Research Article Isolation and Identification of Free

Hindawi Publishing CorporationBioMed Research InternationalVolume 2013 Article ID 675145 8 pageshttpdxdoiorg1011552013675145

Research ArticleIsolation and Identification of Free-Living Amoebae fromTap Water in Sivas Turkey

Kuumlbra AccedilJkalJn CoGkun1 Semra Oumlzccedilelik1 Luumltfi Tutar2 Nazif ElaldJ3 and Yusuf Tutar45

1 Department of Parasitology Faculty of Medicine Cumhuriyet University 58140 Sivas Turkey2Department of Biology Faculty of Science and Letters Kahramanmaras Sutcu Imam University46100 Kahramanmaras Turkey

3 Department of Infectious Diseases Faculty of Medicine Cumhuriyet University 58140 Sivas Turkey4Department of Biochemistry Faculty of Pharmacology Cumhuriyet University 58140 Sivas Turkey5 CUTFAM Research Center Faculty of Medicine Cumhuriyet University 58140 Sivas Turkey

Correspondence should be addressed to Yusuf Tutar ytutarcumhuriyetedutr

Received 9 April 2013 Revised 11 June 2013 Accepted 27 June 2013

Academic Editor Gernot Zissel

Copyright copy 2013 Kubra Acıkalın Coskun et alThis is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

The present work focuses on a local survey of free-living amoebae (FLA) that cause opportunistic and nonopportunistic infectionsin humans Determining the prevalence of FLA in water sources can shine a light on the need to prevent FLA related illnessesA total of 150 samples of tap water were collected from six districts of Sivas province The samples were filtered and seeded onnonnutrient agar containing Escherichia coli spread Thirty-three (22) out of 150 samples were found to be positive for FLA TheFLAwere identified bymorphology and by PCRusing 18S rDNAgeneThemorphological analysis and partial sequencing of the 18SrDNA gene revealed the presence of three different speciesAcanthamoeba castellaniiAcanthamoeba polyphaga andHartmannellavermiformis Naegleria fowleri Balamuthia mandrillaris or Sappinia sp was not isolated during the study All A castellanii and Apolyphaga sequence types were found to be genotype T4 that contains most of the pathogenic Acanthamoeba strains The resultsindicated the occurrence and distribution of FLA species in tap water in these localities of Sivas Turkey Furthermore the presenceof temperature tolerant Acanthamoeba genotype T4 in tap water in the region must be taken into account for health risks

1 Introduction

Free-living amoebae (FLA) ubiquitous and widely dis-tributed protozoa feed on bacteria algae fungi and smallorganic particles and are adaptable to their environment [1]They can be found in dust air seawater dental treatmentunits sewage eyewash solutions contact lenses and dialysisunits and are particularly abundant in soil and water [2 3]Among them only four genera including AcanthamoebaNaegleria Balamuthia and Sappinia cause opportunistic andnonopportunistic infections in humans and in animals butinfections are not commonly reported with the exception ofAcanthamoeba keratitis which is reported in over 1 to 2 casesper million contact lens wearers in the USA annually [4ndash6] Acanthamoeba spp and Balamuthia mandrillaris causegranulomatous amoebic encephalitis (GAE) while Naegleria

fowleri causes primary amoebic meningoencephalitis (PAM)Both GAE and PAM are central nervous system infec-tions Some Acanthamoeba spp commonly Acanthamoebacastellanii cause amoebickeratitis (AK) a vision-threateningcorneal infection In humans Acanthamoeba spp may alsoaffect the skin and lungs [3 7] Hartmannella spp invadeanimal tissues and have been found in nasal mucosa ofhumans the bronchial system of dogs and the intestines ofturkeys [8] Sappinia diploidea have been reported only oncefrom a brain infection in a healthy man [9]This amoeba wasidentified later as Sappinia pedata by using real-time PCRtests based on 18S rRNA gene sequences [10]

The presence of FLA in tap water may represent ahealth risk to both immunocompromised and immunocom-petent individuals [11] and they are resistant to extremeconditions of temperature pH and exposure to various

2 BioMed Research International

Sivas

Hafik

Zara

Kangal

Gemerek

GolovaAkıncılar

Imralı

Koyulhisar

Gurun

Altınyayla

Yıldızeli

Divrigi

0 60 120(km)

Doganşar Suşehri

UlaşŞarkışla

Figure 1 Districts of Sivas province and water sample locations(dots) Turkey

chemicals [2 5] In addition to their pathogenicity FLAserve as hosts for a large number of pathogenic bacteria andviruses for humans including Legionella spp Vibrio choleraeBurkholderia cepacia Listeria monocytogenes Escherichia coliO157 Mycobacterium spp Coxsackievirus Adenovirus andEchovirus [2 5 11] Furthermore FLA can increase virulenceof some of the bacteria called amoeba-resisting microorgan-isms (ARMs) including Mycobacterium spp Pseudomonasaeruginosa Legionella spp Cryptococcus neoformans andHistoplasma capsulatum [11]

An increase in the number of intracerebral infectionscaused by FLA in the USA and worldwide has been reported[6]

FLA human infections are documented [12ndash14] but lim-ited information is available in the literature concerning FLAfrom the environmental samples in Turkey [15ndash17]Thereforethe aim of this study is to isolate FLA from tap water samplescollected from various districts in the province of Sivas byemploying morphological and molecular methods in orderto contribute to the study of understanding their ecology andto identify any potential health risks

