106
Regulation of the Structure and Function of Skeletal Muscle and Tendon by Myostatin by Christopher L. Mendias A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Molecular and Integrative Physiology) in The University of Michigan 2007 Doctoral Committee: Professor John A. Faulkner, Chair Associate Professor Susan V. Brooks Herzog Associate Professor Jeffrey F. Horowitz Assistant Professor Daniel E. Michele

Regulation of the Structure and Function of Skeletal Muscle and

  • Upload
    others

  • View
    3

  • Download
    0

Embed Size (px)

Citation preview

Regulation of the Structure and Function of Skeletal Muscle and Tendon by

Myostatin

by

Christopher L. Mendias

A dissertation submitted in partial fulfillment of the requirements for the degree of

Doctor of Philosophy (Molecular and Integrative Physiology)

in The University of Michigan 2007

Doctoral Committee: Professor John A. Faulkner, Chair Associate Professor Susan V. Brooks Herzog Associate Professor Jeffrey F. Horowitz Assistant Professor Daniel E. Michele

ii

Acknowledgements

I would like to thank my committee for the help they have provided. My

advisor, John Faulkner, has taught me so much about the process and business

of science. His guidance, support, mentorship and colorful stories have been

very much appreciated. I would also like to thank the other members of my

committee, Susan Brooks, Jeffrey Horowitz and Daniel Michele, for their insight

and advice. I appreciate the time you have taken to help in my development as a

scientist.

I would also like to thank the many members of the Muscle Mechanics Lab

for their invaluable assistance. In particular, I would like to express my gratitude

for the assistance of two individuals, Cheryl Hassett and Dennis Claflin. Without

the technical assistance of these two individuals I would not have been able to

complete many of the studies in this dissertation.

I would like to thank my friends who have made my time here in Ann Arbor

a blast.

And finally, I would like to thank my family for their encouragement and

support from 2500 miles away, even they had no idea why I wanted to move to

Michigan from Arizona.

iii

Table of Contents Acknowledgements List of Figures List of Tables Chapters Chapter I. Introduction

Background and Hypotheses Skeletal Muscle Structure and Function Tendon Structure and Function Regulation of Muscle Growth and Atrophy Regulation of Muscle Growth and Atrophy by Myostatin

Methods Figures

References

Chapter II. Contractile Properties of Extensor Digitorum Longus and Soleus Muscles of Myostatin-Deficient Mice

Abstract Introduction Methods Results Discussion Acknowledgements Figures Tables References

Chapter III. Tendons of Myostatin-Deficient Mice are Small, Brittle and Hypocellular

Abstract Introduction Methods Results

ii

v

vi

1 3 8

11 16 19 24 32

38 39 42 49 52 56 57 62 65

70 71 74 80

iv

Discussion Acknowledgements Figures Tables References

Chapter IV. Summary and Conclusion Overview Discussion of Findings and Future Directions - Muscle Discussion of Findings and Future Directions - Tendon Summary References

84 88 89 93 96

100 100 104 108 111

v

List of Figures Figure 1.1 Schematic drawing of myostatin gene structure KO strategy and

genotype strategy

24

1.2 The myostatin deficient mouse model

25

1.3 Growth curves of male and female MSTN+/+, MSTN+/- and MSTN-/- mice.

26

1.4 Muscle fiber CSA distributions

27

1.5 Relative myofibrillar protein content

28

1.6 Myostatin signal transduction pathways

29

1.7 Ubiquitinated myosin heavy chain (Ub-MHC) protein and atrogin-1 expression from EDL and soleus muscles of MSTN+/+ and MSTN-/- mice

30

1.8 Atrogin-1 expression in primary myotubes treated with myostatin

31

2.1 Relative hydroxyproline content of EDL and soleus muscles from MSTN+/+, MSTN+/- and MSTN-/- mice

57

2.2 Myostatin increases col1α2 expression and procollagen I content of primary skeletal muscle myotubes

58

2.3 Force values for EDL and soleus muscles from MSTN+/+, MSTN+/- and MSTN-/- mice

59

2.4 Force deficits following contraction-induced injury to EDL muscles and soleus muscles

60

2.5 ActRIIB protein content of EDL and soleus muscles from MSTN+/+ mice

61

3.1 Tendon fibroblasts express the myostatin receptors and activate signal transduction cascades in the presence of myostatin

89

vi

3.2 Myostatin induces the proliferation of tendon fibroblasts

90

3.3 Myostatin induces the expression of scleraxis, tenomodulin and collagen Iα2 genes in tendon fibroblasts

91

3.4 Mechanical properties of tibialis anterior tendons of MSTN+/+ and MSTN-/- mice

92

vii

List of Tables Table 2.1 Anatomical properties of animals

62

2.2

Contractile properties of EDL and soleus muscles 63

2.3

Mechanical injury of EDL and soleus muscles 64

3.1

PCR primer sequences and expected amplicon sizes 93

3.2

Whole animal, muscle and tendon masses 94

3.3 Morphological and mechanical properties of tibialis anterior tendons

95

1

Chapter I

Introduction

Background and Hypotheses

The ability of skeletal muscle and tendon to adapt to environmental

changes, injury, illness and other physiological conditions is critical in

determining the overall health, mobility and athletic performance of an individual.

Determining the cellular and molecular mechanisms behind the adaptation of

skeletal muscle and tendon provides important insights into basic biological

processes and the design of therapies for the treatment of diseases and injuries.

Several cytokines have been identified as important regulators of skeletal muscle

mass. One of the most potent cytokines that regulate skeletal muscle mass is

myostatin (GDF-8). Myostatin is a member of the TGF-ß superfamily of

cytokines and the targeted inhibition of myostatin results in an up to two-fold

increase in skeletal muscle mass (54, 84). Due to the profound increase in

skeletal muscle mass that occurs as a result of the deficiency of myostatin, much

interest has focused on the targeted inhibition of myostatin in the treatment of

muscle injuries and wasting diseases (81).

While the inhibition of myostatin results in a clear muscle mass phenotype,

arguably with as great an impact on muscle mass as any other single cytokine,

the full range of mechanical consequences of myostatin deficiency are not

known. Using classical muscle mechanics experimental techniques in the

2

myostatin-deficient mouse model, along with contemporary molecular biology

experimental techniques, this doctoral dissertation determined the mechanisms

by which the deficiency of myostatin regulates the structure and function of

skeletal muscles and of tendons. This introductory chapter describes the

molecular biology of myostatin, the structure, function and adaptation of skeletal

muscle and tendon tissue, and preliminary experiments that were critical for the

research studies in Chapters II and III.

In Chapter II, the impact of the deficiency of myostatin on the contractile

properties and extracellular matrix composition of skeletal muscle was

determined. We hypothesized that the deficiency of myostatin increases the

maximum tetanic force (Po), but decreases the specific Po (sPo) of muscles and

increases the susceptibility of muscles to contraction-induced injury. To test

these hypotheses, we measured the in vitro contractile properties of EDL and

soleus muscles from MSTN+/+, MSTN+/- and MSTN-/- mice and subsequently

subjected the muscles to a lengthening contraction protocol. We also

determined the impact of myostatin on the connective tissue composition of

skeletal muscle. We hypothesized that the deficiency of myostatin decreases the

type I collagen content of muscle connective tissue. The type I collagen content

of EDL and soleus muscles from MSTN+/+, MSTN+/- and MSTN-/- mice was

determined, as well as the expression of type I collagen in cultured skeletal

muscle myotubes treated with myostatin. The results from Chapter II indicate

that the deficiency of myostatin increases the Po of muscles, increases the

3

susceptibility of muscles to injury and decreases the type I collagen content of

skeletal muscle connective tissue.

The experiments on skeletal muscles in Chapter II lead to the exploration

of the role of myostatin in the regulation of tendon structure and function in

Chapter III. We hypothesized that the deficiency of myostatin results in smaller,

stiffer, and more brittle tendons. To test this hypothesis, we measured the

stress-strain relationships of tendons from the tibialis anterior muscles of

MSTN+/+ and MSTN-/- mice. We also measured the expression of structural and

cell cycle regulatory genes in whole tendon tissue and in cultured tendon

fibroblasts treated with myostatin. Our studies of tendons lead to the novel

finding that, in addition to regulating skeletal muscle structure and function,

myostatin also regulates the structure and function of tendon tissue.

Skeletal Muscle Structure and Function

Skeletal muscles consist of hundreds to thousands, and sometimes

millions, of long, multinucleated fibers organized together by an extracellular

matrix. There are three general layers of extracellular matrix, or connective

tissue, in muscles – the outermost layer is the epimysium, the intermediate layer

is the perimysium and the inner most layer is the endomysium. Understanding

the structure and function of each of these three layers requires a hierarchical

approach. The structure and function of the epimysium and perimysium will be

discussed in a whole body and tissue level biomechanical context, whereas the

structure and function of the endomysium will be discussed in the context of

cellular and molecular biomechanics.

4

Epimysium and perimysium. The epimysium covers the surface of the

muscle and has important roles in force transmission and insulation of the

muscle (46). Processes from the epimysium extend into muscle tissue and form

the second layer of connective tissue, the perimysium. The perimysium contains

blood vessels, nerves and lymphatic ducts, and structurally divides muscle fibers

into functional groups called fascicles. The orientation of fascicles are important

determinants of the direction of the force a muscle can generate (55). The

variation in the number of fascicles allows muscles to adopt a complex geometry

and facilitate complicated movements at joints. There is a trade-off between the

angle at which the fascicles are oriented and the amount of force the fascicles

are able to generate. The angle at which the fascicles are oriented to the

insertion is known as the angle of pennation (θ). The force that a muscle fiber

can generate is proportional to the cosine of θ (50). As θ goes from 0º to 90º, the

cosine of θ goes from 1 to 0. Therefore, a fascicle can generate the greatest

amount of force when θ is 0º, and can generate no force when θ is 90º. An

interesting feature about the angle of pennation is that, as muscle fibers undergo

hypertrophy, there is an increase in θ (50). While a muscle that experiences

hypertrophy is generally able to generate a greater total force, due to the cosine

relationship between θ and net force development, the muscle must undergo

relatively greater increases in hypertrophy to generate greater net forces across

a joint.

In addition to providing a hierarchical structure to skeletal muscle fibers,

the epimysium and perimysium may also protect an injured muscle from further

5

damage. The epimysium and perimysium are composed mostly of the fibrillar

collagens, type I and type III (43). These collagens act as molecular springs and

exist in parallel with the muscle fibers (9). While some debate still exists on the

topic, the epimysium and perimysium are thought to protect muscle fibers against

stretch induced injury by taking up the load during stretch and protecting the

skeletal muscle fibers from further injury (4).

Endomysium. The innermost layer of connective tissue is the

endomysium. The endomysium is composed of two layers of mostly type I and

type III collagen that fuse to form a sheet-like structure that inserts into the

tendon (43). The endomysium is important in transmitting forces generated

within the muscle to the tendon as well as laterally to other muscle fibers (63).

The endomysium is connected to the basement membrane that directly

surrounds each muscle fiber. The basement membrane is composed mostly of

type IV collagen (43). Unlike the fibrillar type I and type III collagen, type IV

collagen forms a mesh-like network that surrounds the muscle fiber (9).

Embedded within the endomysium and basement membrane are two classes of

proteins that have important functions. The first class of proteins are responsible

for force transmission from the sarcomeres through the intramuscular connective

tissue and eventually to tendons and bone. These proteins, such as integrin and

fibronectin, provide a mechanical link between the structural proteins of muscle

fibers with the collagen network of the extracellular matrix (37). The second

class of proteins are released from the matrix after injury and are important in

initiating the recovery of muscle from injury (24, 30, 76). This second class of

6

proteins will be discussed in the section that focuses on contraction-induced

injury.

Molecular Mechanisms of Force Transmission in Skeletal Muscle. The

structure within muscle fibers that is responsible for the generation of force is the

sarcomere. The sarcomere is composed of three major components – the thick

filament that is surrounded by six thin filaments that are shared with the six

surrounding thick filaments. The thin filaments are imbedded in the Z-disks at

the end of each sarcomere (73). The thick filament contains the protein that is

the molecular motor that drives muscle contraction, myosin heavy chain. The

head of the myosin molecule interacts with the actin molecules on the thin

filaments. The myosin binding sites on the actin molecule are regulated by the

troponin protein complex. The thick filaments are anchored to the Z-disks via the

proteins titin and nebulin. The Z-disks are responsible for transmitting the force

generated within the sarcomere to the extracellular matrix (ECM) (11, 67). The

Z-disks accomplish this by linking to structures that transmit force both laterally

and longitudinally.

For the lateral transmission of force, the Z-disks link with a structure at the

plasma membrane called the costamere. The Z-disk interacts with the

costamere via the dystrophin class of proteins (11, 67). The dystrophin proteins

link the membrane bound dystroglycan complex, which is in turn linked to the

extracellular matrix via laminin and fibronectin. Longitudinal force transmission is

accomplished via a mechanical linkage between the Z-disk and the actin

cytoskeleton of the muscle cell (55). This force is transmitted to the ends of the

7

fibers at the location where the fibers insert into tendons. This linkage comes

about due to the association between the actin cytoskeleton with vinculin and

talin (12). Vinculin and talin transmit force across the plasma membrane using

the fibronectin receptor that is bound to fibronectin in the ECM (3, 12). The

contraction of a muscle is therefore dependent upon the effective transmission of

the forces generated by the interaction between actin and myosin molecules

through structural proteins, out to the endomysium and eventually to tendons that

link the muscles to bone.

Skeletal Muscle Contraction. There are three general types of skeletal

muscle contractions. The contractions are defined by the change in fiber length

that occurs subsequent to muscle activation (18). During a shortening

contraction, the force generated by the muscle is greater than the load placed on

the muscle. Consequently, the distance between the distal and proximal ends of

a muscle decrease and positive work is performed. During an isometric

contraction, the force generated by the muscle is equal to the load on the

muscle. Consequently, the length of the muscle fiber does not change

significantly and no net work is done. The amount of force a muscle can

generate is greatest during an isometric contraction and is referred to as the

maximum isometric tetanic force (Po). The specific maximum tetanic force (sPo)

is the value Po normalized to the CSA. During a lengthening contraction, the

load on the muscle is greater than the force generated by the muscle.

Consequently, the distance between the ends of the muscle increases and there

is net negative work done. Contraction-induced injury occurs during lengthening

8

contractions when the magnitude of the opposing force is sufficient to disrupt the

ultrastructure of individual or groups of sarcomeres (18). Clinically, contraction-

induced injuries are commonly referred to as muscle strains.

Tendon Structure and Function

Tendons are connective tissue structures responsible for the transmission

of the force developed by muscles to bones, and in doing so, enable the

contraction of muscles to lead to joint movements and locomotion. Force

transmission may also occur in the opposite direction, from bone through tendon

to muscle. The transmission of force in this direction allows for the storage of

elastic energy within the tendon and muscle, but may also lead to damage to the

muscle. During a lengthening contraction, tendons may protect muscle from

injury by limiting the strain placed on muscle fibers (23).

Tendon Structure. Tendon tissue is arranged in an hierarchical order,

similar to skeletal muscle. Fibroblasts are the major cellular component of

tendons and consequently are responsible for the maintenance, repair,

modification of the tendon ECM (37). The fundamental anatomical structure in

tendons is the tendon fiber (31, 82). The tendon fiber is composed of collagen

fibrils and other structural proteins and is wrapped in a layer of connective tissue

that carries nerve endings, capillaries and lymphatic ducts. Fibers coalesce to

form fascicles, that are surrounded by a second connective tissue layer that

contains arterioles, venules and axons of nerve cells. Tendon fascicles are

surrounded by a third connective tissue structure called the epitenon. The

synovial sheath surrounds the epitenon and secretes synovial fluid that helps to

9

cushion the tendon and reduce friction from adjacent tissues as the tendon is

stretched and relaxed. Early damage to tendon tissue can result in an

overproduction of tendon synovial fluid (42). Swelling in the synovium is referred

to as tenosynovitis and is an early clinical diagnostic sign that tendon tissue is

injured. Tendons are linked to muscle tissue by myotendinous junctions located

at the ends of the tendon (82). Many muscles have an aponeurosis or internal

tendon, that is an extension of the tendon into the muscle tissue. At the other

end, tendons are connected to bone by strong fibrous structures called entheses

(6).

Tendon Mechanical Properties. The proteins and molecules that make up

the tendon can be divided into two categories, based upon the mechanical

properties they impart to tendon – stiffness and viscoelasticity. The stiffness of a

tendon is an important determinant of the ability of the tendon to store elastic

energy. Type I and type III collagens are the major proteins that determine the

stiffness of a tendon (37). Both type I and type III collagens are triple helical

molecules (9). The amino acid residues that face the inner core of the triple helix

are able to form hydrogen bonds with each other, and it is this hydrogen bonding

that provides much of the molecular basis for the stiffness material property of

tendons (45). As the tendon is stretched the hydrogen bonds between amino

acid residues are broken and the breaking of these bonds gives off energy in the

form of heat (61). The tendon must be able to dissipate this heat energy,

because if the energy is not properly dissipated, the structural covalent bonds of

molecules in the tendon can be broken and this will lead to tendon rupture.

10

The second category of molecules impart the viscoelastic properties of

tendons. Viscoelasticity is important because this allows the tendon to resume

its original shape after the application of a strain (37). This second category of

molecules is comprised of elastin, proteoglycans and glycosaminoglycans.

These molecules are highly hydrophilic, and their ability to bind water molecules

allows for them to transfer the heat produced by the breaking of hydrogen bonds

within collagen to the water molecules, that are further able to dissipate heat

energy into surrounding tissues (61).

An additional factor that is an important determinant of the mechanical

properties of tendons is the covalent cross-linking between collagen molecules.

Cross-linking reduces the friction between collagen molecules as they are

stretched (61). The consequence of greater cross-linking between collagen

molecules is that the tendon becomes stiffer and can store mechanical energy

more efficiently without losing this energy in the form of heat. Cross-linking

between collagen molecules can occur via an enzymatic or a non-enzymatic

mechanism. The lysyl oxidase enzyme generates aldehyde groups on lysine

residues in collagen molecules (19). These highly reactive aldehyde groups can

form stable covalent bonds with other lysine residues. Non-enzymatic cross-

linking can occur when the amino group on the side-chains of amino acid

residues come into contact with a reducing sugar (65). In addition to cross-

linking amino acid residues between collagen molecules, this reaction generates

compounds called advanced glycation end products (AGEs) (65). These AGEs

11

accumulate in the tissue and can disrupt the hierarchical structure of tendons and

lead to tissue damage.

The structural and mechanical properties of tendons change with aging

and physical activity. Compared with younger tendons, aged tendon is stiffer

(60), has a lower rate of type I collagen synthesis (59) and is more prone to

rupture (33, 60). The density of fibroblasts in tendon is highest at birth and

steadily declines throughout the lifespan (56, 59). While conflicting reports have

been published (40, 79), tendon typically adapts to chronic physical activity by

increasing CSA, stiffness, peak stress, peak strain, type I collagen synthesis and

fibroblast activity (34, 47, 48, 72, 80, 86, 87).

Regulation of Muscle Growth and Atrophy

The regulation of muscle growth and atrophy involves a sensitive balance

between protein synthesis and degradation. Minor damage to muscle fibers

causes an adaptive response in which damaged proteins are removed and new

proteins are synthesized (20). With repetitive minor damage, such as the

damage that occurs during exercise sessions that involve repeated lengthening

contractions, there is a net increase in protein synthesis (17). This increase in

protein synthesis increases both the size and Po of individual fibers. However, if

the damage to muscle is of sufficient magnitude, such as the damage that occurs

following a muscle "strain", there is a robust activation of proteolytic enzymes

that cause the breakdown of both damaged proteins and healthy, functional

proteins (21, 30). The premature breakdown of functional proteins leads to

muscle atrophy and a decrease in both the size and Po of individual fibers.

12

Understanding the mechanical, cellular and molecular mechanisms that control

muscle growth and atrophy is critical in improving the current treatments

available for muscle injuries and diseases, as well as enhancing athletic

performance and maximizing strength gains in exercise programs.

Mechanical damage to muscle fibers can initiate a series of events that

lead to muscle hypertrophy and an increase in Po. Sarcomeres are usually

damaged only during lengthening contractions (10, 51, 52). The process of

mechanical damage to sarcomeres is best explained in terms of the length-

tension relationship of the sarcomere. The tension a muscle fiber can develop is

proportional to the amount of overlap between the thick and thin filaments (74).

The point of maximum tension occurs when the muscle is at a length at which the

maximum number of cross bridges can be formed. This is the point at which the

load opposing the muscle contraction is equal to the tension generated by the

muscle, an isometric contraction. As an actively contracting muscle is

lengthened, the available cross bridge binding sites steadily decreases. The

forces transmitted to the sarcomeres from the external load can damage the

ultrastructure of the sarcomere, and this disruption of sarcomere ultrastructure is

responsible for the immediate decrease in force production following injury (10,

16, 41). In addition to damaging the sarcomeres, lengthening contractions can

lead to disruption of the plasma membrane and endomysium due to shear forces

generated during the lengthening contraction (14, 44). This process of

sarcomere and membrane damage initiates a response that eventually leads to

repair of damaged structures and hypertrophy of the damaged muscle fiber.

13

Cellular Regulation of Muscle Growth and Atrophy. The nuclei within

skeletal muscle fibers are arrested at the G1 cell cycle checkpoint and are unable

to replicate (36). Following injury to a muscle fiber, the nuclei in the damaged

area undergo apoptosis (7, 70). Skeletal muscle stem cells, referred to as

satellite cells or myoblasts, reside in a space between the sarcolemma and the

basal lamina (58). Satellite cells, that normally exist in a quiescent state, become

activated, migrate to the site of injury, proliferate, and fuse with the damaged

fiber to repopulate the nuclei lost as a result of injury (24). Damage to the

endomysium releases inactive hepatocyte growth factor (HGF) (76). Reactive

oxygen species, produced by the nitric oxide synthase (NOS) enzyme, activate

HGF (77). Activated HGF binds to the c-met receptor on the plasma membrane

of satellite cells. HGF signaling activates the satellite cells from the quiescent

state and initiates the migration of satellite cells to the site of injury (76).

