAGTGTTTGATCCAGCTTCC
ALGA-10R: CCAAGACGATACTTTGGATTCA 55 449 153425171
ALGA0072308 ALGA-11F: TTCTGGGGGTGGATTATCAG
ALGA-11R: CATCCCATACCTGTCAGCCTA 55 376 154103780
1 SNPs were not found in reference sequence Sscrofa 10.2.
2.3.7 PCR restriction
The PCR products were digested in a total volume of 25 µl, using 1─2 U restriction enzyme at
an appropriate temperature for 2─16 h, according to the manufacturer’s instructions. Restriction samples
- 44 -
were run on agarose gels containing EtBr, to visualise and identify the restriction fragment length
polymorphisms (RFLPs) (Table 2.6).
Table 2.6: Selected SNPs in TNK2, MUC4, HEG1, and MUC13 genes and in the Illumina Porcine SNP60
BeadChip (Illumina, Inc., San Diego, CA, USA) (Ramos et al., 2009), detected by PCR-RFLP.
Restriction enzymes and lengths of the digested fragments are given.
Gene Primers SNP Restriction enzyme Length of digested fragments (bp)
Position of SNPs
TNK2
g.7075 TNK2e6-7-Fc2/R A
TaqI 189, 436
C 625
g.7717 TNK2e9j-F/R T
BseDI 1, 9, 19, 24, 43, 45, 88, 142, 181
C 1, 9, 19, 24, 43, 45, 73, 88, 108, 142
g.11142 TNK2e12b-Fv2/Rv2 A
AluI 18, 27, 97, 134, 214, 261
G 17, 18, 27, 97, 117, 214, 261
MUC4
g.6242 MUC4-6138-F/6887-R A
DdeI 106, 102, 261, 280
G 106, 261, 382
g.7947 MUC4-7741-F/8202-R G
Hin1II 4, 38, 42, 147, 231
A 4, 38, 42, 102, 129, 147
g.8227 MUC4-8012-F/8378-R G
XbaI 155, 212
C 367
HEG1
g.5244 HEG1-F/R T
TspRI 34, 79, 240
C 26, 34, 79, 214
MUC13
226 MUC13-F/R A
FOKI 247, 289
G 33, 214, 289
c.1930 MUC13-ED2-F/R T
HaeIII 61, 242, 393
G 61, 65, 177, 393
MARC0067282 MARC-1F/R T
DdeI 240, 250
C 45, 195, 250
ALGA0122555 ALGA-1F/R T
TaqI 489
C 208, 281
H3GA0037348 H3GA-1F/R A
TaqI 99, 398
C 497
DIAS0000584 DIAS-1AF/R C
PstI 244
G 101, 143
H3GA0037371 H3GA-2F/R A
DdeI 153, 181
G 334
MARC0006918 MARC-4F/R A
DdeI 51, 349
G 51, 168, 181
- 45 -
Continued from previous page
Position of SNPs Primers SNP Restriction enzyme Length of digested fragments (bp)
MARC0045417 MARC-5F/R G
TaqI 176, 220
A 396
ALGA0072168 ALGA-7F/R G
HaeIII 195, 202
A 397
ALGA0072286 ALGA-10F/R A
TspRI 86, 363
G 86, 96, 267
ALGA0072308 ALGA-11F/R A
Hin1II 90, 134, 152
G 71, 81, 90, 134
2.3.8 High throughput sequencing
2.3.8.1 Illumina HiSeq 2000
DNA samples from two pigs selected from UEH were used as templates to amplify, by long-
range PCR, the intergenic regions HEG1-MUC13 and MUC13-ITGB5 (Tables 2.2.1 and 2.2.2). The long-
range PCR products were purified as described in Section 2.3.9. The DNA concentration was measured
with the Qubit (Invitrogen), as described in Section 2.3.1. The samples were sent to the Functional
Genomics Center Zurich (FGCZ), a joint state-of-the-art facility of the ETH Zurich and the University of
Zurich, to be sequenced by a HiSeq 2000 (Illumina, Inc., San Diego, CA, USA). The library preparation
was conducted according to Illumina protocols (Figure 2.3).
Figure 2.3: Simplified diagram of the Illumina HiSeq 2000 sequencing procedure (Illumina).
- 46 -
2.3.8.2 PacBio RS
Long-range PCR products A and B and L8 in HEG1-MUC13 were later resequenced in both pigs
again at FGCZ, using a PacBio RS (Pacific Biosciences of California, Inc., USA).
The long-range PCR samples were first sheared into a random library of ~1000 bp fragments and
converted into SMRTbell™ library (Travers et al., 2010). The SMRTbell™ structure consists of a
double-stranded portion containing the fragment of interest and a single-stranded hairpin loop on either
end. The hairpin loop provides a site for the primer binding. Sequencing primers were annealed to the
DNA, and a modified DNA polymerase was added in order to form a template-polymerase complex. This
complex was loaded onto a chip containing 150,000 microscopic cavities (zero-mode waveguides or
ZMVs). One complex was immobilised at the bottom of one ZMW. By adding the four differently
labelled nucleotides, the sequencing reaction was started. The fluorescent dye was attached to the
phosphate chain of the nucleotide. The dye was cleaved off with the phosphate chain when the nucleotide
was incorporated by the DNA polymerase and the incorporation of the nucleotide registered base per
base. The cleaved fluorescent dye was detected at the bottom of each chamber; when the dye molecules
started to diffuse away, no fluorescence signal was detected until the incorporation of the next nucleotide
(Figure 2.4).
Figure 2.4: Simplified diagram of the PacBio RS sequencing procedure (Pacific Biosciences).
- 47 -
2.3.9 PCR purification
The PCR products for sequencing were purified and concentrated using Montage PCR
centrifugal filter devices (Millipore) or Microcon centrifugal filter units (Millipore), as described in the
manufacturer’s protocol. The PCR products were applied to the filter and supplemented with ddH2O to
400 µl. After centrifugation at 1000 g for 15 min, 21 µl ddH2O were added to the filter. After 5 min at
room temperature, the filter was placed upright on an empty tube and centrifuged at 1000 g for 2 min.
A modified method, described by Boyle & Lew (1995), was also used to purify PCR products
for sequencing and long-range PCRs. The volumes of the PCR products were estimated and 2 vol of
guanidine HCl 6 M were added, then 20 µl of silica suspension were added (Appendix). The DNA was
left binding to the silica beads for 10 min at room temperature; the tubes were inverted several times in
order to keep the beads in suspension. After centrifugation for 1 min at 13,000 rpm, the supernatant was
discarded and the silica pellet was washed with 2 vol of cold wash buffer (Appendix). The solution was
centrifuged again at 13,000 rpm for 1 min, and the supernatant was discarded. The washing step was
repeated twice, and the pellet was left to air dry at room temperature for 10 min. The DNA was
resuspended from the silica beads with 20 µl of distilled water at 55°C. The solution was centrifuged
again at 13,000 rpm for 1 min, and the supernatant containing the DNA was collected in a separate tube.
The DNA concentration was measured with the Qubit (Invitrogen), as described in Section 2.3.1.
A 15 ng/100 bp fragment was sent for sequencing (Microsynth, Balgach).
Long-range PCRs of the intergenic regions HEG1-MUC13 and MUC13-ITGB5 were purified by
using a QIAquick® gel extraction kit (Qiagen). The long-range PCR products were run on 0.8% agarose
gels in 0.5 X TBE buffer containing 100 µg/l EtBr at 75─100 mA for 2 h with a 1 Kb size standard.
Under UV lights, with the use of a scalpel, the expected bands were excised and placed in 1.5 ml tubes.
The gel pieces (100─200 mg) containing the DNA fragments were suspended in 300 µl of Buffer QG
from the kit, incubated at 50°C for 10 min, and vortexed. After the incubation, 100 µl of isopropanol were
added. The solution was transferred to a QIAquick spin column and centrifuged at 13,000 rpm for 1 min.
The flow-through was discarded, and 500 µl of Buffer QG were again added to the column. After
centrifugation, the flow-through was again discarded. The column was washed with 750 µl of Buffer PE
- 48 -
and centrifuged for 1 min at 13,000 rpm. The column was placed in a clean 1.5 ml tube, and the DNA
eluted in 30 µl of Buffer EB (10 mM Tris-HCl, pH 8.5) after centrifugation for 1 min at 13,000 rpm.
The DNA concentration was measured with the Qubit (Invitrogen), as described in Section 2.3.1.
The templates were diluted to the concentration required and sent for sequencing to the FGCZ, as
described in Section 2.3.8.
2.4 RNA methods
2.4.1 RNA extraction
Total RNA from intestinal scrapings was extracted with TRIzol (Invitrogen), and the tissue was
deep-frozen in liquid nitrogen. Of the material, 100 mg were homogenised in 1 ml of TRIzol with a
stator-rotor tissue homogeniser. The homogeniser was cleaned before and after each sample with
deionized water, NaOH 1 M, to prevent carry-over of RNA from one sample to another. The homogeniser
was again rinsed in water, dried, and dipped in TRIzol before the homogenisation of the next sample.
The solution was then incubated at room temperature for 5 min, after which 200 µl of chloroform
were added. The sample was vortexed for 15 s and incubated at room temperature for 2─3 min, and then
the solution was centrifuged at 12000 g for 15 min at 4°C. The mixture was separated into a lower red
phase, an interphase containing the genomic DNA, and an aqueous upper phase containing the RNA
(60% of the mixture volume). The aqueous phase was transferred into a new tube, and the RNA was
precipitated by adding 500 µl of isopropyl alcohol. The sample was incubated at room temperature for 10
min, and then centrifuged at 12,000 g for 10 min at 4°C. The RNA formed a gel-like pellet on the sides
and bottom of the tube. The supernatant was removed using a vacuum device, and the pellet was washed
with 1 ml of EtOH 75% and centrifuged at 12,000 g for 5 min at 4°C. The ethanol was removed with the
vacuum device, and the pellet was left to air dry for 5─10 min then resuspended in 30 µl of RNAse-free
water. The sample was incubated for 10 min at 55°C, and stored at -70°C.
- 49 -
2.4.2 RNA quantification
RNA concentration was measured using a Qubit® (1.0) fluorometer with a Qubit® Quant-
iTTMRNA assay kit (Invitrogen) or using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific).
Total RNA quality was tested using a 2100 Bioanalyzer, and an RNA 6000 Nano Chip (Agilent
Technologies), provided by the FGCZ. The chips are made of glass and have an interconnected network
of etched micro-channels filled with a gel-dye mixture. Each chip contains 16 wells: three for loading the
gel-dye mixture, one for a molecular size ladder also used as a reference for calculating the concentration
of RNA fragments, and 12 for the samples. The movement of the RNA through the micro-channels is
controlled by a series of electrodes and a software program that allows automated data analysis (Panaro et
al., 2000; Mueller et al., 2000). All the RNA chips were prepared according to the manufacturer’s
instructions, with the materials provided by the kit. After the run, the Bioanalyzer displayed the data as
both migration-time plots and as computer-generated virtual pictures.
Figure 2.5: Electropherograms of total RNA extracted from intestinal scrapings. Left: good quality RNA.
The two main peaks correspond to rRNA subunits 18S and 28S. Right: partially degraded RNA.
2.4.3 Reverse Transcription PCR
The M-MLV reverse transcription system (Promega) was used for reverse transcription-PCR
(RT-PCR) of total RNA. A total of 20 µg of RNA was treated with 30 U of DNase (Qiagen), 10 X of
DNase buffer, and RNase-free water up to 100 µl reaction volume. The samples were incubated at 37°C
for 1 h, and then at 70°C for 5 min to inactivate the enzyme. The RNA was then stored at -70°C or used
for the M-MLV RT-PCR.
The RT-PCR was usually performed with 2 µg of DNase-treated RNA. The RNA was placed in
microcentrifuge tubes with 1 µg of either random nonamers or oligo(dT)17 primers. The samples were
incubated for 5 min at 70°C and then placed on ice. Then, a master mix was added to the sample, for a
- 50 -
total volume of 25 µl. The master mix was made with 5 X Reaction Buffer (250 mM Tris-HCl, 375 mM
KCl, 15 mM MgCl2, 50 mM DTT), 5 mM MgCl2, 20 U recombinant RNasin, and 200 U M-MLV reverse
transcriptase. The sample was then incubated for 1 h at 42°C, in cases when oligo(dT)17 primers were
added, or the incubation was at 37°C when random nonamers were used.
To inactivate the M-MLV enzyme, the cDNA was incubated at 95°C for 5 min. The cDNA was
then stored at -20°C or used immediately in a PCR for beta-actin (ACTB) to test the quality of the RT-
PCR. The primers for ACTB were designed from exon sequences. The expected band is around 250 bp if
genomic DNA is used as template and 150 bp with cDNA (Table 2.1). This control PCR shows, under
UV lights after the gel run, if there are possible genomic DNA contaminations in the cDNA samples.
2.4.4 PCR and sequencing
The cDNA was used for specific PCRs with primers designed from exon sequences (Table 2.1).
Usually, 1 µl of cDNA was taken as a template. PCR was performed on the cDNA templates in 25 µl
reaction volume analogous to standard PCR, as described in Section 2.3.2. Purification of the cDNA
PCRs was performed with Microcon centrifugal filter units, as described in Section 2.3.6. The RNA
concentration was measured with the Qubit (Invitrogen), as described in Section 2.3.1. A 15 ng/100 bp
fragment was sent for sequencing (Microsynth, Balgach).
2.4.5 High throughput sequencing
Total RNA from intestinal scrapings was extracted from five pigs selected from UEH. The RNA
was extracted with TRIzol (Invitrogen), as described in Section 2.4.1. RNA concentration was measured
with the Qubit (Invitrogen) or using a NanoDrop (Thermo Scientific), as described in Section 2.4.2. Total
RNA quality was tested using a 2100 Bioanalyzer (Agilent Technologies) at the FGCZ, as described in
Section 2.4.2. The samples were sent to the FGCZ to be sequenced by the SOLiDTM 3 System (Life
Technologies, Inc., Carlsbad, CA, USA). For constructing a library, 500 ng of total RNA depleted of
ribosomal RNA were needed from each sample. The RNA was ligated with adaptors and reverse
transcripted in cDNA. The cDNA was amplified and again size-selected, and the library was ready for
sequencing on the SOLiDTM 3 System.
- 51 -
Figure 2.6: Simplified diagram of the SOLiDTM 3 System RNA sequencing procedure (Life
Technologies)
2.5 Computational methods
2.5.1 Linkage analysis
PCR sequences containing SNPs were compared using either Chromas Pro v. 1.5 or CLC
Sequence Viewer v. 6.4 software. The alleles of the microsatellites were analysed with the ABI PRISM®
GeneScan® Analysis Software v. 2.1 software. IGV v. 2.1 software was used to compare the high-
throughput sequencing of the cDNA samples and of the long-range PCR in the intergenic regions HEG1-
MUC13 and MUC13-ITGB5. The haplotypes were determined using Merlin (Abecasis et al., 2002) and
HaploPainter software (Thiele & Nürnberg, 2005).
2.5.2 Statistics of F4ad adhesion
Bacterial adhesion to the enterocytes was either 0% or close to 100% in most UEH pigs tested
with the F4ad MAT, particularly in sites A and D (Section 3.8.1). The percentage of ETEC F4ad adhesive
- 52 -
enterocytes is not normally distributed, and a normal distribution could not be achieved even with the
transformation of the data. The data was analysed using the Kruskal-Wallis one-way analysis of variance.
The Kruskal-Wallis is based on ranks and does not require a normal distribution of the data. Statistical
analyses were performed with SYSTAT v. 13 software (Systat SoftwareGmbH, Erkrath, Germany).
Models of inheritance for ETEC F4ad receptor were created by analysing the matings with the
Pedigree Analysis Package v. 4.0 (Department of Human Genetics, University of Utah, UT, USA).
2.5.3 In silico mapping
Human sequences were used for BLAST searches and compared to the pig genome generated by
the Swine Genome Sequencing Consortium (Schook et al., 2005; http://www.sanger.ac.uk/cgi-
bin/blast/submitblast/s_scrofa). Human and pig sequences were compared with the ones present in NCBI
(http://blast.ncbi.nlm.nih.gov/). The physical positions of SNPs and microsatellites were determined by
blasting the sequences in the Pig Genome Database, Sscrofa 10.2 (NAGRP Blast Center;
http://www.animalgenome.org/blast/). The physical positions of the BAC clones to which the sequences
belonged were determined from the BAC fingerprint contig map (Humphray et al., 2007;
http://pre.ensembl.org/Sus_scrofa_map/Info/Index).
- 53 -
3. RESULTS
3.1 Exclusion of gene MUC4 as locus for F4bcR
From the SPS, 78 pigs of 38 litters were phenotyped for ETEC F4ab/F4ac susceptibility using
MAT, and their genotype in MUC4_g.8227 was determined by PCR-RFLP (Figure 3.1, Table 2.6). Sixty-
four pigs (82%) were typed as susceptible to ETEC F4ab/F4ac. SNPs MUC4_g.8227 was in LD with the
F4bcR in only 92.3% of the pigs. Pig 2055NO, susceptible to ETEC F4ab/F4ac in the MAT, was
genotyped in MUC4_g.8227 as C/C, the C allele being associated with the absence of ETEC F4ab/F4ac
adhesion. Five pigs (3887C2, 4626II, 6134BLW, 6240PU and 6245PU) were phenotyped as resistant,
whereas their genotype was C/G in MUC4_g.8227 indicating a susceptibility to ETEC F4ab/F4ac.