2 Subjects and Methods

21 Study Location Sampling Isolation and Identificationof Amoebae and DNA Extraction A total of 150 tap watersamples were collected betweenMarch and August 2011 fromthe districts of Divrigi Kangal Susehri Ulas Golova andGemerek of Sivas province located in the central Anatoliaregion of Turkey The total surface area of Sivas province is28500 km2 and the study area is about 10000 km2 (Figure 1)Sivas is located at the junction of different regions and reflectstypical climates of Turkeyrsquos various regions Therefore aprevalence study in a transition region like Sivas may reflectoverall Turkish FLA distribution

All samples (except two of them see Table 2) in thisstudy were chlorinated by the city officials in drinking water

plant according to world health organization criteria (02ndash07 ppm)

A total of 500mL of water sample was collected fromeach tap focus in a sterile plastic container from differentvillages and districtsTheywere then immediately transferredto the laboratory FLA were isolated from the samples aspreviously described elsewhere [7 18] Briefly water sampleswere filtered through 045 120583m pore size cellulose nitratemembrane filter (47mm in diameter) under a vacuum Themembrane filters for each water sample were scraped andcollected materials were placed in 15mL of sterile covertubes containing 10mL phosphate buffered saline (PBS)Tubes were incubated at room temperature overnight andthen centrifuged for ten minutes at 1500 rpm to collectparticles on filters After centrifugation the supernatantsolution was discarded and the pellet was inoculated onto15 nonnutrient agar (NNA) plates A dense suspension ofheat inactivated Escherichia coli prepared in Page Saline wasseeded ontoNNAplates to growFLAAfter the inoculation ofthe samples all plates were incubated at 30∘C and examineddaily for the presence of FLA for up to 10 days using a lightmicroscope (100x) Once a growth was observed a piece ofNNA containing the amoebaewas excised to inoculate a freshNNA plate to subculture and incubated until trophozoiteswere grown Then the trophozoites were scraped to isolategenomic DNA (QIAmp DNAMini Kit QIAGEN)

Amoebae were isolated and identified by morphologicfeatures as well as PCR based sequence analysis Smirnovand Goodkovrsquos basic morphotyping list was used to identifyamoebae [19] Acanthamoeba was identified both by acan-thopodia in the trophozoite form and by double-layeredpolygonal walls in the cysts form (Figure 2(a)) The Hart-mannella was identified by smooth spherical appearance(Figure 2(b)) [16 20] A temperature tolerance test was alsoperformed for Acanthamoeba three sets of subculture plates(NNA-E coli) for each sample were incubated at 37 42and 52∘C respectively All plates were examined daily foramoebal growth by phase contrast microscopy for sevendays [21] When an FLA strain was isolated the flagellatetransformation test was applied for the identification of Nfowleri [20] All FLA strains were transferred to a fresh NNA-E coli plate every month to check their viability and each ofthem were used in the experiments

22 PCR Amplification Sequencing Blast Search of SequencedAmplicons and Cluster Analysis of Amoebae AcanthamoebaN fowleri B mandrillaris and Sappinia genus specific primerpairs along with common amoebae specific primers (Table 1)were employed inmolecular detection of the amoebae species[7 10 22ndash24] Fifty 120583L of PCR mixture contained 1 ngDNA 5 120583L 10x Taq buffer 5 120583L 2mM dNTP 4120583L 25mMMgCl

2 05 120583L 100mM primer 05120583L Taq DNA Polymerase

The thermal cycling conditions were an initial incubationof 94∘C for 7min and 45 cycles of 94∘C for 60 s (95∘Cfor Acanthamoeba) X∘C for 60 s and 72∘C for 60 s with aterminal extension of 72∘C for 10min (X= 55∘C for Nae-gleria Sappina and Balamuthia 60∘C for Acanthamoebaand 65∘C for common primers) PCR reactions were per-formed to amplify 18S rDNA sequences These primers

BioMed Research International 3

(a) (b)

Figure 2 Hartmannella (a) and Acanthamoeba (b) trophozoites (white arrow) cyst forms (black arrow) (original magnification 40x)

yielded 750ndash1000 bp fragments The PCR amplicons wereseparated by 1 agarose gel (data not shown but available onrequest) Amplicon sizes were estimated using a DNA ladderAmplicons were gel purified prior to sequencing Sequenc-ing was unidirectional (5-GTCAGAGGTGAAATTCTTGG-31015840) Nucleotide similarity search was performed by blastsearch (basic local alignment search tool) of sequencedamplicons against amoeba species Acanthamoeba has beenclassified into genotypes based on 18S ribosomal RNAnucleotide sequencing recently [25 26] GenBank accessionnumbers of these species are given in Table 2 Morpho-logical observations and sequencing yielded three differ-ent species A castellanii Hartmannella vermiformis andA polyphaga

Cluster analysis was performed for FLAby using the latestversion of MEGA 505 software [27] Phylogenetic constructwas produced by employing 18S rRNA gene sequences andamoebae genus 18S rDNA gene sequences accession numberslisted in Table 2 These were aligned with the correspondingsequences from 33 reference Acanthamoeba isolates anda neighbor-joining tree was obtained using MEGA 505(Figure 3) [27]