As satellite cells migrate to the site of injury, they also undergo

proliferation. The initiation of proliferation is brought on by an increase in the

expression of the basic helix-loop-helix (bHLH) transcription factor MyoD (24).

MyoD is one of four members of myogenic regulatory factor (MRF) family, that

include Myf-5, myogenin and MRF-4. The MRF family of transcription factors

initiate the "myogenic program" in these proliferating satellite cells (24). The

myogenic program changes the cellular morphology of satellite cells from a

fibroblastic type morphology to a muscle like morphology (75). Once in proximity

of the damaged muscle fiber, satellite cells fuse with each other to form

multinucleated structures called myotubes. These myotubes fuse with the

14

existing, damaged muscle fiber and can help bridge the gap between ruptured

ends of a muscle fiber. As the myotubes fuse with the muscle fiber, the nuclei

within the myotubes arrest in G1 (25, 36). A certain population of satellite cells

that underwent proliferation do not form myotubes, but instead resume a sub-

basal lamina position and return to quiescence (24). In addition to satellite cells,

fibroblasts and immune cells are attracted to the site of injury. The presence of

these cells helps to remove cellular debris and repair the ECM. If there is a

severe disruption of the ECM, fibroblasts can respond with an overproduction of

ECM (27). This overproduction of ECM results in the clinical condition of fibrosis,

or scar tissue accumulation. The mechanisms behind the formation of scar

tissue are of particular interest to clinicians, as this scar tissue is generally

disruptive to the proper function of muscle tissue and, once formed, is relatively

permanent (30).

Once the myotubes have fused with the damaged muscle fiber, the nuclei

from these myotubes occupy a centrally located position in the muscle fiber (24,

52). While nuclei in an uninjured fiber are typically located just beneath the

sarcolemma, taking up a central location presumably allows for greater surface

area contact of the nucleus with ribosomes and endoplasmic reticulum and thus

enhance the ability of muscle fibers to synthesize new proteins. During the repair

stages, the majority of proteins that are synthesized are responsible for repairing

the damaged fiber (26). While it is not clear exactly why the nuclei take up a

subsarcolemmal location after repair, the nuclei do not need as close a direct

association with endoplasmic reticulum, as mRNA that encodes sarcomeric

15

proteins is trafficked directly to the sarcomere, where translation and processing

occur (35). This strategy is likely in place as sarcomeric proteins are relatively

large, translation at the sarcomere minimizes the need for the muscle fiber to

have an elaborate protein trafficking system in place. The location of the nuclei

within the cytosol therefore provides a way to track the progress of repair in

skeletal muscle tissue.

Molecular Regulation of Muscle Growth and Atrophy. While the satellite

cells are undergoing migration, proliferation and fusion, the muscle fiber is

initiating the underlying processes that are responsible to begin the repair

process. Damage to the plasma membrane causes a persistent increase in

intracellular calcium levels (78). The influx of calcium initiates the persistent

activation of sarcomeres distal to the site of injury, and is likely the mechanism

behind the "muscle spasm" that is observed clinically after a muscle injury. This

influx of calcium also activates the proteolytic systems of muscle tissue (5, 29).

By three days following injury, the plasma membranes of the muscle fibers are

largely sealed off (64) and calcium homeostasis is restored (5).

The ubiquitin-proteasome proteolytic system is important in regulating

skeletal muscle mass and protein turn-over. Atrogin-1 (MAFbx) is a ubiquitin

ligase protein expressed in skeletal muscle (20, 32). Atrogin-1 directs the

polyubiquination of proteins (8). Once a protein is tagged with ubiquitin, that

protein is targeted to the proteasome organelle. The amount of ubiquitin tags on

a protein appears to be directly related to the speed at which the doomed protein

is degraded. Upon reaching the proteasome, the protein is broken down and its

16

constituent amino acids for recycled for use in the synthesis of new proteins.

The expression of atrogin-1 is regulated by the Forkhead box O (Foxo) family of

transcription factors (20, 32). The promoter region of the atrogin-1 gene contains

binding sites for the Foxo3 transcription factor that acts as a co-activator of

atrogin-1 transcription (68). Phosphorylation of Foxo3 by Akt inhibits the ability of

Foxo3 to enter the nucleus and thus blocks the ability of Foxo3 to act as a

transcription factor.

Regulation of Muscle Growth and Atrophy by Myostatin

Myostatin is a negative regulator of muscle mass (38, 39, 54, 84, 85, 90).

The myostatin gene consists of three exons, the first two of which encode a

propeptide, and the third encodes the mature, active form of myostatin (Figure

1.1). Compared with MSTN+/+ mice, the MSTN+/- mice used in this study have a

20% reduction in circulating myostatin levels, and MSTN-/- mice have no

detectable myostatin (Figure 1.2). While the masses of the male MSTN+/+,

MSTN+/- and MSTN-/- mice are similar until 9 months of age, following this time

point, the masses of the MSTN-/- mice are noticeably greater than MSTN+/+ and

MSTN+/- mice (Figure 1.3). The masses of female MSTN+/+, MSTN+/- and MSTN-

/- mice do not differ from one another (Figure 1.3). Myostatin deficiency

increases the CSA (cross-sectional area) of muscle fibers from EDL and soleus

muscles, and also increases the whole muscle CSA (Figure 1.4). Myostatin

deficiency does not change the relative myofibrillar protein content of EDL or

soleus muscles (Figure 1.5).

17

Molecular Signaling Pathways. Myostatin signal transduction is mediated

through the activin family of serine/threonine kinase receptors. Myostatin is

secreted as a 25 kDa dimer, bound to its 37 kDa propeptide (54). Upon

dissociation from its latent complex, myostatin binds the type IIb activin receptor

(ActRIIB or ACVR2B) (38). This binding promotes the recruitment and

phosphorylation of the type Ib activin co-receptor (ActRIB or ACVRB) (38). The

activated ActRIIB-ActRIB complex activates Smad2 and Smad3 transcription

factors, and TAK1, via phosphorylation (Figure 1.6) (62). Phosphorylation of

Smad2 and Smad3 allows for these proteins to oligomerize and enter the

nucleus (57). Specifically, Smad2 and Smad3 can form homodimers,

heterodimers and heterotrimers with themselves and an additional transcription

factor, Smad4 (57). The Smad oligomers interact with other transcription factors

and recruit co-activators or co-repressors of gene transcription (57). The

activated TAK1 kinase activates the downstream kinases p38 MAPK and Erk1/2

via MKK3/6 (62, 88). p38 MAPK and Erk1/2 are able in turn to regulate the

activity of various transcription factors via phosphorylation. While the myostatin-

deficient mice have a very clear hypermuscular phenotype, the downstream gene

targets of myostatin-mediated signal transduction, remain largely unknown.

Unlike myostatin, IGF-1 (insulin like growth factor-1) is a positive regulator

of muscle mass. IGF-1 binds to the IGF-1 receptor that activates PI3K via IRS-1

(1). PI3K activates Akt/PKB that activates several downstream transcription

factors via phosphorylation (1). Akt appears to regulate muscle mass both by

promoting satellite cell proliferation and by decreasing protein degradation (20).

18

Akt promotes satellite cell proliferation, at least in part, by increasing the

expression of MyoD (20). To inhibit protein degradation, Akt phosphorylates the

Foxo3 transcription factor that keeps Foxo3 localized in the cytosol (20, 69).

Foxo3 is a potent activator of atrogin-1, and in the absence of a nuclear localized

Foxo3 transcription factor, atrogin-1 expression declines (20). The myostatin and

IGF-1 pathways can inhibit each other. Activation of ActRIIB by myostatin blocks

the IGF-1 mediated phosphorylation of PI3K and Akt (89). Akt binds and

prevents the nuclear localization of Smad3 (13).

Induction of Muscle Atrophy by Myostatin. The deficiency of myostatin

results in a profound increase in skeletal muscle mass (38, 39, 54, 84, 85, 90)

and overexpression of myostatin results in muscle atrophy (66, 91). While the

deficiency of myostatin increases protein synthesis (83), it was not known if

myostatin also increase protein breakdown. Our preliminary studies of the

regulation of atrogin-1 by myostatin indicated that, despite no difference in

relative myofibrillar protein content (Figure 1.5), compared with MSTN+/+ mice,

the EDL muscles of MSTN-/- mice had a noticeable decrease in ubiquitin tagged

myosin heavy chain (Figure 1.7A) and a 40% decrease in atrogin-1 expression

(Figure 1.7C). For soleus muscles, MSTN-/- mice had only a minor decrease in

ubiquitin tagged myosin heavy chain (Figure 1.7B) and no difference in atrogin-1

expression (Figure 1.7D). The decreased ubiquitination of myosin heavy chain,

in conjunction with the decrease in atrogin-1 expression, suggests that there is a

decrease in protein degradation in MSTN-/- EDL muscles. This may explain why,

compared with soleus muscles, the deficiency of myostatin leads to a greater

19

relative increase in EDL muscle mass (further discussed in Chapter II). While

sarcomeric proteins must first be liberated from the sarcomere by calpain

mediated proteolysis of titin, these results do indicate that myostatin deficiency

leads to a functional decrease in protein degradation. Determining the

expression of the calpain proteases will provide greater insight into this

mechanism.

Myostatin increases the expression of atrogin-1 in C2C12 myotubes (53).

We determined if myostatin could increase the expression of atrogin-1 in primary

myotubes, and which arm of the myostatin signaling pathway was involved in this

process. When primary myotubes were treated with myostatin, there was a

dose-dependent increase in atrogin-1 expression (Figure 1.8). Inhibition of both

the p38 MAPK and Smad2/3 pathways blocked the myostatin-mediated increase

in atrogin-1 expression, suggesting that both arms of the myostatin signal

transduction pathway are important in the regulation of atrogin-1. While the p38

MAPK mediated induction of atrogin-1 expression is not clear, Foxo3 can directly

bind Smad3 to promote gene transcription (22, 69), and the interaction between

Foxo3 and Smad3 may therefore be necessary for the regulation of atrogin-1 by

myostatin.

Methods

Animals. All experiments were conducted in accordance with the

guidelines of the University of Michigan Committee on the Use and Care of

Animals. Mice were housed in specific-pathogen-free conditions and were

provided food and water ad libidum. The MSTN-/- mice are of a C57Bl/6

20

background and were a kind gift of Dr. Se-Jin Lee (54). The null MSTN allele

was generated by replacing a portion of the third exon of the MSTN gene that

encodes the C-terminal region of the mature myostatin protein with a neo

cassette (Figure 1.1A). The genotype of mice was determined by PCR-based

analysis of DNA samples obtained via tail biopsy (Figure 1.1B).

ELISA Quantification of Myostatin in Serum. Approximately 1mL of blood

was withdrawn from 6 month old male MSTN+/+, MSTN+/-, and MSTN-/- mice,

allowed to clot and spun at 10,000 × g for 10 minutes to separate serum. Serum

was briefly treated with 0.1N HCl to dissociate myostatin from its carrier proteins

and was subsequently diluted 1:2 in RIPA buffer. Samples were then subjected

to sandwich ELISA (R&D Systems) in triplicate.

Cell Culture. Satellite cells were isolated from 6 month old male MSTN+/+

mice using the methods described by Allen and his colleagues (2). Mice were

anesthetized with intraperitoneal injection of Avertin (400 mg/kg) and sacrificed

by cervical dislocation. The hindlimb muscles were quickly removed, minced and

digested in protease solution (1.0 mg/mL of Type XIV Proteinase in PBS, Sigma)

for 1 hour at 37ºC. Satellite cells were separated from muscle fiber fragments

and from tissue debris by differential centrifugation and then plated on fibronectin

coated 35mm tissue culture plates (BD Biosciences). Cultures were maintained

in a humidified environment maintained at 37ºC and 5% CO2.

Satellite cells were grown in DMEM + 20% FBS + 1% antibiotic-

antimycotic (AbAm) until reaching 80% confluence, at which time the media was

changed to DMEM + 2% horse serum + 1% AbAm to induce differentiation into

21

myotubes. Myotubes were maintained in culture for 5 days and then serum

starved for 24 hours by replacing the differentiation media with DMEM + Insulin-

Transferrin-Selenium Supplement (Invitrogen) + 1% AbAm. Recombinant murine

myostatin was produced in NS0 mouse myeloma cells (R & D Systems) and

dissolved into the starvation media at a final concentration of 250 or 500 ng/mL.

Stock solutions of the p38 MAPK inhibitor SB-203580 (15) and the Smad2/3

inhibitor SB-431542 (28) were prepared by dissolving these solid anhydrous

compounds in DMSO at a concentration of 10mM. SB-203580 and SB-431542

stock solutions were then added to starvation media containing myostatin and

0.5% DMSO at a final concentration of 10µM for SB-203580 and 5µM for SB-

431542. Cells were pretreated with SB-203580 or SB-431542 for 1 hour prior to

treatment with myostatin for 12 hours.

Myofibrillar Protein Content. Myofibrillar proteins were extracted from EDL

and soleus muscles using the methods of Solaro (71), modified to include the

addition of Leupeptin (Sigma). The protein content of the isolated myofibrils was

determined using a DC Protein Assay (Bio-Rad) and normalized to the wet mass

of the muscle.

SDS-PAGE and Immunoblot. Whole EDL and soleus muscles were

removed from anesthetized 6 month old MSTN+/+ and MSTN-/- mice, flash frozen

in liquid nitrogen and stored at -80ºC until use. Muscles and myotubes were

homogenized in Laemmli's sample buffer with 1:20 β-mercaptoethanol, 1:20

protease inhibitor cocktail (Sigma) and 1:40 phosphatase inhibitor cocktail

(Sigma) and then placed in boiling water for 5 minutes. Protein concentration of

22

the samples was determined using an RC DC Protein Assay (Bio-Rad). Equal

amounts of protein were loaded into 4% stacking, 7.5% resolving polyacrylamide

gels and subjected to electrophoresis. To detect total myosin heavy chain, gels

were stained with Coomassie Brilliant Blue (Bio-Rad). To detect ubiquitinated

myosin heavy chain, proteins were transferred from gels to a 0.45 µm

nitrocellulose membrane and stained with Ponceau S to verify equal protein

transfer. Membranes were blocked using casein (Vector Labs), incubated with

an HRPO tagged anti-ubiquitin antibody (Santa Cruz) and developed with

SuperSignal West Dura enhanced chemiluminescent reagents (Pierce

Biotechnology) and visualized using a FluorChem chemiluminescent

documentation system (Alpha Innotech).

RT-qPCR. RNA was isolated from samples using an RNeasy Fibrous

Tissue kit (Qiagen) and treated with DNase I. Poly-A mRNA was reverse

transcribed using an Omniscript RT system (Qiagen) and oligo(dT)15 primers.

cDNA was amplified using primers for atrogin-1 (forward: 5'-

ATTCTACACTGGCAGCAGCA-3'; reverse: 5'- TGTAAGCACACAGGCAGGTC-

3') and β2-microglobulin (forward: 5'-ATGGGAAGCCGAACATACTG-3'; reverse:

5'-CAGTCTCAGTGGGGGTGAAT-3') using a SYBR Green I PCR system

(Qiagen) with Uracil DNA Glycosylase (Invitrogen) in an Opticon 2 real-time

thermal cycler (Bio-Rad). qPCR reactions were conducted in quadruplicate for

each sample. C(t) values for atrogin-1 were normalized to β2-microglobulin

using the 2-ΔΔC(t) method. β2-microglobulin was selected as a normalizing gene

based on its stable expression in skeletal muscle tissue (49) and because its

23

expression did not differ between groups. The presence of single amplicons from

qPCR reactions were verified by melting curve analysis as well as

electrophoresis using a 2% agarose gel. Genomic DNA contamination was not

detected in qPCR reactions.

Statistical Analysis. Results are presented as means ± SE. KaleidaGraph

4.02 software was used to conduct statistical tests. For ELISA, histology and

gene expression data from cell culture experiments, differences between groups

were tested with a one-way ANOVA with α = 0.05. Fisher’s least significant post

hoc test was used to identify specific differences when significance was tested.

For all other data, differences between groups were tested with Student’s t-test

with α = 0.05.

24

Figure 1.1. (A) Structure of wild type and null MSTN alleles. (B) PCR based detection of myostatin alleles.

25

Figure 1.2. Mouse models used in the current study. Picture of (A) whole mouse carcasses and (B) hind limb musculature. (C) Relative myostatin concentration in plasma measured by ELISA. N = 6 mice. *, significantly different from MSTN+/+ at P < 0.05, #, significantly different from MSTN+/- at P < 0.05.

26

Figure 1.3. Growth curves of male and female MSTN+/+, MSTN+/- and MSTN-/- mice.

27

Figure 1.4. Muscle fiber CSA distributions. EDL muscles of (A) MSTN+/+, (B) MSTN+/- and (C) MSTN-/- mice. Soleus muscles of (D) MSTN+/+, (E) MSTN+/- and (F) MSTN-/- mice. N = 3 muscles from each genotype. *, significantly different from MSTN+/+ at P < 0.05, #, significantly different from MSTN+/- at P < 0.05.

28

Figure 1.5. Relative myofibrillar protein content of (A) EDL and (B) soleus muscles of MSTN+/+ and MSTN-/- mice. (A) There was no difference between the myofibrillar protein content (normalized first to muscle mass, and then to levels in MSTN+/+ mice) between MSTN+/+ and MSTN-/- mice for (A) EDL and (B) soleus muscles. N = 3 muscles.

29

Figure 1.6. Myostatin signal transduction pathways.

30

Figure 1.7. Ubiquitinated myosin heavy chain (Ub-MHC) protein and atrogin-1 expression from EDL and soleus muscles of MSTN+/+ and MSTN-/- mice. MSTN-/- mice have less Ub-MHC than MSTN+/+ mice in (A) EDL, but there is only a minimal difference between genotypes in (B) soleus muscles. There is a decrease in the relative expression of atrogin-1, normalized to β2-microglobulin, in (C) EDL muscles of MSTN-/- mice, but no differences in (D) soleus muscles. N = 4 muscles.

31

Figure 1.8. Atrogin-1 expression in primary myotubes treated with myostatin. Treatment of primary myotubes with myostatin for 12h increases the relative expression of atrogin-1, normalized to β2-microglobulin. +, 250ng/mL of myostatin. ++, 500ng/mL of myostatin. *, significantly different from control group at P < 0.05. #, significantly different from 250ng/mL group at P < 0.05. N = 3 independent experiments.

32

References 1. Adams G. Invited Review: Autocrine/paracrine IGF-I and skeletal muscle adaptation. J Appl Physiol 93: 1159-1167, 2002. 2. Allen RE, Temm-Grove CJ, Sheehan SM, and Rice G. Skeletal muscle satellite cell cultures. Methods Cell Biol 52: 155-176, 1997. 3. Anastasi G, Cutroneo G, Santoro G, and Trimarchi F. The non-junctional sarcolemmal cytoskeleton: the costameres. Ital J Anat Embryol 103: 1-11, 1998. 4. Arruda E, Mundy K, Calve S, and Baar K. Denervation does not change the ratio of collagen I and collagen III mRNA in the extracellular matrix of muscle. Am J Physiol Regul Integr Comp Physiol 292: R983-987, 2007. 5. Belcastro AN, Shewchuk LD, and Raj DA. Exercise-induced muscle injury: a calpain hypothesis. Mol Cell Biochem 179: 135-145, 1998. 6. Benjamin M, Kumai T, Milz S, Boszczyk B, Boszczyk A, and Ralphs J. The skeletal attachment of tendons--tendon "entheses". Comp Biochem Physiol, Part A Mol Integr Physiol 133: 931-945, 2002. 7. Biral D, Jakubiec-Puka A, Ciechomska I, Sandri M, Rossini K, Carraro U, and Betto R. Loss of dystrophin and some dystrophin-associated proteins with concomitant signs of apoptosis in rat leg muscle overworked in extension. Acta Neuropathol (Berl) 100: 618-626, 2000. 8. Bodine S, Latres E, Baumhueter S, Lai V, Nunez L, Clarke B, Poueymirou W, Panaro F, Na E, Dharmarajan K, Pan Z, Valenzuela D, DeChiara T, Stitt T, Yancopoulos G, and Glass D. Identification of ubiquitin ligases required for skeletal muscle atrophy. Science 294: 1704-1708, 2001. 9. Brinckmann J. Collagen - Primer in Structure, Processing and Assembly. Top Curr Chem 247: 1-229, 2005. 10. Brooks SV, Zerba E, and Faulkner JA. Injury to muscle fibres after single stretches of passive and maximally stimulated muscles in mice. J Physiol 488 ( Pt 2): 459-469, 1995. 11. Capetanaki Y, Bloch RJ, Kouloumenta A, Mavroidis M, and Psarras S. Muscle intermediate filaments and their links to membranes and membranous organelles. Exp Cell Res 313: 2063-2076, 2007. 12. Chopard A, Arrighi N, Carnino A, and Marini JF. Changes in dysferlin, proteins from dystrophin glycoprotein complex, costameres, and cytoskeleton in human soleus and vastus lateralis muscles after a long-term bedrest with or without exercise. Faseb J 19: 1722-1724, 2005. 13. Conery AR, Cao Y, Thompson EA, Townsend CM, Jr., Ko TC, and Luo K. Akt interacts directly with Smad3 to regulate the sensitivity to TGF-beta induced apoptosis. Nat Cell Biol 6: 366-372, 2004. 14. Consolino CM, and Brooks SV. Susceptibility to sarcomere injury induced by single stretches of maximally activated muscles of mdx mice. J Appl Physiol 96: 633-638, 2004. 15. Cuenda A, Rouse J, Doza Y, Meier R, Cohen P, Gallagher T, Young P, and Lee J. SB 203580 is a specific inhibitor of a MAP kinase homologue which is stimulated by cellular stresses and interleukin-1. FEBS Lett 364: 229-233, 1995.