From the UEH, boar 2349, which was used for breeding purposes, was found to have a
recombination in the MUC4-F4bcR interval. Boar 2349 was homozygous for the susceptible allele at the
F4bcR locus, but heterozygous in SNP MUC4_g.8227. Boar 2349 was mated with four sows that were
resistant to ETEC F4ab/F4ac, generating 48 offspring. The offspring were phenotyped with MAT and
genotyped in MUC4_g.8227 (Figure 3.1). All offspring were susceptible to ETEC F4ab/F4ac; 25 (52.8%)
showed in MUC4_g.8227 as a C/C genotype that is usually associated with the absence of ETEC
F4ab/F4ac adhesion. MAT confirmed the homozygosity for the allele resistant to ETEC F4ab/F4ac in the
sows.
Boar 2349 and its offspring were tested with PCR-RFLP for other SNPs in MUC4. SNPs
MUC4_g.6242 A>G and MUC4_g.7947 G>A are also associated with ETEC F4ab/F4ac
susceptibility/resistance (Figure 3.1, Table 2.6). The other two SNPs were selected according to haplotype
information, based on 10 Nordic Experimental Herd (NEH) pigs and 10 Swiss pigs provided by
Jørgensen’s Danish group. Boar 2349 was heterozygous in both SNPs as in MUC4_g.8227. The offspring
with a C/C genotype in MUC4_g.8227 had a G/G and an A/A genotype in MUC4_g.6242 and
MUC4_g.7947, respectively, associated with the absence of ETEC F4ab/F4ac adhesion.
The parents of 2349, boar 1978 and sow 2002, were genotyped for the same SNPs. Two siblings,
2344 and 2348, from the same litter as 2349, were also genotyped (Figure 3.2, Table 3.1). The pigs were
sequenced in the interval MUC4_g.6138-6887 that contains, together with SNP MUC4_g.6242, another
- 54 -
11 SNPs not in LD with F4bcR (Table 3.1). Haplotype analyses showed that 2349 inherited the
recombinant allele in MUC4 from 1978, by a crossing-over event during meiosis (Figure 3.2). The
recombinant allele was then transmitted from 2349 to half its progeny.
Figure 3.1:
Left: Restriction pattern of DdeI digestion of MUC4-6138-F/6887-R 749 bp PCR product to determine
the MUC4_g.6242 A>G polymorphism. Middle: Restriction pattern of Hin1II digestion of MUC4-7741-
F/8202-R PCR products to determine the MUC4_g.7947 G>A polymorphism. Right: Restriction pattern
of XbaI digestion of MUC4-8012-F/8378-R 367 bp PCR product to determine the MUC4_g.8227 G>C
polymorphism.
- 55 -
- 56 -
Figure 3.2: Diagram of three-generation family tree of 2349 and haplotypes in the SSC13q41-q44 region.
Marker names and position, according to Sscrofa assembly 9, are given on the right side. Animal identity
is shown above the haplotypes. The SNP genotypes are depicted on the left and right sides of the coloured
columns. Digit 1 corresponds to nucleotide A, 2 to C, 3 to G and 4 to T. Microsatellite markers are
represented by 5, 6 and so on, depending on the size of the allelic bands. S above the colored bars
indicates the adhesive haplotype, and s indicates the nonadhesive haplotype. Each haplotype has its own
colour. The lines indicate the relationships among the pigs. The geometric figures above the animal’s
identity indicate the sex: squares indicate males and circles indicate females. The filled figures indicate
ETEC F4ab/F4ac susceptible, and the blank figures represent resistant pigs (Rampoldi et al., 2011
[modified version]).
3.2 Exclusion of interval ZDHHC19-LMLN as locus for F4bcR
For further investigation of the recombinant event in 2349, three SNPs in TNK2 were typed by
PCR-RFLP (Figure 3.3, Table 2.6): TNK2_g.7075 A>C, TNK2_g.7717 T>C and TNK2_g.11142 A>G.
Two SNPs in ZDHHC19 (ZDHHC19_g.4043 T>C) and KIAA0226 (KIAA0226_g.62250 A>G) were
typed by pyrosequencing (Table 2.3). These SNPs were associated with ETEC F4ab/F4ac
susceptibility/resistance by Jørgensen’s Danish group by haplotyping 10 NEH and 10 Swiss pigs. A SNP
in Leishmanolysin-like peptidase (LMLN), LMLN_g.15920, was detected in this study by blasting the
human sequence (NM_001136409) to the pig genome and by sequencing the genomic porcine homolog.
The remaining SNPs in MUC13 and leucine-rich repeat and calponin homology domain-containing
protein 3 (LRCH3) were selected according to the literature.
Haplotype analyses showed that 2349 still possessed a recombinant allele in interval ZDHHC19-
LMLN, but not in MUC13 (Figure 3.2). Boar 2349’s recombination ended in the interval between genes
LMLN-MUC13 (~808 Kb). Two SNPs tested in MUC13, MUC13-226 and MUC13-813, were in LD with
F4bcR in 2349’s family (Table 3.1).
SNP MUC13-226 is mapped in an intronic region of MUC13, and it is a restriction site for
enzyme FOKI (Figure 3.4, Table 2.6). SNP MUC13-813 is mapped in an exon. However, the C>T
transition is a silent mutation. SNP MUC13-813 was tested in our study by pyrosequencing (Table 2.3).
- 57 -
Table 3.1: Polymorphisms in genes ZDHHC19, TNK2, MUC4, KIAA0226, LRCH3, LMLN and MUC13
of 2349’s family, which were determined by sequencing, pyrosequencing, and PCR-RFLP. SNPs name
and changes in nucleotides are given. The ETEC F4ab/F4ac phenotype is given as S for susceptibility and
s for resistance.
F4bcR S>s S/S S/S s/s S/s S/s
SNPs 2349 2348 2344 1978 2002
ZDHHC19
g.4043 T>C T/C T/T C/C T/C T/C
TNK2
g.7075 A>C A/C A/A C/C A/C A/C
g.7717 T>C T/C T/T C/C T/C T/C
g.11142 A>G A/G A/A G/G A/G A/G
MUC4
g.6242 G>A G/A A/A G/G G/A G/A
g.6308 G>T G/T T/T G/G G/T G/T
g.6317 G>A G/A A/A G/G G/A G/A
g.6321 G>C G/C C/C G/G G/C G/C
g.6609 T>A A/A A/A T/A A/A A/T
g.6616 G>T T/T T/T G/T T/T T/G
g.6634 A>C C/C C/C A/C C/C C/A
g.6675 Del GAACGT/No Del Del Del Hetero Del Hetero
g.6690 A>T T/T T/T A/T T/T A/T
g.6745 T>C C/C C/C T/C C/C C/T
g.6770 G>T T/T T/T G/T T/T T/G
g.6862 T>C C/C C/C T/C C/C C/T
g.7947 A>G A/G A/A G/G A/G A/G
g.8227 G>C G/C G/G C/C G/C G/C
KIAA0226
g.62250 A>G A/G A/A G/G A/G A/G
LRCH3
212 G>C G/C G/G G/C G/C G/G
213 G>C G/C G/G G/C G/C G/G
214 T>C T/C T/T T/C T/C T/T
215 T>A T/A T/T T/A T/A T/T
216 No Del/Del A Hetero No Del Hetero Hetero No Del
217 G>A G/A G/G G/A G/A G/G
218 A>G A/G A/A A/G A/G A/A
219 G>T G/T G/G G/T G/T G/G
LMLN
g.15920 G>C G/C G/G G/C G/C G/G
MUC13
227 T>C T/T T/T T/C T/C T/T
226 A>G A/A A/A G/G A/G A/G
225 C>G C/C C/C C/G C/G C/C
224 G>A G/G G/G G/A G/G G/A
- 58 -
Continued from previous page
F4bcR S>s S/S S/S s/s S/s S/s
SNPs 2349 2348 2344 1978 2002
MUC13
223 C>T C/C C/C C/T C/C C/T
813 C>T C/C C/C T/T C/T C/T
814 G>T G/G G/G T/T G/G G/T
829 A>C A/A A/A C/C A/A A/C
895 A>C A/A A/A C/C A/A A/C
905 G>A G/G G/G A/A G/G G/A
908 G>A G/G G/G A/A G/G G/A
920 A>G A/A A/A G/G A/A A/G
933 C>T C/C C/C T/T C/C C/T
935 A>C A/A A/A A/A A/A A/A
Figure 3.3:
Left: Restriction pattern of TaqI digestion of TNK2e6-7-Fc2/R PCR product to determine the
TNK2_g.7075 A>C polymorphism. Middle: Restriction pattern of BseDI digestion of TNK2e9j-F/R PCR
product to determine the TNK2_g.7717 T>C polymorphism. Right: Restriction pattern of AluI digestion
of TNK2e12b-Fv2/Rv2 PCR product to determine the TNK2_g.11142 A>G polymorphism.
- 59 -
Figure 3.4:
Left: Restriction pattern of TspRI digestion of HEG1-F/R PCR product to determine the HEG1_g.5244
T>C polymorphism. Middle: Restriction pattern of FOKI digestion of MUC13-F/R PCR product to
determine the MUC13-226 A>G polymorphism. Right: Restriction pattern of HaeIII digestion of
MUC13-ED2-F/R PCR product to determine the MUC13_c1930 T>G polymorphism.
3.3 SNPs chip results
To investigate further the recombinant event in 2349, we performed a three-generation study
using the Porcine SNP60 DNA BeadChip. Thirty-two pigs were selected, including 2349, its parents, two
siblings, and 18 offspring from four different matings. Prof. Martien Groenen and his group at Animal
Breeding and Genetics (Wageningen University, Netherlands) provided the SNPs sequence and their
position in the reference sequence 9.0.
The BeadChip contained 62163 SNPs. Of these, only 3638 were located on SSC13. The
recombinant haplotype of boar 2349 started ~6.4 Mb distal to gene ZDHHC19. Sixty-three SNPs were
located in the interval ZDHHC19-S0075 (Table 3.2).
Four SNPs derived by the BeadChip were in complete LD with F4bcR in boar 2349’s family
(Figure 3.2, Table 3.2): SNP ALGA0072075 is mapped in the intergenic region SLC12A8-HEG1, SNP
ALGA0106330 is mapped in an intron of gene MUC13, SNP DIAS0000584 is mapped in an intron of
gene Kalirin (KALRN), and SNP MARC0006918 is mapped in an intron of gene MYLK. Pig 2349’s
recombination ended at SNP ALGA0072075 (Figure 3.2). The SNP was mapped to reference sequence
10.2 at 144832256 bp in SSC13.
- 60 -
Table 3.2: List of SNPs from the Porcine SNP60 DNA BeadChip located in the interval ZDHHC19-
S0075. Genes and microsatellites are written in bold. The position of SNPs, microsatellites and the mean
position of genes are according to reference sequence 10.2. SNPs in LD with F4bcR are highlighted.
ZDHHC19 143310000 ALGA0106230 145023374
H3GA0037318 143315618 ITGB5 145060000
ALGA0072055 143574087 S0283 145083113
H3GA0037333 143593394 H3GA0037348 ---2
MARC0012378 143618378 H3GA0037351 ---2
M1GA0017682 143624457 ALGA0072090 145096895
MARC0093203 143638483 MARC0096736 145146697
TNK2 143650000 DIAS0001297 145176833
ASGA0058885 143656188 ALGA0072091 ---2
MUC4 143810000 MARC0112804 145223359
ASGA0058906 143825858 ALGA0072095 145300325
ALGA0072062 143866440 ALGA0115627 145338186
KIAA0226 143890000 ALGA0072104 145547495
ALGA0072071 144065180 KALRN 145410000
ASGA0058918 144082720 DIAS0000584 145414267
MARC0089106 144094647 MARC0021405 145431613
LRCH3 144100000 H3GA0037371 145473321
MARC0043596 144126389 ALGA0072105 145504531
ALGA0072067 144145817 ALGA0072101 145578358
ALGA0072065 144167475 ALGA0072097 145598524
ALGA0072072 144197577 ASGA0058947 145611904
LMLN 144200000 ASGA0058958 145732401
MARC0096777 144499692 MARC0088848 145772058
MARC0099692 144488410 ALGA0105068 146120125
ZNF148 144540000 ASGA0096469 146122112
MARC0067282 144611608 MYLK 146200000
SLC12A8 144850000 MARC0006918 ---2
ALGA0072075 1448322561 ASGA0058970 ---2
HEG1 144800001 H3GA0037376 146288325
MARC0002946 1448101001 H3GA0037373 146265419
ASGA0058923 1447818091 ASGA0058962 146244907
INRA0041036 1447600371 ALGA0072134 146374488
ASGA0058925 1447330311 ALGA0072138 146403234
MARC0006663 1447023921 ALGA0072128 146534002
ALGA0122555 144946317 H3GA0037388 146433577
ASGA0089965 144946742 ASGA0058976 146458592
ASGA0091537 144981309 ASGA0058980 146496697
MUC13 144990000 MARC0053131 146460232/1466045633
ALGA0106330 145009805 S0075 146639048 1 Inversion in Sscrofa 10.2 2 SNP does not map on Sscrofa 10.2 3 SNP maps twice on Sscrofa 10.2
All the SNPs are enlisted according to their physical positions in the genomic DNA
- 61 -
The results of the Porcine SNP60 DNA BeadChip and the genotyping of ZDHHC19-MUC13
interval indicated that 2349’s recombination ended between SNPs LMLN_g.15920-ALGA0072075, a ~0.6
Mb interval comprising genes zinc finger protein 148 (ZNF148) and SLC12A8.
No informative SNPs derived by the BeadChip were found in the LMLN_g.15920-
ALGA0072075 interval.
3.4 Exclusion of interval LMLN-ZNF148 as locus for F4bcR
A second three-generation study on 2349 was perfomed to refine the position of F4bcR locus in
SSC13. More markers were genotyped in the ZNF148-ITGB5 interval (Figure 3.5).
The markers were either selected by literature or detected in this study by BLASTing the human
sequences to the pig genome and sequencing the genomic porcine homolog (Table 2.1).
SNP HEG1_g.5244 was tested by PCR-RFLP (Figure 3.4).
- 62 -
- 63 -
Figure 3.5: Diagram of a second three-generation family tree of 2349 and haplotypes in the SSC13q41-
q44 region. Marker names are given on the left side. Animal identity is shown above the haplotypes. The
SNP genotypes are depicted on the left and right sides of the colored columns. Digit 1 corresponds to
nucleotide A, 2 to C, 3 to G, and 4 to T; 998 corresponds to nucleotide insertion; and 999 corresponds to
nucleotide deletion. Microsatellite markers KVL1293 and HEG1T4A are represented by numbers
corresponding to their peaks in the genescan. S above the coloured bars indicates the adhesive haplotype,
and s indicates the nonadhesive haplotype. Each haplotype has its own colour. The lines indicate the
relationships among the pigs. The geometric figures above animal identity indicate the sex: squares
indicate males and circles indicate females. The filled figures indicate ETEC F4ab/F4ac susceptible, and
the blank figures represent resistant pigs.
Haplotype analyses showed that 2349’s recombination ended in SNP SLC12A8_g.22157, located
in intron 1 of SLC12A8. The SNP was mapped at 144631142bp on reference sequence 10.2. The
sequencing of 2349 excluded that the locus for F4bcR is located in the ZDHHC19-ZNF148 interval and
suggested it may be located in the candidate genes SLC12A8, HEG1, MUC13, or ITGB5.
SNPs in the interval ITGB5_c.246-MARC0006918 were not in LD with F4bcR in boar 2240
(Figure 3.5). SNP SLC12A8_159 was not in LD with F4bcR in all pigs (Figure 3.5). Microsatellite
KVL1293 was in LD with F4bcR in boar 2349’s family. This microsatellite was mapped in intron 12 of
HEG1.
3.5 Exclusion of interval SLC12A8-KVL1293 as locus for F4bcR
Boar 2349 was no longer informative in refining the F4bcR locus in the SLC12A8-ITGB5
interval. Six pigs from SPS with a recombination in MUC4-F4bcR (Section 3.1) were genotyped in the
MUC4-MARC0045417 interval to obtain new information on F4bcR locus position (Table 3.3).
SNPs DIAS0000584 and MARC0006918 were not in LD with F4bcR in the SPS pigs (Table 3.3).
In pigs 3887C2, 4626II, and 6134BLW, the recombination ended proximal to SNP
ZNF148_g.96828. Pigs 6240PU and 6245PU possessed recombinant alleles until SNP SLC12A8_c.2947.
Pig 2055NO possessed a recombinant allele until microsatellite KVL1293, with the exception of SNP
SLC12A8_c.1990 (Table 3.3).
- 64 -
SLC12A8_c.1990 T>C transition encoded for a silent mutation in SLC12A8. This SNP is in LD
with F4bcR in 2055NO, but not in 6240PU and 6245PU. In the interval between SLC12A8_g.129502-
SLC12A8_c.1990-SLC12A8_c.2947, no SNPs in LD with F4bcR were discovered.
Table 3.3: Haplotypes of the six pigs recombinant in MUC4-F4bcR from the SPS showing exclusion of
the MUC4-KVL1293 interval as a locus for F4bcR. SNPs name and nucleotide changes are given.