3 Results

FLA were detected in 33 (22) out of 150 water samples insix Sivas districts All Hartmannella isolates (119899 = 24) wereidentified as H vermiformis and except one isolate whichwas identified as A polyphaga all Acanthamoeba isolates(119899 = 8) were identified as A castellanii No representativeof any of the other three genera of FLA of clinical relevanceBalamuthia Naegleria and Sappinia was present in any ofthe samples (Table 2) It was observed that all Acanthamoebaisolates were capable of growth at all incubation temperaturesand they grew easily and fast at 37∘C incubation but theamoeba trophozoites grew slower at either 42∘C or 52∘C ofincubations After two days of incubation respective Acan-thamoeba isolates stayed alive at 42∘C (samples numbers 213 19 27 30 32 and 33) and at 52∘C (samples numbers 2 1327 30 32 and 33) The flagellate transforming test was foundto be negative for all the 33 isolates

Morphological identification of amoebae revealed Acan-thamoeba and Hartmannella trophozoites Acanthamoeba

strains belong to the T4 genotype as confirmed by genusspecific primer pair (Table 1)

The main target of the current study was to apply andevaluate molecular methods to recognize FLA along withclassical microscopic determination method We used PCRprimers to diagnose FLA species by employing a generalprimer set and four genus specific primer sets (Table 1) Inthis study FLA isolates were compared to GenBank andthe reference strains (Table 2) to determine species PCRamplicon lengths varied from 500 to 1000 base pairs

Acanthamoeba isolates were further examined by phy-logenetic analyses by comparison of sequenced ampliconsto Acanthamoeba strains This included all representativesequences available from GenBank All Acanthamoeba iso-lates were clustered in sequence type group T4

A homology search was performed with BLAST fromNCBI The deduced sequences were aligned by ClustalWwith FLA sequences and the phylogenetic tree was then dis-played by neighbor-joining analysis conducted with MEGA(Figure 3) All sequences gave 100 similarity except sam-ple number 2 (99) with accession numbers being givenin Figure 3 In the phylogenetic tree Acanthamoeba andHartmannella species clustered in different branches butsequences of the same genus clustered together in the samebranchThis shows their genetic similarity to a certain degreeand consistency with identification of isolated samples

Neighbor-joining gene tree analysis identifies individualstrains of the isolates obtained in this study as revealedby reference numbers given at Table 2 The phylogeneticanalysis illustrated thatAcanthamoeba isolates were clusteredto pathogenic genotype T4 and closest to U07413 referencenumber However two Acanthamoeba isolates belong to theU7413 and U07407 reference numbers Similarly Hartman-nella isolates belong to the AF426157 reference number

The phylogenetic analysis confirms clinically relevantamphizoic amoebae in tap water which may present a risk topeoplersquos health

4 Discussion

FLA were distributed worldwide and the composition ofthese species at certain locations depends on the surround-ings Also the spreading of FLA species depends on its


U074011 CDC0184V014 18S rRNA geneAF0190681 BH-2 18S ribosomal RNA gene partial sequenceAF0190631 2802 18S ribosomal RNA gene partial sequenceAF0190581 Vazaldua 18S ribosomal RNA gene partial sequenceU074041 ATCC 50498 18S ribosomal RNA gene complete sequenceU074061 BCM0685116 ATCC 50368 18S rRNA geneAF0190561 HC-2 18S ribosomal RNA gene partial sequenceU074071 BCM017316 ATCC 50371 18S rRNA geneU074141 ATCC 50370 18S rRNA geneS813371 18S rRNA H37 genomic 2781 ntU074001 CDC0981V006 18S rRNA geneAF0190521 Panola Mountain 18S ribosomal RNA gene partial sequenceU074161 ATCC 50373 18S rRNA geneAF0190601 2AX1 18S ribosomal RNA gene partial sequenceAF0190621 Nagington 18S ribosomal RNA gene partial sequenceU074081 ATCC 50496 18S ribosomal RNA gene complete sequenceAF0190551 Liu-E1 18S ribosomal RNA gene partial sequenceU074121 S-7 ATCC 30731 18S rRNA geneAF0190591 Rodriguez 18S ribosomal RNA gene partial sequenceAF0190501 GE3a 18S ribosomal RNA gene partial sequenceU074111 ATCC 30870 18S rRNA geneU074131 ATCC 50374 18S rRNA geneU074051 CDC01801 18S rRNA geneU074021 CDC0884V029 18S rRNA geneU074171 Oak Ridge ATCC 30884 18S rRNA geneAF0190611 18S ribosomal RNA gene partial sequenceU074101 ATCC 50497 18S ribosomal RNA gene complete sequenceAF0190511 OX-1 18S ribosomal RNA gene partial sequenceAF0190531 18S ribosomal RNA gene partial sequenceU074031 CDC0786V042 18S rRNA geneU074151 JACS2 ATCC 50372 18S rRNA geneAF0190571 Diamond 18S ribosomal RNA gene partial sequenceU074091 ATCC 50369 18S ribosomal RNA gene complete sequenceAF0190541 Jin-E5 18S ribosomal RNA gene partial sequenceAF0190671 Lilly A-1 18S ribosomal RNA gene partial sequenceAF0190691 RBF1 18S ribosomal RNA gene partial sequenceAF0190701 18S ribosomal RNA gene partial sequenceU947411 PD2S 18S small subunit ribosomal RNA gene partial sequenceU947381 NJSP-3-2 18S small subunit ribosomal RNA gene partial sequenceU947301 45 18S small subunit ribosomal RNA gene partial sequenceU947321 722 18S small subunit ribosomal RNA gene partial sequenceU947331 68-2 18S small subunit ribosomal RNA gene partial sequenceU947311 7327 18S small subunit ribosomal RNA gene partial sequenceU947351 E18-2 18S small subunit ribosomal RNA gene partial sequenceU947361 118 18S small subunit ribosomal RNA gene partial sequenceU947371 53-2 18S small subunit ribosomal RNA gene partial sequenceU947401 251 18S small subunit ribosomal RNA gene partial sequenceU947391 Jc-1 18S small subunit ribosomal RNA gene partial sequenceU947341 407-3a 18S small subunit ribosomal RNA gene partial sequence