33

16. Devor ST, and Faulkner JA. Regeneration of new fibers in muscles of old rats reduces contraction-induced injury. J Appl Physiol 87: 750-756, 1999. 17. Evans WJ. Protein nutrition and resistance exercise. Can J Appl Physiol 26 Suppl: S141-152, 2001. 18. Faulkner JA, Brooks SV, and Opiteck JA. Injury to skeletal muscle fibers during contractions: conditions of occurrence and prevention. Phys Ther 73: 911-921, 1993. 19. Gerriets J, Curwin S, and Last J. Tendon hypertrophy is associated with increased hydroxylation of nonhelical lysine residues at two specific cross-linking sites in type I collagen. J Biol Chem 268: 25553-25560, 1993. 20. Glass D. Molecular mechanisms modulating muscle mass. Trends in molecular medicine 9: 344-350, 2003. 21. Glass DJ. Skeletal muscle hypertrophy and atrophy signaling pathways. Int J Biochem Cell Biol 37: 1974-1984, 2005. 22. Gomis R, Alarcón C, He W, Wang Q, Seoane J, Lash A, and Massagué J. A FoxO-Smad synexpression group in human keratinocytes. Proc Natl Acad Sci USA 103: 12747-12752, 2006. 23. Griffiths RI. Shortening of muscle fibres during stretch of the active cat medial gastrocnemius muscle: the role of tendon compliance. J Physiol 436: 219-236, 1991. 24. Hawke T, and Garry D. Myogenic satellite cells: physiology to molecular biology. J Appl Physiol 91: 534-551, 2001. 25. Hawke TJ, Meeson AP, Jiang N, Graham S, Hutcheson K, DiMaio JM, and Garry DJ. p21 is essential for normal myogenic progenitor cell function in regenerating skeletal muscle. Am J Physiol Cell Physiol 285: C1019-1027, 2003. 26. Herndon DN, Dasu MR, Wolfe RR, and Barrow RE. Gene expression profiles and protein balance in skeletal muscle of burned children after beta-adrenergic blockade. Am J Physiol Endocrinol Metab 285: E783-789, 2003. 27. Huard J, Li Y, and Fu F. Muscle injuries and repair: current trends in research. The Journal of bone and joint surgery American volume 84-A: 822-832, 2002. 28. Inman G, Nicolás F, Callahan J, Harling J, Gaster L, Reith A, Laping N, and Hill C. SB-431542 is a potent and specific inhibitor of transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4, ALK5, and ALK7. Mol Pharmacol 62: 65-74, 2002. 29. Jackman R, and Kandarian S. The molecular basis of skeletal muscle atrophy. Am J Physiol, Cell Physiol 287: C834-843, 2004. 30. Järvinen T, Järvinen T, Kääriäinen M, Kalimo H, and Järvinen M. Muscle injuries: biology and treatment. The American journal of sports medicine 33: 745-764, 2005. 31. Józsa LG, and Kannus P. Human tendons : anatomy, physiology, and pathology. Champaign, IL: Human Kinetics, 1997, p. ix, 574 p. 32. Kandarian S, and Jackman R. Intracellular signaling during skeletal muscle atrophy. Muscle Nerve 33: 155-165, 2006.

34

33. Kannus P, and Józsa L. Histopathological changes preceding spontaneous rupture of a tendon. A controlled study of 891 patients. The Journal of bone and joint surgery American volume 73: 1507-1525, 1991. 34. Kiiskinen A. Physical training and connective tissues in young mice--physical properties of Achilles tendons and long bones. Growth 41: 123-137, 1977. 35. Kiri A, and Goldspink G. RNA-protein interactions of the 3' untranslated regions of myosin heavy chain transcripts. J Muscle Res Cell Motil 23: 119-129, 2002. 36. Kitzmann M, and Fernandez A. Crosstalk between cell cycle regulators and the myogenic factor MyoD in skeletal myoblasts. Cell Mol Life Sci 58: 571-579, 2001. 37. Kjaer M. Role of extracellular matrix in adaptation of tendon and skeletal muscle to mechanical loading. Physiol Rev 84: 649-698, 2004. 38. Lee S, and McPherron A. Regulation of myostatin activity and muscle growth. Proc Natl Acad Sci USA 98: 9306-9311, 2001. 39. Lee S, Reed L, Davies M, Girgenrath S, Goad M, Tomkinson K, Wright J, Barker C, Ehrmantraut G, Holmstrom J, Trowell B, Gertz B, Jiang M, Sebald S, Matzuk M, Li E, Liang L, Quattlebaum E, Stotish R, and Wolfman N. Regulation of muscle growth by multiple ligands signaling through activin type II receptors. Proc Natl Acad Sci USA 102: 18117-18122, 2005. 40. Legerlotz K, Schjerling P, Langberg H, Brüggemann G, and Niehoff A. The effect of running, strength, and vibration strength training on the mechanical, morphological, and biochemical properties of the Achilles tendon in rats. J Appl Physiol 102: 564-572, 2007. 41. Lieber R, Woodburn T, and Fridén J. Muscle damage induced by eccentric contractions of 25% strain. J Appl Physiol 70: 2498-2507, 1991. 42. Lin T, Cardenas L, and Soslowsky L. Biomechanics of tendon injury and repair. Journal of biomechanics 37: 865-877, 2004. 43. Listrat A, Picard B, and Geay Y. Age-related changes and location of type I, III, IV, V and VI collagens during development of four foetal skeletal muscles of double-muscled and normal bovine animals. Tissue & cell 31: 17-27, 1999. 44. Lovering RM, and De Deyne PG. Contractile function, sarcolemma integrity, and the loss of dystrophin after skeletal muscle eccentric contraction-induced injury. Am J Physiol Cell Physiol 286: C230-238, 2004. 45. Lucero HA, and Kagan HM. Lysyl oxidase: an oxidative enzyme and effector of cell function. Cell Mol Life Sci 63: 2304-2316, 2006. 46. MacIntosh BR, Gardiner PF, and McComas AJ. Skeletal muscle : form and function. Champaign, IL: Human Kinetics, 2006, p. 423 p. 47. Maganaris C, Narici M, and Reeves N. In vivo human tendon mechanical properties: effect of resistance training in old age. Journal of musculoskeletal & neuronal interactions 4: 204-208, 2004. 48. Magnusson S, Hansen P, and Kjaer M. Tendon properties in relation to muscular activity and physical training. Scandinavian journal of medicine & science in sports 13: 211-223, 2003.

35

49. Mahoney D, Carey K, Fu M, Snow R, Cameron-Smith D, Parise G, and Tarnopolsky M. Real-time RT-PCR analysis of housekeeping genes in human skeletal muscle following acute exercise. Physiol Genomics 18: 226-231, 2004. 50. Maxwell L, Faulkner J, and Hyatt G. Estimation of number of fibers in guinea pig skeletal muscles. Journal of applied physiology 37: 259-264, 1974. 51. McCully KK, and Faulkner JA. Characteristics of lengthening contractions associated with injury to skeletal muscle fibers. J Appl Physiol 61: 293-299, 1986. 52. McCully KK, and Faulkner JA. Injury to skeletal muscle fibers of mice following lengthening contractions. J Appl Physiol 59: 119-126, 1985. 53. McFarlane C, Plummer E, Thomas M, Hennebry A, Ashby M, Ling N, Smith H, Sharma M, and Kambadur R. Myostatin induces cachexia by activating the ubiquitin proteolytic system through an NF-kappaB-independent, FoxO1-dependent mechanism. J Cell Physiol 209: 501-514, 2006. 54. McPherron A, Lawler A, and Lee S. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387: 83-90, 1997. 55. Monti RJ, Roy RR, Hodgson JA, and Edgerton VR. Transmission of forces within mammalian skeletal muscles. J Biomech 32: 371-380, 1999. 56. Moore MJ, and De Beaux A. A quantitative ultrastructural study of rat tendon from birth to maturity. J Anat 153: 163-169, 1987. 57. Moustakas A, Souchelnytskyi S, and Heldin C. Smad regulation in TGF-beta signal transduction. J Cell Sci 114: 4359-4369, 2001. 58. Muir AR, Kanji AH, and Allbrook D. The structure of the satellite cells in skeletal muscle. J Anat 99: 435-444, 1965. 59. Nakagawa Y, Majima T, and Nagashima K. Effect of ageing on ultrastructure of slow and fast skeletal muscle tendon in rabbit Achilles tendons. Acta Physiol Scand 152: 307-313, 1994. 60. O'Brien M. Functional anatomy and physiology of tendons. Clin Sports Med 11: 505-520, 1992. 61. Paxton JZ, and Baar K. Tendon Mechanics: The Argument Heats Up. J Appl Physiol 2007. 62. Philip B, Lu Z, and Gao Y. Regulation of GDF-8 signaling by the p38 MAPK. Cell Signal 17: 365-375, 2005. 63. Purslow PP, and Trotter JA. The morphology and mechanical properties of endomysium in series-fibred muscles: variations with muscle length. J Muscle Res Cell Motil 15: 299-308, 1994. 64. Rader EP, Song W, Van Remmen H, Richardson A, and Faulkner JA. Raising the antioxidant levels within mouse muscle fibres does not affect contraction-induced injury. Exp Physiol 91: 781-789, 2006. 65. Reddy G, Stehno-Bittel L, and Enwemeka C. Glycation-induced matrix stability in the rabbit achilles tendon. Arch Biochem Biophys 399: 174-180, 2002. 66. Reisz-Porszasz S, Bhasin S, Artaza J, Shen R, Sinha-Hikim I, Hogue A, Fielder T, and Gonzalez-Cadavid N. Lower skeletal muscle mass in male transgenic mice with muscle-specific overexpression of myostatin. Am J Physiol Endocrinol Metab 285: E876-888, 2003.

36

67. Rybakova IN, Patel JR, and Ervasti JM. The dystrophin complex forms a mechanically strong link between the sarcolemma and costameric actin. J Cell Biol 150: 1209-1214, 2000. 68. Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh K, Schiaffino S, Lecker S, and Goldberg A. Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 117: 399-412, 2004. 69. Seoane J, Le H, Shen L, Anderson S, and Massagué J. Integration of Smad and forkhead pathways in the control of neuroepithelial and glioblastoma cell proliferation. Cell 117: 211-223, 2004. 70. Smith HK, Maxwell L, Martyn JA, and Bass JJ. Nuclear DNA fragmentation and morphological alterations in adult rabbit skeletal muscle after short-term immobilization. Cell Tissue Res 302: 235-241, 2000. 71. Solaro RJ, Pang DC, and Briggs FN. The purification of cardiac myofibrils with Triton X-100. Biochim Biophys Acta 245: 259-262, 1971. 72. Sommer H. The biomechanical and metabolic effects of a running regime on the Achilles tendon in the rat. International orthopaedics 11: 71-75, 1987. 73. Squire JM. Architecture and function in the muscle sarcomere. Curr Opin Struct Biol 7: 247-257, 1997. 74. Squire JM. Muscle contraction. Encyclopedia of Life Sciences 2005. 75. Tapscott SJ. The circuitry of a master switch: Myod and the regulation of skeletal muscle gene transcription. Development 132: 2685-2695, 2005. 76. Tatsumi R, and Allen R. Active hepatocyte growth factor is present in skeletal muscle extracellular matrix. Muscle Nerve 30: 654-658, 2004. 77. Tatsumi R, Liu X, Pulido A, Morales M, Sakata T, Dial S, Hattori A, Ikeuchi Y, and Allen R. Satellite cell activation in stretched skeletal muscle and the role of nitric oxide and hepatocyte growth factor. Am J Physiol, Cell Physiol 290: C1487-1494, 2006. 78. Turner PR, Fong PY, Denetclaw WF, and Steinhardt RA. Increased calcium influx in dystrophic muscle. J Cell Biol 115: 1701-1712, 1991. 79. Viidik A. The effect of training on the tensile strength of isolated rabbit tendons. Scand J Plast Reconstr Surg 1: 141-147, 1967. 80. Vilarta R, and Vidal Bde C. Anisotropic and biomechanical properties of tendons modified by exercise and denervation: aggregation and macromolecular order in collagen bundles. Matrix 9: 55-61, 1989. 81. Wagner K. Muscle regeneration through myostatin inhibition. Current opinion in rheumatology 17: 720-724, 2005. 82. Wang J. Mechanobiology of tendon. Journal of biomechanics 39: 1563-1582, 2006. 83. Welle S, Bhatt K, and Pinkert C. Myofibrillar protein synthesis in myostatin-deficient mice. Am J Physiol Endocrinol Metab 290: E409-415, 2006. 84. Whittemore L, Song K, Li X, Aghajanian J, Davies M, Girgenrath S, Hill J, Jalenak M, Kelley P, Knight A, Maylor R, O'Hara D, Pearson A, Quazi A, Ryerson S, Tan X, Tomkinson K, Veldman G, Widom A, Wright J, Wudyka S, Zhao L, and Wolfman N. Inhibition of myostatin in adult mice increases skeletal muscle mass and strength. Biochem Biophys Res Commun 300: 965-971, 2003.

37

85. Williams M. Myostatin mutation associated with gross muscle hypertrophy in a child. N Engl J Med 351: 1030-1031; author reply 1030-1031, 2004. 86. Woo SL, Gomez MA, Amiel D, Ritter MA, Gelberman RH, and Akeson WH. The effects of exercise on the biomechanical and biochemical properties of swine digital flexor tendons. J Biomech Eng 103: 51-56, 1981. 87. Woo SL, Ritter MA, Amiel D, Sanders TM, Gomez MA, Kuei SC, Garfin SR, and Akeson WH. The biomechanical and biochemical properties of swine tendons--long term effects of exercise on the digital extensors. Connect Tissue Res 7: 177-183, 1980. 88. Yang W, Chen Y, Zhang Y, Wang X, Yang N, and Zhu D. Extracellular signal-regulated kinase 1/2 mitogen-activated protein kinase pathway is involved in myostatin-regulated differentiation repression. Cancer Res 66: 1320-1326, 2006. 89. Yang W, Zhang Y, Li Y, Wu Z, and Zhu D. Myostatin induces cyclin D1 degradation to cause cell cycle arrest through a phosphatidylinositol 3-kinase/AKT/GSK-3 beta pathway and is antagonized by insulin-like growth factor 1. J Biol Chem 282: 3799-3808, 2007. 90. Zhu X, Hadhazy M, Wehling M, Tidball J, and McNally E. Dominant negative myostatin produces hypertrophy without hyperplasia in muscle. FEBS Lett 474: 71-75, 2000. 91. Zimmers T, Davies M, Koniaris L, Haynes P, Esquela A, Tomkinson K, McPherron A, Wolfman N, and Lee S. Induction of cachexia in mice by systemically administered myostatin. Science 296: 1486-1488, 2002.

38

Chapter II

Contractile Properties of Extensor Digitorum Longus and Soleus Muscles of Myostatin-Deficient Mice

Abstract

Myostatin is a negative regulator of muscle mass. The impact of

myostatin deficiency on the contractile properties of healthy muscles has not

been determined. We hypothesized that myostatin deficiency would increase the

maximum tetanic force (Po), but decrease the specific Po (sPo) of muscles and

increase the susceptibility to contraction-induced injury. The in vitro contractile

properties of EDL and soleus muscles from wild type (MSTN+/+), heterozygous-

null (MSTN+/-) and homozygous-null (MSTN-/-) adult male mice were determined.

For EDL muscles, the Po of both MSTN+/- and MSTN-/- mice were greater than

the Po of MSTN+/+ mice. For soleus muscles, the Po of MSTN-/- mice was greater

than that of MSTN+/+ mice. The sPo of EDL muscles of MSTN-/- mice was less

than MSTN+/+ mice. For soleus muscles, however, no difference in sPo was

observed. Following two lengthening contractions, EDL muscles from MSTN-/-

mice had a greater force deficit than MSTN+/+ or MSTN+/- mice, whereas no

differences were observed for the force deficits of soleus muscles. Myostatin

deficient EDL muscles had less hydroxyproline, and myostatin directly increased

type I collagen mRNA expression and protein content. The difference in the

response of EDL and soleus muscles to myostatin may arise from differences in

39

the levels of a myostatin receptor, ActRIIB. Compared with the soleus, the

amount of ActRIIB was approximately two-fold greater in EDL muscles. The

results support a significant role for myostatin not only in the mass of muscles,

but also in the contractility and the composition of the ECM of muscles.

Introduction

Myostatin (GDF-8) is a member of the transforming growth factor-beta

(TGF-β) family of cytokines and functions as a negative regulator of skeletal

muscle mass. Inactivation of the myostatin genes and post-natal inhibition of

myostatin both result in significant increases in skeletal muscle mass (4, 5, 21,

42, 47, 65, 68, 69). Systemic and skeletal muscle specific overexpression of

myostatin induce skeletal muscle atrophy (52, 71). The Belgian Blue and

Piedmontese breeds of cattle have a mutated form of the myostatin gene and are

characterized by larger skeletal muscles than other breeds (20, 24). At the time

of birth, a human child with apparent null mutations in his myostatin genes had a

thigh muscle volume two-fold greater in size than ten age-matched controls (54).

The child's mother, who is heterozygous for the mutation, was also reported to be

hypermuscular (54).

Myostatin circulates through the blood in a latent form bound to its

propeptide and to follistatin (2). The myostatin gene (MSTN) encodes a

precursor protein that undergoes proteolytic processing to generate a propeptide

and a mature myostatin dimer (67). The propeptide binds myostatin

noncovalently and inhibits the bioactivity of myostatin (42, 57, 67). Cleavage of

the propeptide by the BMP-1/tolloid family of metalloproteinases results in the

40

liberation and activation of myostatin (67). Activated myostatin binds to the

activin type IIB (ActRIIB) and IB (ActRIB) receptors to initiate the Smad2/3 and

p38 MAPK intercellular signal transduction cascades (29, 46, 50, 70). Myostatin

appears to regulate skeletal muscle mass, at least in part, by inhibiting the

proliferation, differentiation and self-renewal of myoblasts (28, 39, 56, 58). Type

II muscle fibers appear to be more responsive to the myostatin signaling pathway

than type I muscles, but the mechanism responsible for this difference is

unknown (10, 37, 41, 43).

The inhibition of myostatin may be useful in the treatment of muscle

injuries and muscle wasting diseases by improving the contractile properties of

muscle (17, 26, 45, 53, 55, 59, 61). Compared with wild type mice, myostatin

deficient mice have increased bite force (9) and gross grip strength (65).

Treating mdx mice with an antibody against myostatin increased the maximum

tetanic force (Po) of EDL muscles, but did not change the specific maximum

tetanic force (sPo) (4). When mdx mice were treated with the propeptide of

myostatin, both the Po and sPo of EDL muscles increased (5).

Myostatin may also be useful in treating muscle injuries and disease by

regulating the collagen accumulation and scar tissue formation in the

extracellular matrix (ECM) (17, 45). In addition to enhancing the contractile

properties of dystrophic muscle, the deficiency of myostatin decreased the

accumulation of scar tissue and ECM of mdx mice (4, 5, 63). Type I collagen is a

major component of muscle ECM (31). The transcripts of two separate genes,

col1α1 and col1α2, are used to synthesize the collagen I precursor molecule,

41

procollagen I. Procollagen I is secreted into the ECM where it undergoes

cleavage and assembly to form mature collagen I (27). TGF-β has a well

established role as a positive regulator of type I collagen protein synthesis via the

Smad2/3 and p38-MAPK signaling pathways (reviewed in (60)). As myostatin is

a member of the TGF-β family of cytokines and utilizes similar signal transduction

pathways as TGF-β (29, 46, 50, 70), myostatin may have a direct role in the

regulation of the type I collagen content of skeletal muscle ECM.

While a few studies have examined the effects of myostatin deficiency on

the contractile properties and ECM of dystrophic muscles (4, 5, 63), how

myostatin deficiency impacts on healthy, non-dystrophic muscle is unknown.

The overall aim of this study was to determine the effect of myostatin deficiency

on the contractile properties, susceptibility to contraction-induced injury and

collagen composition of skeletal muscle tissue. As increases in Po due to

hypertrophy of muscle fibers often results in a corresponding decrease in sPo

(15, 25, 30), we hypothesized that a deficiency of myostatin would increase the

Po, but decrease the sPo. Based upon the observations that myostatin deficiency

decreased the ECM accumulation in dystrophic muscle (4, 5, 63), and the

similarities between the myostatin and TGF-β signal transduction pathways (29,

46, 50, 70), we formed the hypothesis that myostatin deficient mice would have

less muscle ECM and that myostatin would directly increase type I collagen

expression in skeletal muscle tissue. If these assumptions proved to be correct,

we hypothesized that the deficiency of myostatin would increase the force deficits

of muscles following a protocol of damaging lengthening contractions.

42

Methods

Animals. All experiments were conducted in accordance with the

guidelines of the University of Michigan Committee on the Use and Care of

Animals. Mice were housed in specific-pathogen-free conditions and fed food

and water ad libidum. MSTN-/- mice of a C57BL/6 background were a generous

gift of Dr. Se-Jin Lee. The MSTN null allele was generated by replacing the

portion of the third exon of the MSTN gene that encodes the C-terminal region of

the mature myostatin protein with a neo cassette (42). Male MSTN-/- mice were

crossed with MSTN+/+ C57BL/6 female mice to generate an F1 MSTN+/-

generation. The F1 generation was backcrossed to obtain an F2 generation

containing all three genotypes. F2 male mice 10 - 12 months of age were used

in this study. The genotype of mice was determined by PCR-based analysis of

genomic DNA samples obtained via tail biopsy. The MSTN wild type allele was

detected using a set of primers that generate a 247 bp amplicon from the third

exon of the MSTN gene, and the MSTN null allele was detected using a set of

primers that generate a 192 bp amplicon from the neo cassette that replaced the

third exon of the MSTN gene. Amplicons from PCR reactions were separated on

a 2% agarose gel.