Microsatellite and peaks in genescan are given. The ETEC F4ab/F4ac phenotype is given as S for
susceptibility and s for resistance.
F4bcR S>s s/s s/s s/s s/s s/s S/s
SNPs 6134BLW 4626II 3887C2 6240PU 6245PU 2055NO
MUC4
g.8227 G>C G/C G/C G/C G/C G/C C/C
ZNF148
g.96828 T>G G/G G/G G/G T/G T/G G/G
SLC12A8
g.129502 T>C C/C C/C C/C T/C T/C C/C
c.1990 G>A A/A A/A A/A G/A G/A G/A1
c.2947 T>A A/A A/A A/A A/T A/T A/A
HEG1-MUC13
ALGA0072075 T>C C/C C/C C/C C/C C/C C/C
HEG1
g.5244 T>C C/C C/C C/C C/C C/C C/C
c.321 T>C C/C C/C C/C C/C C/C C/C
g.49379 T>C C/C C/C C/C C/C C/C C/C
KVL1293 253>249/261 249/249 249/249 249/249 249/249 249/249 249/249
MUC13
g.15376 A>G G/G G/G G/G G/G G/G A/G
ALGA0106330 G>A A/A A/A A/A A/A A/A G/A
226 A>G G/G G/G G/G G/G G/G A/G
813 T>C C/C C/C C/C C/C C/C T/C
DIAS0000584 C>G G/G G/G C/G C/G G/G C/G
MARC0045417 A>G A/G G/G G/G A/G G/G G/G 1 Typing error: unfortunately, pig 2055NO could not be retyped.
The interval between markers KVL1293-HEG1T4A-JN613413-23529 (~28 Kb) was sequenced
in unrelated pigs by Jørgensen’s Danish group. The region was highly conserved with an average of 1
SNP every 2000-2500 bp. All the markers discovered were not in LD with F4bcR. SNP JN613413-23529
is located ~2 Kb after HEG1 3’UTR (Table 2.1).
- 65 -
3.6 Partial exclusion of MUC13 as locus for F4bcR
Sow 9480XJZ had a recombination in the F4bcR-MUC13 interval (Figure 3.6). Sow 9480XJZ
was resistant in MAT to ETEC F4ab/F4ac and had a C/C genotype in MUC4_g.8227 associated with the
absence of ETEC F4ab/F4ac adhesion. Sow 9480XJZ possessed a heterozygous genotype in MUC13
SNPs: ALGA0106330, MUC13-226, and MUC13-813.
Sow 9480XJZ was mated with four boars resistant to ETEC F4ab/F4ac, generating 21 offspring.
Boar 552, used for mating, was also an offspring of 9480XJZ (Figure 3.6). The offspring were
phenotyped with the MAT, and their genotype in MUC4_g.8227 and MUC13-226 was determined by
PCR-RFLP (Figures 3.1 and 3.4). The offspring were resistant to ETEC F4ab/F4ac and showed a C/C
genotype in MUC4_g.8227.
The PCR-RFLP in MUC13-226 (Figure 3.4) showed that 18 offspring (85.7%) had the same
heterozygous genotype in MUC13-226 as 9480XJZ. Unfortunately, none of the pigs with the recombinant
allele was selected as a breeder. 9480XJZ was genotyped in the MUC4-MARC0045417 interval together
with three of its offspring from two litters (Figures 3.6).
- 66 -
Figure 3.6: Family tree and haplotypes of sow 9480XJZ in the MUC4-MARC0045417 region. Marker
names are given on the left side. Animal identity is shown above the haplotypes. The nonadhesive
haplotype is indicated by s. The lines indicate the relationships among the pigs. The colour of the elliptic
circles indicates the SNPs and the microsatellite alleles: orange represents those associated with
susceptibility to F4bcR and green represents resistance. The underlined markers are the ones with high
LD with F4bcR. The red rectangle showed the interval where the pigs are recombinant.
- 67 -
Sow 9480XJZ had a possible recombinant event in F4bcR-MUC13 interval. In the MUC4-
KVL1293 interval, 9480XJZ possessed a haplotype associated with resistance to ETEC F4ab/F4ac in
markers with high LD with F4bcR (Figure 3.6). The same associated haplotype was inherited in most of
its offspring.
Sow 9480XJZ’s family was genotyped in gene MUC13, from the 5’UTR until the 3’UTR. It was
not possible to sequence exon 2 of MUC13 because of the presence of tandem repeats. Sow 9480XJZ and
its recombinant offspring possessed a heterozygous or homozygous genotype associated with
susceptibility to ETEC F4ab/F4ac in all the markers of MUC13.
It was not possible to determine by haplotype analyses if the recombination of sow 9480XJZ
started before or after the exon 2 of MUC13 (MUC13_g.1974-MUC13_g.8951). In the MUC13_g.207-
MUC13_g.1974 and MUC13_g.8951-MUC13_g.15150 interval, sow 9480XJZ possessed a homozygous
genotype associated with susceptibility to ETEC F4ab/F4ac. SNP MUC13_g.15376 was mapped in intron
5 of MUC13. Haplotype analyses showed that 9480XJZ’s recombination ended after SNP
JN613413_115242, mapped in the first ~8 Kb of the intergenic region MUC13-ITGB5 (Table 2.1, Figure
3.6). The interval MUC13_g.15150-JN613413_115242 is excluded as a locus for F4bcR.
3.7 Sequencing and mRNA expression of candidate genes
As described in section 2.4.5, the total RNA from intestinal scrapings was extracted from five
pigs and used for high throughput sequencing by the SOLiDTM 3 System. Two pigs were homozygous
susceptible to ETEC F4ab/F4ac (2349 and 641), two were heterozygous (2938 and 2939), and one was
resistant (1168).
The total RNA from intestinal scrapings was also extracted from other five pigs: two were
homozygous susceptible to ETEC F4ab/F4ac (654, 2006), one was heterozygous (2762), and two were
resistant (1017, 1715). The 10 cDNA samples were used to test SNPs in SLC12A8, HEG1, MUC13, and
ITGB5.
- 68 -
3.7.1 SLC12A8
The data obtained by the SOLiDTM System displayed a low expression of gene SLC12A8 in the
small intestine. No alternative splicings and no remarkable differences were seen between pigs resistant
and susceptible to ETEC F4ab/F4ac.
Two SNPs, SLC12A8_c.1990 and SLC12A8_c.2947, were found in high LD with F4bcR (Table
2.1). The G>A transition in SLC12A8_c.1990 is a silent mutation, and SNP SLC12A8_c.2947 is located in
the 3’UTR of SLC12A8.
3.7.2 HEG1
The data obtained by the SOLiDTM System displayed a low expression of gene HEG1 in the
small intestine. An alternative splicing was seen in gene HEG1, not related to F4bcR.
The genomic sequence of HEG1 presents an 1147 bp duplication, mapped at 144789345-
144788199 and 144790896-144789750 in reference sequence 10.2. This repeat region contains exon 5 of
HEG1 (351 bp). Primers HEG-E5F/R were designed to amplify a region of 493 in the cDNA of HEG1
between exons 4 and 6 (Table 2.1). After the gel run, a band of ~1000 bp was visible. This band indicates
a duplication of HEG1 in exon 5. Therefore, an alternative form of protein HEG1 is expressed in the
small intestine.
The cDNA was re-extracted from the intestinal tissues, and the PCR was repeated to ensure that
the ~1000 bp band was not an artefact. The cDNA obtained from brain, liver, and muscle tissue were used
in the same PCR. No expression of HEG1 was revealed, except in the intestinal tissue. The PCR products
from two pigs, one homozygous susceptible and the other resistant to ETEC F4ab/F4ac, were sent for
sequencing.
The ~1000 bp band possessed two copies of the exon 5 of HEG1 and a 282 bp alternative exon
was mapped between exons 5 and 6 of HEG1 (Figure 3.7). The duplication and the new exon were in
frame with the mRNA. Four SNPs were found in this cDNA region. However, they were not in LD with
F4bcR. The data obtained by the SOLiDTM displayed low expression in the region where exons 4 and 6
were mapped in the reference sequence 10.2. No RNA transcripts were mapped to the reference sequence
10.2 in the interval corresponding to exon 5, the duplicated exon 5, or the new exon.
- 69 -
SNPs were discovered also in exons 3, 6, and 17 of HEG1 but they were also not in LD with F4bcR. Only
SNP HEG1_c.321, mapped in exon 2 of HEG1, was in high LD with F4bcR (Table 2.1). The T>C
transition in HEG1_c.321 is a silent mutation.
Figure 3.7: Alternative splicing of gene HEG1 in exon 5. Primers HEG-E5F/R are highlighted in azure;
SNPs are highlighted in red.
3.7.3 MUC13
The data obtained by the SOLiDTM System displayed high expression of gene MUC13 in the small
intestine. In the interval corresponding to exon 2 of MUC13, RNA transcripts were mapped to the
reference sequence 10.2 only in pigs that were resistant (1168) and heterozygous susceptible (2938 and
2939) to ETEC F4ab/F4ac.
SNP MUC13_c.232 (Table 2.1), mapped in exon 4 of MUC13, generates a stop codon in the
mRNA sequence with a C>T transition. However, the SNP was not in LD with F4bcR (Figure 3.6). SNP
MUC13-813 encodes a silent mutation, as described in section 3.2. SNP MUC13_c.1788 (Table 2.1),
mapped in MUC13 3’UTR, was in high LD with F4bcR, except in 9480XJZ’s recombinant family (Figure
- 70 -
3.6). SNP MUC13_c.1930 was tested by PCR-RFLP (Figure 3.4). However, the SNP was not in LD with
F4bcR.
3.7.4 ITGB5
The data obtained by the SOLiDTM System displayed low expression of gene ITGB5 in the small
intestine. No alternative splicings and no remarkable differences were seen between pigs that were
resistant and susceptible to ETEC F4ab/F4ac.
Six SNPs were found in the cDNA of ITGB5: ITGB5_c.246, ITGB5_c.917, ITGB5_c.920,
ITGB5_c.1580, ITGB5_c.1715, and ITGB5_c.2744 (Table 2.1). The six SNPs were not in full LD with
F4bcR (Figure 3.5).
3.8 Sequencing of intergenic regions
3.8.1 Interval of HEG1-MUC13
Long-range PCRs covered the intergenic region HEG1-MUC13 and exon 2 of MUC13 (Table
2.2.1, Figure 3.8). DNA samples from boar 2349 and sow 9480XJZ, respectively homozygous susceptible
and resistant to ETEC F4ab/F4ac, were used as templates.
Long-range PCR products from L1 to L6 were correctly mapped by blast to the reference
sequence 10.2. However, problems in alignment have occurred in long-range PCR products L7, L8 and
L9. The genomic sequences obtained were highly conserved. The alignment with the reference sequence
10.2 has led to the discovery of ~250 SNPs. Sow 9480XJZ possessed a heterozygous or homozygous
genotype associated with susceptibility to ETEC F4ab/F4ac in all but two SNPs, SNP 1 and SNP 2. The
two SNPs were mapped at 144944384 bp (SNP 1 C>A) and at 144978031bp (SNP 2 C>A) (Figure 3.9).
Long-range PCR products A, B and L8 were sequenced by the PacBio platform RS (Table
2.2.1). Long-range PCR products A and B were blasted to the reference sequence 10.2. However,
problems in alignment were seen again in long-range PCR product L8. Sow 9480XJZ possessed a
homozygous genotype associated with susceptibility to ETEC F4ab/F4ac in the sequences derived from
long-range PCR products A and B.
- 71 -
Several attempts with different PCR primers were made to amplify exon 2 of MUC13; however,
they were not successful.
3.8.2 Interval of MUC13-ITGB5
Long-range PCRs covered the intergenic region MUC13-ITGB5 and the 5’ of ITGB5 (Table
2.2.2, Figure 3.8). DNA samples from pigs 2349 and 9480XJZ were used as templates.
Long-range PCR products from L1 to L11 were sequenced by the Illumina platform and
correctly mapped by blast to the reference sequence 10.2. The alignment with the reference sequence 10.2
has led to the discovery of ~300 SNPs. Sow 9480XJZ possessed a homozygous genotype associated with
resistance to ETEC F4ab/F4ac in ~200 SNPs. The majority of SNPs were mapped either in the intergenic
region MUC13-ITGB5 or in introns of ITGB5. Three SNPs, ITGB5_c.246, ITGB5_c.917, and
ITGB5_c.920, were mapped in exons of ITGB5 but are not in LD with F4bcR (Figures 3.5 and 3.6).
Figure 3.8: Position of long-range PCR products in the HEG1-ITGB5 interval. The genes, exon order, and
scale are deduced from the reference sequence 10.2.
- 72 -
Figure 3.9: SNP positions in the HEG1-ITGB5 interval. The genes, exon order, and scale are deduced
from the reference sequence 10.2. Informative SNPs for pig 9480XJZ are indicated.
- 73 -
3.9 Validation of alternative markers for ETEC F4ab/F4ac susceptibility
Analyses of the pigs belonging to UEH and the six pigs recombinant in MUC4-F4bcR from the
SPS have shown that SNPs ALGA0072075, ALGA0106330, MUC13-226, MUC13-813, and microsatellite
KVL1293 were high in LD with F4bcR. The markers in UEH pigs had close to 100% accuracy with the
only exceptions being the pigs in sow 9480XJZ’s recombinant family.
Forty pigs were randomly selected from the SPS as representative of the Swiss porcine
population. A standard MAT was conducted on these pigs and DNA samples were collected. The MAT
revealed that only 13 pigs (32.5%) were resistant to ETEC F4ab/F4ac adhesion. The DNA of the pigs was
initially tested with old marker MUC4_g.8227. Unlike the previous 78 pigs selected from the SPS, which
contained six pigs recombinant in MUC4 gene, the expected genotype of SNP MUC4_g.8227 in the 40
pigs coincided 100% with the phenotype found in the MAT.
The 13 pigs resistant in the MAT were found to have a C/C genotype in MUC4_g.8227 that was
associated with the absence of ETEC F4ab/F4ac adhesion. Among the remaining 27 pigs, eight were
found to be G/G in MUC4_g.8227, which indicated a possible homozygous susceptible genoptype in
F4bcR, whereas the other 19 pigs showed a heterozygous genotype.
The pigs were genotyped in SNPs ALGA0072075, ALGA0106330, MUC13-226, MUC13-813,
and microsatellite KVL1293. SNP 1 and SNP 2, discovered in the intergenic region HEG1-MUC13
(Section 3.8.1), were also tested in the 40 pigs.
Results were similar to SNP MUC4_g.8227. The alleles, associated with susceptibility and
resistance to ETEC F4ab/F4ac, coincided with the phenotypes in all 40 pigs. The markers were in 100%
LD with F4bcR.
The markers could be used in breeding programs to select pigs resistant to F4bcR, as
replacements for SNP MUC4_g.8227. SNP MUC13-813 is currently being patented by Zhang et al.
(2008) for this purpose.
- 74 -
Table 3.4: Genotyping of the 461 pigs selected from the SPS in markers MUC4_g.8227, ALGA0072075,
KVL1293, SNP 1, SNP 2, ALGA0106330, MUC13-226, and MUC13-813 compared to their phenotypes
for ETEC F4ab/F4ac susceptibility/resistance.
F4bcR phenotypes
Discordance % on
total Susceptible Resistant
SNPs Genotype SNPs Genotype SNPs
AA AB BB AA AB BB
MUC4_g.8227 8 19 1 5 13 6 13%
ALGA0072075 8 19 1 18 1 2.2%
KVL1293 8 19 1 18 1 2.2%
SNP 1 8 20 18
SNP 2 8 19 12 18 12 2.2%2
ALGA0106330 8 20 18
MUC13-226 8 20 18
MUC13-813 8 20 18 1 Combined data of selected 40 SPS pigs and the 6 SPS pigs recombinant in MUC4_g.8227 (Section 3.5).
2 Typing error: unfortunately, pig 2055NO could not be retyped.
- 75 -
3.10 F4ad susceptibility
From the UEH, a total of 489 pigs from sixty-three litters were used to elucidate the inheritance
of the receptors for ETEC F4ad (F4adR). Offspring and parents were divided into three classes based on
the results of the F4ad MAT, as described in section 2.2.4.
The phenotype C (F4ab+/F4ac-/F4ad+) was seen in 26 pigs from the 489 tested with F4ad MAT
(Table 3.5). Most pigs with a C phenotype originated from litters with a common parent. All the C
phenotyped pigs expressed the weak F4ad receptor.
Table 3.5: Phenotypes observed in the 489 pigs from UEH according to the binding of ETEC F4 variants.
The bacterical adhesion is marked with ●.
Phenotypes Fimbrial variants
F4ab F4ac F4ad No. pigs % in the UEH
A ● ● ● 301 61.6
B ● ● 29 5.9
C ● ● 26 5.3
D ● 37 7.6
E 96 19.6
F ● 0 0
G ● 0 0
H ● ● 0 0
Total 489 100
3.10.1 Two receptors for E. coli F4ad
In the offpring and parents, bacterial adhesion to the enterocytes in the four sites examined was
close either to 0%, indicating a resistant phenotype, or to 100%, indicating a fully susceptible phenotype.
In the F4ad MAT, several parents and offspring showed variable percentages of enterocytes susceptible to
ETEC F4ad, especially in sites B and C of the intestine, indicating a third weakly susceptible phenotype.