HM3636271 GERF2 small subunit ribosomal RNA gene partial sequenceFR8205921 MTZ genomic DNA containing 18S rRNA geneAB4259531 Mbc 3H gene for 18S ribosomal RNAEF3786751 T5-5 18S ribosomal RNA (rrn) geneEF3786741 T5-4 18S ribosomal RNA (rrn) geneEF3786711 T3-3 18S ribosomal RNA (rrn) geneEF3786701 T3-1 18S ribosomal RNA (rrn) geneAF4261571 18S ribosomal RNA geneM951681 small subunit ribosomal RNAAY6808401 18S ribosomal RNA geneAY5029611 isolate KWR-3 18S ribosomal RNA geneAY5029601 isolate KWR-2 18S ribosomal RNA geneAY5029591 isolate KWR-1 18S ribosomal RNA geneHM3636261 GERF1 small subunit ribosomal RNA geneHQ0070371 strain D113 18S ribosomal RNA geneFJ9407091 18S ribosomal RNA geneGQ9965351 isolate A3 18S ribosomal RNA geneFJ9407101 isolate 12i 18S ribosomal RNA geneHQ8334421 isolate LN-HB5 18S ribosomal RNA geneAB5258391 18S ribosomal RNAAB5258371 18S ribosomal RNAAB5258351 18S ribosomal RNAAB5258341 18S ribosomal RNAHQ8334431 isolate LN-B14 18S ribosomal RNA geneAB5258361 18S ribosomal RNAHQ8334441 isolate LN-HD12 18S ribosomal RNA geneFJ9407161 isolate 2e 18S ribosomal RNA gene

AF0190641 Ray Hayes 18S ribosomal RNA gene partial sequenceAF0190651 OC-15C 18S ribosomal RNA gene partial sequenceAF0190661 Comandon de Fonbrune 18S ribosomal RNA gene partial sequence

AY5763651 546 18S ribosomal RNA geneAY5763641 545 18S ribosomal RNA gene99

92

12

12

43

75

58

43

02

Figure 3 Phylogenetic analysis of FLA isolates Neighbor-joining tree based on 18S rDNA sequencesThe sequences from Sivas isolates werealigned byMEGA software using reference isolates fromGenBank Bar is index of evolutionary distances (02) among the different sequencesThe numbers on the branch nodes of phylogenetic tree corresponded to bootstrap value


Table 1 Primers used in this study (51015840 rarr 31015840)

Species Forward primer Reverse primer ReferenceCommon for FLA CGCGGTAATTCCAGCTCCAATAGC CAGGTTAAGGTCTCGTTCGTTAAC Tsvetkova et al 2004 [7]Acanthamoeba spp GGCCCAGATCGTTTACCGTG TCTCACAAGCTGCTAGGGAGTCA Schroeder et al 2001 [22]N fowleri CAAACACCGTTATGACAGGG CTGGTTTCCCTCACCTTACG Schild et al 2007 [23]B mandrillaris CGCATGTATGAAGAAGACCA TTACCTATATAATTGTCGATACCA Booton et al 2003 [24]Sappinia TCT GGT CGC AAG GCT GAA AC GCA CCA CCA CCC TTG AAA TC Qvarnstrom et al 2009 [10]FLA Free-living amoebae

Table 2 Species genotypes GenBank accession numbers and isolation sources of free living amoebae in districts of Sivas Turkey

No Species identified Genotype Gene Bank ref no Source of tap water1 Acanthamoeba castellanii T4 U07403 Divrigi village2 Acanthamoeba castellanii T4 U07413 Kangal village3 Hartmannella vermiformis AF426157 Susehri village4 Hartmannella vermiformis AF426157 Kangal village5 Hartmannella vermiformis AF426157 Kangal village6 Hartmannella vermiformis AF426157 Kangal village7 Hartmannella vermiformis AF426157 Kangal city centerlowast

8 Hartmannella vermiformis AF426157 Susehri village9 Hartmannella vermiformis AF426157 Susehri village10 Hartmannella vermiformis AF426157 Kangal village11 Hartmannella vermiformis AF426157 Susehri village12 Hartmannella vermiformis AF426157 Divrigi village13 Acanthamoeba castellanii T4 U07413 Kangal village14 Hartmannella vermiformis AF426157 Ulas village15 Hartmannella vermiformis AF426157 Susehri village16 Hartmannella vermiformis AF426157 Divrigi village17 Hartmannella vermiformis AF426157 Golova village18 Hartmannella vermiformis AF426157 Divrigi village19 Acanthamoeba castellanii T4 U07413 Kangal village20 Hartmannella vermiformis AF426157 Kangal villagelowastlowast

21 Acanthamoeba castellanii T4 U07413 Kangal village22 Acanthamoeba castellanii T4 U07413 Divrigi hospital23 Hartmannella vermiformis AF426157 Susehri village24 Hartmannella vermiformis AF426157 Ulas healthcare center25 Hartmannella vermiformis AF426157 Gemerek village26 Hartmannella vermiformis AF426157 Kangal village27 Hartmannella vermiformis AF426157 Kangal village28 Hartmannella vermiformis AF426157 Susehri village29 Hartmannella vermiformis AF426157 Ulas village30 Acanthamoeba castellanii T4 U07413 Kangal village31 Hartmannella vermiformis AF426157 Susehri village32 Acanthamoeba polyphaga T4 U07407 Ulas village33 Acanthamoeba castellanii T4 U07413 Kangal villagelowastSpring waterlowastlowastFountain water

tolerance to survive under adverse conditions Therefore theecological importance of FLA must be adequately studied toprevent fatal human diseases In this present comprehensivestudy waterborne amoebae were isolated in various districtsof Sivas province We found FLA nearly in one out offive water sources in Sivas districts Results revealed that