Operative Procedure. Mice were anesthetized with intraperitoneal

injection of Avertin (400 mg/kg). Additional doses were provided as required to

maintain a deep anesthesia throughout the experiment. The EDL and soleus

muscles were removed from both the left and right legs of each mouse. Muscles

used for fiber counts, hydroxyproline, histochemistry or protein analysis were

43

flash frozen in liquid nitrogen and stored at -80°C until use. A 5-0 silk suture was

tied to the proximal and distal tendons of muscles used in the contractile

properties experiments. These muscles were placed immediately in a bath that

contained Kreb's mammalian Ringer solution with 0.25 mM tubocurarine

chrloride. The bath was maintained at 25°C and the solution was bubbled with

95% O2 and 5% CO2 to stabilize pH at 7.4. Following the removal of muscles,

mice were euthanized with an overdose of anesthetic and induction of a

pneumothorax.

Fiber Counts of Muscles. To determine the number of fibers present in

muscles, the extracellular matrices of muscles were digested as described (38).

Briefly, muscles were placed in a 15% HNO3 solution overnight at room

temperature. Following digestion, the HNO3 solution was replaced with

phosphate buffered saline. Individual muscle fibers were teased apart from

bundles and counted under a dissecting microscope. The lengths of forty

individual fibers per muscle were measured using digital calipers.

Measurement of Maximum Isometric Tetanic Force. Each muscle was

immersed in the bath solution and the distal tendon was attached to a servo

motor (model 305B, Aurora Scientific, Aurora, ON). The proximal tendon was

attached to a force transducer (model BG-50, Kulite Semiconductor Products,

Leonia, NJ). The attachment of tendons to the servo motor and force transducer

occurred just distal to the myotendinous junctions so that the impact of the

tendon on the measurement of contractile properties was minimized. Muscles

were stimulated by square pulses delivered by two platinum electrodes

44

connected to a high-power biphasic current stimulator (model 701B, Aurora

Scientific). An IBM-compatible personal computer and custom designed

software (LabVIEW 7.1, National Instruments, Austin, TX) controlled electrical

pulse properties and servo motor activity and recorded data from the force

transducer. The voltage of pulses was increased and muscle length (Lo) was

subsequently adjusted to the length that resulted in maximum twitch force (Pt)

(6). The Lo was measured with digital calipers. Muscles were held at Lo and

subjected to trains of pulses to generate an isometric contraction. Pulse trains

were 300 ms for EDL muscles and 900 ms for soleus muscles. Stimulus

frequency was increased until the Po was achieved (6). The general shape of the

force traces during twitch and isometric contractions were not different between

the three genotypes of mice for EDL and soleus muscles, respectively. The sPo

was determined by dividing Po by the cross sectional area (CSA). Following nitric

acid digestion, both EDL and soleus muscles showed no difference in the ratio of

fiber lengths to whole muscle lengths among any of the three genotypes.

Therefore the Lf/Lo ratios of 0.44 for EDL muscles and 0.70 for soleus muscles

were used to calculate Lf (6). The physiological CSA of muscles was determined

by dividing the mass of the muscle by the product of Lf and 1.06 g/cm3, the

density of mammalian skeletal muscle.

Contraction-Induced Injury. Following measurement of Pt and Po, a

mechanical injury to muscles was produced by two 40% lengthening contractions

(7, 11, 14). Muscles were stimulated and held at Lo for 100 ms for EDL muscles

and 300 ms for soleus muscles to allow muscles to develop Po. Following the

45

isometric contraction, muscles were stretched through a 40% strain relative to Lf.

A 40% strain of the EDL plantarflexes the ankle by 12º and the soleus dorsiflexes

by 16º. The velocity of the stretch was 1 Lf/s. The total time of stimulation was

500 ms. Following stimulation, muscles were returned to Lo, remained quiescent

for 1 min, then were subjected to a second 40% strain. Following 1 min of rest

the Po was measured. The general shape of the force traces during lengthening

contractions were not different for any of the three genotypes of mice. The

average force produced during a stretch was calculated by integrating the force-

time curve and dividing this value by the duration of the stretch. Work was

calculated by multiplying the average force produced during a stretch by the

length of the displacement and normalized by the wet mass of the muscle.

Measurement of Lengths of Tibias. Hindlimbs from euthanized mice were

stripped of gross muscle and connective tissue and placed in 20% hydrogen

peroxide at 55°C overnight to remove remaining soft tissue. Photographic

images of tibias were analyzed with ImageJ (version 1.34, NIH, Bethesda, MD) to

determine length.

Hydroxyproline Assay. Hydroxyproline content of muscles was measured

as described by Woessner (66). Muscles were dried for 90 min at 110ºC and

hydrolyzed in 500 µL of 6 M hydrochloric acid for 3.5 hours. The hydrolysate was

neutralized with an equal volume of 6 M sodium hydroxide. Known amounts of

purified L-hydroxyproline (Sigma, St. Louis, MO) were used to construct a

standard curve. Samples were assayed in triplicate using a Genios plate reader

(Tecan, Mannedorf, Switzerland) at an absorbance of 560 nm.

46

Histology. Muscles were cryosectioned at their mid-belly and stained with

Masson's Trichrome. The areas of 100 muscle fibers randomly selected from

sections of three muscles of each of the three genotypes were measured using

ImageJ.

ActRIIB Immunoblot. Muscles that did not undergo assessments of the

contractile properties were homogenized in cold Laemmli's sample buffer with

1:20 β-mercaptoethanol and 1:20 protease inhibitor cocktail (Sigma) and then

placed in boiling water for 5 minutes. Protein concentration of the samples was

determined using an RC DC Protein Assay (Bio-Rad, Hercules, CA). Equal

amounts of protein were loaded into two 4% stacking, 7.5% separating

polyacrylamide gels and subjected to electrophoresis. To verify equal protein

loading, gels that were not used in immunoblotting were stained with Coomassie

Brilliant Blue (Bio-Rad). Proteins were transferred to a 0.45 µm nitrocellulose

membrane and stained with Ponceau S to verify equal protein transfer.

Membranes were blocked using casein and an avidin-biotin blocking kit (Vector

Labs, Burlingame, CA), rinsed and incubated with a biotinylated monoclonal

antibody against ActRIIB (R & D Systems, Minneapolis, MN) and an avidin-

HRPO conjugate (Vector Labs). Membranes were developed with SuperSignal

West Dura enhanced chemiluminescent reagents (Pierce Biotechnology,

Rockford, IL) and visualized using a chemiluminescent documentation system

(Bio-Rad).

Satellite Cell Isolation and Culture. Satellite cells were isolated from adult

male MSTN+/+ mice as described by Allen and his colleagues (1). Mice were

47

anesthetized with intraperitoneal injection of Avertin (400 mg/kg) and sacrificed

by cervical dislocation. The hindlimb muscles were quickly removed, minced and

digested in protease solution (1.25 mg/mL of Pronase E in PBS, Sigma) for 1

hour at 37ºC. Satellite cells were separated from muscle fiber fragments and

from tissue debris by differential centrifugation and then plated on fibronectin

coated 60mm tissue culture plates (BD Biosciences, San Jose, CA). Cultures

were maintained in a humidified environment maintained at 37ºC and 5% CO2.

Satellite cells were grown in DMEM + 20% FBS + 1% antibiotic-antimycotic

(AbAm) until reaching 80% confluence, at which time the media was changed to

DMEM + 2% horse serum + 1% AbAm to induce differentiation into myotubes.

RT-qPCR. Myotubes were treated with different concentrations of

recombinant murine myostatin (R & D Systems, Minneapolis, MN) in DMEM +

1% AbAm for 2 hours. RNA was isolated from myotubes using an RNeasy Mini

kit (Qiagen, Valencia, CA), treated with DNase I and reverse transcribed using an

Omniscript RT kit (Qiagen) and oligo(dT)15 primers. cDNA was amplified using

primers for col1α2 (forward: 5'-CCAGCGAAGAACTCATACAGC-3'; reverse: 5'-

GGACACCCCTTCTACGTTGT-3') and β2-microglobulin (forward: 5'-

ATGGGAAGCCGAACATACTG-3'; reverse: 5'-CAGTCTCAGTGGGGGTGAAT-

3') using a SYBR Green I PCR system (Qiagen) with Uracil DNA Glycosylase

(Invitrogen) in an Opticon 2 real-time thermal cycler (Bio-Rad). qPCR reactions

were conducted in triplicate for each sample. C(t) values for col1α2 were

normalized to β2-microglobulin (β2m) using the 2-ΔΔC(t) method (32). β2m was

chosen as a housekeeping gene based on its stable expression in skeletal

48

muscle tissue (35) and because β2m expression did not differ between treatment

groups. The presence of single amplicons from qPCR reactions were verified by

melting curve analysis as well as electrophoresis using a 2% agarose gel.

Primers for col1α2 generate a 105 bp amplicon from exons 46 and 47 of the

col1α2 gene. Intron 46 - 47 of the col1α2 gene is 320 bp which would allow us to

detect the presence of genomic DNA in qPCR reactions using gel

electrophoresis. Genomic DNA contamination was not detected in qPCR

reactions.

Procollagen I Immunoblot. Myotubes were treated with different

concentrations of recombinant murine myostatin (R & D Systems) in DMEM + 1%

AbAm for 8 hours, rinsed with PBS and 0.5M EDTA, scraped and homogenized

in Laemmli's sample buffer with 1:20 β-mercaptoethanol and 1:20 protease

inhibitor cocktail (Sigma) and subsequently placed in boiling water for 5 minutes.

Protein concentration, electrophoresis and blotting occurred as described above.

Membranes were blocked in 10% powdered milk, rinsed and incubated with a

polyclonal antibody against procollagen I (Santa Cruz Biotechnology, Santa

Cruz, CA) and an HRPO conjugated secondary antibody (Pierce Biotechnology),

and developed as described above. Following detection of procollagen I,

membranes were stripped and reprobed using a monoclonal antibody against β-

tubulin (Developmental Studies Hybridoma Bank, Iowa City, IA).

Statistical Analyses. Results are presented as mean ± SEM.

KaleidaGraph 4.02 software (Synergy Software, Reading, PA) was used to

conduct statistical analyses. Differences between groups were tested using a

49

one-way ANOVA with α=0.05. Fisher's LSD post-hoc test was used to identify

specific differences when significance was detected.

Results

Morphology. The body mass, body length, tibial length, muscle mass,

absolute numbers of fibers per muscle, fiber areas, Lo, Lf, and CSA values of

EDL and soleus muscles from each of the three groups of mice are shown in

Table 2.1. Although no differences were observed for body masses or body

lengths of the MSTN+/+, MSTN+/- or MSTN-/- mice, the mean mass of the EDL

muscles of MSTN-/- mice was 66% greater than that of the MSTN+/+ mice and

51% greater than that of the MSTN+/- mice. For MSTN-/- mice, the mass of the

soleus was 36% greater soleus muscle mass than that of the MSTN+/+ mice.

Conflicting reports have been published regarding the role of myostatin in

determining the number of fibers per muscle (21, 36, 42, 47, 51, 68, 69). Each of

these reports counted the number of muscle fibers present in a cross section of

muscle. The counting of the number of fibers present in a cross section of a

muscle does not necessarily provide an accurate indication of the total number of

fibers present in that muscle (38). To address this issue, the absolute number of

fibers in muscles from MSTN+/+, MSTN+/- and MSTN-/- mice were counted. The

EDL muscles of MSTN-/- mice had 60% more muscle fibers than MSTN+/+ mice

and 39% more fibers than MSTN+/- mice, and the MSTN+/- mice had 16% more

fibers than MSTN+/+ mice (Table 2.1). For soleus muscles, MSTN-/- mice had

31% more fibers than MSTN+/+ mice and 9% more than MSTN+/- mice, and the

MSTN+/- mice had 20% more fibers than MSTN+/+ mice (Table 2.1).

50

The mean fiber areas and CSA of EDL muscles of MSTN+/- and MSTN-/-

mice were greater than MSTN+/+ mice. For soleus muscles, the mean fiber areas

and CSA of MSTN-/- mice were greater than MSTN+/+ mice (Table 2.1).

The EDL and soleus muscles of mice both originate on the proximal tibia

and run the entire length of the tibia before inserting on the phalanges or

calcaneus, respectively. No differences in the lengths of tibias of MSTN+/+,

MSTN+/- and MSTN-/- mice were observed (Table 2.1). Furthermore, the Lo and

Lf values of EDL and soleus muscles, respectively, were not different among the

three genotypes.

Collagen Content of Muscles. The amino acid hydroxyproline makes up

~14% of the dry mass of fibrillar collagens (44) and is commonly used as an

indicator of collagen content. The relative hydroxyproline content of EDL

muscles of MSTN-/- was 75% less than MSTN+/+ mice (Table 2.1 and Figure 2.1).

MSTN+/- mice had 59% less hydroxyproline than MSTN+/+ mice. For soleus

muscles, no difference was observed for the relative amounts of hydroxyproline

amongst the three genotypes (Table 2.1 and Figure 2.1).

Myostatin Mediated Type I Collagen Synthesis. The marked decrease in

the collagen content of the EDL muscles from myostatin deficient mice lead us to

hypothesize that myostatin induces the expression of type I collagen in muscle

tissue. We found a dose dependent increase in col1α2 expression (Figure 2.2)

and procollagen I protein content (Figure 2.2) of primary myotubes treated with

myostatin. Similar results were observed in C2C12 myotubes and primary

fibroblasts isolated from mouse tendon (data not shown).

51

Contractile Properties. Myostatin deficiency had a more profound impact on the

contractile properties of EDL muscles than soleus muscles (Table 2.2 and Figure

2.3). The Po of MSTN-/- mice was 34% greater than the Po of MSTN+/+ mice and

19% greater than the Po of MSTN+/- mice. MSTN+/- mice had a 13% greater Po

than MSTN+/+ mice. When Po was normalized by the CSA, MSTN-/- mice had an

18% lower value for sPo than either MSTN+/+ or MSTN+/- mice. For soleus

muscles, the Po of MSTN-/- mice was 30% greater than MSTN+/+ mice, but the

values for sPo were not different.

Contraction-Induced Injury. During lengthening contractions, the average

force developed by EDL muscles was not different, but compared with MSTN+/+

mice, the work done to lengthen the muscles was 12% and 37% less for MSTN+/-

and MSTN-/- mice, respectively (Table 2.3), indicating a decrease in the stiffness

of these muscles. After the lengthening contraction protocol (LCP), muscles

from MSTN-/- mice had a force deficit that was 15% greater than MSTN+/+ mice

(Table 2.3 and Figure 2.4). During stretches of soleus muscles, the average

force developed by MSTN-/- mice was approximately 18% greater than that of

MSTN+/+ mice. During lengthening contractions of soleus muscles, no

differences in the work done to stretch the muscles were observed. Following

the LCP, the force deficits of soleus muscles were not different.

ActRIIB Content of EDL and Soleus Muscles. The deficiency of myostatin

had a more profound impact on the morphological and contractile properties of

EDL muscles than soleus muscles. Since myostatin appears to act systemically

(71), the difference in the amount of ActRIIB present in EDL and soleus muscles

52

was determined. Compared with soleus muscles, the amount of ActRIIB was

greater in EDL muscles (Figure 2.5).

Discussion

The Po of skeletal muscle can be increased by either hypertrophy of

existing fibers or by hyperplasia. In either case, as whole muscle CSA increases,

the angle of pennation of muscle fibers (θ) also increases (38). The transmission

of the force developed by single muscle fibers from tendon to tendon along the

line of tension development of the muscle is proportional to the cosine of θ. As θ

increases from 0º to 90º, the cosine of θ decreases from 1 to 0. Therefore, as a

muscle undergoes hypertrophy or hyperplasia, the net force per CSA is expected

to decrease. Our hypothesis that myostatin deficiency would increase the Po but

decrease the sPo of muscles is supported by the observations of the contractile

properties of the EDL muscles of MSTN-/- mice. In contrast, for soleus muscles,

the complete deficiency of myostatin increased the Po less than that of the EDL

muscle and had no effect on the sPo. Furthermore, EDL muscles of MSTN+/-

mice displayed a greater Po than MSTN+/+ mice, but showed no change in sPo.

While θ was not measured directly, using a model of muscle architecture that

estimates θ based upon the number of fibers in a muscle, Lf, Lo and fiber areas

(38), compared with MSTN+/+ mice, we estimate that MSTN-/- mice had a 38%

greater θ for EDL muscles, and a 17% greater θ for soleus muscles, respectively.

The greater increase in θ for EDL than soleus muscles may explain the observed

decrease in sPo for EDL muscles and the lack of change in sPo for soleus

muscles. In terms of the magnitude of the increases in muscle CSA, mass and

53

Po, a threshold appears to exist for initiating a decrease in sPo, wherein large

increases in muscle CSA, mass and Po initiate decreases in sPo, whereas with

small increases, sPo does not change.

Following contraction-induced injury to muscles, the immediate force

deficit results from the mechanical disruption of the ultrastructure of sarcomeres

(8, 18, 33, 34). The magnitude of this force deficit is a function of strain and the

work done to stretch the contractile component (CC) of muscle (8). The

aponeurosis (intramuscular tendon) and the tendon, composed chiefly of type I

and III collagen (12, 22, 27), form the series elastic component (SEC) of muscle

(23). A positive correlation exists between the collagen content and stiffness of a

muscle (16, 19, 48). During a lengthening contraction, the total displacement of

the muscle is the sum of the displacement of the CC and the SEC, therefore

displacement of the SEC protects the CC from contraction-induced injury. During

a lengthening contraction, the protection afforded to the CC by the SEC

increases as the displacement of the SEC relative to the CC increases. Despite

this potential for protection, if the strain and work done during a lengthening

contraction are great enough, the SEC can become damaged and no longer

provide protection for the CC. Consequently, an advantageous arrangement for

a muscle is to have an SEC with a stiffness that allows for a moderate amount of

displacement during a lengthening contraction, but not too compliant as to

become damaged during a lengthening contraction. Our results suggest that for

EDL muscles, the complete deficiency of myostatin decreases the stiffness of the

54

SEC in such a way that the susceptibility to contraction-induced injury is

increased.

The effect of myostatin deficiency on the structure and function of EDL

and soleus muscles was quite different. Compared with the content of the

primary myostatin receptor, ActRIIB, in the soleus muscles of MSTN+/+ mice, the

content in the EDL muscles was ~ two-fold greater. The greater quantity of

ActRIIB in the EDL muscles of MSTN+/+ mice appeared to make the EDL

muscles more responsive than soleus muscles to the presence of myostatin.

Consequently, with the absence of myostatin in the MSTN-/- mice, the EDL

muscles experience a much greater relative increase in mass and number of

fibers than experienced by the soleus muscles.

The treatment of muscle injuries and disease often involves a two-pronged

therapeutic regimen of improving the strength of muscle and decreasing the

formation of collagenous scar tissue (13, 49). Much of the interest behind the

potential use of myostatin inhibitors is the ability of these inhibitors to enhance

the regeneration of skeletal muscle and also decrease the accumulation of scar

tissue in murine models of muscle injuries and disease (17, 40, 45, 61-63).

Myostatin inhibitors may therefore be a useful therapeutic adjunct to traditional

athletic training and physical therapy by directly improving contractility and

decreasing fibrosis. The enhanced regenerative capacity of myostatin-deficient

muscle is likely due to an increase in satellite cell activity, as myostatin is a

negative regulator of satellite cell proliferation and migration (28, 39, 40, 56, 58,

62). The increased satellite cell activity produced by the deficiency of myostatin

55

does not explain how myostatin deficiency decreases the fibrosis normally

present in dystrophic muscle (4, 5, 63) and following snake venom-induced

muscle injury (40, 62). The decreased content of collagen in otherwise healthy

myostatin-deficient muscles, along with the observation that myostatin increases

directly the expression of type I collagen in cultured muscle tissue, suggest a

direct role for myostatin in the signal transduction pathways that regulate the

collagen content of the ECM of skeletal muscle tissue.

Pharmaceutical inhibition of myostatin likely suppresses, but does not

eliminate myostatin signaling completely. The haploinsufficient MSTN+/- mouse

provides a useful model for the investigation of the effects of partial suppression

of myostatin signaling. In the present study, compared with their MSTN+/+

littermates, the EDL muscles of MSTN+/- mice developed a greater Po, but unlike

the MSTN-/- mice had no difference in sPo or force deficit after injury. The

collagen content and stiffness of the EDL muscles of MSTN+/- mice was less than

that of MSTN+/+ mice, but this did not increase the susceptibility of these muscles

to contraction-induced injury. Such a decrease in the stiffness of muscle might

be beneficial in the treatment of diseases that involve severe muscle fibrosis,

such as Duchenne muscular dystrophy (DMD). Patients with DMD suffer from

respiratory insufficiency due to impaired contractility of the diaphragm muscle

and to the increased stiffness of the diaphragm muscle (3, 64). Therefore, partial

inhibition of myostatin may provide a useful treatment for fibrotic muscle diseases

through an increase in the contractile forces and a decrease in the stiffness of

the muscles.

56

Acknowledgements

We would like to acknowledge the generosity of Dr. Se-Jin Lee for

providing transgenic mice for this study, Cheryl Hassett for providing assistance

with animal surgeries and Kimberly Gates for assistance with animal breeding.