The weakly susceptible phenotype was not an artefact caused by poor cell quality or mistakes performed
in the F4ad MAT. We found evidence in this study that the weakly susceptible phenotype is inherited
independently from the fully susceptible phenotype, which indicates the existence of at least two
- 76 -
receptors in the enterocytes for ETEC F4ad adhesion. We gave the designation E1 to the receptor
responsible for full susceptibility and the designation E2 to the receptor responsible for weak
susceptibility.
A threshold deduced from observations was made to distinguish pigs resistant (R) to ETEC F4ad
from those having fully susceptible (E1) phenotype or a weakly susceptible (E2) phenotype. Pigs with 0%
adhesive enterocytes in all the four intestinal sites were considered resistant. Pigs with an adhesion
between 0.5% and 100% in at least one of the intestinal sites examined were considered E2, and pigs with
>85% adhesion in all the four intestinal sites were considered E1.
In the matings, it was observed that only pigs with 0% in all sites were truly resistant. Pigs with
even <1% of adhesion were shown to produce susceptible progeny if mated with resistant pigs. Based on
this data, 173 pigs (35.4% of total) were classified as E1, 189 (38.6%) as E2, and 127 (26%) as resistant
to ETEC F4ad (Table 3.6).
Table 3.6: E. coli F4ad adhesion strengths (% of enterocytes with more than 5 adherent bacteria) at four
intestinal sites in pigs of phenotypes E1 (n=173), E2 (n=189) and R (n=127).
Site A Site B Site C Site D
Phenotype E1 E2 R E1 E2 R E1 E2 R E1 E2 R
Minimum 95 0 0 90 0 0 90 0 0 90 0 0
Maximum 100 100 0 100 100 0 100 100 0 100 100 0
Mean 99.5 9.8 0 99.3 16.8 0 99.7 44.3 0 99.4 59.9 0
Standard
deviation 1.6 22.8 0 2.1 27.9 0 1.4 36.7 0 2.0 34.5 0
The pigs possessing an E2 phenotype showed large variability in the F4ad MAT. During the first
years, as described in section 2.2.2, the standard MAT caused some E2 pigs to be labelled erroneously as
resistant to ETEC F4ad or E1. The investigation of four sites decreased significantly the possibility of
mistyping. However, E2 pigs can still be typed with a wrong phenotype. Mistakes can occur during the
F4ad MAT because of the manual selection and counting of the intact enterocytes. Testing more intestinal
sites appears more important than the selection and counting of cells, where the same source of error
would apply to E1 and R pigs.
- 77 -
3.10.2 Inheritance of phenotype
The 19 parents were divided into the three phenotypes (E1, E2 and R) according to the F4ad
MAT results. The 470 offspring from the 63 litters were divided into six combinations, based on the
parents’ F4adR phenotypes.
The matings of R x R pigs has generated only resistant pigs (Table 3.7). The matings of E1 x E1
pigs has generated only E1 pigs. The matings of R x E2, R x E1, E1 x E2 and E2 x E2 has generated E1,
E2 and resistant pigs (Table 3.7). The results of the F4ad MAT test on the progeny indicated the existence
of a genetic component in the inheritance of E1 and E2 receptors (Table 3.8). The data, however,
excluded that E1 is a Mendelian monogenetic trait. E1 must be encoded by more than one gene to explain
its expression in E2 x E2 and R x E2 litters, as shown in Table 3.7. The mean adhesion strength observed
in Table 3.8 shows similar values for E1 x R and E1 x E2 matings, indicating that the genes involved in
the inheritance of E1 are independent from E2. Statistical analyses of the data were performed to confirm
this hypothesis (Table 3.9).
Table 3.7: Distribution of the three phenotypes for ETEC F4d in progeny with known phenotyped
parents.
Phenotype of parents Number of progeny Phenotype of progeny
E1 E2 R
R x R 45 0 0 45
R x E1 178 81 79 18
R x E2 107 6 55 46
E1 x E1 63 63 0 0
E1 x E2 36 12 15 9
E2 x E2 41 9 28 4
- 78 -
Table 3.8: Influence of phenotypes of parents on the median adhesion strengths (± SD) at the four
intestinal sites A through D of the progeny.
Phenotypes
of parents
Number of
matings
Number of
progeny
Mean adhesion strength (% of enterocytes with more than 5
adherent bacteria) ± standard deviation (SD) at intestinal site
A B C D
R x R 7 45 0.0±0.0 0.0±0.0 0.0±0.0 0.0±0.0
R x E1 16 178 49.5±48.4 52.2±46.8 68.6±39.1 74.4±36.4
R x E2 15 107 8.3±25.1 10.7±27.1 20.5±34.2 31.1±38.5
E1 x E1 11 63 99.9±0.6 99.6±1.6 99.8±0.9 99.8±1.1
E1 x E2 5 36 42.7±48.6 43.7±46.5 49.9±47.8 52.1±46.2
E2 x E2 9 41 31.1±40.3 43.9±43.5 54.9±42.2 66.6±37.2
Table 3.9: Kruskal-Wallis test with the six mating combinations of the three phenotypes for ETEC F4ad.
Significant differences (p<0.05) between the combinations are in bold.
Site A
Matings R x R R x E1 R x E2 E1 x E1 E1 x E2 E2 x E2
R x R --- 0.000 0.005 0.000 0.000 0.000
R x E1 --- 0.000 0.000 0.353 0.052
R x E2 --- 0.000 0.000 0.000
E1 x E1 --- 0.000 0.000
E1 x E2 --- 0.566
E2 x E2 ---
Site B
Matings R x R R x E1 R x E2 E1 x E1 E1 x E2 E2 x E2
R x R --- 0.000 0.001 0.000 0.000 0.000
R x E1 --- 0.000 0.000 0.325 0.197
R x E2 --- 0.000 0.000 0.000
E1 x E1 --- 0.000 0.000
E1 x E2 --- 0.921
E2 x E2 ---
Site C
Matings R x R R x E1 R x E2 E1 x E1 E1 x E2 E2 x E2
R x R --- 0.000 0.000 0.000 0.000 0.000
R x E1 --- 0.000 0.000 0.045 0.039
R x E2 --- 0.000 0.001 0.000
E1 x E1 --- 0.000 0.000
E1 x E2 --- 0.650
E2 x E2 ---
- 79 -
Continued from previous page
Site D
Matings R x R R x E1 R x E2 E1 x E1 E1 x E2 E2 x E2
R x R --- 0.000 0.000 0.000 0.000 0.000
R x E1 --- 0.000 0.000 0.010 0.101
R x E2 --- 0.000 0.010 0.000
E1 x E1 --- 0.000 0.000
E1 x E2 --- 0.263
E2 x E2 ---
The results of the Kruskal-Wallis tests indicated that E1 and E2 are not encoded by the same
receptor gene. If the same gene expresses receptors E1 and E2, no significant difference should be present
between mating combinations, such as E1 x E1 and E2 x E2 or R x E1 and R x E2. The test showed a
significant difference in all four sites.
E2 pigs have a crescent adhesion strength that can be 0% in sites A and B or >85% in sites C and
D. This crescent adhesion explains why pairs of mating combinations, such as E1 x E2 and R x E1, show
a significant difference only in sites A and B.
3.10.3 Statistical pedigree analysis
Models for the inheritance of F4adR were evaluated with the Pedigree Analysis Package v. 4.0
(Department of Human Genetics, University of Utah, UT, USA) at the Institute of Genetics, University of
Berne.
The phenotype was assigned to three classes: resistant, weakly, or fully susceptible to ETEC
F4ad. Five different models were considered in the analysis. A general genetic model estimating the allele
frequency, the transmission probabilities, the dominance effect, the displacement to characterize a major
gene, and the heritability to characterize a polygenic component was compared with an environmental
model, where a major gene was excluded by setting the transmission probabilities equal to the allele
frequency. In the case where the general genetic model turns out to explain the data better than the
environmental model, it is compared to a mixed inheritance model that is the very same model, with the
exception that the transmission probabilities are set to be Mendelian. In the case where the mixed
inheritance model turns out to be better than the general genetic model it is compared to a major gene
model and a polygenic model. The major gene model is the same as the mixed inheritance model with the
- 80 -
exception that a polygenic component is excluded by setting the heritability to zero. The polygenic model
only estimates the heritability.
The data show that E1 and E2 are not the product of a single receptor gene, confirming the
results of the Kruskal-Wallis test (Table 3.9).
The mixed inheritance model explained our data best (Table 3.10). It seems that the ETEC F4ad
receptors are regulated by both a major gene and a polygenic component. This is in accordance with our
proposed model for the inheritance of F4adR in the pig.
We postulated that the E1 phenotype is encoded by two complementary or epistatic genes, with
the alleles A and a, and B and b respectively, while the E2 phenotype is encoded by only one gene with
the alleles W and w (Table 3.11). The receptor E1 is expressed only when both hypothetical alleles, A and
B, occur in the dominant form, either homozygously or heterozygously. The receptor E2 is expressed as a
Mendelian dominant trait. The expression of phenotype E1 covers the expression of phenotype E2.
Several matings with many offspring are necessary to be sure of a breeder genotype in F4adR.
Table 3.10: Evaluation of the Pedigree Analysis Package models. The differences in the -2- ln likelihoods
of the different models follow a chi-square (χ2) distribution where the degrees of freedom (df) are equal to
the difference in the number of parameters estimated. Significant differences (p<0.01) are in bold.
Models df -2- ln likelihood χ2 df p
general genetic
environmental
7
3
727.2
1061.7 334.5 4 <0.001
general genetic
mixed inheritance
7
4
727.2
729.0 1.8 3 0.626
mixed inheritance
major gene
4
3
729.0
767.0 38.0 1 <0.001
mixed inheritance
polygenic
4
1
729.0
757.4 28.4 3 <0.001
The -2- ln likelihood of the mixed inheritance model is not significantly different from the -2- ln
likelihood of the general model. Therefore it is considered the better model as it needs less parameters to
explain the data.
- 81 -
Table 3.11: Analyses of the largest litters (≥12 pigs) from UEH. Repetitive matings were put together.
Hypothetical genotypes of parents were deduced from phenotypes observed in progeny. For each litter,
the parents, the number of piglets, the phenotypes for ETEC F4ad, and F4dR hypothetical genotype are
indicated. The genotype frequencies for systems E1 and E2, the expected phenotypes for ETEC F4ad, and
the obtained phenotypes are shown for each litter. Chi-square (χ2) for the Hardy-Weinberg equilibrium is
calculated for each litter. A separate χ2 is calculated only for E1 phenotype. Significant differences
(p<0.05) are in bold.
Litters Parents Offspring
χ2 No. pigs N°
Phen
otype Genotype
System E1 System E2 Expected Obt.
Gen./Frequency % Phen./Freq. %/No. No.
217 & 230 2831
2842
R
R
aa Bb ww
aa bb ww
aa bb
aa Bb
50
50 ww 100
R
E2
E1
100
0
0
24
0
0
24
0
0
0.00 24
205 & 222 2674
2577
E1
R
AA Bb WW
aa Bb ww
Aa bb
Aa B-
25
75 Ww 100
R
E2
E1
0
25
75
0
6.8
20.2
0
9
18
0.95
0.24 E1 27
216 & 2231 2674
2570
E1
R
AA Bb WW
aa bb ww
Aa bb
Aa Bb
50
50 Ww 100
R
E2
E1
0
50
50
0
15.5
15.5
2
11
18
0.81
If R=E2
0.4 E1 31
2272 2674
2840
E1
R
AA Bb WW
aa bb ww
Aa bb
Aa Bb
50
50 Ww 100
R
E2
E1
0
50
50
0
7
7
3
8
3
4.57
If R=E2
2.29 E1 14
2281 2674
2842
E1
R
AA Bb WW
aa bb ww
Aa bb
Aa Bb
50
50 Ww 100
R
E2
E1
0
50
50
0
6.5
6.5
1
6
6
0.08
If R=E2
0.04 E1 13
232 & 244 2831
2791
R
E1
aa Bb ww
Aa BB WW
aa B-
Aa B-
50
50 Ww 100
R
E2
E1
0
50
50
0
6
6
0
9
3
3.00
1.50 E1 12
238 2988
2577
E1
R
AA Bb WW
aa Bb ww
Aa bb
Aa B-
25
75 Ww 100
R
E2
E1
0
25
75
0
3.8
11.2
0
5
10
0.51
0.13 E1 15
248 2859
2842
E1
R
Aa Bb Ww
aa bb ww
aa bb
aa Bb
Aa bb
Aa Bb
25
25
25
25
ww
Ww
50
50
R
E2
E1
37.5
37.5
25
4.9
4.9
3.2
7
3
3
1.65
0.01 E1 13
219 2831
2726
R
E2
aa Bb ww
aa bb Ww
aa bb
aa Bb
50
50
ww
Ww
50
50
R
E2
E1
50
50
0
7
7
0
6
8
0
0.29 14
221 & 231 2831
2766
R
E2
aa Bb ww
Aa bb Ww
aa bb
Aa bb
aa Bb
Aa Bb
25
25
25
25
ww
Ww
50
50
R
E2
E1
37.5
37.5
25
7.5
7.5
5
11
7
2
3.47
1.80 E1 20
- 82 -
Continued from previous page
Litters Parents Offspring
χ2 No. pigs N°
Phen
otype Genotype
System E1 System E2 Expected Obt.
Gen./Frequency % Phen./Freq. %/No. No.
229 2554
2726
R
E2
aa bb ww
aa bb Ww aa bb 100
ww
Ww
50
50
R
E2
E1
50
50
0
6
6
0
7
5
0
0.33 12
2341 2831
2878
R
E2
aa Bb ww
aa bb WW
aa bb
aa Bb
50
50 Ww 100
R
E2
E1
0
100
0
0
12
0
2
10
0
0.00
If R=E2 12
213 2732
2791
E1
E1
AA Bb WW
Aa BB WW A- B- 100 WW 100
R
E2
E1
0
0
100
0
0
13
0
0
13
0.00 13
207 2559
2450
E2
E2
Aa bb WW
aa Bb Ww
Aa bb
aa Bb
Aa bb
Aa Bb
25
25
25
25
W- 100
R
E2
E1
0
75
25
0
9
3
0
11
1
1.78
1.33 E1 12
1 In litters 216, 223, 228, and 234, based on the parents supposed genotype, resistant pigs were not
expected. If the pigs were counted as E2, the χ2 showed no significant difference (p<0.05).
2 In litter 227, based on the parents supposed genotype, resistant pigs were not expected. χ2 showed a
significant difference (p<0.05), even if the pigs counted as resistant were calculated as E2.
Unexpected phenotypes in litters could be caused by mistyping in the F4ad MAT. By testing
only four sites in the F4ad MAT, not all E2 pigs could be distinguished from E1 or resistant pigs.
The significative differences observed in litters 227 could be caused by a mistake in assigning the
hypothetical genotype of the parents. A separate χ2 was calculated in litters with expected E1 phenotype
to test the two genes’ inheritance model for the E1 receptor. The data showed no significative difference
in all litters examined for E1.
- 83 -
4. DISCUSSION
4.1 F4bcR mapping on SSC13
The genotyping of pigs from the UEH revealed the presence of many haplotypes associated with
resistance to ETEC F4ab/F4ac in the ALGA0072075-MUC13-813 interval (Figures 3.2, 3.5, and 3.6). The
haplotype associated with susceptibility to ETEC F4ab/F4ac in the interval ALGA0072075-MUC13-813
was identical in all the pigs genotyped. The presence of several haplotypes associated with resistance to
ETEC F4ab/F4ac indicated that the pig was not originally susceptible to ETEC F4ab/F4ac. A mutation in
the DNA provokes the expression of a receptor on the brush border of the enterocytes, enabling the
adhesion of ETEC F4ab/F4ac. Because of the presence of different haplotypes, until the causative
mutation is discovered all markers used for the selection of pigs resistant to F4bcR will not be 100%
accurate.
The recombinant allele in 2349 allowed the exclusion of the whole ZDHHC19-MUC4-ZNF148
interval as a position for the F4bcR locus (Section 3.4, Figure 3.5). Boar 2240, resistant to ETEC
F4ab/F4ac in MAT, possessed a homozygous genotype associated with susceptibility to ETEC F4ab/F4ac
in all the SNPs tested downstream ITGB5. It is possible that 2240 had a recombination in the interval
ITGB5-MYLK similar to the one in ZDHHC19-ZNF148 of pig 2349 (Section 3.4, Figure 3.5).
The data from pig 2349 indicated that the F4bcR locus should be mapped to one of the four
candidate genes: SLC12A8, HEG1, MUC13, and ITGB5.
4.2 Exclusion of genes SLC12A8 and HEG1
The RNA sequencing results from the SOLiDTM System revealed a low level of expression for
genes SLC12A8 and HEG1 in the small intestine. No RNA expression was revealed in the intronic
sequences of the genes or in the intergenic region SLC12A8-HEG1. Exon 5 duplication seen in HEG1 was
not associated with ETEC F4ab/F4ac susceptibility. A similar duplication was not present in the human
homolog gene (ENSG00000173706). No expression of HEG1 was revealed in brain, liver, and muscle, so
it is not clear whether exon duplication leads to an alternative splicing expressed only in the intestine.