Acanthamoeba and Hartmannella have a high distributionin the samples compared to other FLA Although specificprimers were designed we did not isolate any of N fowleriB mandrillaris and Sappinia sp during the study This couldbe due to a lower prevalence of such FLA in the environmentOur findings are in agreement with a study from Bulgaria


[7] This Bulgarian study group determined Acanthamoebaand Hartmannella abundantly in water and soil samplescompared to other species in Bulgaria The high prevalenceof the above FLA in human-related habitats was observed inenvironmental freshwaters of several countries as reported bythe studies [28 29]

Acanthamoebae have been isolated previously from bot-tled drinking water tap water soil and dust in Burdurand Istanbul provinces in Turkey [15] Furthermore bothAcanthamoebae and Naegleria have also been isolated fromsoil and thermalwater specimens in our region [16]Howeverin that study the amoebae have not been identified belowthe genus level In our study except Naegleria we have alsoshown the presence of Acanthamoeba in the same region andidentified those species Acanthamoeba isolates belonging toT2 T3 T4 and T7 genotypes from Ankara [17] and T4 andT9 genotypes from Aydin province [13] have been found inenvironmental samples in Turkey

To our knowledge the presence of FLA in the envi-ronment does not mean a risk factor for illness Howevermany species of Acanthamoeba are potentially pathogenicfor animals and for humans A castellanii A polyphagaand A culbertsoni are the most common species to infecthumans [30 31]Acanthamoeba spp are themain cause of AKassociated with contact lenses [2 3] although cases involvingHartmannella sp have also been described [32] H vermi-formis has been suggested as a cause of AK but this is stillunder debate by other investigators [33] In a study performedin Aydin province in the western part of Turkey a case ofAK caused by a genotype T4 Acanthamoeba strain relatedpossibly with source of tap water was reported [13] Anothergenotype T4 Acanthamoeba strain was also reported in anAK case in Izmir province a neighbor province of Aydin Tapwater has been assumed to be the most important source ofAK caused by genotype T4Acanthamoeba [7] and worldwidethe most important AK-causing strains are associated withgenotype T4 [34 35]

Acanthamoeba can tolerate extreme temperatures andthus become cold resistant A polyphaga may survive below4∘C Some strains of Hartmannella can tolerate up to 48∘C[11 36] Since Sivas province is a place of extreme hotand cold temperatures during the year we conclude thatdetermined FLA species are tolerant to ecological conditionsAir temperature ranges between winter and summer havebeen reported as minus346 to 40∘C during the years of 1972to 2011 in Sivas (Turkish State Meteorological Service athttpwwwdmigovtr) In addition to environmental tem-perature conditions several other factors such as cyst struc-ture and surface availability of the organism pH alterationsand osmolarity changes in water also determine the FLA life[37]

Acanthamoeba spp and Hartmannella spp can har-bor pathogenic microorganism which indicates the impor-tance of these amoebae to public health AcanthamoebaT4 genotype and H vermiformis may be infected naturallyby pathogenic ARMs Acanthamoeba T4 genotype may beinfected by Legionella sp and Neochlamydia sp whereasH vermiformis may be infected by Neochlamydia sp andLegionella donaldsonii [37] FLA can facilitate growth and

transportation of waterborne pathogens Therefore theyare used by pathogenic waterborne ARMs to proliferate indrinking water systemsWe have limited data about host FLAin drinking water It was reported previously that the infectedFLA rate by ARM in drinking water system was 16 [5]It is likely that several other infected FLA by unidentifiedpathogenic ARMs are yet to be determined

Interestingly FLA detection reported the presence ofseveral genera of FLA namely Acanthamoeba Naegleriaand Hartmannella at different stages of the water treatmentin drinking water treatment plants [38 39] FurthermoreHartmannella spp have been reported to resist disinfection intreatment plants [38 39] Acanthamoeba spp can resist watertreatment for sanitizing drinking water as well [28]This datais consistent with our findings since 24 out of 33 detectedFLA were H vermiformis and 9 out of 33 detected FLA wereAcanthamoeba spp (Table 2) One other reason is that thehigh H vermiformis prevalence in our region might be dueto high levels of active biomass and natural organic matter[40] since agriculture and animal husbandry is common inSivas province

5 Conclusions

The results indicated the presence of A castellanii H vermi-formis and A polyphaga in tap water in Sivas localities Fur-thermore presence of temperature tolerant AcanthamoebaT4 genotypes in the region must be taken into account forAK

FLA were underestimated by medical community untilsome species of amebae caused systemic infections inimmunocompromised individuals The amebic diseases aredifficult to determine clinically and a patient may suffer fromdelay in treatment Further this delay may lead to deadlyinfections and cause fatal casesTherefore an investigation ofthe connection between environment and the patientrsquos infec-tions is essential An individual history including interactionwith amebic water and inhalation of cysts during dust stormmay help a physician to diagnose the infection Knowledge ofprior prevalence of amebae in the regionmay help physiciansto diagnose and treat either healthy or immunocompromisedindividuals Clinicians may benefit from the reported data inthe treatment of amebae related infections Presence of FLAcan lead to take precautions and reported FLA distributioncan help understand the potential threat to the health ofindividuals