This work was supported by grants AG13283 and AG020591 from the National

Institute on Aging. This chapter represents previously published work: Mendias

C.M., Marcin J.E., Calderon D.R., and Faulkner J.A. Contractile properties of

EDL and soleus muscles of myostatin-deficient mice. J Appl Physiol 101: 898-

905, 2006.

57

Figure 2.1. Relative hydroxyproline content of EDL (A) and soleus (B) muscles from MSTN+/+, MSTN+/- and MSTN-/- mice. (A) Compared with MSTN+/+ mice, the amount of hydroxyproline per mg of dry EDL muscle mass was less for MSTN+/- and MSTN-/- mice. (B) There was no difference in the amount of hydroxyproline per mg of dry soleus muscle mass between MSTN+/+, MSTN+/- and MSTN-/- mice. Values are means ± SE. N = 5 muscles per genotype. *Significantly different from MSTN+/+ at P < 0.05.

58

Figure 2.2. Myostatin increases (A) col1α2 expression and (B) procollagen I content of primary skeletal muscle myotubes. (A) RT-qPCR: Myostatin increases the expression of col1α2 normalized to β2m in a dose-dependant fashion. Values are means ± SE. *Significantly different from the 0 ng/mL group at P < 0.05. #Significantly different from the 10ng/mL group at P < 0.05. (B) Immunoblot: Myostatin increases the procollagen I protein content of myotubes in a dose-dependant fashion. β-tubulin is shown as a loading control.

59

Figure 2.3. Force values for EDL muscles (A, B) and soleus muscles (C,D) from MSTN+/+, MSTN+/- and MSTN-/- mice. (A) The Po of EDL muscles of MSTN-/- mice is greater than the Po of MSTN+/+ and MSTN+/- mice. (B) When Po is normalized to CSA, the sPo of EDL muscles of MSTN-/- mice is less than the sPo of MSTN+/+ and MSTN+/- mice. (C) The Po of soleus muscles of MSTN-/- mice is greater than the Po of MSTN+/+ and MSTN+/- mice. (D) When Po is normalized to CSA, there is no difference in sPo of soleus muscles. Values are means ± SE. N = 6 muscles per genotype. *Significantly different from MSTN+/+ at P < 0.05. #Significantly different from MSTN+/- at P < 0.05.

60

Figure 2.4. Force deficits following contraction-induced injury to EDL muscles (A) and soleus muscles (B). (A) Muscles from MSTN-/- mice had a force deficit that was greater than MSTN+/+ mice after the first lengthening contraction, and a force deficit that was greater than MSTN+/+ and MSTN+/- mice after the second lengthening contraction. (B) There was no difference in the force deficits between soleus muscles following the lengthening contractions. LC = Lengthening contraction. Values are means ± SE. N = 6 muscles per genotype. *Significantly different from MSTN+/+ at P < 0.05. #Significantly different from MSTN+/- at P < 0.05.

61

Figure 2.5. ActRIIB protein content of EDL and soleus muscles from MSTN+/+ mice. Compared with soleus muscles, the amount of ActRIIB protein is greater in EDL muscles (immunoblot). Sarcomeric myosin proteins are shown as loading controls (Coomassie Brilliant Blue staining).

62

MSTN+/+ MSTN+/- MSTN-/- Body Mass (g) 32.39±1.32 36.63±1.11 35.01±1.27 Body Length (mm) 93.33±0.53 95.00±0.59 92.75±0.92 Tibia Length (mm) 17.91±0.10 17.74±0.13 18.07±0.15 EDL Muscles Wet Mass (mg) 11.62±0.29 12.82±0.25* 19.32±0.52*# Fibers per muscle 1462±12 1693±58* 2351±87*# Fiber area (µm2) 1231.12±28.64 1315.38±24.55* 1512.14±29.00*# Lo (mm) 13.13±0.43 12.78±0.22 13.38±0.23 Lf (mm) 5.78±0.19 5.63±0.10 5.89±0.10 CSA (mm2) 1.90±0.04 2.15±0.05* 3.10±0.07*# Hyp / Muscle Mass (µg/mg) 1.90±0.14 0.77±0.09* 0.47±0.08* Soleus Muscles Wet Mass (mg) 10.45±0.44 11.97±0.78 14.22±0.73* Fibers per muscle 985±37 1185±33* 1292±34*# Fiber area (µm2) 1148.99±20.89 1162.28±20.66 1316.45±36.12*# Lo (mm) 12.42±0.30 12.55±0.25 12.98±0.46 Lf (mm) 8.82±0.21 8.91±0.18 9.22±0.33 CSA (mm2) 1.12±0.06 1.27±0.07 1.45±0.03* Hyp / Muscle Mass (µg/mg) 0.71±0.10 0.61±0.09 0.54±0.09 Table 2.1. Anatomical properties of animals. Values are means ± SE. N = 12 for tibia length and body length. N = 300 fibers from 3 muscles for each genotype. N = 5 muscles per genotype for fibers per muscle and hydroxyproline. N = 6 muscles per genotype for all other values. *Significantly different from MSTN+/+ at P < 0.05. #Significantly different from MSTN+/- at P < 0.05.

63

MSTN+/+ MSTN+/- MSTN-/- EDL Muscles Pt (mN) 110.78±4.84 136.76±12.33 160.87±8.07* sPt (mN/mm2) 58.20±1.75 63.27±5.10 52.25±3.38 TTPT (ms) 23.68±2.80 20.91±1.32 23.86±2.46 ½RT (ms) 22.56±1.48 20.80±1.02* 15.51±0.25*# dP/dt (mN/ms) 13.07±0.05 15.64±1.29 19.00±1.24*# Po (mN) 461.19±14.69 520.53±18.48* 616.93±17.10*# sPo (mN/mm2) 243.32±10.04 242.12±8.22 199.86±7.37*# Soleus Muscles Pt (mN) 47.12±2.78 60.43±5.00 65.52±5.85* sPt (mN/mm2) 42.08±1.90 47.51±2.30 45.06±3.81 TTPT (ms) 40.61±4.68 32.41±0.99 27.38±3.75 ½RT (ms) 50.10±5.42 47.55±2.13 37.57±1.92 dP/dt (mN/ms) 4.20±0.21 4.91±0.33 6.08±0.80 Po (mN) 295.84±7.49 324.94±18.52 385.06±17.57*# sPo (mN/mm2) 265.81±10.10 257.15±6.34 264.84±8.50 Table 2.2. Contractile Properties of EDL and Soleus Muscles. Values are means ± SE. N = 6 muscles per genotype. Pt = peak twitch force; sPt = specific Pt; TTPT = time to peak twitch tension; ½RT = half-relaxation time; dP/dt = maximum rise in tension. *Significantly different from MSTN+/+ at P < 0.05. #Significantly different from MSTN+/- at P < 0.05.

64

MSTN+/+ MSTN+/- MSTN-/- EDL Muscles Stretch 1 Average Force (mN) 648.07±8.21 644.48±15.74 664.56±8.63 Work (J/kg) 129.00±3.66 113.05±1.85* 81.31±2.65*# Force Deficit (% of Pre-injury Po) 15.74±0.81 18.19±2.78 24.14±3.03* Stretch 2 Average Force (mN) 631.03±8.43 632.78±14.93 651.86±9.00 Work (J/kg) 125.58±3.39 111.01±1.76* 79.76±2.65*# Force Deficit (% of Pre-injury Po) 30.10±1.71 29.59±2.46 45.23±6.52*# Soleus Muscles Stretch 1 Average Force (mN) 509.53±26.93 537.37±33.60 620.89±28.49* Work (J/kg) 173.21±11.68 160.60±5.56 161.15±5.39 Force Deficit (% of Pre-injury Po) 18.21±3.63 19.18±4.38 18.60±2.52 Stretch 2 Average Force (mN) 455.83±14.49 480.13±29.67 569.29±31.98*# Work (J/kg) 154.89±8.35 143.33±3.96 147.60±6.21 Force Deficit (% of Pre-injury Po) 20.68 ± 4.93 20.21 ± 3.45 25.08 ± 3.76 Table 2.3. Mechanical Injury of EDL and Soleus Muscles. Values are means ± SE. N = 6 muscles per genotype. *Significantly different from MSTN+/+ at P < 0.05. #Significantly different from MSTN+/- at P < 0.05.

65

References

1. Allen RE, Temm-Grove CJ, Sheehan SM, and Rice G. Skeletal muscle satellite cell cultures. Methods Cell Biol 52: 155-176, 1997. 2. Amthor H, Nicholas G, McKinnell I, Kemp CF, Sharma M, Kambadur R, and Patel K. Follistatin complexes Myostatin and antagonises Myostatin-mediated inhibition of myogenesis. Dev Biol 270: 19-30, 2004. 3. Bernasconi P, Torchiana E, Confalonieri P, Brugnoni R, Barresi R, Mora M, Cornelio F, Morandi L, and Mantegazza R. Expression of transforming growth factor-beta 1 in dystrophic patient muscles correlates with fibrosis. Pathogenetic role of a fibrogenic cytokine. J Clin Invest 96: 1137-1144, 1995. 4. Bogdanovich S, Krag TO, Barton ER, Morris LD, Whittemore LA, Ahima RS, and Khurana TS. Functional improvement of dystrophic muscle by myostatin blockade. Nature 420: 418-421, 2002. 5. Bogdanovich S, Perkins KJ, Krag TO, Whittemore LA, and Khurana TS. Myostatin propeptide-mediated amelioration of dystrophic pathophysiology. Faseb J 19: 543-549, 2005. 6. Brooks SV and Faulkner JA. Contractile properties of skeletal muscles from young, adult and aged mice. J Physiol 404: 71-82, 1988. 7. Brooks SV and Faulkner JA. The magnitude of the initial injury induced by stretches of maximally activated muscle fibres of mice and rats increases in old age. J Physiol 497 ( Pt 2): 573-580, 1996. 8. Brooks SV, Zerba E, and Faulkner JA. Injury to muscle fibres after single stretches of passive and maximally stimulated muscles in mice. J Physiol 488 ( Pt 2): 459-469, 1995. 9. Byron CD, Hamrick MW, and Wingard CJ. Alterations of temporalis muscle contractile force and histological content from the myostatin and Mdx deficient mouse. Arch Oral Biol, 2005. 10. Carlson CJ, Booth FW, and Gordon SE. Skeletal muscle myostatin mRNA expression is fiber-type specific and increases during hindlimb unloading. Am J Physiol 277: R601-606, 1999. 11. Consolino CM and Brooks SV. Susceptibility to sarcomere injury induced by single stretches of maximally activated muscles of mdx mice. J Appl Physiol 96: 633-638, 2004. 12. Contri MB, Guerra D, Vignali N, Taparelli F, Marcuzzi A, Caroli A, and Ronchetti IP. Ultrastructural and immunocytochemical study on normal human palmar aponeuroses. Anat Rec 240: 314-321, 1994. 13. Delforge G. Musculoskeletal Trauma : implications for sports injury management. Champaign, IL: Human Kinetics, 2002. 14. Dellorusso C, Crawford RW, Chamberlain JS, and Brooks SV. Tibialis anterior muscles in mdx mice are highly susceptible to contraction-induced injury. J Muscle Res Cell Motil 22: 467-475, 2001. 15. Donovan CM and Faulkner JA. Muscle grafts overloaded by ablation of synergistic muscles. J Appl Physiol 61: 288-292, 1986.

66

16. Ducomps C, Mauriege P, Darche B, Combes S, Lebas F, and Doutreloux JP. Effects of jump training on passive mechanical stress and stiffness in rabbit skeletal muscle: role of collagen. Acta Physiol Scand 178: 215-224, 2003. 17. Engvall E and Wewer UM. The new frontier in muscular dystrophy research: booster genes. Faseb J 17: 1579-1584, 2003. 18. Friden J and Lieber RL. Segmental muscle fiber lesions after repetitive eccentric contractions. Cell Tissue Res 293: 165-171, 1998. 19. Gosselin LE, Adams C, Cotter TA, McCormick RJ, and Thomas DP. Effect of exercise training on passive stiffness in locomotor skeletal muscle: role of extracellular matrix. J Appl Physiol 85: 1011-1016, 1998. 20. Grobet L, Martin LJ, Poncelet D, Pirottin D, Brouwers B, Riquet J, Schoeberlein A, Dunner S, Menissier F, Massabanda J, Fries R, Hanset R, and Georges M. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nat Genet 17: 71-74, 1997. 21. Grobet L, Pirottin D, Farnir F, Poncelet D, Royo LJ, Brouwers B, Christians E, Desmecht D, Coignoul F, Kahn R, and Georges M. Modulating skeletal muscle mass by postnatal, muscle-specific inactivation of the myostatin gene. Genesis 35: 227-238, 2003. 22. Hanyu T, Tajima T, Takagi T, Sasaki S, Fujimoto D, Isemura M, and Yosizawa Z. Biochemical studies on the collagen of the palmar aponeurosis affected with Dupuytren's disease. Tohoku J Exp Med 142: 437-443, 1984. 23. Huijing P. Muscular force transmission: a unified, dual or multiple system? A review and some explorative experimental results. Arch Physiol Biochem 107: 292-311, 1999. 24. Kambadur R, Sharma M, Smith TP, and Bass JJ. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Res 7: 910-916, 1997. 25. Kandarian SC and White TP. Mechanical deficit persists during long-term muscle hypertrophy. J Appl Physiol 69: 861-867, 1990. 26. Khurana TS and Davies KE. Pharmacological strategies for muscular dystrophy. Nat Rev Drug Discov 2: 379-390, 2003. 27. Kjaer M. Role of extracellular matrix in adaptation of tendon and skeletal muscle to mechanical loading. Physiol Rev 84: 649-698, 2004. 28. Langley B, Thomas M, Bishop A, Sharma M, Gilmour S, and Kambadur R. Myostatin inhibits myoblast differentiation by down-regulating MyoD expression. J Biol Chem 277: 49831-49840, 2002. 29. Lee SJ and McPherron AC. Regulation of myostatin activity and muscle growth. Proc Natl Acad Sci U S A 98: 9306-9311, 2001. 30. Lesch M, Parmley WW, Hamosh M, Kaufman S, and Sonnenblick EH. Effects of acute hypertrophy on the contractile properties of skeletal muscle. Am J Physiol 214: 685-690, 1968. 31. Light N and Champion AE. Characterization of muscle epimysium, perimysium and endomysium collagens. Biochem J 219: 1017-1026, 1984. 32. Livak KJ and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-408, 2001.

67

33. Macpherson PC, Dennis RG, and Faulkner JA. Sarcomere dynamics and contraction-induced injury to maximally activated single muscle fibres from soleus muscles of rats. J Physiol 500 ( Pt 2): 523-533, 1997. 34. Macpherson PC, Schork MA, and Faulkner JA. Contraction-induced injury to single fiber segments from fast and slow muscles of rats by single stretches. Am J Physiol 271: C1438-1446, 1996. 35. Mahoney DJ, Carey K, Fu MH, Snow R, Cameron-Smith D, Parise G, and Tarnopolsky MA. Real-time RT-PCR analysis of housekeeping genes in human skeletal muscle following acute exercise. Physiol Genomics 18: 226-231, 2004. 36. Martyn JK, Bass JJ, and Oldham JM. Skeletal muscle development in normal and double-muscled cattle. Anat Rec A Discov Mol Cell Evol Biol 281: 1363-1371, 2004. 37. Matsakas A, Friedel A, Hertrampf T, and Diel P. Short-term endurance training results in a muscle-specific decrease of myostatin mRNA content in the rat. Acta Physiol Scand 183: 299-307, 2005. 38. Maxwell LC, Faulkner JA, and Hyatt GJ. Estimation of number of fibers in guinea pig skeletal muscles. J Appl Physiol 37: 259-264, 1974. 39. McCroskery S, Thomas M, Maxwell L, Sharma M, and Kambadur R. Myostatin negatively regulates satellite cell activation and self-renewal. J Cell Biol 162: 1135-1147, 2003. 40. McCroskery S, Thomas M, Platt L, Hennebry A, Nishimura T, McLeay L, Sharma M, and Kambadur R. Improved muscle healing through enhanced regeneration and reduced fibrosis in myostatin-null mice. J Cell Sci 118: 3531-3541, 2005. 41. McMahon CD, Popovic L, Oldham JM, Jeanplong F, Smith HK, Kambadur R, Sharma M, Maxwell L, and Bass JJ. Myostatin-deficient mice lose more skeletal muscle mass than wild-type controls during hindlimb suspension. Am J Physiol Endocrinol Metab 285: E82-87, 2003. 42. McPherron AC, Lawler AM, and Lee SJ. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387: 83-90, 1997. 43. Mendler L, Zador E, Ver Heyen M, Dux L, and Wuytack F. Myostatin levels in regenerating rat muscles and in myogenic cell cultures. J Muscle Res Cell Motil 21: 551-563, 2000. 44. Neuman RE and Logan MA. The determination of hydroxyproline. J Biol Chem 184: 299-306, 1950. 45. Patel K and Amthor H. The function of Myostatin and strategies of Myostatin blockade-new hope for therapies aimed at promoting growth of skeletal muscle. Neuromuscul Disord 15: 117-126, 2005. 46. Philip B, Lu Z, and Gao Y. Regulation of GDF-8 signaling by the p38 MAPK. Cell Signal 17: 365-375, 2005. 47. Pirottin D, Grobet L, Adamantidis A, Farnir F, Herens C, Daa Schroder H, and Georges M. Transgenic engineering of male-specific muscular hypertrophy. Proc Natl Acad Sci U S A 102: 6413-6418, 2005. 48. Prado LG, Makarenko I, Andresen C, Kruger M, Opitz CA, and Linke WA. Isoform diversity of giant proteins in relation to passive and active contractile properties of rabbit skeletal muscles. J Gen Physiol 126: 461-480, 2005.

68

49. Prentice WE. Rehabilitation techniques in sports medicine and athletic training. New York: McGraw-Hill, 2004. 50. Rebbapragada A, Benchabane H, Wrana JL, Celeste AJ, and Attisano L. Myostatin signals through a transforming growth factor beta-like signaling pathway to block adipogenesis. Mol Cell Biol 23: 7230-7242, 2003. 51. Rehfeldt C, Ott G, Gerrard DE, Varga L, Schlote W, Williams JL, Renne U, and Bunger L. Effects of the Compact mutant myostatin allele Mstn (Cmpt-dl1Abc) introgressed into a high growth mouse line on skeletal muscle cellularity. J Muscle Res Cell Motil, 2005. 52. Reisz-Porszasz S, Bhasin S, Artaza JN, Shen R, Sinha-Hikim I, Hogue A, Fielder TJ, and Gonzalez-Cadavid NF. Lower skeletal muscle mass in male transgenic mice with muscle-specific overexpression of myostatin. Am J Physiol Endocrinol Metab 285: E876-888, 2003. 53. Roth SM and Walsh S. Myostatin: a therapeutic target for skeletal muscle wasting. Curr Opin Clin Nutr Metab Care 7: 259-263, 2004. 54. Schuelke M, Wagner KR, Stolz LE, Hubner C, Riebel T, Komen W, Braun T, Tobin JF, and Lee SJ. Myostatin mutation associated with gross muscle hypertrophy in a child. N Engl J Med 350: 2682-2688, 2004. 55. Sharma M, Langley B, Bass J, and Kambadur R. Myostatin in muscle growth and repair. Exerc Sport Sci Rev 29: 155-158, 2001. 56. Taylor WE, Bhasin S, Artaza J, Byhower F, Azam M, Willard DH, Jr., Kull FC, Jr., and Gonzalez-Cadavid N. Myostatin inhibits cell proliferation and protein synthesis in C2C12 muscle cells. Am J Physiol Endocrinol Metab 280: E221-228, 2001. 57. Thies RS, Chen T, Davies MV, Tomkinson KN, Pearson AA, Shakey QA, and Wolfman NM. GDF-8 propeptide binds to GDF-8 and antagonizes biological activity by inhibiting GDF-8 receptor binding. Growth Factors 18: 251-259, 2001. 58. Thomas M, Langley B, Berry C, Sharma M, Kirk S, Bass J, and Kambadur R. Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation. J Biol Chem 275: 40235-40243, 2000. 59. Tobin JF and Celeste AJ. Myostatin, a negative regulator of muscle mass: implications for muscle degenerative diseases. Curr Opin Pharmacol 5: 328-332, 2005. 60. Verrecchia F and Mauviel A. TGF-beta and TNF-alpha: antagonistic cytokines controlling type I collagen gene expression. Cell Signal 16: 873-880, 2004. 61. Wagner KR. Muscle regeneration through myostatin inhibition. Curr Opin Rheumatol 17: 720-724, 2005. 62. Wagner KR, Liu X, Chang X, and Allen RE. Muscle regeneration in the prolonged absence of myostatin. Proc Natl Acad Sci U S A 102: 2519-2524, 2005. 63. Wagner KR, McPherron AC, Winik N, and Lee SJ. Loss of myostatin attenuates severity of muscular dystrophy in mdx mice. Ann Neurol 52: 832-836, 2002.