- 84 -
More analyses are necessary in other tissues where the gene is expressed more strongly. SNP
SLC12A8_159, reported to be in LD with F4bcR by Huang et al. (2008), showed no association with
ETEC F4ab/F4ac susceptibility in the second three-generation study conducted on pig 2349 (Figure 3.5).
Pig 2055NO from SPS showed a recombinant haplotype in all the SNPs tested in the interval SLC12A8-
HEG1, with the exception of SLC12A8_c.1990 (Table 3.3). Two other pigs from the SPS, 6240PU and
6245PU, showed a recombinant genotype in SLC12A8_c.1990 that encodes for a silent mutation. The
interval between SLC12A8_c.1990-SLC12A8_c.2947 was sequenced in unrelated pigs. All the markers
discovered were not in LD with F4bcR, indicating a typing error in pig 2055NO that unfortunately could
not be retyped.
Microsatellite KVL1293 was mapped to intron 12 of HEG1. The interval between KVL1293 and
the 3’UTR of HEG1 was sequenced in unrelated pigs by Jørgensen’s Danish group. All the markers
discovered were not in LD with F4bcR. The data obtained from SPS pigs disprove the genome-wide
association study by Fu et al. (2012), which demonstrated an association between HEG1 and F4bcR. Our
results suggested that the F4bcR locus does not map in the region SLC12A8-HEG1.
4.3 Exclusion of genes ITGB5
The data from the SOLiDTM System revealed a low level of expression for genes ITGB5 in the
small intestine. No RNA expression was revealed in the intronic sequences of the gene or in the
intergenic region MUC13-ITGB5. No SNPs in LD with F4bcR were found in the exonic sequences of
ITGB5 in UEH pigs (Figures 3.5 and 3.6). The data disprove Huang et al. (2011), who reported SNPs
ITGB5_c.920, ITGB5_c.1580, ITGB5_c.1715, and ITGB5_c.2744 in LD with F4bcR.
The comparison of all the results showed that it is highly probable that ITGB5 is not the locus of
F4bcR.
4.4 MUC13
No remarkable differences in expression were observed in MUC13 between intestinal samples
from pigs resistant or susceptible to ETEC F4ab/F4ac, confirming the findings of Schroyen et al. (2012).
- 85 -
No RNA expression was revealed in the intronic sequences of MUC13 or in the intergenic region HEG1-
MUC13.
Recombinant sow 9480XJZ, resistant to ETEC F4ab/F4ac in the MAT, was sequenced in the
whole gene MUC13, except for the exon 2 (MUC13_g.1974-MUC13_g.8951). In all the SNPs tested,
from 5’UTR to 3’UTR, either a heterozygous or a homozygous genotype associated with susceptibility to
ETEC F4ab/F4ac was observed (Figure 3.6).
RNA reads from ETEC F4ab/F4ac homozygous susceptible pigs 641 and 2349 could not be
mapped in exon 2 of MUC13 (Section 3.8.1). Exon 2 of MUC13 is a 3-5 kb region rich in tandem repeats.
Ren et al. (2012) found differences in the tandem repeat sequences between pigs susceptible and resistant
to ETEC F4ab/F4ac (Section 1.8.2.2). The reference sequence 10.2 is based on the genomic DNA of a
Duroc pig resistant to ETEC F4ab/F4ac. Only the RNA reads from pigs with a resistant allele to ETEC
F4ab/F4ac could be mapped to the reference sequence 10.2.
The data indicated that the tandem repeat region in the exon 2 of MUC13 is the most probable
location for the F4bcR locus.
4.5 F4adR inheritance
The F4ad MAT and the statistical analyses revealed the presence of a weakly susceptible
receptor for ETEC F4ad (E2), as postulated by Hu et al. (1993). The E2 receptor, however, was found to
be expressed in breeder pigs from the UEH. The hypothesis that expression of the weak receptor for F4ad
is terminated at 16 weeks of age is not valid; like the receptor E1, the receptor E2 is expressed throughout
the lifespan.
In most of the E2 pigs, an increase was observed in the adhesion strength of the bacteria the
closer the intestinal sites were to the ileocaecal valve. Inhibitors of gene expression could explain the
inhomogeneous presence of the weak ETEC F4ad receptor in the small intestine.
Our model for F4adR inheritance is mostly valid and confirms Bijlsma & Bouw’s (1987)
asssumption of the existence of more than one gene controlling the F4ad receptor. Few litters did not
respect the Hardy-Weinberg equilibrium with unexpected phenotypes (Table 3.11). The unexpected
phenotypes could be caused by mistakes in the F4ad MAT or in typing the hypothetical genotypes of the
parents in F4adR. Mutation in the receptors for ETEC F4ad could also be involved.
- 86 -
In the past years, several pigs from the UEH were reported expressing a C phenotype
(F4ab+/F4ac-/F4ad+) in the MAT (Python, 2003; Python et al., 2005). Most pigs with a C phenotype
originated from litters with a common parent, indicating that a genetic component may be involved in
phenotype expression. ETEC F4ab adhesion was tested in the MAT by examining only one intestinal site.
This test could have led some pigs used in this study, with a possible C phenotype, to be labelled as D
(F4ab-/F4ac-/F4ad+). All the C phenotyped pigs expressed the weak F4ad receptor. It is possible that like
ETEC F4ad, ETEC F4ab adhesion is also governed by two receptors: F4bcR and another one involved
with the C phenotype. It is also possible that ETEC F4ab can weakly bind to a mutated ETEC F4ad E2
receptor. More data are necessary to investigate this hypothesis.
4.6 Conclusions and perspectives
The different tandem repeat sequences observed by Ren et al. (2012) are the most probable cause
of ETEC F4ab/F4ac susceptibility in pigs. Pig 9480XJZ could express in MUC13 either the variant void
of the O-glycosylated binding site or a third variant with a shorter glycosylation site because of its
recombination. Bacteria could not use a shorter glycosylation site as a binding site. If further attempts at
DNA and cDNA sequencing on the tandem repeats prove futile, proteomic analyses from intestinal
scrapings of 9480XJZ’s recombinant progeny could determine which variant is expressed in MUC13.
The sequencing problem of MUC13 exon 2 precludes its use as a valuable marker. Because of
the possibility of close cross-over events, future diagnostic tests for F4ab/F4ac susceptibility should be
performed using at least two markers close to both ends of exon 2. The markers described in section 3.9
have proven quite reliable, whereas the two newly discovered SNPs of the intergenic region HEG1-
MUC13 need more analyses to ensure their complete LD with the F4bcR (Section 3.8.1 and Figure 3.9).
Pigs should be tested for E2 phenotype at more than four intestinal sites to show in detail the
expression of the weak receptor in the intestine. If further matings prove that the E2 phenotype is
inherited as a dominant monogenetic trait, genome scans will be performed in selected pigs to find
possible candidate genes for the receptor locus.
- 87 -
REFERENCES:
Abecasis G.R., Cherny S.S., Cookson W.O., Cardon L.R. (2002): Merlin-rapid analysis of dense genetic
maps using sparse gene flow trees. Nature Genetics 30: 97-101.
Alexa P., Štouračová K., Hamřík J., Rychlík I. (2001): Gene typing of the colonisation factors K88 (F4)
in the enterotoxigenic Escherichia coli strains isolated from diarrhoeic piglets. Veterinární Medicína 46:
46-49.
Alexander L.J., Rohrer G.A., Beattie C.W. (1996): Cloning and characterization of 414 polymorphic
porcine microsatellites. Animal Genetics 27: 137-148.
Atroshi F., Alaviuhkola T., Schildt R., Sandholm M. (1983): Fat globule membrane of sow milk as a
target for adhesion of K88-positive Escherichia coli. Comparative Immunology, Microbiology and
Infectious Diseases 6: 235-245.
Baker D.R., Billey L.O., Francis D.H. (1997): Distribution of K88 Escherichia coli adhesive and
nonadhesive phenotypes among pigs of four breeds. Veterinary Microbiology 54: 123-132.
Bentley R. & Meganathan R. (1982): Biosynthesis of vitamin K (menaquinone) in bacteria.
Microbiological Reviews 46: 241-280.
Berberov E.M., Zhou Y., Francis D.H., Scott M.A., Kachman S.D., Moxley R.A. (2004): Relative
importance of heat-labile enterotoxin in the causation of severe diarrheal disease in the gnotobiotic piglet
model by a strain of enterotoxigenic Escherichia coli that produces multiple enterotoxins. Infection and
Immunity 72: 3914-3924.
Bijlsma I.G.W., De Nijs A., Van Der Meer C., Frik J.F. (1982): Different pig phenotypes affect adherence
of Escherichia coli to jejunal brush-borders by K88ab, K88ac, or K88ad antigen. Infection and Immunity
37: 891-894.
Bertschinger H.U., Moon H.W., Whipp S.H. (1972): Association of Escherichia coli with the small
intestinal epithelium. Infection and Immunity 5: 595-605.
Bijlsma I.G.W. & Bouw J. (1987): Inheritance of K88-mediated adhesion of Escherichia coli to jejunal
brush borders in pigs: A genetic-analysis. Veterinary Research Communications 11: 509-518.
Billey L.O., Erickson A.K., Francis D.H. (1998): Multiple receptors on porcine intestinal epithelial cells
for the three variants of Escherichia coli K88 fimbrial adhesin. Veterinary Microbiology 59: 203-212.
- 88 -
Björkstén B., Sepp E., Julge K., Voor T., Mikelsaar M. (2001): Allergy development and the intestinal
microflora during the first year of life. Journal of Allergy and Clinical Immunology 108: 516-520.
Blomberg L., Henriksson A., Conway P.L. (1993): Inhibition of adhesion of Escherichia coli K88 to
piglet ileal mucus by Lactobacillus spp. Applied and Environmental Microbiology 59: 34-39.
Bork P., Downing A.K., Kieffer B., Campbell I.D. (1996): Structure and distribution of modules in
extracellular proteins. Quarterly Reviews of Biophysics 29: 119-167.
Bosi P., Casini L., Finamore A., Cremokolini C., Merialdi G., Trevisi P., Nobili F., Mengheri E. (2004):
Spray-dried plasma improves growth performance and reduces inflammatory status of weaned pigs
challenged with enterotoxigenic Escherichia coli K88. Journal of Animal Science 82: 1764-1772.
Boyle J.S. & Lew A.M. (1995): An inexpensive alternative to glassmilk for DNA purification. Trends in
Genetics 11: 8.
Brown E.A. & Hardwidge P.R. (2007): Biochemical characterization of the enterotoxigenic Escherichia
coli LeoA protein. Microbiology 153: 3776-3784.
Camerlink I., Ellinger L., Bakker E.J., Lantinga E.A. (2010): Homeopathy as replacement to antibiotics in
the case of Escherichia coli diarrhea in neonatal piglets. Homeopathy 99: 57-62.
Castillo M., Martìn-Orùe S.M., Taylor-Pickard J.A., Pérez J.F., Gasa J. (2008): Use of
mannanoligosaccharides and zinc chelate as growth promoters and diarrhea preventative in weaning pigs:
Effects on microbiota and gut function. Journal of Animal Science 86: 94-101.
Chandler D.S., Mynott T.L., Luke R.K.J., Craven J.A. (1994): The distribution and stability of
Escherichia coli K88 receptor in the gastrointestinal tract of the pig. Veterinary Microbiology 38: 203-
215.
Chappuis J.P., Duval-Iflah Y., Ollivier L., Legault C. (1984): Escherichia coli K88 adhesion: A
comparison of Chinese and Large White piglets. Genetic Selection Evolution 16: 385-390.
Chen X., Gao S., Jiao X., Liu X.F. (2004a): Prevalence of serogroups and virulence factors of
Escherichia coli strains isolated from pigs with postweaning diarrhoea in eastern China. Veterinary
Microbiology 103: 13-20.
Chen X.Q., Zhang X.D., Liang R.Q., Cao M.Q. (2004b): Betaine improves LA-PCR amplification.
Chinese Journal of Biotechnology 20: 715-718.
- 89 -
Clarke S.C. (2001): Diarrhoeagenic Escherichia coli-an emerging problem? Diagnostic Microbiology &
Infectious Disease 41: 93-98.
Cox E. & Houvenaghel A. (1993): Comparison of the in vitro adhesion of K88, K99, F41 and P987
positive Escherichia coli to intestinal villi of 4- to 5-week-old pigs. Veterinary Microbiology 34: 7-18.
Curtis J. & Bourne F.J. (1971): Immunoglobulin quantitation in sow serum, colostrum and milk and the
serum of young pigs. Biochimica et Biophysica Acta 236: 319-332.
Davies W., Høyheim B., Chaput B., Archibald A.L., Frelat G. (1994): Characterization of microsatellites
from flow-sorted porcine chromosome 13. Mammalian Genome 5: 707-711.
De Geus B., Harmsen M., Van Zijderveld F. (1998): Prevention of diarrhoea using pathogen specific
monoclonal antibodies in an experimental enterotoxigenic E. coli infection in germfree piglets. The
Veterinary Quarterly 20: S87-S89.
De Greve H., Wyns L., Bouckaert J. (2007): Combining sites of bacterial fimbriae. Current Opinion in
Structural Biology 17: 506-512.
Delsol A.A., Randall L., Cooles S., Woodward M.J., Sunderland J., Roe J.M. (2005): Effect of the growth
promoter avilamycin on emergence and persistence of antimicrobial resistance in enteric bacteria in the
pig. Journal of Applied Microbiology 98:564-571.
Downing A.K., Knott V., Werner J.M., Cardy C.M., Campbell I.D., Handford P.A. (1996): Solution
structure of a pair of calcium-binding epidermal growth factor-like domains: implications for the Marfan
syndrome and other genetic disorders. Cell 85: 597-605.
Duchet-Suchaux M.F., Bertin A.M., Menanteau P.S. (1991): Susceptibility of Chinese Meishan and
European Large White pigs to enterotoxigenic Escherichia coli strains bearing colonization factor K88,
987P, K99, or F41. American Journal of Veterinary Research 52: 40-44.
Dunn D.L. (1990): Autochthonous microflora of the gastrointestinal tract. Perspectives on Colon Rectal
Surgery 2: 105-119.
ECH, European Committee of Homeopathy, Spence D., Nicolai T., Van Wassenhoven M., Ives G.
(2005): A strategy for research in homeopathy: assessing the value of homeopathy for health care in
Europe. 3rd edition: 1-27.
Eckburg P.B., Bik E.M., Bernstein C.N., Purdom E., Dethlefsen L. Sargent M., Gill S.R., Nelson K.E.,
Relman D.A. (2005): Diversity of the human intestinal microbial flora. Science 308: 1635-1638.
- 90 -
Edfors-Lilja I., Petersson H., Gahne B. (1986): Performance of pigs with or without the intestinal receptor
for Escherichia coli K88. Animal Production 42: 381-387.
Edfors-Lilja I., Gustafsson U., Duval-Iflah Y., Ellergren H., Johansson M., Juneja R.K., Marklund L.,
Andersson L. (1995): The porcine intestinal receptor for Escherichia coli K88ab, K88ac: regional
localization on chromosome 13 and influence of IgG response to the K88 antigen. Animal Genetics 26:
237-242.
EFSA, European Food Safety Authority (2007): Foodborne antimicrobial resistance as a biological
hazard-Scientific Opinion of the Panel on Biological Hazards. Question No. EFSA-Q-2007-089
http://www.efsa.europa.eu/en/efsajournal/doc/765.pdf
Elton C.M., Smethurst P.A., Eggleton P., Farndale R.W. (2002): Physical and functional interaction
between cell-surface calreticulin and the collagen receptors integrin α2β1 and glycoprotein VI in human
platelets. Thrombosis and Haemostasis 88: 648-654.
Engel P. (1998): Genetische Untersuchungen über Rezeptoren für Escherichia coli F4 (K88) im Darm
von Schweinen als Grundlage für züchterische Massnahmen zur Bekämpfung der Diarrhöe bei Ferkeln.
Dissertation, Universität Giessen.
Engel P., Seibert B., Beuing R, Senft B., Erhardt G. (1998): Occurence of Escherichia coli F4 receptors in
several pig breeds in Germany and influence on parameters of reproduction and fattening performance.
Archives of Animal Breeding 41: 75-87.
Fairbrother J.M. (1999): Identification, nomenclature and diagnosis of pathogenic Escherichia coli.
Proceedings of the Annual Meeting of the Western Canadian Association of Swine Practitioners.
Saskatoon, Canada: 21-31.
Fairbrother J.M., Nadeau E., Gyles C.L. (2005): Escherichia coli in postweaning diarrhea in pigs: An
update on bacterical types, pathogenesis and prevention strategies. Animal Health Research Reviews 6:
17-39.
Fairbrother J.M. & Gyles C.L. (2006): Escherichia coli infections. In: Taylor D.J.: Disease of Swine. 9th
edition, Wiley-Blackwell, Oxford, UK: 639-674.
Floss D.M., Falkenburg D., Conrad U. (2007): Production of vaccines and therapeutic antibodies for
veterinary applications in transgenic plants: an overview. Transgenic Research 16: 315-332.
Fredholm M., Winterø A.K., Christensen K., Kristensen B., Nielsen P.B., Davies W., Archibald A.
(1993): Characterization of 24 porcine (dA-dC)n-(dT-dG)n microsatellites: genotyping of unrelated
animals from four breeds and linkage studies. Mammalian Genome 4: 187-192.