Thedata obtained from the studymay be beneficial for theclinicians and the environmental professionals in the regionand regions around the world that have similar ecologicalconditions

Conflict of Interests

The authors declare no conflict of interests

Authorsrsquo Contribution

Y Tutar was the principal investigator and takes primaryresponsibility for the paper K A Coskun and L Tutar


performed the experiments N Elaldı and S Ozcelik coordi-nated the research Y Tutar wrote the paper

Acknowledgment

This work was funded by a seed grant from the TurkishNational Academy of Sciences (TUBA-GEBIP)

References

[1] L J Stockman C J Wright G S Visvesvara B S Fields andM J Beach ldquoPrevalence of Acanthamoeba spp and other free-living amoebae in household water Ohio USAmdash1990ndash1992rdquoParasitology Research vol 108 no 3 pp 621ndash627 2011

[2] H Trabelsi F Dendana A Sellami et al ldquoPathogenic free-living amoebae epidemiology and clinical reviewrdquo PathologieBiologie vol 60 no 6 pp 399ndash405 2012

[3] A J Martinez and G S Visvesvara ldquoFree-living amphizoic andopportunistic amebasrdquo Brain Pathology vol 7 no 1 pp 583ndash598 1997

[4] G S Visvesvara H Moura and F L Schuster ldquoPathogenic andopportunistic free-living amoebae Acanthamoeba spp Bala-muthia mandrillaris Naegleria fowleri and Sappinia diploideardquoFEMS Immunology and Medical Microbiology vol 50 no 1 pp1ndash26 2007

[5] V Thomas J-F Loret M Jousset and G Greub ldquoBiodiversityof amoebae and amoebae-resisting bacteria in a drinking watertreatment plantrdquo EnvironmentalMicrobiology vol 10 no 10 pp2728ndash2745 2008

[6] J H Diaz ldquoIncreasing intracerebral infections caused by free-living amebae in the United States and worldwiderdquo Journal ofNeuroparasitology vol 1 no 1 pp 1ndash10 2010

[7] N Tsvetkova M Schild S Panaiotov et al ldquoThe identificationof free-living environmental isolates of amoebae fromBulgariardquoParasitology Research vol 92 no 5 pp 405ndash413 2004

[8] G S Visvesvara and J K Stehr-Green ldquoEpidemiology of free-living ameba infectionsrdquo Journal of Protozoology vol 37 no 4pp 25Sndash33S 1990

[9] B B Gelman S J Rauf R Nader et al ldquoAmoebic encephalitisdue to sappinia diploideardquo Journal of the American MedicalAssociation vol 285 no 19 pp 2450ndash2451 2001

[10] Y Qvarnstrom A J Da Silva F L Schuster B B Gelman andG S Visvesvara ldquoMolecular confirmation of sappinia pedata asa causative agent of amoebic encephalitisrdquo Journal of InfectiousDiseases vol 199 no 8 pp 1139ndash1142 2009

[11] V Thomas G McDonnell S P Denyer and J-Y Mail-lard ldquoFree-living amoebae and their intracellular pathogenicmicroorganisms Risks for water qualityrdquo FEMS MicrobiologyReviews vol 34 no 3 pp 231ndash259 2010

[12] F B Sarica K Tufan M Cekinmez B Erdogan and MN Altinors ldquoA rare but fatal case of granulomatous amebicencephalitis with brain abscess the first case reported fromTurkeyrdquo Turkish Neurosurgery vol 19 no 3 pp 256ndash259 2009

[13] H Ertabaklar M Turk V Dayanir S Ertug and J WalochnikldquoAcanthamoeba keratitis due toAcanthamoeba genotype T4 in anon-contact-lens wearer in Turkeyrdquo Parasitology Research vol100 no 2 pp 241ndash246 2007

[14] S Ozkoc S Tuncay S B Delibas et al ldquoIdentification ofAcanthamoeba genotype T4 and Paravahlkampfia sp from twoclinical samplesrdquo Journal of Medical Microbiology vol 57 no 3pp 392ndash396 2008

[15] HMergeryan ldquoThe prevalence of Acanthamoeba in the humanenvironmentrdquo Reviews of Infectious Diseases vol 13 no 5 ppS390ndashS391 1991

[16] G Saygi Z Akin andH Tecer ldquoIsolation ofAcanthamoeba andNaegleria spp from soil and thermal water samples in SivasrdquoActa Parasitologica Turcica vol 24 no 3 pp 237ndash242 2000

[17] A Kilic M Tanyuksel J Sissons S Jayasekera and N A KhanldquoIsolation ofAcanthamoeba isolates belonging to T2 T3 T4 andT7 genotypes from environmental samples in Ankara TurkeyrdquoActa Parasitologica vol 49 no 3 pp 246ndash252 2004

[18] Z ZeybekMUstunturk andA R Binay ldquoMorphological char-acteristics and growth abilities of free living amoeba isolatedfrom domestic tap water samples in Istanbulrdquo IUFS Journal ofBiology vol 69 no 1 pp 17ndash23 2010

[19] A V Smirnov and A V Goodkov ldquoAn illustrated list ofbasic morphotypes of Gymnamoebia (Rhizopoda Lobosea)rdquoProtistology vol 1 no 1 pp 20ndash29 1999