69

64. Wanke T, Toifl K, Merkle M, Formanek D, Lahrmann H, and Zwick H. Inspiratory muscle training in patients with Duchenne muscular dystrophy. Chest 105: 475-482, 1994. 65. Whittemore LA, Song K, Li X, Aghajanian J, Davies M, Girgenrath S, Hill JJ, Jalenak M, Kelley P, Knight A, Maylor R, O'Hara D, Pearson A, Quazi A, Ryerson S, Tan XY, Tomkinson KN, Veldman GM, Widom A, Wright JF, Wudyka S, Zhao L, and Wolfman NM. Inhibition of myostatin in adult mice increases skeletal muscle mass and strength. Biochem Biophys Res Commun 300: 965-971, 2003. 66. Woessner JF, Jr. The determination of hydroxyproline in tissue and protein samples containing small proportions of this imino acid. Arch Biochem Biophys 93: 440-447, 1961. 67. Wolfman NM, McPherron AC, Pappano WN, Davies MV, Song K, Tomkinson KN, Wright JF, Zhao L, Sebald SM, Greenspan DS, and Lee SJ. Activation of latent myostatin by the BMP-1/tolloid family of metalloproteinases. Proc Natl Acad Sci U S A 100: 15842-15846, 2003. 68. Yang J, Ratovitski T, Brady JP, Solomon MB, Wells KD, and Wall RJ. Expression of myostatin pro domain results in muscular transgenic mice. Mol Reprod Dev 60: 351-361, 2001. 69. Zhu X, Hadhazy M, Wehling M, Tidball JG, and McNally EM. Dominant negative myostatin produces hypertrophy without hyperplasia in muscle. FEBS Lett 474: 71-75, 2000. 70. Zhu X, Topouzis S, Liang LF, and Stotish RL. Myostatin signaling through Smad2, Smad3 and Smad4 is regulated by the inhibitory Smad7 by a negative feedback mechanism. Cytokine 26: 262-272, 2004. 71. Zimmers TA, Davies MV, Koniaris LG, Haynes P, Esquela AF, Tomkinson KN, McPherron AC, Wolfman NM, and Lee SJ. Induction of cachexia in mice by systemically administered myostatin. Science 296: 1486-1488, 2002.

70

Chapter III

Tendons of Myostatin-Deficient Mice are Small, Brittle and Hypocellular Abstract

Tendons play a significant role in the modulation of forces transmitted

between bones and skeletal muscles and consequently protect muscle fibers

from contraction-induced, or high strain, injuries. Myostatin (GDF-8) is a

negative regulator of muscle mass. Inhibition of myostatin not only increases the

mass and maximum isometric force of muscles, but also increases the

susceptibility of muscle fibers to contraction-induced injury. Furthermore, the

expression of myostatin and the myostatin receptors, ACVR2B and ACVRB,

were detectable in the tendons. We hypothesized that myostatin would regulate

the morphology and mechanical properties of tendons. Surprisingly, compared

with wild type (MSTN+/+) mice, the tendons of myostatin-null mice (MSTN-/-) were

smaller, had a decrease in fibroblast density and a decrease in the expression of

type I collagen. Tendons of MSTN-/- mice also had a decrease in the expression

of two genes that promote tendon fibroblast proliferation, scleraxis and

tenomodulin. Treatment of tendon fibroblasts with myostatin activated the p38

MAPK and Smad2/3 signaling cascades, increased cell proliferation and

increased the expression of type I collagen, scleraxis and tenomodulin.

Compared with the tendons of MSTN+/+ mice, the mechanical properties of tibialis

71

anterior tendons from MSTN-/- mice had a greater peak stress, lower peak strain

and a increased stiffness. We conclude that in addition to the regulation of

muscle mass and force, myostatin regulates the structure and function of tendon

tissues.

Introduction

Tendons are a critical component of the musculoskeletal system.

Situated, as tendons are, between bones and skeletal muscles, tendons are in a

position to transmit forces generated within skeletal muscle fibers to bone and

conversely transmit to skeletal muscle external loads placed on bone. The

extracellular matrix (ECM) of tendon tissue is composed primarily of type I

collagen, as well as type III collagen, elastin and various proteoglycans and

mucopolysaccharides. Tendons are in series with both the contractile and non-

contractile elements of skeletal muscles as well as with bone. Consequently,

tendons are able to both store elastic energy during locomotion and protect

muscle fibers from stretch-induced and contraction-induced injuries (15, 28).

While considerable research has been conducted on the effects of exercise,

immobilization and aging on the structure and function of tendons (19, 20), much

less is known about the specific cytokines that regulate the structure and function

of tendons.

During embryonic development of the limb, early tendon development can

be categorized into three phases, with each phase corresponding to an

upregulation of the bHLH transcription factor scleraxis (13, 40). Scleraxis is a

marker of the tendon cell lineage (38, 40) and mice deficient in scleraxis display

72

severe tendon defects, have impaired locomotion and a complete inability to use

their tails (34). Scleraxis promotes the formation of tendon ECM by inducing the

expression of type I collagen (23) and increases tendon fibroblast proliferation by

the upregulation of the expression of the type II transmembrane protein,

tenomodulin (41). During the final stages of early tendon development, FGF-4

and FGF-8, are secreted by adjacent myogenic cells and induce the expression

of scleraxis (5, 14). While FGF-4 and FGF-8 can induce scleraxis expression in

the final phase of early tendon development, they do not appear to be

responsible for the first and second phases of scleraxis expression (13). In fact,

another member of the GDF family may be a candidate for the regulation of

scleraxis expression during the first and second phases of early tendon

development (13), but the specific member of the GDF family has not been

identified.

Three members of the GDF family have been reported to influence the

development of tendon tissue. The placement of matrices coated with GDF-5,

GDF-6 and GDF-7 into skeletal muscle induce the ectopic formation of tendon-

like tissue (50). The tendons of GDF5-/- mice are smaller and display decreases

in type I collagen content, peak stress, stiffness and energy absorption to yield

(32). The GDF5-/- mice also have severe bone and joint defects (32), but

whether these changes in tendon mechanical properties arise due to a direct

effect of GDF-5 on tendon cells or the associated skeletal defects is not clear.

Compared with wild type mice, GDF7-/- mice have a minor tendon phenotype,

with a decrease in proteoglycan content and smaller collagen fibrils, but no

73

differences in Achilles tendon mechanical properties, type I collagen content, or

gross morphology (31). Some evidence supports roles for GDF-5, GDF-6 and

GDF-7 in tendon development, but whether other members of the GDF family

influence tendon development has not been established.

Myostatin (GDF-8) is a member of the TGF-ß superfamily of cytokines and

is a negative regulator of skeletal muscle mass. Myostatin binds to the activin

type IIB (ACVR2B) and type IB (ACVRB) receptors and activates the Smad2/3,

p38 MAPK and Erk1/2 signal transduction pathways (22, 37, 39, 51, 53).

Myostatin regulates muscle mass by inhibiting the proliferation and differentiation

of satellite cells (21, 26, 45), in addition to decreasing myofibrillar protein

synthesis (49) and increasing the expression of the E3 ubiquitin ligase atrogin-

1/MAFbx (27). Myostatin has a well established role in regulation of the structure

and function of skeletal muscle, but the contribution of myostatin to the regulation

of the structure and function of tendon has not been established.

In addition to the regulation of muscle mass, myostatin has a profound

impact on the contractile properties of skeletal muscles. Inhibition of myostatin

increases the maximum isometric force of skeletal muscles (3, 4, 30) and the

susceptibility of muscles to contraction-induced injury (30). During a lengthening

contraction, the series elastic component (aponeurosis and tendon) of a muscle

protects muscle fibers from damage by reducing the strain on fibers (15). The

MSTN-/- mice are much more susceptible to contraction-induced injury than the

MSTN+/+ mice, an observation that is consistent with the possibility that myostatin

might play a role in the regulation of the structural and functional properties of the

74

tendons. Our prior study (30) focused on the mechanical and contractile

properties of the muscle and aponeurosis, but did not investigate the mechanical

properties of the tendons of MSTN-/- mice directly. The overall aim of this

investigation was to determine the role of myostatin in regulation of the

mechanical and morphological properties of tendons. We hypothesized that a

deficiency in myostatin results in smaller, stiffer, and more brittle tendons.

Methods

Animals. All experiments were conducted in accordance with the

guidelines of the University of Michigan Committee on the Use and Care of

Animals. Mice were housed in specific-pathogen-free conditions and were

provided food and water ad libidum. The line of MSTN-/- mice used in this study

are of a C57Bl/6 background and were a kind gift of Dr. Se-Jin Lee. The null

MSTN allele was generated by replacing a portion of the third exon of the MSTN

gene that encodes the C-terminal region of the mature myostatin protein with a

neo cassette (29). The wild type (MSTN+/+) littermates of the MSTN-/- mice

served as controls. The genotype of mice was determined by PCR-based

analysis of DNA samples obtained via tail biopsy.

Mechanical Testing of Tendons. To evaluate the mechanical properties of

the tibialis anterior tendon, the entire tendon unit (from the myotendinous junction

to the base of the first metatarsal bone) was used. The tibialis anterior tendon

was chosen based on its relative uniformity of diameter, minimal aponeurosis

and long gauge length (2). Six month old male mice were anesthetized with

intraperitoneal injection of Avertin (400 mg/kg). Braded silk sutures were tied

75

around the distal end of the tibialis anterior muscle just superior to the

myotendinous junction and at the very distal end of the tendon, just superior to

the first metatarsal. The length (Lo) of the tibialis anterior tendon was measured

using digital calipers while the ankle was placed in maximal plantarflexion. The

tendon was removed by cutting the muscle just superior to the proximal suture

and by removing the first metatarsal bone that was inferior to the distal suture.

The tendon was immediately submerged in PBS maintained at 25º C. The

tendon was held at Lo and cross-sectional area (CSA) was calculated from 10

evenly spaced width and depth measurements from high resolution digital

photographs of both top and side views of the tendon. Side views were obtained

using a 90º prism embedded in the side of the bath. These measurements were

fitted to an ellipse and the ellipse area was used as the tendon CSA.

The proximal end of the tendon was attached to a dual-mode servo

motor/force transducer (model 305C, Aurora Scientific) and the distal end was

attached to a fixed post. Custom designed software (LabVIEW 7.1, National

Instruments) controlled the servo motor motion and recorded force and strain

data at a sampling rate of 20 kHz. The tendon was stretched to a 100% strain

relative to Lo at a velocity of 1 Lo × s-1. Peak stress was defined as the stress

that further increases in length resulted in a rupture of the tendon or the point at

which yield strength had been reached without a frank rupture of the tendon.

Peak strain was defined as the strain at which peak stress was reached. The

data were fitted by either a fourth or fifth order polynomial function with an R2 ≥

0.9995. Peak tendon stiffness was calculated by differentiating the fitted

76

polynomial and then determining its maximum value between Lo and peak strain.

Average tendon stiffness was calculated as the mean value of the differentiated

polynomial between Lo and peak strain. The energy absorption to the yield point

was calculated by integrating the force-displacement function from Lo through

peak strain and normalizing this value by the mass of the tendon.

Histology. To determine the density of fibroblasts in tendon tissue, tibialis

anterior tendons were removed from 6 month old anesthetized mice, placed in

embedding media and snap frozen in using isopentane cooled with dry ice.

Sections were obtained from the proximal, middle and distal thirds of the tendon

and stained with hematoxylin and eosin. Fibroblast density for the entire tendon

was calculated by taking the mean value of the counts from each of the three

regions of the tendon.

Tendon Fibroblast Isolation, Culture And Treatment With Myostatin.

Hindlimb and forelimb tendons were isolated from anesthetized 4 month old male

MSTN+/+ mice, carefully trimmed of muscle and fat tissue, finely minced and

placed in DMEM + 0.05% Type II Collagenase (Invitrogen) in a shaking water

bath for 2 h at 37º C. Following dissociation, fibroblasts were pelleted by

centrifugation, resuspended in DMEM + 2% fetal bovine serum (FBS) + 1%

antibiotic-antimycotic (AbAm) and expanded in 100 mm culture dishes coated

with type I collagen (BD Biosciences). Fibroblasts were passaged twice upon

reaching 70% confluence. Following the last passage, 2 × 104 fibroblasts were

plated in 35 mm culture dishes coated with type I collagen and expanded until

reaching 80% confluence. Fibroblasts were then starved of serum for 24 hours

77

prior to treatment by replacing serum containing media with DMEM + 1% AbAm

+ 1× Insulin-Transferrin-Selenium supplement (ITS, Invitrogen). Recombinant

murine myostatin, produced in NS0 mouse myeloma cells (R & D Systems), was

dissolved into the serum-free media at a final concentration of 500 or 1000

ng/mL. Stock solutions of the p38 MAPK inhibitor SB-203580 (10) and the

Smad2/3 inhibitor SB-431542 (17) were prepared by dissolving these solid

anhydrous compounds in DMSO at a concentration of 10mM. These stock

solutions were then added to serum-free media containing 1% DMSO at a final

concentration of 10µM for SB-203580 and 5µM for SB-431542. Fibroblasts were

pretreated with SB-203580 or SB-431542 for 1 hour prior to treatment with

myostatin.

Cell Proliferation and Immunocytochemistry. Following serum starvation,

fibroblasts were incubated in serum free media containing 20µM of the thymidine

analog 5-bromo-2′-deoxyuridine (BrdU, Sigma) for 3 hours. Fibroblasts were

rinsed twice with serum free media and treated with myostatin, SB-203580 and

SB-431542 as described above. Following 24 hours of treatment, fibroblasts

were rinsed with PBS, fixed in ice cold methanol and permeabilized with 0.5%

Triton X-100. The BrdU epitope was exposed by digesting DNA with 200U/mL of

EcoRI and denaturing DNA with 2N HCl. BrdU was visualized using an anti-

BrdU antibody (G3G4, SJ Kaufman, Developmental Studies Hybridoma Bank)

and a Cy3-conjugated secondary antibody (Jackson ImmunoResearch). DAPI

(Sigma) was used as a non-specific nuclear stain. Twenty five random fields

78

were counted per dish. Cell proliferation data presented are the mean ± SE

values of three independent experiments.

RT-PCR. RNA was isolated from samples using an RNeasy Mini Kit

(Qiagen). When isolating RNA from whole tendons, the tissue was treated with

type II collagenase and proteinase K prior to vigorous homogenization in

guanidine thiocyanate buffer. Due to the smaller size of the tibialis anterior

tendons, we were unable to consistently obtain adequate quantities of RNA

with an A260/A280 ratio between 1.8 and 2.0. We instead used RNA from Achilles

tendons, as we were able to obtain RNA with A260/A280 ratios between 1.8 and

2.0 from these tendons. RNA was treated with DNase I and reverse

transcribed using an Omniscript RT kit (Qiagen) and oligo(dT)15 primers.

Primers for PCR reactions (Table 3.1) were designed to generate amplicons that

span multiple exons. For standard PCR, 250ng of cDNA underwent 42 rounds of

amplification using GoTaq Green (Promega). PCR products were separated

using a 2% agarose gel. For real-time PCR, cDNA was amplified using a

QuantiTect SYBR Green I PCR system (Qiagen) with Uracil-N-Glycosylase

(Invitrogen) in an Opticon 2 real-time thermal cycler (Bio-Rad). qPCR reactions

were conducted in quadruplicate for each sample. We used the methods of

Livak and Schmittgen (25) to determine optimal loading quantities of cDNA and

in the validation of GAPDH as a housekeeping gene. Gene expression was

normalized to GAPDH expression using the 2-ΔΔC(t) method (25). The presence of

single amplicons from qPCR reactions was verified by melting curve analysis as

79

well as electrophoresis using a 2% agarose gel. qPCR data presented is the

combined means ± SE of three independent experiments.

Immunoblot. Tendon fibroblasts, prepared as described above and

starved of serum for 24 hours, were treated for two hours with myostatin, SB-

203580 and SB-431542 for 2 hours. Following treatment, cells were rinsed with

PBS and scraped and homogenized in Laemmli's sample buffer with 1:20 ß-

mercaptoethanol, 1:20 protease inhibitor cocktail (Sigma) and 1:40 phosphatase

inhibitor cocktail (Sigma), and then placed in boiling water for 5 minutes. Protein

concentration of the samples was determined using an RC DC Protein Assay

(Bio-Rad). Equal amounts of protein were loaded into polyacrylamide gels and

subjected to electrophoresis using a 4% stacking, 10% resolving gel. Proteins

were transferred to a 0.45 µm nitrocellulose membrane, stained with Ponceau S

to verify equal protein transfer and blocked using casein (Vector Labs).

Antibodies against p38 MAPK and phospho-p38 MAPK were purchased from

Cell Signaling. Primary antibodies against Smad2/3 and phospho-Smad2/3 were

purchased from Millipore. Biotinylated secondary antibodies were purchased

from Pierce Biotechnology. Avidin-HRPO conjugates were purchased from

Vector Labs. Membranes were developed using SuperSignal West Dura

enhanced chemiluminescent reagents (Pierce Biotechnology) and visualized

using a FluorChem chemiluminescent documentation system (Alpha Innotech).

Statistical Analysis. Results are presented as means ± SE. KaleidaGraph 4.02

software was used to conduct statistical tests. For gene expression and cell

proliferation data from cell culture experiments, differences between groups were

80

tested with a one-way ANOVA with α = 0.05. Fisher’s least significant post hoc

test was used to identify specific differences when significance was tested. For

all other data, differences between MSTN+/+ and MSTN-/- mice was tested with

Student’s t-test with α = 0.05.

Results

MSTN-/- mice have greater muscle masses but smaller tendons. We first

determined the impact of myostatin deficiency on the mass of tendons. Although

the mass of the tibialis anterior (TA) muscles of MSTN-/- mice were 72% greater

than MSTN+/+ mice, the TA tendons of the MSTN-/- mice were 40% smaller

(Table 3.2). When the tendon mass was normalized by the muscle mass, the

MSTN-/- mice had a 64% decrease in the tendon/muscle mass ratio. Similar

results were observed for soleus muscles and Achilles tendons. The mass of the

soleus muscles of MSTN-/- mice were 82% greater than MSTN+/+ mice, but the

Achilles tendons of the soleus muscles of MSTN-/- mice were 44% smaller than

those of MSTN+/+ mice. Consequently, for MSTN-/- mice the Achilles

tendon/soleus muscle mass ratio was decreased by 69%. Furthermore, for the

MSTN-/- mice, the CSA of the TA tendons were 50% smaller than those of the

MSTN+/+ mice (Table 3.3). The lengths and densities of the TA tendons of

MSTN-/- and MSTN+/+mice were not different. CSA and the lengths and densities

of Achilles tendons were not determined, as the Achilles tendons were not used

in testing of mechanical properties.

Tendon fibroblasts express the myostatin receptors and activate the p38

MAPK and Smad2/3 signaling pathways in response to myostatin treatment.

81

Subsequently, the expression of the myostatin receptors, ACVR2B and ACVRB,

was examined in tendon fibroblasts. Transcripts for both ACVR2B and ACVRB

were identified in whole tendon tissue, as well as in cultured tendon fibroblasts

(Figure 3.1A). The myostatin transcript was also detected in tendon tissue and in

cultured fibroblasts. Due to the close anatomical proximity between muscle and

tendon tissue, the purity of tendon samples was verified by probing for the

presence of type IIa myosin heavy chain and MyoD. Neither muscle specific

gene was detected in tendon samples.

The next step was to determine whether cultured tendon fibroblasts

activate intracellular signaling cascades in response to myostatin treatment.

Myostatin induced the phosphorylation of both p38 MAPK and Smad2/3 (Figure

3.1B). When cells were treated with myostatin in the presence of the p38 MAPK

inhibitor SB-203580 (10), the phosphorylation of p38 MAPK did not occur.

Consequently, SB-203580 was specific to the p38 MAPK pathway, as this

inhibitor did not block the phosphorylation of Smad2/3. For cells that were

treated with myostatin in the presence of the Smad2/3 inhibitor SB-431542 (17),

the phosphorylation of Smad2/3 was blocked with no effect on the

phosphorylation of p38 MAPK. These results indicated that tendon fibroblasts

expressed the myostatin receptors, were responsive to myostatin treatment and

this response could be blocked by the use of SB-203580 and SB-431542.

Myostatin induces the proliferation of tendon fibroblasts. To determine

whether myostatin induced the proliferation of tendon fibroblasts, fibroblasts were

pulsed with BrdU and the cells were subsequently treated with myostatin, SB-

82

203580 and SB-431542 for 24h. Treatment with 1000 ng/mL of myostatin

increased tendon cell proliferation by 37% over controls (Figure 3.2A). While the

inhibition of the p38 MAPK pathway was sufficient to decrease the myostatin-

mediated increase in fibroblast proliferation, the inhibition of the Smad2/3

pathway did not block the myostatin-mediated increase in fibroblast proliferation.

Compared with MSTN+/+ mice, the density of fibroblasts in whole tendon tissue

was 47% less than for the MSTN-/- mice (Figure 3.2B). These results indicated

that myostatin was a potent regulator of tendon cell proliferation.

Myostatin induces the expression of scleraxis, tenomodulin and type I

collagen in tendon fibroblasts. The next step was to determine if myostatin

regulated the expression of scleraxis and tenomodulin, the two genes that induce

the proliferation of tendon fibroblasts. Treatment with 1000 ng/mL of myostatin

resulted in a greater than two-fold increase in scleraxis expression (Figure 3.3A).

Inhibiting the p38 MAPK pathway resulted in a 70% decrease in scleraxis

expression, while the inhibition of the Smad2/3 pathway resulted in a 50%

increase in scleraxis expression. Myostatin treatment doubled the expression of

tenomodulin, and inhibition of both the p38 MAPK and Smad2/3 pathways to

blocked the myostatin-mediated increase in tenomodulin expression (Figure

3.3B). Compared with MSTN+/+ mice, MSTN-/- mice had a 64% decrease in

scleraxis expression (Figure 3.3D) and a 63% decrease in tenomodulin

expression (Figure 3.3E). These results indicated that the mechanisms

responsible for the myostatin-mediated increase in fibroblast proliferation were

due to an upregulation of scleraxis and tenomodulin.

83

Due to the smaller mass and CSA of the tendons of MSTN-/- mice, the

impact of myostatin on the major structural protein of tendon, type I collagen, was

determined. Treatment with 1000 ng/mL of myostatin resulted in a 67% increase

in the expression of type I collagen (Figure 3.3C). The inhibition of either the p38

MAPK, or the Smad2/3 pathway was sufficient to block this increase in type I

collagen expression. Compared with MSTN+/+ mice, a 54% decrease in type I

collagen expression was observed in the tendons of MSTN-/- mice (Figure 3.3F).