- 91 -
Frenyó V.L., Pethes G., Antal T., Szabó I. (1981): Changes in colostral and serum IgG content in swine in
relation to time. Veterinary Research Communications 4: 275-282.
Frydendahl K. (2002): Prevalence of serogroups and virulence genes in Escherichia coli associated with
postweaning diarrhoea and edema disease in pigs and a comparison of diagnostic approaches. Veterinary
Microbiology 85: 169-182.
Fu W.X., Liu Y., Lu X., Niu X.Y., Ding X.D., Liu J.F., Zhang Q. (2012): A Genome-Wide Association
Study Identifies Two Novel Promising Candidate Genes Affecting Escherichia coli F4ab/F4ac
Susceptibility in Swine. PloS One 7: e32127.
Fürer E., Cryz S.J. Jr., Dorner F., Nicolet J., Wanner M., Germanier R. (1982): Protection against
colibacillosis in neonatal piglets by immunization of dams with procholeragenoid. Infection and
Immunity 35: 887-894.
Galindo-Rodriguez S.A., Allemann E., Fessi H., Doelker E. (2005): Polymeric nanoparticles for oral
delivery of drugs and vaccines: a critical evaluation of in vivo studies. Critical Reviews in Therapeutic
Drug Carrier Systems 22: 419-464.
Glenn G.M., Flyer D.C., Ellingsworth L.R., Frech S.A., Frerichs D.M., Seid R.C., Yu J. (2007):
Transcutaneous immunization with heat-labile enterotoxin: development of a needle-free vaccine patch.
Expert Review of Vaccines 6: 809-819.
Gross L. (2006): Bacterial Fimbriae Designed to Stay with the Flow. PLoS Biology 4: e314.
Guarner F. & Malagelada J.R. (2003): Gut flora in health and disease. Lancet 361: 512-519.
Guérin G., Duval-Iflah Y., Bonneau M., Bertaud M., Guillaume P., Ollivier L. (1993): Evidence for
linkage between K88ab, K88ac intestinal receptors to Escherichia coli and transferrin loci in pigs. Animal
Genetics 24: 393-396.
Guinée P.A. & Jansen W.H. (1979): Behaviour of Escherichia coli K antigens K88ab, K88ac, and K88ad
in immunoelectrophoresis, double diffusion, and hemagglutination. Infection and Immunity 23: 700-705.
Gunderson K.L., Steemers F.J., Lee G., Mendoza L.G., Chee M.S. (2005): A genome-wide scalable SNP
genotyping assay using microarray technology. Nature Genetics 37: 549-554.
Gyles C.L. (1994): Escherichia coli verotoxin and other cytotoxin. In: Gyles C.L.: Escherichia coli in
domestic animals and humans. CAB International, Wallingford, UK: 151-170.
- 92 -
Hediger M.A., Romero M.F., Peng J.B., Rolfs A., Takanaga H., Bruford E.A. (2004): The ABCs of solute
carriers: physiological, pathological and therapeutic implications of human membrane transport proteins:
Introduction. European Journal of Physiology 447: 465-468.
Hewett D., Samuelsson L., Polding J., Enlund F., Smart D., Cantone K., See C.G., Chadha S., Inerot A.,
Enerback C., Montgomery D., Christodolou C., Robinson P., Matthews P., Plumpton M., Wahlstrom J.,
Swanbeck G., Martinsson T., Roses A., Riley J., Purvis I. (2002): Identification of a psoriasis
susceptibility candidate gene by linkage disequilibrium mapping with a localized single nucleotide
polymorphism map. Genomics 79: 305-314.
Holt J.P., Van Heugten E., Graves A.K., See M.T., Morrow W.E.M. (2011): Growth performance and
antibiotic tolerance patterns of nursery and finishing pigs fed growth-promoting levels of antibiotics.
Livestock Science 136: 184-191.
Hu Z.L., Hasler-Rapacz J., Huang S.C., Rapacz J. (1993): Studies in swine on inheritance and variation in
expression of small intestinal receptors mediating adhesion of the K88 enteropathogenic Escherichia coli
variants. The Journal of Heredity 84: 157-165.
Huang L., Ren J., Yan X., Huang X., Zhang Z., Zhang B. (2006): MUC13 molecular marker for
identifying the F4ac adhesion-caused diarrhea resistance of the weaning pig and the use thereof. Patent
number WO2010066118.
Huang X., Ren J., Yan X., Peng Q., Tang H., Zhang B., Ji H., Yang S., Huang L. (2008): Polymorphisms
of three gene-derived STS on pig chromosome 13q41 are associated with susceptibility to enterotoxigenic
Escherichia coli F4ab/ac in pigs. Science in China. Series C: Life Sciences 51: 614-619.
Huang L., Ren J., Yan X.M. (2011): cDNA cloning of porcine ITGB5 gene and its association with
susceptibility to ETEC F4ac. http://www.agrpaper.com; epub ahead of print.
Hudault S., Guignot J., Servin A.L. (2001): Escherichia coli strains colonizing the gastrointestinal tract
protect germ-free mice against Salmonella typhimurium infection. Gut 49: 47-55.
Hüffmeier U., Lascorz J., Traupe H., Böhm B., Schürmeier-Horst F., Ständer M., Kelsch R., Baumann C.,
Küster W., Burkhardt H., Reis A. (2005): Systematic linkage disequilibrium analysis of SLC12A8 at
PSORS5 confirms a role in susceptibility to Psoriasis vulgaris. The Journal of Investigative Dermatology
125: 906-912.
Hughes J.M., Murad F., Chang B., Guerrant R.L. (1978): Role of cyclic GMP in the action of heat-stable
enterotoxin of Escherichia coli. Nature 271: 755-756.
- 93 -
Huijsdens X.W., Linskens R.K., Mak M., Meuwissen S.G.M., Van Den Broucke-Grauls C.M.J.E.,
Savelkoul P.H.M. (2002): Quantification of Bacteria Adherent to Gastrointestinal Mucosa by Real-Time
PCR. Clinical Microbiology 40: 4423-4427.
Humphray S.J., Scott C.E., Clark R., Marron B., Bender C., Camm N., Davis J., Jenks A., Noon A., Patel
M., Sehra H., Yang F., Rogatcheva M.B., Milan D., Chardon P., Rohrer G., Nonneman D., De Jong P.,
Meyers S.N., Archibald A., Beever J.E., Schook L.B., Rogers J. (2007): A high utility integrated map of
the pig genome. Genome Biology 8: R139.
Jacobsen M. (2011): Genetic dissection of the ETEC F4ab/ac susceptibility locus in pigs. PhD thesis,
ISBN 978-87-7611-423-7.
Jacobsen M., Kracht S.S., Esteso G., Cirera S., Edfors I., Archibald A.L., Bendixen C., Andersson L.,
Fredholm M., Jørgensen C.B. (2010): Refined candidate region specified by haplotype sharing for
Escherichia coli F4ab/F4ac susceptibility alleles in pigs. Animal Genetics 41: 21-25.
Jensen B.B. (1998): The impact of feed additives on the microbial ecology of the gut in young pigs.
Journal of Animal and Feed Sciences 7: 45-64.
Ji H., Ren J., Yan X., Huang X., Zhang B., Zhang Z., Huang L. (2011): The porcine MUC20 gene:
molecular characterization and its association with susceptibility to enterotoxigenic Escherichia coli
F4ab/ac. Molecular Biology Reports 38: 1593-1601.
Joller D. (2009): Comparative molecular approaches to identify host determinants mediating adhesion of
E. coli F4 strains in pigs. Dissertation ETH Zurich number 18518.
Joller D., Jørgensen C.B., Bertschinger H.U., Python P., Edfors I., Cirera S., Archibald A.L., Bürgi E..,
Karlskov-Mortesen P., Andersson L., Fredholm M., Vögeli P. (2009): Refined localization of the
Escherichia coli F4ab/F4ac receptor locus on pig chromosome 13. Animal Genetics 40: 749-752.
Jones G.W. & Rutter J.M. (1972): Role of the K88 antigen in the pathogenesis of neonatal diarrhea
caused by Escherichia coli in piglets. Infection and Immunity 6: 918-927.
Jørgensen C.B., Cirera S., Andersson S.I., Archibald A.L., Raudsepp T., Chowdhary B., Edfors-Lilja I.,
Andersson L., Fredholm M. (2003): Linkage and comparative mapping of the locus controlling
susceptibility towards E. coli F4ab/ac diarrhoea in pigs. Cytogenetic and Genome Research 102: 157-162.
Jørgensen C.B., Cirera S., Archibald A.L., Andersson S.I., Fredholm M., Edfors-Lilja I. (2004): Porcine
polymorphisms and methods for detecting them. Patent number WO2004048606.
- 94 -
Kapitany R.A., Scoot A, Forsyth G.W., McKenzie S.L., Worthington R.W. (1979): Evidence for Two
Heat-Stable Enterotoxins Produced by Enterotoxigenic Escherichia coli. Infection and Immunity 24: 965-
966.
Karlskov-Mortensen P., Hu Z.L., Gorodkin J., Reecy J.M., Fredholm M. (2007): Identification of 10882
porcine microsatellite sequences and virtual mapping of 4528 of these sequences. Animal Genetics 38:
401-405.
Kim Y.J., Kim J.H., Hur J., Lee J.H. (2010): Isolation of Escherichia coli from piglets in South Korea
with diarrhea and characteristics of the virulence genes. Canadian Journal of Veterinary Research 74: 59-
64.
Kjaersgard H.D., Christensen G., Svensmark B., Bækbo P. (2002): Mortality in pigs. Proceedings of the
17th IPVS Congress. Ames, Iowa, USA.
Lang T., Hansson G.C., Samuelsson T. (2006): An inventory of mucin genes in the chicken genome
shows that the mucin domain of MUC13 is encoded by multiple exons and that ovomucin is part of a
locus of related gel-forming mucins. BMC Genomics 7: 197.
Lee R.W., Strommer J., Hodgins D., Shewen P.E., Niu Y., Lo R.Y. (2001): Towards development of an
edible vaccine against bovine pneumonic pasteurellosis using transgenic white clover expressing a
Mannheimia Haemolytica A1 leukotoxin 50 fusion protein. Infection and Immunity 69: 5786-5793.
Li Y., Qiu X. & Li H., Zhang Q. (2007): Adhesive patterns of Escherichia coli F4 in piglets of three
breeds. Journal of Genetics and Genomics 34: 591-599.
Li X.Y., Jin L.J., Uzonna J.E., Li S.Y., Liu J.J., Li H.Q., Lu Y.N., Zhen Y.H., Xu Y.P. (2009): Chitosan-
alginate microcapsules for oral delivery of egg yolk immunoglobulin (IgY): In vivo evaluation in a pig
model of enteric colibacillosis. Veterinary Immunology and Immunopathology 129: 132-136.
Liang W., Huang Y., Yang X., Zhou Z., Pan A., Qian B., Huang C., Chen J., Zhang D. (2006): Oral
immunization of mice with plant-derived fimbrial adhesion FaeG induces systemic and mucosal K88ad
enterotoxigenic Escherichia coli-specific immune responses. FEMS Immunology & Medical
Microbiology 46: 393-399.
Luther H., Vögeli P., Hofer A. (2009): Increasing genetic E. coli F18 resistance in Swiss pigs.
http://www.eaap.org/Barcellona/Book_Abstracts.pdf.
Mably J.D., Mohideen M.A., Burns C.G., Chen J.N., Fishman M.C. (2003): Heart of glass regulates the
concentric growth of the heart in zebrafish. Current Biology 13: 2138-2147.
- 95 -
MacKinnon J.D. (1998): Enteritis in the young pig caused by Escherichia coli. The Pig Journal 41: 227-
255.
Madoroba E., Van Driessche E., De Greve H., Mast J., Ncube I., Read J., Beeckmans S. (2009):
Prevalence of enterotoxigenic Escherichia coli virulence genes from scouring piglets in Zimbabwe.
Tropical Animal Health and Production 41: 1539-1547.
Maher D.M., Gupta B.K., Nagata S., Jaggi M., Chauhan S.C. (2011): Mucin 13: structure, function, and
potential roles in cancer pathogenesis. Molecular Cancer Research 9: 531-537.
Marin, F., Luquet, G., Marie, B., Medakovic, D. (2008): Molluscan Shell Proteins: Primary Structure,
Origin, and Evolution. Current Topics in Developmental Biology 80: 209-276.
Markwalder K. (2001): Travelers' diarrhea. Therapeutische Umschau 58: 367-371.
Mathie R.T. (2003): Clinical outcomes research: contributions to the evidence base for homeopathy.
Homeopathy 92: 56-57.
McCluskie M.J. & Davis H.L. (2000): Mucosal immunization with DNA vaccines. Methods in Molecular
Medicine 29: 287-295.
Meijerink E., Fries R., Vögeli P., Masabanda J., Wigger G., Stricker C., Neuenschwander S.,
Bertschinger H.U., Stranzinger G. (1997): Two alpha(1, 2) fucosyltransferase genes on porcine
chromosome 6q11 are closely linked to the blood group inhibitor (S) and Escherichia coli F18 receptor
(ECF18R) loci. Mammalian Genome 8: 736-741.
Meijerink E., Neuenschwander S., Fries R., Dinter A., Bertschinger H.U., Stranzinger G., Vögeli P.
(2000): A DNA polymorphism influencing alpha(1, 2) fucosyltransferase activity on the pig FUT1
enzyme determines susceptibility of small intestinal epithelium to Escherichia coli F18 adhesion.
Immunogenetics 52: 129-136.
Michaels R.D., Whipp S.C., Rothschild M.F. (1994): Resistance of Chinese Meishan, Fengjing, and
Minzhu pigs to the K88ac+ strain of Escherichia coli. American Journal of Veterinary Research 55: 333-
338.
Moon H.W. (1978): Mechanisms in the pathogenesis of diarrhea: a review. Journal of the American
Veterinary Medical Association 172: 443-448.
Moon H.W. (1997): Comparative histopathology of intestinal infections. Advances in Experimental
Medicine and Biology 412: 1-19.
- 96 -
Moore, W.E. & Holdeman L.V. (1974): Special problems associated with the isolation and identification
of intestinal bacteria in fecal flora studies. The American Journal of Clinical Nutrition 27: 1450-1455.
Mueller O., Hahnenberger K., Dittmann M., Yee H., Dubrow R., Nagle R., Ilsley D. (2000): A
microfluidic system for high-speed reproducible DNA sizing and quantitation. Electrophoresis 21: 128-
134.
Nagy B., Casey T.A., Moon H.W. (1990): Phenotype and genotype of Escherichia coli isolated from pigs
with postweaning diarrhea in Hungary. Journal of Clinical Microbiology 28: 651-653.
Nagy B. & Fekete P.Z. (2005): Enterotoxigenic Escherichia coli in veterinary medicine. International
Journal of Medical Microbiology 295: 443-454.
Nataro J.P. & Kaper J.B. (1998): Diarrheagenic Escherichia coli. Clinical Microbiology Reviews 11:
142-201.
Ngeleka M., Pritchard J., Appleyard G., Middleton D.M. Fairbrother J.M. (2003): Isolation and
association of Escherichia coli AIDA-I/STb, rather than EAST1 pathotype, with diarrhea in piglets and
antibiotic sensitivity of isolates. Journal of Veterinary Diagnostic Investigation 15: 242-252.
NOAH, National Office of Animal Health (2001): Antibiotics for animals.
http://www.noah.co.uk/issues/antibiotics.htm.
Owczarzy R., Tataurov A.V., Wu Y., Manthey J.A., McQuisten K.A., Almabrazi H.G., Pedersen K.F.,
Lin Y., Garretson J., McEntaggart N.O., Sailor C.A., Dawson R.B., Peek A.S. (2008): IDT SciTools: a
suite for analysis and design of nucleic acid oligomers. Nucleic Acids Research 36: W163-W169.
Ojeniyi B., Ahrens P., Meyling A. (1994): Detection of fimbrial and toxin genes in Escherichia coli and
their prevalence in piglets with diarrhea. The Application of colony hybridization assay, polymerase chain
reaction and phenotypic assays. Journal of Veterinary Medicine Series B 41: 49-59.
Ouyang J., Zeng W., Ren J., Yan X., Zhang Z., Yang M., Han P., Huang X., Ai H., Huang L. (2012):
Association of B3GNT5 polymorphisms with susceptibility to ETEC F4ab/ac in the white Duroc ×
Erhualian intercross and 15 outbred pig breeds. Biochemical Genetics 50: 19-33.
Panaro N.J., Yuen P.K., Sakazume T., Fortina P., Kricka L.J., Wilding P. (2000): Evaluation of DNA
fragment sizing and quantification by the Agilent 2100 Bioanalyzer. Clinical Chemistry 46: 1851-1853.
Peng Q.L., Ren J., Yan X.M., Huang X., Tang H., Wang Y.Z., Zhang B., Huang L.S. (2007): The
g.243A>G mutation in intron 17 of MUC4 is significantly associated with susceptibility/resistance to
ETEC F4ab/ac infection in pigs. Animal Genetics 38: 397-400.
- 97 -
Pentsuk N. & Van Der Laan J.W. (2009): An interspecies comparison of placental antibody transfer: new
insights into developmental toxicity testing of monoclonal antibodies. Birth Defects Research. Part B:
Developmental and Reproductive Toxicology 86: 328-344.