[20] G S Visvesvara ldquoPathogenic and opportunistic amebaerdquo inManual of Clinical Microbiology P R Murray E J Baron J HJorgensen M L Landry andM A Pfaller Eds pp 2082ndash2091ASM Press Washington DC USA 2007

[21] M A T Winck K Caumo and M B Rott ldquoPrevalence ofAcanthamoeba from tap water in Rio Grande do Sul BrazilrdquoCurrent Microbiology vol 63 no 5 pp 464ndash469 2011

[22] J M Schroeder G C Booton J Hay et al ldquoUse of subgenic 18Sribosomal DNA PCR and sequencing for genus and genotypeidentification of Acanthamoebae from humans with keratitisand from sewage sludgerdquo Journal of Clinical Microbiology vol39 no 5 pp 1903ndash1911 2001

[23] M Schild C Gianinazzi B Gottstein and N Muller ldquoPCR-based diagnosis of Naegleria sp infection in formalin-fixedand paraffin-embedded brain sectionsrdquo Journal of ClinicalMicrobiology vol 45 no 2 pp 564ndash567 2007

[24] G C Booton J R Carmichael G S Visvesvara T J Byersand P A Fuerst ldquoIdentification of Balamuthia mandrillaris byPCR assay using the mitochondrial 16S rRNA gene as a targetrdquoJournal of ClinicalMicrobiology vol 41 no 1 pp 453ndash455 2003

[25] D Corsaro and D Venditti ldquoPhylogenetic evidence for a newgenotype of Acanthamoeba (Amoebozoa Acanthamoebida)rdquoParasitology Research vol 107 no 1 pp 233ndash238 2010

[26] W Nuprasert C Putaporntip L Pariyakanok and S Jongwu-tiwes ldquoIdentification of a novel T17 genotype of Acanthamoebafrom environmental isolates and T10 genotype causing keratitisinThailandrdquo Journal of Clinical Microbiology vol 48 no 12 pp4636ndash4640 2010

[27] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[28] J-F Loret and G Greub ldquoFree-living amoebae biological by-passes in water treatmentrdquo International Journal of Hygiene andEnvironmental Health vol 213 no 3 pp 167ndash175 2010

[29] C Gianinazzi M Schild B Zumkehr et al ldquoScreening ofSwiss hot spring resorts for potentially pathogenic free-livingamoebaerdquo Experimental Parasitology vol 126 no 1 pp 45ndash532010

[30] P-M Kao B-M Hsu N-H Chen et al ldquoMolecular detectionand comparison of Acanthamoeba genotypes in different func-tions of watersheds in Taiwanrdquo Environmental Monitoring andAssessment vol 184 no 7 pp 4335ndash4344 2012


[31] J Lorenzo-Morales J F Lindo E Martinez et al ldquoPathogenicAcanthamoeba strains from water sources in Jamaica WestIndiesrdquo Annals of Tropical Medicine and Parasitology vol 99no 8 pp 751ndash758 2005

[32] D Aitken J Hay F B Kinnear C M Kirkness W R Leeand D V Seal ldquoAmebic keratitis in a wearer of disposablecontact lenses due to a mixed Vahlkampfia and Hartmannellainfectionrdquo Ophthalmology vol 103 no 3 pp 485ndash494 1996

[33] M W Kuiper R M Valster B A Wullings H BoonstraH Smidt and D Van Der Kooij ldquoQuantitative detection ofthe free-living amoeba Hartmannella vermiformis in surfacewater by using real-time PCRrdquo Applied and EnvironmentalMicrobiology vol 72 no 9 pp 5750ndash5756 2006

[34] N A Khan and T A Paget ldquoMolecular tools for speciation andepidemiological studies of Acanthamoebardquo Current Microbiol-ogy vol 44 no 6 pp 444ndash449 2002

[35] N A Khan E L Jarroll and T A Paget ldquoMolecular and physi-ological differentiation between pathogenic and nonpathogenicAcanthamoebardquo Current Microbiology vol 45 no 3 pp 197ndash202 2002

[36] S Rodriguez-Zaragoza ldquoEcology of free-living amoebaerdquo Crit-ical Reviews in Microbiology vol 20 no 3 pp 225ndash241 1994

[37] J M Thomas and N J Ashbolt ldquoDo free-living amoebae intreated drinking water systems present an emerging healthriskrdquo Environmental Science and Technology vol 45 no 3 pp860ndash869 2011

[38] D Corsaro V Feroldi G Saucedo F Ribas J-F Loret andG Greub ldquoNovel Chlamydiales strains isolated from a watertreatment plantrdquo Environmental Microbiology vol 11 no 1 pp188ndash200 2009

[39] D Corsaro G S Pages V Catalan J-F Loret and G GreubldquoBiodiversity of amoebae and amoeba-associated bacteria inwater treatment plantsrdquo International Journal of Hygiene andEnvironmental Health vol 213 no 3 pp 158ndash166 2010

[40] R M Valster B A Wullings G Bakker H Smidt and D VanDer Kooij ldquoFree-living protozoa in two unchlorinated drinkingwater supplies identified by phylogenic analysis of 18S rRNAgene sequencesrdquo Applied and Environmental Microbiology vol75 no 14 pp 4736ndash4746 2009

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


Sivas

Hafik

Zara

Kangal

Gemerek

GolovaAkıncılar

Imralı

Koyulhisar

Gurun

Altınyayla

Yıldızeli

Divrigi

0 60 120(km)