Taken together, the cell proliferation and gene expression data indicated that the

smaller tendons of the MSTN-/- mice depended on a decrease in tendon

fibroblast proliferation and on the production of the constituents of the ECM.

MSTN-/- mice have stiff, brittle tendons. The profound impact of myostatin

on the structure of tendons indicated that myostatin-deficiency likely influenced

the mechanical properties of tendons. Consequently, the stress-strain

relationships of tendons from MSTN+/+ and MSTN-/- mice were measured (Figure

3.4A). Compared with the tendons of MSTN+/+ mice, those of MSTN-/- mice

reached a greater than two-fold higher peak stress before yielding, but reached

less than half of the peak strain before yielding (Table 3.3). Tendons of MSTN-/-

mice also demonstrated a fourteen-fold greater peak stiffness and average

stiffness values than those of MSTN+/+ mice (Figure 3.4B and Table 3.3).

Despite the different stress-strain and stiffness properties of tendons from

MSTN+/+ and MSTN-/- mice, the tendons absorbed the same amount of energy

before reaching the yield point (Figure 3.4C and Table 3.3). These results

84

indicated that the loss of myostatin had a major impact on the mechanical

properties of tendons.

Discussion

Myostatin has a well characterized role in the regulation of the structure

and function of skeletal muscles. Although the myostatin transcript has been

detected previously in tendons (16), our results provide the first evidence that

myostatin regulates directly the structure and function of tendons. For the

MSTN-/- mice, the deficiency in myostatin resulted in small, brittle, hypocellular

tendons. The difference in tendon phenotypes between the MSTN-/- and

MSTN+/+ mice is clearly not attributable to any indirect influence of a greater

muscle mass of the MSTN-/- mice, as both genotypes were limited to cage

sedentary activity levels and the two genotypes showed no differences in body

masses. Consequently, the tendons of both groups of mice experienced very

similar mechanical loads throughout their lifespan and the dramatic change in the

structure and function of tendons could be attributed directly to the effect of

myostatin on tendon fibroblasts. In addition, this conclusion is supported further

by the concurrent cell culture experiments.

While myostatin promotes the synthesis of intramuscular collagen content

and skeletal muscle fibroblast proliferation (30, 52), whether myostatin regulated

the collagen content and proliferation of fibroblasts of tendon was not

immediately evident. The inhibition of myostatin in mdx mice, a murine model of

Duchenne muscular dystrophy, decreased fibrosis and increased maximum

isometric force production (3, 4, 48). Compared with MSTN+/+ mice, a decrease

85

in the type I collagen content of EDL muscles of MSTN-/- mice was observed

(30). Myostatin also induced the expression of type I collagen in skeletal muscle

myotubes (30) and muscle-derived fibroblasts (52) and increased the

proliferation of cultured muscle-derived and NIH/3T3 fibroblasts (52). The

current investigation indicated that myostatin also promotes fibroblast

proliferation and type I collagen synthesis in tendons, both in vivo and in vitro.

A rapidly growing body of literature supports the role of scleraxis and

tenomodulin in the embryonic development of tendons (5, 12-14, 23, 34, 38, 40,

41), but little is known regarding their function in adult tendons. FGF-4 and FGF-

8 directly induced the expression of scleraxis in tendon fibroblasts (5, 6, 14, 43).

Furthermore, TGF-ß induced the expression of scleraxis in osteosarcoma cells

(24) . Overexpression of scleraxis in tendon fibroblasts either directly or

indirectly resulted in the upregulation of tenomodulin (41). The relative

expression of scleraxis and tenomodulin in the tendons of MSTN+/+ and MSTN-/-

mice in this study were in good agreement with the data on tendon mass and cell

density. Similar to tenomodulin deficient mice, the tendons of MSTN-/- mice were

hypocellular (12). The results from the current study indicate that scleraxis and

tenomodulin are expressed in adult tendons and that both genes are downstream

targets of myostatin, that activates similar signal transduction cascades as TGF-

ß and FGF.

During several stages of embryonic development, myogenic cells and

tendon precursor cells interact with each other to ensure proper spatial alignment

and proper timing of differentiation events (13, 18). While myostatin was

86

expressed in myogenic cells and decreased the expression of the myogenic

genes MyoD, Myf-5 and Pax3 in these cells, myostatin was also expressed in

non-myogenic cells of the ectoderm (1) but the reason for the expression of

myostatin in non-muscle cells was not known. Scleraxis expression occurred in

three phases of tendon development (13, 40), with the final phase initiated by

FGF-4 and FGF-8 (5, 14) produced in adjacent myogenic cells. The signal that

initiated the first phase of scleraxis expression in tendon progenitor cells is not

known, but this signal does not come from muscle cells, as removal of myogenic

cells does not alter scleraxis expression (14). The ectoderm appeared critical to

the induction of the first stage of scleraxis expression, as ablation of the

ectoderm abolished the first phase of scleraxis expression (40). Myostatin was

expressed in the ectoderm around the time of the first phase of scleraxis

expression (1) and removal of the ectoderm resulted in a downregulation of

scleraxis. Consequently, myostatin may play a direct role in the development of

tendons by regulating the initial expression of scleraxis.

One of the most striking differences between the mechanical properties of

MSTN+/+ and MSTN-/- mice was the fourteen-fold increase in the stiffness of

tendons in MSTN-/- mice. The stiffness of tendons is a critical factor in

determining the damage to muscle fibers during lengthening contractions.

Immediately following a two-stretch lengthening contraction protocol, the EDL

muscles of MSTN-/- mice had a 15% greater force deficit than MSTN+/+ mice (30).

The force deficit following a contraction-induced injury is directly related to the

strain on the muscle fibers during the lengthening contraction (7). Consequently,

87

the series elastic component of a muscle protects the sarcomeres from damage

by limiting the strain of the muscle fibers during the contraction (15). Similarly,

the increased stiffness of tendons increases the strain on the muscle fibers plays

a direct role in the greater force deficit observed for the muscles of MSTN-/- mice

compared with MSTN+/+ mice following a lengthening contraction protocol (30).

While the mechanisms responsible for the increased stiffness of tendons from

MSTN-/- mice are not known, the stiffening of tendons is thought to arise as a

result of the increased crosslinking between type I collagen molecules (47).

Future studies that evaluate the biochemical and molecular differences between

the tendons of MSTN+/+ and MSTN-/- mice are necessary to determine the

mechanisms behind the regulation of tendon mechanical properties by myostatin.

Considerable interest has focused on the potential use of myostatin

inhibitors in the treatment of muscle wasting diseases such as Duchenne

muscular dystrophy (8, 35, 46). Muscles of mdx mice (9, 11, 33, 36, 44) and

patients with Duchenne muscular dystrophy (42) are highly susceptible to

contraction-induced injury. A profound increase in the stiffness of tendons would

likely further increase the susceptibility of dystrophic muscles to contraction-

induced injury and exacerbate the symptoms of muscular dystrophy. A careful

evaluation of the long term impact of myostatin suppression on the mechanical

properties of tendons of dystrophic muscles, and the susceptibility of dystrophic

muscles to contraction-induced injury, is warranted.

88

Acknowledgements

The authors wish to thank Dennis Claflin, Keith Baar, Cheryl Hassett and

Kimberly Gates for providing technical assistance. This work was supported by

the grants AG-13283 and AG-20591 from the National Institute on Aging.

89

Figure 3.1. Tendon fibroblasts expressed the myostatin receptors and activated signal transduction cascades in the presence of myostatin. (A) PCR analysis of cDNA libraries from whole tendon tissue and cultured tendon fibroblasts indicated that tendon fibroblasts expressed both of the myostatin receptors (ACVRB and ACVR2B) as well as myostatin (MSTN) itself. MHC2A and MyoD were used as negative controls to indicate purity of tendon samples. (B) Treatment of tendon fibroblasts with myostatin for 2h results in the phosphorylation of both p38 MAPK and Smad2/3. The p38 MAPK inhibitor SB-203580 was able to specifically block the myostatin-mediated phosphorylation of p38 MAPK, and the Smad2/3 inhibitor SB-431542 was able to specifically block the myostatin-mediated phosphorylation of Smad2/3. +, 500ng/mL of myostatin. ++, 1000ng/mL of myostatin.

90

Figure 3.2. Myostatin induced the proliferation of tendon fibroblasts. (A) Treatment of tendon fibroblasts for 24h with myostatin increases cell proliferation as measured by the relative incorporation of the thymidine analog BrdU. N = 3 independent experiments. +, 500ng/mL of myostatin. ++, 1000ng/mL of myostatin. *, significantly different from control group at P < 0.05. (B) Cell density data from tibialis anterior tendon sections stained with H&E. MSTN-/- mice a lower fibroblast density than MSTN+/+ mice. N = 6 tendons per genotype. *, significantly different from MSTN+/+ at P < 0.05.

91

Figure 3.3. Myostatin induces the expression of scleraxis, tenomodulin and collagen Iα2 genes in tendon fibroblasts. Treatment of cells with myostatin for 24h increases the relative expression of scleraxis (A), tenomodulin (B) and collagen Iα2 (C) normalized to GAPDH. +, 500ng/mL of myostatin. ++, 1000ng/mL of myostatin. *, significantly different from control group at P < 0.05. There is a decrease in the expression of scleraxis (D), tenomodulin (E) and collagen Iα2 (F) normalized to GAPDH in tendons of MSTN-/- mice. N = 4 tendons per genotype. *, significantly different from MSTN+/+ at P < 0.05.

92

Figure 3.4. Mechanical properties of tibialis anterior tendons of MSTN+/+ and MSTN-/- mice. (A) The stress-strain relationship of tendons from MSTN+/+ and MSTN-/- mice indicate that MSTN-/- mice develop a higher peak stress but have a lower peak strain. (B) MSTN-/- mice have a greater peak stiffness and average stiffness than MSTN+/+ mice. (C) The energy absorbed to the yield point is not different between MSTN+/+ and MSTN-/- mice. N = 5 tendons per genotype. *, significantly different from MSTN+/+ at P < 0.05.

93

Gene Forward Primer (5' - 3') Reverse Primer (5' - 3')

ACVRB GCTGGAAAGCCCTTCTACTG TGATGACCAGGAAGACGATG ACVR2B GAAGATGAGGCCCACGATTA GGAGGTCACCAGAGAGACGA COL1A2 CCAGCGAAGAACTCATACAGC GGACACCCCTTCTACGTTGT GAPDH TGGAAAGCTGTGGCGTGAT TGCTTCACCACCTTCTTGAT MHC2A CCAAGTCAGAGGCAAAGAGG TCTTTGATTTTGGCCTCCAG MSTN TGCAAAATTGGCTCAAACAG GCAGTCAAGCCCAAAGTCTC MYOD CGCTCCAACTGCTCTGATG TAGTAGGCGGTGTCGTAGCC TNMD TGTACTGGATCAATCCCACTCT GCTCATTCTGGTCAATCCCCT

Table 3.1. PCR primer sequences. Primers for RT-PCR and RT-qPCR. Primers are designed to generate an amplicon which spans two or more exons and can discriminate cDNA from genomic DNA.

94

MSTN+/+ MSTN-/- Mouse Mass (g) 33.8±1.1 36.8±1.1 TA Tendon Mass (mg) 1.30±0.10 0.78±0.05* TA Muscle Mass (mg) 51.84±1.58 89.34±3.92* TA Tendon/Muscle Mass Ratio 0.025±0.002 0.009±0.001* Achilles Tendon Mass (mg) 2.34±0.10 1.32±0.10* Soleus Mass (mg) 8.10±0.29 14.80±0.21* Achilles Tendon/Soleus Muscle Mass Ratio 0.291±0.005 0.090±0.008* Table 3.2. Whole animal, muscle and tendon masses. Values are means ± SE. N = 5 for each genotype. *Significantly different from MSTN+/+ at P < 0.05.

95

MSTN+/+ MSTN-/- Lo (mm) 6.78±0.28 6.12±0.10 CSA (mm2) 0.16±0.03 0.08±0.01* Density (mg/mm3) 1.54±0.42 1.63±0.06 Peak Strain (ΔL/Lo) 0.75±0.02 0.33±0.04* Peak Stress (kPa) 8250±1223 20300±1067* Peak Stiffness (mN/mm2) 95.0±17.1 1386±212* Average Stiffness (mN/mm2) 49.6±8.3 711±253* Energy Absorption (mJ/mg) 1.93±0.56 1.89±0.27 Table 3.3. Morphological and mechanical properties of tibialis anterior tendons. Values are means ± SE. N = 5 for each genotype. *Significantly different from MSTN+/+ at P < 0.05.

96

References 1. Amthor H, Huang R, McKinnell I, Christ B, Kambadur R, Sharma M, and Patel K. The regulation and action of myostatin as a negative regulator of muscle development during avian embryogenesis. Dev Biol 251: 241-257, 2002. 2. Arruda E, Calve S, Dennis R, Mundy K, and Baar K. Regional variation of tibialis anterior tendon mechanics is lost following denervation. J Appl Physiol 101: 1113-1117, 2006. 3. Bogdanovich S, Krag T, Barton E, Morris L, Whittemore L, Ahima R, and Khurana T. Functional improvement of dystrophic muscle by myostatin blockade. Nature 420: 418-421, 2002. 4. Bogdanovich S, Perkins K, Krag T, Whittemore L, and Khurana T. Myostatin propeptide-mediated amelioration of dystrophic pathophysiology. FASEB J 19: 543-549, 2005. 5. Brent A, Schweitzer R, and Tabin C. A somitic compartment of tendon progenitors. Cell 113: 235-248, 2003. 6. Brent A, and Tabin C. FGF acts directly on the somitic tendon progenitors through the Ets transcription factors Pea3 and Erm to regulate scleraxis expression. Development 131: 3885-3896, 2004. 7. Brooks SV, Zerba E, and Faulkner JA. Injury to muscle fibres after single stretches of passive and maximally stimulated muscles in mice. J Physiol 488 ( Pt 2): 459-469, 1995. 8. Chakkalakal JV, Thompson J, Parks RJ, and Jasmin BJ. Molecular, cellular, and pharmacological therapies for Duchenne/Becker muscular dystrophies. Faseb J 19: 880-891, 2005. 9. Consolino CM, and Brooks SV. Susceptibility to sarcomere injury induced by single stretches of maximally activated muscles of mdx mice. J Appl Physiol 96: 633-638, 2004. 10. Cuenda A, Rouse J, Doza Y, Meier R, Cohen P, Gallagher T, Young P, and Lee J. SB 203580 is a specific inhibitor of a MAP kinase homologue which is stimulated by cellular stresses and interleukin-1. FEBS Lett 364: 229-233, 1995. 11. Dellorusso C, Crawford RW, Chamberlain JS, and Brooks SV. Tibialis anterior muscles in mdx mice are highly susceptible to contraction-induced injury. J Muscle Res Cell Motil 22: 467-475, 2001. 12. Docheva D, Hunziker E, Fässler R, and Brandau O. Tenomodulin is necessary for tenocyte proliferation and tendon maturation. Mol Cell Biol 25: 699-705, 2005. 13. Edom-Vovard F, and Duprez D. Signals regulating tendon formation during chick embryonic development. Dev Dyn 229: 449-457, 2004. 14. Edom-Vovard F, Schuler B, Bonnin M, Teillet M, and Duprez D. Fgf4 positively regulates scleraxis and tenascin expression in chick limb tendons. Dev Biol 247: 351-366, 2002. 15. Griffiths RI. Shortening of muscle fibres during stretch of the active cat medial gastrocnemius muscle: the role of tendon compliance. J Physiol 436: 219-236, 1991.

97

16. Heinemeier K, Olesen J, Schjerling P, Haddad F, Langberg H, Baldwin K, and Kjaer M. Short-term strength training and the expression of myostatin and IGF-I isoforms in rat muscle and tendon: differential effects of specific contraction types. J Appl Physiol 102: 573-581, 2007. 17. Inman G, Nicolás F, Callahan J, Harling J, Gaster L, Reith A, Laping N, and Hill C. SB-431542 is a potent and specific inhibitor of transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4, ALK5, and ALK7. Mol Pharmacol 62: 65-74, 2002. 18. Kardon G. Muscle and tendon morphogenesis in the avian hind limb. Development 125: 4019-4032, 1998. 19. Kjaer M. Role of extracellular matrix in adaptation of tendon and skeletal muscle to mechanical loading. Physiol Rev 84: 649-698, 2004. 20. Kjaer M, Magnusson P, Krogsgaard M, Boysen Møller J, Olesen J, Heinemeier K, Hansen M, Haraldsson B, Koskinen S, Esmarck B, and Langberg H. Extracellular matrix adaptation of tendon and skeletal muscle to exercise. J Anat 208: 445-450, 2006. 21. Langley B, Thomas M, Bishop A, Sharma M, Gilmour S, and Kambadur R. Myostatin inhibits myoblast differentiation by down-regulating MyoD expression. J Biol Chem 277: 49831-49840, 2002. 22. Lee S, and McPherron A. Regulation of myostatin activity and muscle growth. Proc Natl Acad Sci USA 98: 9306-9311, 2001. 23. Léjard V, Brideau G, Blais F, Salingcarnboriboon R, Wagner G, Roehrl M, Noda M, Duprez D, Houillier P, and Rossert J. Scleraxis and NFATc regulate the expression of the pro-alpha 1(I) collagen gene in tendon fibroblasts. J Biol Chem 2007. 24. Liu Y, Cserjesi P, Nifuji A, Olson E, and Noda M. Sclerotome-related helix-loop-helix type transcription factor (scleraxis) mRNA is expressed in osteoblasts and its level is enhanced by type-beta transforming growth factor. J Endocrinol 151: 491-499, 1996. 25. Livak K, and Schmittgen T. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-408, 2001. 26. McCroskery S, Thomas M, Maxwell L, Sharma M, and Kambadur R. Myostatin negatively regulates satellite cell activation and self-renewal. J Cell Biol 162: 1135-1147, 2003. 27. McFarlane C, Plummer E, Thomas M, Hennebry A, Ashby M, Ling N, Smith H, Sharma M, and Kambadur R. Myostatin induces cachexia by activating the ubiquitin proteolytic system through an NF-kappaB-independent, FoxO1-dependent mechanism. J Cell Physiol 209: 501-514, 2006. 28. McHugh M, and Pasiakos S. The role of exercising muscle length in the protective adaptation to a single bout of eccentric exercise. Eur J Appl Physiol 93: 286-293, 2004. 29. McPherron A, Lawler A, and Lee S. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387: 83-90, 1997.

98

30. Mendias C, Marcin J, Calerdon D, and Faulkner J. Contractile properties of EDL and soleus muscles of myostatin-deficient mice. J Appl Physiol 101: 898-905, 2006. 31. Mikic B, Bierwert L, and Tsou D. Achilles tendon characterization in GDF-7 deficient mice. J Orthop Res 24: 831-841, 2006. 32. Mikic B, Schalet B, Clark R, Gaschen V, and Hunziker E. GDF-5 deficiency in mice alters the ultrastructure, mechanical properties and composition of the Achilles tendon. J Orthop Res 19: 365-371, 2001. 33. Moens P, Baatsen PH, and Marechal G. Increased susceptibility of EDL muscles from mdx mice to damage induced by contractions with stretch. J Muscle Res Cell Motil 14: 446-451, 1993. 34. Murchison N, Price B, Conner D, Keene D, Olson E, Tabin C, and Schweitzer R. Regulation of tendon differentiation by scleraxis distinguishes force-transmitting tendons from muscle-anchoring tendons. Development 2007. 35. Patel K, Macharia R, and Amthor H. Molecular mechanisms involving IGF-1 and myostatin to induce muscle hypertrophy as a therapeutic strategy for Duchenne muscular dystrophy. Acta Myol 24: 230-241, 2005. 36. Petrof BJ, Shrager JB, Stedman HH, Kelly AM, and Sweeney HL. Dystrophin protects the sarcolemma from stresses developed during muscle contraction. Proc Natl Acad Sci U S A 90: 3710-3714, 1993. 37. Philip B, Lu Z, and Gao Y. Regulation of GDF-8 signaling by the p38 MAPK. Cell Signal 17: 365-375, 2005. 38. Pryce B, Brent A, Murchison N, Tabin C, and Schweitzer R. Generation of transgenic tendon reporters, ScxGFP and ScxAP, using regulatory elements of the scleraxis gene. Dev Dyn 236: 1677-1682, 2007. 39. Rebbapragada A, Benchabane H, Wrana J, Celeste A, and Attisano L. Myostatin signals through a transforming growth factor beta-like signaling pathway to block adipogenesis. Mol Cell Biol 23: 7230-7242, 2003. 40. Schweitzer R, Chyung J, Murtaugh L, Brent A, Rosen V, Olson E, Lassar A, and Tabin C. Analysis of the tendon cell fate using Scleraxis, a specific marker for tendons and ligaments. Development 128: 3855-3866, 2001. 41. Shukunami C, Takimoto A, Oro M, and Hiraki Y. Scleraxis positively regulates the expression of tenomodulin, a differentiation marker of tenocytes. Dev Biol 298: 234-247, 2006. 42. Siegel IM. The management of muscular dystrophy: a clinical review. Muscle Nerve 1: 453-460, 1978. 43. Smith T, Sweetman D, Patterson M, Keyse S, and Münsterberg A. Feedback interactions between MKP3 and ERK MAP kinase control scleraxis expression and the specification of rib progenitors in the developing chick somite. Development 132: 1305-1314, 2005. 44. Stevens ED, and Faulkner JA. The capacity of mdx mouse diaphragm muscle to do oscillatory work. J Physiol 522 Pt 3: 457-466, 2000. 45. Thomas M, Langley B, Berry C, Sharma M, Kirk S, Bass J, and Kambadur R. Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation. J Biol Chem 275: 40235-40243, 2000.