Python P., Jörg H., Neuenschwander S., Hagger C., Stricker C., Bürgi E., Bertschinger H.U., Stranzinger
G., Vögeli P. (2002): Fine-mapping of the intestinal receptor locus for enterotoxigenic Escherichia coli
F4ac on porcine chromosome 13. Animal Genetics 33: 441-447.
Python P. (2003): Genetic host determinants associated with the adhesion of E. coli with fimbriae F4 in
swine. Dissertation, ETH Zurich.
Python P., Jorg H., Neuenschwander S., Asai-Coakwell M., Hagger C., Burgi E., Bertschinger H.U.,
Stranzinger G., Vögeli P. (2005): Inheritance of the F4ab, F4ac and F4ad E. coli receptors in swine and
examination of four candidate genes for F4acR. Journal of Animal Breeding and Genetics 122: 5-14.
Qadri F., Svennerholm A.M., Faruque A.S.G., Sack R.B. (2005): Enterotoxienic Escherichia coli in
developing countries: epidemiology, microbiology, clinical features, treatment, and prevention. Clinical
Microbiology Reviews 18: 465-483.
Ramos A.M., Crooijmans R.P., Affara N.A., Amaral A.J., Archibald A.L., Beever J.E., Bendixen C.,
Churcher C., Clark R., Dehais P., Hansen M.S., Hedegaard J., Hu Z.L., Kerstens H.H., Law A.S., Megens
H.J., Milan D., Nonneman D.J., Rohrer G.A., Rothschild M.F., Smith T.P., Schnabel R.D., Van Tassell
C.P., Taylor J.F., Wiedmann R.T., Schook L.B., Groenen M.A. (2009): Design of a high density SNP
genotyping assay in the pig using SNPs identified and characterized by next generation sequencing
technology. PloS One 4: e6524.
Rampoldi A., Jacobsen M.J., Bertschinger H.U., Joller D., Bürgi E., Vögeli P., Andersson L., Archibald
A.L., Fredholm M., Jørgensen C.B., Neuenschwander S. (2011): The receptor locus for Escherichia coli
F4ab/F4ac in the pig maps distal to the MUC4-LMLN region. Mammalian Genome 22: 122-129.
Rapacz J. & Hasler-Rapacz J. (1986): Polymorphism and inheritance of swine small intestinal receptors
mediating adhesion of three serological variants of Escherichia coli producing K88 pilus antigen. Animal
Genetics 17: 305-321.
Rasschaert K., Verdonck F., Goddeeris B.M., Duchateau L., Cox E. (2007): Screening of pigs resistant to
F4 enterotoxigenic Escherichia coli (ETEC) infection. Veterinary Microbiology 123: 249-253.
Reid G., Howard J., Gan B.S. (2001): Can bacterial interference prevent infection? Trends in
Microbiology 9: 424–428.
- 98 -
Ren J., Yan X., Ai H., Zhang Z., Huang X., Ouyang J., Yang M., Yang H., Han P., Zeng W., Chen Y.,
Guo Y., Xiao S., Ding N., Huang L. (2012): Susceptibility towards enterotoxigenic Escherichia coli F4ac
diarrhea is governed by the MUC13 gene in pigs. PLoS One 7: e44573.
Rohrer G.A., Alexander L.J., Keele J.W., Smith T.P., Beattie C.W. (1994): A Microsatellite Linkage Map
of the porcine Genome. Genetics 136: 231-245.
Ronaghi M., Uhlén M., Nyrén P. (1998): A sequencing method based on real-time pyrophosphate.
Science 281: 363-365.
Roselli M., Finamore A., Britti M.S., Konstantinov S.R., Smidt H., De Vos W.M., Mengheri E. (2007):
The novel porcine Lactobacillus Sobrius strain protects intestinal cells from enterotoxigenic Escherichia
coli K88 infection and prevents membrane barrier damage. Journal of Nutrition 137: 2709-2716.
Rosengren L.B., Waldner C.L., Reid-Smith R.J., Checkley S.L., McFall M.E., Rajić A. (2008):
Antimicrobial resistance of fecal Escherichia coli isolated from grow-finish pigs in 20 herds in Alberta
and Saskatchewan, Canada. Canadian Journal of Veterinary Research 72: 160-167.
Rozen S. & Skaletsky H.J. (2000): Primer3 on the WWW for general users and for biologist
programmers. In Krawets S. & Misener S. (editors): Bioinformatics-methods and protocols: methods in
molecular biology. Humana Press, Totowa, 1st edition: 365-386.
Sarrazin E., Fritzsche C., Bertschinger H.U. (2000): Hauptvirulenzfaktoren bei Escherichia coli-Isolaten
von über zwei Wochen alten Schweinen mit Ödemkrankheit und/oder Colidiarrhöe. Schweizer Archiv
Tierheilk 142: 625-630.
Schook L.B., Beever J.E., Rogers J., Humphray S., Archibald A., Chardon P., Milan D., Rohrer G.,
Eversole K. (2005): Swine Genome Sequencing Consortium (SGSC): a strategic roadmap for sequencing
the pig genome. Comparative and Functional Genomics 6: 251-255.
Schroyen M., Stinckens A., Verhelst R., Geens M., Cox E., Niewold T., Buys N. (2012): Susceptibility of
piglets to enterotoxigenic Escherichia coli is not related to the expression of MUC13 and MUC20.
Animal Genetics 43: 324-327.
Sears C.L. (2005): A dynamic partnership: celebrating our gut flora. Anaerobe 11: 247-255.
Sellwood R., Gibbons R.A., Jones G.W., Rutter J.M. (1975): Adhesion of enteropathogenic Escherichia
coli to pig intestinal brush borders: the existence of 2 pig phenotypes. Journal of Medical Microbiology 8:
405-411.
- 99 -
Sellwood R. (1979): Escherichia coli diarrhea in pigs with or without the K88 receptor. Veterinary
Record 105: 228-230.
Sellwood R. (1982): Escherichia coli associated porcine neonatal diarrhea: Antibacterial activities of
colostrum from genetically susceptible and resistant sows. Infection and Immunity 35: 396-401.
Shahriar F., Ngeleka M., Gordon J.R., Simko E. (2006): Identification by mass spectroscopy of F4ac-
fimbrial-binding proteins in porcine milk and characterization of lactadherin as an inhibitor of F4ac-
positive Escherichia coli attachment to intestinal villi in vitro. Developmental and Comparative
Immunology 30: 723-734.
Simon G.L. & Gorbach S.L. (1986): The human intestinal microflora. Digestive Diseases and Sciences
31: 147S-162S.
Smith M.G., Jordan D., Chapman T.A., Chin J.J.-C., Barton M.D., Do T.N., Fahy V.A., Fairbrother J.M.,
Trott D.J. (2010): Antimicrobial resistance and virulence gene profiles in multi-drug resistant
enterotoxigenic Escherichia coli isolated from pigs with post-weaning diarrhoea. Veterinary
Microbiology 145: 299-307.
Snodgrass D.R., Chandler D.S., Makin T.J. (1981): Inheritance of Escherichia coli K88 adhesion in pigs:
identification of nonadhesion phenotypes in a commercial herd. The Veterinary Record 109: 461-463.
Steinhoff U. (2005): Who controls the crowd? New findings and old questions about the intestinal
microflora. Immunology Letters 99: 12-16.
Steemers F.J. & Gunderson K.L. (2007): Whole genome genotyping technologies on the BeadArray
platform. Biotechnology Journal 2: 41-49.
Sterzl J., Rejnek J., Tràvnìcek J. (1966): Impermeability of pig placenta for antibodies. Folia
Microbiologica 11: 7-10.
Sweeney E.J. (1968): Escherichia coli enteric disease of swine: observation on herd resistance. Irish
Veterinary Journal 22: 42-46.
Thiele H. & Nürnberg P. (2005): HaploPainter: a tool for drawing pedigrees with complex haplotypes.
Bioinformatics 21:1730-1732.
Thorns C.J., Boarer C.D.H., Morris J.A. (1987): Production and evaluation of monoclonal-antibodies
directed against the K88 fimbrial adhesin produced by Escherichia coli enterotoxigenic for piglets.
Research in Veterinary Science 43: 233-238.
- 100 -
Toledo A., Gómez D., Cruz C., Carreón R., López J., Giono S., Castro A.M. (2012): Prevalence of
virulence genes in Escherichia coli strains isolated from piglets in the suckling and weaning period in
Mexico. Journal of Medical Microbiology 61: 148-156.
Travers K.J., Chin C.S., Rank D.R., Eid J.S., Turner S.W. (2010): A flexible and efficient template format
for circular consensus sequencing and SNP detection. Nucleid Acids Research 38: e159.
Turner M. (2011): German E. coli outbreak caused by previously unknown strain. Nature
doi:10.1038/news.2011.345.
Valpotic I., Frankovic M., Vrbanac I. (1992): Identification of infant and adult swine susceptible to
enterotoxigenic Escherichia coli by detection of receptors for F4(K88)ac fimbriae in brush borders or
feces. Comparative Immunology, Microbiology and Infectious Diseases 15: 271-279.
Vandamme K., Melkebeek V., Cox E., Remon J.P., Vervaet C. (2011): Adjuvant effect of Gantrez®AN
nanoparticles during oral vaccination of piglets against F4+ enterotoxigenic Escherichia coli. Veterinary
Immunology and Immunopathology 139: 148-155.
Van Den Broeck W., Cox E., Goddeeris B.M. (1999): Receptor-dependent immune responses in pigs
after oral immunization with F4 fimbriae. Infection and Immunity 67: 520-526.
Van Den Broeck W., Cox E., Oudega B., Goddeeris B.M. (2000): The F4 fimbrial antigen of Escherichia
coli and its receptors. Veterinary Microbiology 71: 223-244.
Vögeli P., Bolt R., Fries R., Stranzinger G. (1994): Co-segregation of the malignant hyperthermia and the
Arg(615)-Cys(615) mutation in the skeletal-muscle calcium-release channel protein in 5 European
Landrace and Pietrain pig breeds. Animal Genetics 25: 59-66.
Vögeli P., Bertschinger H.U., Stamm M., Stricker C., Hagger C., Fries R., Rapacz J., Stranzinger G.
(1996): Genes specifying receptors for F18 fimbriated Escherichia coli, causing oedema disease and
postweaning diarrhoea in pigs, map to chromosome 6. Animal Genetics 27: 321-328.
Vogt R.L. & Dippold L. (2005): Escherichia coli O157:H7 outbreak associated with consumption of
ground beef, June–July 2002. Public Health Reports 120: 174–178.
Wagner B., Hufnagl K., Radauer C., Wagner S., Baier K., Scheiner O., Wiedermann U., Breiteneder H.
(2004): Expression of the B subunit of the heat-labile enterotoxin of Escherichia coli in tobacco mosaic
virus-infected Nicotiana benthamiana plants and its characterization as mucosal immunogen and
adjuvant. Journal of Immunological Methods 287: 203-215.
- 101 -
Wang Y., Ren J., Lan L., Yan X., Huang X., Peng Q., Tang H., Zhang B., Ji H., Huang L. (2007):
Characterization of polymorphisms of transferrin receptor and their association with susceptibility to
ETEC F4ab/ac in pigs. Journal of Animal Breeding and Genetics 124: 225-229.
Westerman R.B., Mills K.W., Phillips R.M., Fortner G.W., Greenwood J.M. (1988): Predominance of the
ac variant in K88-positive Escherichia coli isolates from swine. Journal of Clinical Microbiology 26: 149-
150.
Williams S.J., Wreschner D.H., Tran M., Eyre H.J., Sutherland G.R., McGuckin M.A. (2001): MUC13, a
novel human cell surface mucin expressed by epithelial and hemopoietic cells. The Journal of Biological
Chemistry 276: 18327-18336.
Winterø A.K. & Fredholm M. (1995): Three porcine polymorphic microsatellite loci (S0075, S0151,
S0158). Animal Genetics 26: 125-126.
Wittig W., Klie H., Gallien P., Lehmann S., Timm M., Tschäpe H. (1995): Prevalence of the fimbrial
antigens F18 and K88 and of enterotoxins and verotoxins among Escherichia coli isolated from weaned
pigs. International Journal of Medical Microbiology 283: 95-104.
Yan X., Huang X., Ren J., Zou Z., Yang S., Ouyang J., Zeng W., Yang B., Xiao S., Huang L. (2009):
Distribution of Escherichia coli F4 adhesion phenotypes in pigs of 15 Chinese and Western breeds and a
White Duroc x Erhualian intercross. Journal of Medical Microbiology 58: 1112-1117.
Zhang W., Berberov E.M., Freeling J., He D., Moxley R.A., Francis D.H. (2006): Significance of heat-
stable and heat-labile enterotoxins in porcine colibacillosis in an additive model for the pathogenicity
studies. Infection and Immunity 74: 3107-3114.
Zhang W., Zhao M., Ruesch L., Omot A., Francis D. (2007): Prevalence of virulence genes in
Escherichia coli strains recently isolated from young pigs with diarrhea in the U.S. Veterinary
Microbiology 123: 145-152.
Zhang B., Ren J., Yan X., Huang X., Ji H., Peng Q., Zhang Z., Huang L. (2008): Investigation of the
porcine MUC13 gene: isolation, expression, polymorphisms and strong association with susceptibility to
enterotoxigenic Escherichia coli F4ab/ac. Animal Genetics 39: 258-266.
Zhao L., Chen X., Xu X., Song G., Liu X. (2009): Analysis of the AIDA-I gene sequence and prevalence
in Escherichia coli isolates from pigs with post-weaning diarrhoea and oedema disease. Veterinary
Journal 180: 124-129.