Doganşar Suşehri

UlaşŞarkışla

Figure 1 Districts of Sivas province and water sample locations(dots) Turkey

chemicals [2 5] In addition to their pathogenicity FLAserve as hosts for a large number of pathogenic bacteria andviruses for humans including Legionella spp Vibrio choleraeBurkholderia cepacia Listeria monocytogenes Escherichia coliO157 Mycobacterium spp Coxsackievirus Adenovirus andEchovirus [2 5 11] Furthermore FLA can increase virulenceof some of the bacteria called amoeba-resisting microorgan-isms (ARMs) including Mycobacterium spp Pseudomonasaeruginosa Legionella spp Cryptococcus neoformans andHistoplasma capsulatum [11]

An increase in the number of intracerebral infectionscaused by FLA in the USA and worldwide has been reported[6]

FLA human infections are documented [12ndash14] but lim-ited information is available in the literature concerning FLAfrom the environmental samples in Turkey [15ndash17]Thereforethe aim of this study is to isolate FLA from tap water samplescollected from various districts in the province of Sivas byemploying morphological and molecular methods in orderto contribute to the study of understanding their ecology andto identify any potential health risks

2 Subjects and Methods

21 Study Location Sampling Isolation and Identificationof Amoebae and DNA Extraction A total of 150 tap watersamples were collected betweenMarch and August 2011 fromthe districts of Divrigi Kangal Susehri Ulas Golova andGemerek of Sivas province located in the central Anatoliaregion of Turkey The total surface area of Sivas province is28500 km2 and the study area is about 10000 km2 (Figure 1)Sivas is located at the junction of different regions and reflectstypical climates of Turkeyrsquos various regions Therefore aprevalence study in a transition region like Sivas may reflectoverall Turkish FLA distribution

All samples (except two of them see Table 2) in thisstudy were chlorinated by the city officials in drinking water

plant according to world health organization criteria (02ndash07 ppm)

A total of 500mL of water sample was collected fromeach tap focus in a sterile plastic container from differentvillages and districtsTheywere then immediately transferredto the laboratory FLA were isolated from the samples aspreviously described elsewhere [7 18] Briefly water sampleswere filtered through 045 120583m pore size cellulose nitratemembrane filter (47mm in diameter) under a vacuum Themembrane filters for each water sample were scraped andcollected materials were placed in 15mL of sterile covertubes containing 10mL phosphate buffered saline (PBS)Tubes were incubated at room temperature overnight andthen centrifuged for ten minutes at 1500 rpm to collectparticles on filters After centrifugation the supernatantsolution was discarded and the pellet was inoculated onto15 nonnutrient agar (NNA) plates A dense suspension ofheat inactivated Escherichia coli prepared in Page Saline wasseeded ontoNNAplates to growFLAAfter the inoculation ofthe samples all plates were incubated at 30∘C and examineddaily for the presence of FLA for up to 10 days using a lightmicroscope (100x) Once a growth was observed a piece ofNNA containing the amoebaewas excised to inoculate a freshNNA plate to subculture and incubated until trophozoiteswere grown Then the trophozoites were scraped to isolategenomic DNA (QIAmp DNAMini Kit QIAGEN)

Amoebae were isolated and identified by morphologicfeatures as well as PCR based sequence analysis Smirnovand Goodkovrsquos basic morphotyping list was used to identifyamoebae [19] Acanthamoeba was identified both by acan-thopodia in the trophozoite form and by double-layeredpolygonal walls in the cysts form (Figure 2(a)) The Hart-mannella was identified by smooth spherical appearance(Figure 2(b)) [16 20] A temperature tolerance test was alsoperformed for Acanthamoeba three sets of subculture plates(NNA-E coli) for each sample were incubated at 37 42and 52∘C respectively All plates were examined daily foramoebal growth by phase contrast microscopy for sevendays [21] When an FLA strain was isolated the flagellatetransformation test was applied for the identification of Nfowleri [20] All FLA strains were transferred to a fresh NNA-E coli plate every month to check their viability and each ofthem were used in the experiments

22 PCR Amplification Sequencing Blast Search of SequencedAmplicons and Cluster Analysis of Amoebae AcanthamoebaN fowleri B mandrillaris and Sappinia genus specific primerpairs along with common amoebae specific primers (Table 1)were employed inmolecular detection of the amoebae species[7 10 22ndash24] Fifty 120583L of PCR mixture contained 1 ngDNA 5 120583L 10x Taq buffer 5 120583L 2mM dNTP 4120583L 25mMMgCl

2 05 120583L 100mM primer 05120583L Taq DNA Polymerase

The thermal cycling conditions were an initial incubationof 94∘C for 7min and 45 cycles of 94∘C for 60 s (95∘Cfor Acanthamoeba) X∘C for 60 s and 72∘C for 60 s with aterminal extension of 72∘C for 10min (X= 55∘C for Nae-gleria Sappina and Balamuthia 60∘C for Acanthamoebaand 65∘C for common primers) PCR reactions were per-formed to amplify 18S rDNA sequences These primers


(a) (b)




3 Results









4 Discussion







92

12

12

43

75

58

43

02



















5 Conclusions










Acknowledgment


References

















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


(a) (b)




3 Results









4 Discussion







92

12

12

43

75

58

43

02



















5 Conclusions










Acknowledgment


References

















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology






92

12

12

43

75

58

43

02



















5 Conclusions










Acknowledgment


References

















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


















5 Conclusions










Acknowledgment


References

















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology









5 Conclusions










Acknowledgment


References

















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



Acknowledgment


References

















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



















Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology








Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Documents

Research Article Isolation and Identification of Free