99

46. Tobin J, and Celeste A. Myostatin, a negative regulator of muscle mass: implications for muscle degenerative diseases. Current opinion in pharmacology 5: 328-332, 2005. 47. Tuite D, Renström P, and O'Brien M. The aging tendon. Scandinavian journal of medicine & science in sports 7: 72-77, 1997. 48. Wagner K, McPherron A, Winik N, and Lee S. Loss of myostatin attenuates severity of muscular dystrophy in mdx mice. Ann Neurol 52: 832-836, 2002. 49. Welle S, Bhatt K, and Pinkert C. Myofibrillar protein synthesis in myostatin-deficient mice. Am J Physiol Endocrinol Metab 290: E409-415, 2006. 50. Wolfman N, Hattersley G, Cox K, Celeste A, Nelson R, Yamaji N, Dube J, DiBlasio-Smith E, Nove J, Song J, Wozney J, and Rosen V. Ectopic induction of tendon and ligament in rats by growth and differentiation factors 5, 6, and 7, members of the TGF-beta gene family. J Clin Invest 100: 321-330, 1997. 51. Yang W, Chen Y, Zhang Y, Wang X, Yang N, and Zhu D. Extracellular signal-regulated kinase 1/2 mitogen-activated protein kinase pathway is involved in myostatin-regulated differentiation repression. Cancer Res 66: 1320-1326, 2006. 52. Zhu J, Li Y, Shen W, Qiao C, Ambrosio F, Lavasani M, Nozaki M, Branca M, and Huard J. Relationships between TGF-beta -1, myostatin, and decorin: Implications for skeletal muscle fibrosis. J Biol Chem 2007. 53. Zhu X, Topouzis S, Liang L, and Stotish R. Myostatin signaling through Smad2, Smad3 and Smad4 is regulated by the inhibitory Smad7 by a negative feedback mechanism. Cytokine 26: 262-272, 2004.

101

Structure. The genetic deficiency of myostatin leads to both hypertrophy

and hyperplasia of fast-fibered muscles (17). In prior studies, the measurements

of the number of fibers in the skeletal muscles were determined from cross

sections of muscles that might not provide an accurate indication of the true

number of fibers (15). By digesting the ECM of EDL and soleus muscles and

counting all of the fibers present in the muscle, we have now demonstrated that

the deficiency of myostatin leads to a bona fide hyperplasia.

In addition to a greater number of fibers, myostatin deficiency leads to an

increase in the CSAs of fibers. While myostatin inhibition increases satellite cell

proliferation (12, 16, 27), this satellite cell inhibition does not appear to be wholly

sufficient to explain the hypertrophic response that occurs with the inhibition of

myostatin. Administering mice an inhibitory antibody against myostatin resulted

in a 14% increase in muscle mass in only two weeks (29). This increase in

muscle mass is unlikely to occur simply by modulating satellite cell activity. The

preliminary study presented in Chapter I demonstrated that the deficiency of

myostatin leads to a marked decrease in ubiquitinated myosin heavy chain and a

decrease in atrogin-1 expression. No difference in relative myofibrillar protein

content was observed between the muscles of MSTN+/+ and MSTN-/- mice.

These results suggest that the inhibition of myostatin leads to muscle fiber

hypertrophy by the inhibition of protein degradation.

The deficiency of myostatin reduced collagenous fibrosis in mdx mice (1,

2, 28), but whether myostatin regulate the expression of type I collagen directly

was not clear. The cell culture studies from Chapter II demonstrated that

102

myostatin increased directly the expression of type I collagen. Additionally,

myostatin-deficient EDL muscles showed a decrease in whole muscle collagen

content. These results indicated that, in addition to regulating the numbers of

fibers in a muscle, myostatin regulated the ECM of skeletal muscle.

Function. In addition to the profound impact on the structure of skeletal

muscle, myostatin had an impact on the function of skeletal muscle through the

hypertrophy and hyperplasia present in the skeletal muscles of myostatin-

deficient mice, and the impact these changes had on the contractile properties of

muscles. The studies from Chapter II demonstrated that the deficiency of

myostatin increased the Po of both EDL and soleus muscles. When Po was

normalized to the CSA of the muscles to calculate sPo, an unexpected finding

was observed. As a muscle undergoes hypertrophy and is able to generate a

greater Po, the sPo will usually decrease due to the increase in θ (15). Despite

having a greater number of fibers, fiber CSA, Po and θ, the EDL muscles from

MSTN+/- and soleus muscles from MSTN-/- mice did not show a decrease in sPo.

In contrast, the EDL muscles of the MSTN-/- mice, that had a greater number of

fibers, fiber CSA, Po and θ did suffer from a decrease in sPo. For a muscle that

undergoes hypertrophy, a threshold appears to exist above which a decrease in

sPo occurs. In contrast, for small increases in muscle CSA, mass and Po, sPo

does not change.

Furthermore, the deficiency of myostatin was found to increase the

susceptibility of muscles to contraction-induced injury. Following contraction-

induced injury, the EDL muscles of MSTN-/- mice had greater relative force

103

deficits than those of MSTN+/+ mice. Despite having a greater force deficit

following injury, the work done to stretch the muscles of MSTN-/- mice was less

than MSTN+/+ and MSTN+/- mice. As the series elastic component of muscles

can protect fibers from injury (9), we initially hypothesized that the series elastic

component of muscles of the MSTN-/- mice were more compliant, exceeded their

elastic limit during the lengthening contractions, and therefore no longer acted as

mechanical springs. This lead to a subsequent study of tendon structure and

function, presented in Chapter III. After completion of the investigation of the

properties of tendon structure and function, the initial hypothesis as to why the

EDL muscles of MSTN-/- mice are more susceptible to contraction-induced injury

was rejected. The rejection was based on the observation that the tendons of

MSTN-/- mice were fourteen times stiffer than the tendons of MSTN+/+ mice and

the peak stiffness occurred at an early strain value. These findings suggested

that the series elastic component of the tendons of the MSTN-/- mice were so stiff

that they acted as a rigid body and did not take up much, if any, strain as the

muscle was stretched. Extremely stiff tendons appear to be the reason why the

deficiency of myostatin increases the susceptibility of the fast-fibered EDL

muscles to contraction-induced injury.

Future Studies. An interesting finding from the studies presented in

Chapter II is that the EDL muscles of MSTN+/- mice developed a greater Po than

the MSTN+/+ mice, but unlike the MSTN-/- mice, no difference was observed in

sPo, or force deficit, after the injury. Even though the collagen content of the EDL

muscles of MSTN+/- mice was less than that of MSTN+/+ mice, this did not

104

increase the susceptibility of these muscles to contraction-induced injury. As the

MSTN+/- mice have a 20% decrease in circulating myostatin levels compared to

MSTN+/+ mice, this suggests that the partial suppression of myostatin is able to

increase force production of muscles without making the muscles more

susceptible to injury. Based on the preliminary data in Chapter I that showed that

myostatin increased protein degradation and the data in Chapter II that showed

that myostatin increased type I collagen expression, the use of a pharmaceutical

inhbitor of myostatin might be beneficial in the treatment of severe contraction-

induced injuries. Following the induction of a severe lengthening contraction

injury to the muscles of a mouse, the administration of a pharmaceutical inhibitor

such as a monoclonal antibody against myostatin, the propeptide of myostatin, or

a small peptide that blocks the interaction of myostatin with its receptors, the

effect of myostatin inhibition on the recovery from a severe contraction induced

injury could be determined. Based on the findings from Chapters I and II, the

hypothesis that inhibition of myostatin promotes the long-term recovery of muscle

from severe injury by blocking protein degradation and reducing fibrosis appears

promising.

Discussion of Findings and Future Directions - Tendon

The study described in Chapter III demonstrated, for the first time, that

myostatin has a profound impact on the structure and function of tendon tissue.

The study not only described and characterized the phenotype of tendons from

myostatin-deficient mice, but also demonstrated that myostatin can directly

activate intracellular signal transduction cascades in tendon fibroblasts and

105

explored the possible cellular and molecular mechanisms behind the tendon

phenotype. In addition to showing that myostatin can directly regulate tendon

structure and function, Chapter III demonstrated for the first time that the bHLH

transcription factor scleraxis continues to be expressed in adult tendon

fibroblasts and that myostatin increases the expression of scleraxis directly.

Tenomodulin was also shown to be a downstream target of myostatin signaling.

While tenomodulin deficient mice displayed hypocellular tendons with no change

in ECM structure or size (3), the mechanisms behind the control of cell

proliferation by tenomodulin are not known. Three future studies are suggested

that would provide further insight into the regulation of tendon physiology.

Study 1 – Myostatin-mediated regulation of scleraxis expression during

development. During the development of tendon structures in the limb, tendon

development can be categorized into three phases, each phase corresponding to

an upregulation of scleraxis (4, 25). While FGF appears to be responsible for the

third phase of scleraxis expression, FGF does not appear to be responsible for

the first and second phases of scleraxis expression (4). Edom-Vovard and

Duprez (4) suggested that a member of the GDF family is a likely candidate for

the regulation of scleraxis expression during the first and second phases of early

tendon development. To determine if myostatin induces the expression of

scleraxis during the first and second phases of early tendon development, a

double transgenic animal model could be utilized. Crossing the myostatin

deficient mice with the ScxGFP line of mice that contain a GFP reporter linked to

the scleraxis promoter (23) to obtain MSTN-/-ScxGFP mice would create a model

106

organism that would allow for the visualization of scleraxis expression in the

absence of myostatin at various stages of development. Comparing GFP

intensity between MSTN+/+ScxGFP and MSTN-/-ScxGFP mice would be a useful

first step to determine if myostatin is the cytokine that induces the first two

phases of scleraxis expression. The most likely interpretation is that compared

with MSTN+/+ScxGFP mice, the GFP intensity in the tendon primordia of MSTN-/-

ScxGFP mice is severely depressed.

Study 2 – Myostatin-mediated biochemical modifications of tendons.

Compared with MSTN+/+ mice, the tendons of MSTN-/- mice had a two-fold

greater peak stress, less than half of the peak strain, and a fourteen-fold greater

peak stiffness. Furthermore, the fibroblast density of the tendons of the MSTN-/-

mice was only half that of the MSTN+/+ mice. While the hypocellularity may

explain the increase in stiffness, as fibroblasts can break the spontaneous cross-

links that form between collagen molecules, changes in the activities of other

enzymes might also occur that regulate tendon mechanical properties. Lysyl

oxidase is the chief enzyme that can form cross-links between collagen

molecules (6). In addition, elastin is a structural protein that allows tendon to

have a greater peak stress (8). Determining the expression of lysyl oxidase and

elastin in tendon might reveal the molecular mechanism behind the myostatin-

mediated regulation of tendon mechanical properties. Based on the stiffness and

peak strain data, myostatin might promote the expression of lysyl oxidase and

elastin in tendon tissue.

107

Study 3 – Regulation of Tendon Fibroblast Proliferation by Tenomodulin.

Tenomodulin is a type II transmembrane protein that promotes the proliferation of

tendon fibroblasts (3), but the molecular mechanisms behind the actions of

tenomodulin are not known. The tenomodulin protein consists of two domains,

an N-terminal transmembrane anchor domain and a C-terminal extracellular

domain (26). The C-terminal peptide is cleaved and presumably interacts with

other receptors on the plasma membrane, but the identities of these receptors

are not known. To determine if the C-terminal peptide of tenomodulin interacts

with receptors on the plasma membrane, recombinant c-myc tagged C-terminal

tenomodulin peptide could be incubated with tendon fibroblast cells followed by

treatment with a crosslinking reagent. The cell homogenates would then be

subjected to immunoprecipitation with an antibody against c-myc. The pull down

would then be treated with a reagent to reverse the crosslinking and samples

would be separated using 2D SDS-PAGE. Proteins would be removed from the

gel and subjected to N-terminal sequencing. The amino acid sequence data

could then be used to search for possible receptors with which the C-terminal

peptide of tenomodulin interacts. The underlying mechanism could be that the

C-terminal tenomodulin peptide interacts with a receptor that controls cell

proliferation, but currently there is no basis for the selection of a particular

receptor. Identifying the receptors with which tenomodulin interacts is the first

step in determining the molecular mechanisms behind the tenomodulin-mediated

increase in tendon fibroblast proliferation.

108

Summary

The studies described in this thesis demonstrate that myostatin not only

has a profound impact on the structure and function of muscle tissue, but also on

the structure and function of tendon tissue. While initially characterized as a

cytokine that regulates skeletal muscle function, myostatin also has important

roles in tendon, cardiac, bone, mammary and adipose tissue (5, 11, 18, 20, 30).

From an evolutionary perspective, an interesting question is: Why is there

a gene for myostatin? The presence of larger, stronger muscles would appear to

be beneficial for many aspects of everyday life. All vertebrate species have a

myostatin gene (22), and fish have two copies (14). While myostatin has a

controversial role in metabolism, one potential role of myostatin in metabolism is

to divert food energy to fat, instead of to muscle (5, 7, 13, 18, 19, 30, 31).

Diverting food energy to fat instead of muscle would presumptively better enable

an animal to survive during periods of low food availability. A recent study

explored the adaptive evolution of myostatin in the human genome (24). The

authors of this study concluded that positive natural selection has acted on the

myostatin gene, but acknowledged that the amount and rate of polymorphisms at

the myostatin locus may suggest an evolutionarily recent decline in natural

selective pressure for myostatin. While not all polymorphisms lead to a loss of

function mutation, the greater the rate of polymorphisms, the greater the chance

of developing a loss of function mutation. The authors rejected this decline in

selective pressure at the myostatin locus based entirely on the long history of

conservation of the myostatin gene across all vertebrate species (24). The

109

results of this thesis argue against a decline in the natural selective pressure at

the myostatin gene. The studies in Chapter II indicate that the MSTN+/- mice

generate greater forces, without incurring an increased susceptibility to injury. In

the Whippet breed of racing dogs, a natural loss of the functional mutation in the

myostatin gene has arisen (21). The MSTN+/- and MSTN-/- whippets are known

as "Bully Whippets" and are considerably faster than their MSTN+/+ counterparts

(21). While we did not directly assess the amount of adipose tissue, the MSTN+/-

mice appear to be leaner than their MSTN+/+ littermates. We are currently

conducting a longevity study of MSTN+/+, MSTN+/-, and MSTN-/- mice. While the

study is still ongoing, our preliminary results indicate that the MSTN+/- mice have

an 8 month longer maximum longevity than either the MSTN+/+ or MSTN-/- mice.

While the long history of selective pressure being applied at the myostatin locus

may have helped our ancestors survive through periods of famine, in the

developed world, currently most humans have access to a virtually unlimited

source of food energy. The increased rate of polymorphisms does suggest a

decline in selective pressure at the myostatin locus. With an unlimited access to

food energy, the "larger, faster, stronger, leaner, longer-lived" phenotype of

MSTN+/- organisms has clear advantages over the wild type phenotype. A

pharmaceutical inhibitor of myostatin, Stamulumab (Myo-029, Wyeth), is

currently in clinical trials in the USA and Europe. Stamulumab is not yet

available for prescription in the USA, but is available for purchase in China and

Korea. Inhibition of myostatin appears to be a practical and potentially useful

treatment for many muscle wasting conditions and to counteract the decline in

110

muscle mass that occurs with aging. Future studies that determine the long term

safety and efficacy of the use of myostatin inhibitors are warranted. Doping

control policies and procedures for myostatin inhibitors must also be developed

to ensure equality in athletic performance.

111

References 1. Bogdanovich S, Krag T, Barton E, Morris L, Whittemore L, Ahima R, and Khurana T. Functional improvement of dystrophic muscle by myostatin blockade. Nature 420: 418-421, 2002. 2. Bogdanovich S, Perkins K, Krag T, Whittemore L, and Khurana T. Myostatin propeptide-mediated amelioration of dystrophic pathophysiology. FASEB J 19: 543-549, 2005. 3. Docheva D, Hunziker E, Fässler R, and Brandau O. Tenomodulin is necessary for tenocyte proliferation and tendon maturation. Mol Cell Biol 25: 699-705, 2005. 4. Edom-Vovard F, and Duprez D. Signals regulating tendon formation during chick embryonic development. Dev Dyn 229: 449-457, 2004. 5. Feldman B, Streeper R, Farese R, and Yamamoto K. Myostatin modulates adipogenesis to generate adipocytes with favorable metabolic effects. Proc Natl Acad Sci USA 103: 15675-15680, 2006. 6. Gerriets J, Curwin S, and Last J. Tendon hypertrophy is associated with increased hydroxylation of nonhelical lysine residues at two specific cross-linking sites in type I collagen. J Biol Chem 268: 25553-25560, 1993. 7. Gonzalez-Cadavid N, and Bhasin S. Role of myostatin in metabolism. Current opinion in clinical nutrition and metabolic care 7: 451-457, 2004. 8. Gosline J, Lillie M, Carrington E, Guerette P, Ortlepp C, and Savage K. Elastic proteins: biological roles and mechanical properties. Philos Trans R Soc Lond, B, Biol Sci 357: 121-132, 2002. 9. Griffiths RI. Shortening of muscle fibres during stretch of the active cat medial gastrocnemius muscle: the role of tendon compliance. J Physiol 436: 219-236, 1991. 10. Grobet L, Martin L, Poncelet D, Pirottin D, Brouwers B, Riquet J, Schoeberlein A, Dunner S, Ménissier F, Massabanda J, Fries R, Hanset R, and Georges M. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nat Genet 17: 71-74, 1997. 11. Hamrick M, Pennington C, Webb C, and Isales C. Resistance to body fat gain in 'double-muscled' mice fed a high-fat diet. International journal of obesity (2005) 30: 868-870, 2006. 12. Langley B, Thomas M, Bishop A, Sharma M, Gilmour S, and Kambadur R. Myostatin inhibits myoblast differentiation by down-regulating MyoD expression. J Biol Chem 277: 49831-49840, 2002. 13. Lin J, Arnold HB, Della-Fera MA, Azain MJ, Hartzell DL, and Baile CA. Myostatin knockout in mice increases myogenesis and decreases adipogenesis. Biochem Biophys Res Commun 291: 701-706, 2002. 14. Maccatrozzo L, Bargelloni L, Cardazzo B, Rizzo G, and Patarnello T. A novel second myostatin gene is present in teleost fish. FEBS Lett 509: 36-40, 2001. 15. Maxwell L, Faulkner J, and Hyatt G. Estimation of number of fibers in guinea pig skeletal muscles. Journal of applied physiology 37: 259-264, 1974.

112

16. McCroskery S, Thomas M, Maxwell L, Sharma M, and Kambadur R. Myostatin negatively regulates satellite cell activation and self-renewal. J Cell Biol 162: 1135-1147, 2003. 17. McPherron A, Lawler A, and Lee S. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387: 83-90, 1997. 18. McPherron A, and Lee S. Suppression of body fat accumulation in myostatin-deficient mice. J Clin Invest 109: 595-601, 2002. 19. Milan G, Dalla Nora E, Pilon C, Pagano C, Granzotto M, Manco M, Mingrone G, and Vettor R. Changes in muscle myostatin expression in obese subjects after weight loss. J Clin Endocrinol Metab 89: 2724-2727, 2004. 20. Morissette M, Cook S, Foo S, McKoy G, Ashida N, Novikov M, Scherrer-Crosbie M, Li L, Matsui T, Brooks G, and Rosenzweig A. Myostatin regulates cardiomyocyte growth through modulation of Akt signaling. Circ Res 99: 15-24, 2006. 21. Mosher D, Quignon P, Bustamante C, Sutter N, Mellersh C, Parker H, and Ostrander E. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet 3: e79, 2007. 22. Pie M, and Alvares L. Evolution of myostatin in vertebrates: is there evidence for positive selection? Mol Phylogenet Evol 41: 730-734, 2006. 23. Pryce B, Brent A, Murchison N, Tabin C, and Schweitzer R. Generation of transgenic tendon reporters, ScxGFP and ScxAP, using regulatory elements of the scleraxis gene. Dev Dyn 236: 1677-1682, 2007. 24. Saunders M, Good J, Lawrence E, Ferrell R, Li W, and Nachman M. Human adaptive evolution at Myostatin (GDF8), a regulator of muscle growth. Am J Hum Genet 79: 1089-1097, 2006. 25. Schweitzer R, Chyung J, Murtaugh L, Brent A, Rosen V, Olson E, Lassar A, and Tabin C. Analysis of the tendon cell fate using Scleraxis, a specific marker for tendons and ligaments. Development 128: 3855-3866, 2001. 26. Shukunami C, Oshima Y, and Hiraki Y. Molecular cloning of tenomodulin, a novel chondromodulin-I related gene. Biochem Biophys Res Commun 280: 1323-1327, 2001. 27. Thomas M, Langley B, Berry C, Sharma M, Kirk S, Bass J, and Kambadur R. Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation. J Biol Chem 275: 40235-40243, 2000. 28. Wagner K, McPherron A, Winik N, and Lee S. Loss of myostatin attenuates severity of muscular dystrophy in mdx mice. Ann Neurol 52: 832-836, 2002. 29. Whittemore L, Song K, Li X, Aghajanian J, Davies M, Girgenrath S, Hill J, Jalenak M, Kelley P, Knight A, Maylor R, O'Hara D, Pearson A, Quazi A, Ryerson S, Tan X, Tomkinson K, Veldman G, Widom A, Wright J, Wudyka S, Zhao L, and Wolfman N. Inhibition of myostatin in adult mice increases skeletal muscle mass and strength. Biochem Biophys Res Commun 300: 965-971, 2003. 30. Zhao B, Wall R, and Yang J. Transgenic expression of myostatin propeptide prevents diet-induced obesity and insulin resistance. Biochem Biophys Res Commun 337: 248-255, 2005.

113

31. Zimmers T, Davies M, Koniaris L, Haynes P, Esquela A, Tomkinson K, McPherron A, Wolfman N, and Lee S. Induction of cachexia in mice by systemically administered myostatin. Science 296: 1486-1488, 2002.