- 102 -
ABBREVIATIONS
Description
A,T,G,C Adenine, thymine, guanine, cytosine
ADP Adenosine diphosphate
ATP Adenosine triphosphate
BAC Bacterial artificial chromosome
bp Base pair
°C Degree Celsius
cDNA Complementary deoxyribonucleic acid
cM CentiMorgan
ddH2O Double distilled H2O
DMSO Dimethyl sulfoxide
DNA Deoxyribonucleic acid
dNTP Deoxynucleotide triphosphate
EDTA Ethylenediaminetetraacetic acid
E. coli Escherichia coli
ETEC Enterotoxigenic Escherichia coli
EtOH Ethanol
F4 Fimbrial antigen F4, former K88
F4ab, F4ac, F4ad Fimbriae of type F4 with ab, ac and ad antigens
F18 Fimbrial antigen F18
FaeG Major subunit protein of F4 fimbriae
g Gram
x g Acceleration of gravity
h Hour
H2O Water
HSA Homo Sapiens chromosome
Kb Kilobase (103 bp)
kDa KiloDalton (103 Dalton)
l Liter
LT-I, LT-II Heat-labile enterotoxin type I and type II
M Molarity (mol/liter)
Mb Megabase (106 bp)
mg Milligram (10-3 gram)
µg Microgram (10-6 gram)
min Minute
ml Milliliter (10 -3 liter)
µl Microliter (10-6 liter)
mmol Millimol (10-3 mol)
mol Mole 6 x 1023 molecules
- 103 -
Continued from previous page
Description
mRNA Messenger RNA
NaAc Natrium acetate
NaCl Sodium chloride
NaOH Sodium hydroxide
NEH Nordic Experimental Herd
ng Nanogram (10-9 gram)
nl Nanoliter (10-9 liter)
PBS Phosphate buffered saline
PCR Polymerase chain reaction
RFLP Restriction fragment length polymorphism
RNA Ribonucleic acid
RNase(s) Ribonuclease(s)
RNasin RNases inhibitor
rpm Revolutions per minute
rRNA Ribosomal RNA
RT-PCR Reverse transcription PCR
s Second
SDS Sodium dodecyl sulfate
SNP Single nucleotide polymorphism
SPS Swiss Performing Station
SSC Saline sodium citrate buffer
SSC Sus Scrofa chromosome
STa, STb Heat-stabile enterotoxin a and b
Ta Annealing temperature
TBE Tris-borate-EDTA buffer
U Unit
UEH University experimental herd
5’ UTR Region at 5’ of a transcript, before the start codon, untranslated
3’ UTR Region at 3’ of a transcript, after the stop codon, untranslated
v/v Volume per volume
w/v Weight per volume
List of figures
Figure 1.1 E. coli bacterium with fimbriae. 13
Figure 1.2 Small intestinal brush border with strong ETEC F4 adhesion. 14
Figure 1.3 Gene cluster encoding F4 fimbriae. 16
Figure 1.4 Location of candidate genes for F4bcR on SSC13. 24
SUMMARY
104
Continued from previous page
Figure 2.1 Determination of the ETEC F4 receptor phenotype in the MAT 31
Figure 2.2 Example of a pyrogram 42
Figure 2.3 Simplified diagram of the Illumina HiSeq 2000 sequencing procedure 45
Figure 2.4 Simplified diagram of the PacBio RS sequencing procedure 46
Figure 2.5 Electropherograms of total RNA extracted from intestinal scrapings 49
Figure 2.6 Simplified diagram of the SOLiDTM 3 System RNA sequencing procedure 51
Figure 3.1:
Left: Restriction pattern of DdeI digestion of MUC4-6138-F/6887-R 749 bp PCR product to
determine the MUC4_g.6242 A>G polymorphism
Middle: Restriction pattern of Hin1II digestion of MUC4-7741-F/8202-R PCR products to
determine the MUC4_g.7947 G>A polymorphism
Right: Restriction pattern of XbaI digestion of MUC4-8012-F/8378-R 367 bp PCR product
to determine the MUC4_g.8227 G>C polymorphism
54
Figure 3.2 Diagram of three-generation family tree of 2349 and haplotypes in the SSC13q41-q44 region 55
Figure 3.3:
Left: Restriction pattern of TaqI digestion of TNK2e6-7-Fc2/R PCR product to determine the
TNK2_g.7075 A>C polymorphism
Middle: Restriction pattern of BseDI digestion of TNK2e9j-F/R PCR product to determine
the TNK2_g.7717 T>C polymorphism
Right: Restriction pattern of AluI digestion of TNK2e12b-Fv2/Rv2 PCR product to
determine the TNK2_g.11142 A>G polymorphism
58
Figure 3.4
Left: Restriction pattern of TspRI digestion of HEG1-F/R PCR product to determine the
HEG1_g.5244 T>C polymorphism
Middle: Restriction pattern of FOKI digestion of MUC13-F/R PCR product to determine the
MUC13-226 A>G polymorphism
Right: Restriction pattern of HaeIII digestion of MUC13-ED2-F/R PCR product to determine
the MUC13_c1930 T>G polymorphism
59
Figure 3.5 Diagram of a second three-generation family tree of 2349 and haplotypes in the SSC13q41-
q44 region 62
Figure 3.6 Family tree and haplotypes of sow 9480XJZ in the MUC4-MARC0045417 region 66
Figure 3.7 Alternative splicing of gene HEG1 in exon 5 69
Figure 3.8 Position of long-range PCR products in the HEG1-ITGB5 interval 71
Figure 3.9 SNPs positions in the HEG1-ITGB5 interval 72
List of tables
Table 1.1 Phenotypes observed in pigs according to the binding of ETEC F4 variants 18
Table 2.1 Primers for standard PCR 34
Table 2.2.1 Primers for long-range PCR in the intergenic region HEG1-MUC13 38
Table 2.2.2 Primers for long-range PCR in the intergenic region MUC13-ITGB5 39
Table 2.3 Primers for pyrosequencing 40
Table 2.4 Microsatellite markers used for genescan analyses 41
SUMMARY
105
Continued from previous page
Table 2.5 Selected SNPs belonging to the Illumina Porcine SNP60 BeadChip 43
Table 2.6 Selected SNPs in TNK2, MUC4, HEG1, and MUC13 genes and in the Illumina Porcine
SNP60 BeadChip 44
Table 3.1 Polymorphisms in genes ZDHHC19, TNK2, MUC4, KIAA0226, LRCH3, LMLN and MUC13
of 2349’s family 57
Table 3.2 List of SNPs from the Porcine SNP60 DNA BeadChip located in the interval ZDHHC19-
S0075 60
Table 3.3 Haplotypes of the six pigs recombinant in MUC4-F4bcR from the SPS 64
Table 3.4 Genotyping of the 46 pigs selected from the SPS in markers MUC4_g.8227, ALGA0072075,
KVL1293, SNP 1, SNP 2, ALGA0106330, MUC13-226 and MUC13-813 74
Table 3.5 Phenotypes observed in the 489 pigs from UEH according to the binding of ETEC F4
variants 75
Table 3.6 E. coli F4ad adhesion strengths at four intestinal sites in pigs of phenotypes E1, E2 and R 76
Table 3.7 Distribution of the three phenotypes for ETEC F4d in progeny with known phenotyped
parents 77
Table 3.8 Influence of phenotypes of parents on the median adhesion strengths (± SD) at the four
intestinal sites A through D of the progeny 78
Table 3.9 Kruskal-Wallis test with the six mating combinations of the three phenotypes for ETEC F4ad 78
Table 3.10 Evaluation of the Pedigree Analysis Package models 80
Table 3.11 Analyses of the largest litters (≥12 pigs) from UEH 81
Appendix
Media and solutions
Agarose gel 0.8-1.5% (w/v) PBS buffer
TBE 1 X NaCl 145 Mm
Agarose 0.8-1.5% Na2HPO4 9 Mm
Ethidium bromide 0.1 µg/ml NaH2PO4 1.3 mM
DMSO-Hanks-Medium (as in Bosi et al., 2004) PBS-EDTA buffer
Hanks’ Balanced Salt Solution 80 ml NaCl 96 Mm
Fetal Calf Serum 10 ml Na2HPO4 5.5 mM
DMSO 10 ml KH2PO4 1.5 mM
Glycerol 30 ml KCl 1.5 mM
BSA 1 g EDTA 10 mM
DNA loading dye-Bromophenol blue PBS-formaldehyde
Bromophenol blue 0.25% (w/v) Formaldehyde solution 2% (v/v)
D(+)-sucrose 40% (w/v) PBS buffer 1X 98% (v/v)
SUMMARY
106
Continued from previous page
DNA loading dye-XCFF Polyacrylamide gel 4.5%
XCFF 0.25% (w/v) ddH2O 23 ml
Orange G 0.26% (w/v) Urea 18 g
D(+)-sucrose 40% (w/v) TBE buffer 10 X 5 ml
Acrylamide: bis-acryl-amide (29:1) solution 7.5 ml
Formamide loading dye TEMED 15 µl
Formamide 4 X Ammonium persulfate 10% solution 350 µl
Loading buffer 1 X
Silica suspension 100 mg/ml
Lysis Buffer Silicon-dioxide 10 g
Sucrose 320 mM PBS buffer 1 X 100 ml
Tris-HCl 10mM
MgCl2 5mM TBE buffer 10X
Triton X-100 1% (w/v) Tris-HCL 890 mM
H3BO3 890 mM
Mannose buffer 2% EDTA 20 mM
D(+)-Mannose 2% (w/v)
PBS buffer 1X 98% (w/v) TE buffer
Tris-HCl 10 mM
ECL Buffer EDTA 1 mM
NH4Cl 155 mM
KHCO3 10 mM Wash-buffer
EDTA 0.1 mM NaCl 50 mM
Tris-HCl 10 mM
EDTA 2.5 mM
EtOH 50% (v/v)
Chemicals
Product Producer
λ-phage DNA 500 µg/ml GE
100 bp ladder GE
100 bp ladder direct load Sigma
50 bp ladder GE
50 bp ladder direct load Sigma
1 Kb ladder Life Technologies
Acrylamide: bis-acryl-amide (29:1) solution Bio-Rad
Agarose low EEO Sigma
BigDye sequencing mix AB
Columbia sheep blood agar Oxoid
DNase, RNase-free Qiagen
dNTPs, 100 mM GE
SUMMARY
107
Continued from previous page
Product Producer
dNTPs, 100 mM Sigma
Ethanol (EtOH) Merck
Etidium bromide (EtBr)
Formamide Fluka
Formaldehyde solution Sigma
Genescan 350 TAMRA or ROX size standard AB
Guanidine HCl Sigma
Isopropanol Merck
M-MLV reverse transcription system Promega
SequalPrep Long PCR kit with dNTPs Invitrogen
Silicon-dioxide Sigma
Sodium Acetate Fluka
Taq JumpStart DNA polymerase 2.5 U/µl Sigma
TRIzol Invitrogen
Trypticase soy broth (TSB) Becton Dickinson
Restriction enzymes
Producer
AluI Fermentas
BseDI (SecI) Fermentas
DdeI BioLabs
DdeI (HpyF3I) Fermentas
DdeI Promega
FOKI BioLabs
HaeIII Fermentas
Hin1II (NlaIII) Fermentas
PstI Boehringer Mannheim
TaqI Roche
TspRI BioLabs
TspRI (TscAI) Fermentas
XbaI Fermentas
XbaI Promega
Labware
Product Producer
6-well macroplates 82 x 127 mm Greiner
6-well macroplates 82 x 127 mm Orange
Blood tubes 10 ml with EDTA Vacuette Greiner
SUMMARY
108
Continued from previous page
Product Producer
Blood tubes 10 ml with EDTA Venosafe Terumo
Centrifuge tubes 15 ml Falcon
Centrifuge tubes 50 ml TPP
Cover glass 18 x 18 mm Menzel
Cryotubes 1.8 ml Nunc
Genelute Mammalian Genomic DNA miniprep kit Sigma
Glass slide frosted ends 76 x 26 mm Menzel
Micro tubes 1.5 ml Treff
Micro tubes 2 ml Treff
Microcon centrifugal filter units Millipore
Montage PCR centrifugal filter devices Millipore
PCR 8-strip tubes SSI
PCR 8-strip tubes VWR
PCR plates 96 well Axygen
PCR plates 96 well ABI
PCR plates 96 well low profile Thermo
PCR tubes 0.2 ml SSI
PCR tubes 0.5 ml Axygen
Petri dishes 92 mm Falcon
QIAquick Gel extraction kit Qiagen
Serological pipette 1 ml Falcon
Serological pipette 5 ml Falcon
Serological pipette 5 ml Sarstedt
Serological pipette 10 ml Falcon
Serological pipette 25 ml VWR
Tips 10 µl Axygen
Tips 30 µl Matrix
Tips 200 µl Treff
Tips 1000 µl Treff
Wide-necked bottles PVC 100 ml Semadeni
SUMMARY
109
SNPs Nomenclature
All the SNPs discovered in this project have been deposited in dbSNP (NCBI) under batch
number CHCF. The SNPs are given with their dbSNP ID and position according to the reference
sequence Sscrofa 10.2.
SNPs NCBI
dbSNP ID
Position on
Sscrofa 10.2
SNP 1 CHCF1 144944384
SNP 2 CHCF3 144978031
LMLN_g.15920 CHCF5 144201963/1442551221
ZNF148_g.96828 CHCF6 144544700
SLC12A8_g.1365 CHCF7 144499531
SLC12A8_g.22157 CHCF8 144631142
SLC12A8_g.129502 CHCF9 144853219
SLC12A8_c.1990 CHCF10 144853282
SLC12A8_c.2947 CHCF11 144849048
HEG1_g.5244 CHCF12 144823489
HEG1_c.321 CHCF13 144800514
HEG1_c.1905 CHCF14 144783551
HEG1_c.1917 CHCF15 144783539
HEG1_g.49379 CHCF16 144779899
HEG1_c.6955 CHCF17 144707761/1449312421
JN613413_23529 CHCF18 144935458
JN613413_34623 CHCF19 144946537
JN613413_34996 CHCF20 144946910
JN613413_35253 CHCF21 144947167
JN613413_35314 CHCF22 144947228
JN613413_53252 CHCF23 144965272/1609104181
JN613413_53278 CHCF24 144965298/1609103921
JN613413_53373 CHCF25 144965393/1609103011
JN613413_53494 CHCH26 144965514/1609101801
JN613413_53612 CHCF27 144965632/1609100621
JN613413_61641 CHCF28 144973813
JN613413_61768 CHCF29 144973940
JN613413_62196 CHCF30 144974368
MUC13_g.207 CHCF31 144986614
MUC13_g.791 CHCF32 144987198
MUC13_g.1248 CHCF33 144987655
MUC13_g.1345 CHCF34 144987751
MUC13_g.1412 CHCF35 144987819
SUMMARY
110
Continued from previous page
SNPs NCBI
dbSNP ID
Position on
Sscrofa 10.2
MUC13_g.1414 CHCF36 144987821
MUC13_g.1945 CHCF37 144988352
MUC13_g.1974 CHCF38 144988381
MUC13_g.8951 CHCF39 144997010
MUC13_g.8981 CHCF40 144997040
MUC13_c.232 CHCF41 144997797
MUC13_g.15150 CHCF42 145003208
MUC13_g.15376 CHCF43 145003434
MUC13_g.15379 CHCF44 145003436
MUC13_g.15381 CHCF45 145003439
MUC13_c.1243 CHCF46 145019310
MUC13_c.1289 CHCF47 145019356
MUC13_c.1290 CHCF48 145019357
MUC13_c.1702 CHCF49 145019769
MUC13_c.1788 CHCF50 145019855
MUC13_c.1842 CHCF51 145019909
MUC13_c.1930 CHCF52 145019997
MUC13_c.1986 CHCF53 145020053
MUC13_c.2014 CHCF54 145020081
MUC13_c.2068 CHCF55 145020135
JN613413_107599 CHCF56 145021109
JN613413_107649 CHCF57 145021159
JN613413_115242 CHCF58 145028754
JN613413_115364 CHCF59 145028876
JN613413_115460 CHCF60 145028972
ITGB5_c.246 CHCF61 145064038
ITGB5_g.65464 CHCF62 145107986/1608950211
ITGB5_c.917 CHCF63 145108180/1608952151
ITGB5_g.115393 CHCF64 ---2
1 SNP maps twice on Sscrofa 10.2
2 SNP ITGB5_g.115393 does not map in reference sequence Sscrofa 10.2, this SNP is mapped in BAC
clone CH242-89F13, NCBI accession no. CU466522.
SUMMARY
111
CURRICULUM VITAE
Antonio Rampoldi
Personal Information
Date of birth 26th March 1983
Place of birth Cantù, Italy
Nationality Italian
Citizen of Bregnano, Italy
Education and Training
Dates (from – to) 2002
Name and type of organisation
providing education and training
Liceo Scientifico “De Amicis”
Via Salita Camuzio 4 - 22063 Cantù - Italy
Title of qualification awarded Scientific high school diploma 92/100
Dates (from – to) 02/2005-06/2005
Name and address of employer Zootechnical Department, Biotechnical Faculty, University of
Ljubljana
3 GROBLJE - 1230 DOMŽALE - SLOVENIA
Type of business or sector ERASMUS Program
Occupation or position held Intern
112
Dates (from – to) 22/02/2006
Name and type of organisation
providing education and training
UNIVERSITY OF MILAN
Via Festa del Perdono 7 – 20122 Milan - Italy
Title of qualification awarded Bachelor’s Degree in Veterinary biotechnology 110/110
Dates (from – to) 20/11/2007
Name and type of organisation
providing education and training
UNIVERSITY OF MILAN
Via Festa del Perdono 7 – 20122 Milan - Italy
Title of qualification awarded Master’s Degree in Veterinary biotechnology 110/110 with
distinction
Dates (from – to)
06/2008-07/2008
Name and address of employer Unité de Génomique et Physiologie de la Lactation
INRA
78352 Jouy-en-Josas Cedex, France
Type of business or sector Galileo Program
Occupation or position held Intern
Dates (from – to) 08/2008-07/2013
Name and address of employer Institut für Agrarwissenschaften (IAS)
ETH Zürich
8092 Zürich, Switzerland
Occupation or position held Doctoral student
113
Publications
Rampoldi A., Jacobsen M.J., Bertschinger H.U., Joller D., Bürgi E., Vögeli P., Andersson L., Archibald
A.L., Fredholm M., Jørgensen C.B., Neuenschwander S. (2011): The receptor locus for Escherichia coli
F4ab/F4ac in the pig maps distal to the MUC4-LMLN region. Mammalian Genome 22: 122-129.
Jacobsen M., Cirera S., Joller D., Esteso G., Kracht S.S., Edfors I., Bendixen C., Archibald A.L., Vogeli
P., Neuenschwander S., Bertschinger H.U., Rampoldi A., Andersson L., Fredholm M., Jørgensen C.B.
(2011): Characterisation of five candidate genes within the ETEC F4ab/F4ac candidate region in pigs.
BMC Research Notes 4: 225.
Abstracts
Rampoldi A., Bertschinger H.U., Bürgi E., Vögeli P., Joller D., Neuenschwander S. “Mapping of the
Escherichia coli F4ab/F4ac receptor locus on pig chromosome 13”. Pig Genome III Conference, 2-4
November, 2009, Hinxton, UK; poster.
Rampoldi A., Bertschinger H.U., Bürgi E., Vögeli P., Jacobsen M.J., Jørgensen C.B., Neuenschwander S.
“Refined mapping of the Escherichia coli F4ab/F4ac receptor locus (F4bcR) on pig chromosome 13”.
32nd Conference of the International Society of Animal Genetics, 26-30 July, 2010, Edinburgh, UK;
poster.
Neuenschwander S., Bruggmann R., Rampoldi A., Qi W., Aluri S., Schlapbach R., Vögeli P. “Detection
of porcine miRNA in various tissues by next generation sequencing”. 32nd Conference of the
International Society of Animal Genetics, 26-30 July, 2010, Edinburgh, UK; poster.
Rampoldi A., Jacobsen M.J., Bertschinger H.U., Joller D., Bürgi E., Vögeli P., Jørgensen C.B.,
Neuenschwander S. “Comparative and molecular approach to the identification of receptors for E. coli
with fimbriae F4ab/F4ac in the pig”. Schweizerische Vereinigung für Tierproduktion, 2011, Zollikofen,
Switzerland; poster.
Rampoldi A., Bertschinger H.U., Bürgi E., Vögeli P., Jørgensen C.B., Jacobsen M.J., Neuenschwander S.
“Exclusion of gene HEG1 as receptor locus for the E. coli F4ab/F4ac”. 33rd Conference of the
International Society for Animal Genetics, 15-20 July, 2012, Cairns, Australia; poster.
Rampoldi A., Bertschinger H.U., Bürgi E., Dolf G., Vögeli P., Neuenschwander S. “Inheritance
mechanisms of receptor(s) for Enterotoxigenic Escherichia coli fimbriae F4ad (F4adR) in the pig”.
Schweizerische Vereinigung für Tierproduktion, 2013, Posieux, Switzerland; poster.
