Regulation of S. aureus pathogenesis via TRAP · 16/10/2000 · Regulation of S. aureus pathogenesis via TRAP Author list in alphabetical order: Naomi Balaban1,2,* Tzipora Goldkorn3,

Regulation of S. aureus pathogenesis via TRAP

Author list in alphabetical order:

Naomi Balaban1,2,* Tzipora Goldkorn3, Yael Gov2, Miriam Hirshberg4, Nir Koyfman2 Harry R. Matthews5, Rachael T.

Nhan1, Baljit Singh1, Orit Uziel2

1. Department of Pathology, University of California, Davis, Medical Center, Davis, CA 95616, U.S.A.

2. Department of Human Microbiology, Sackler School of Medicine, Tel Aviv University, Tel Aviv, Israel

3. Department of Internal Medicine, University of California, Davis, CA 95616, U.S.A.

4. Department of Biochemistry, University of Cambridge, 80 Tennis Court Road, Old Addenbrooke’s Site, Cambridge CB2

1GA, UK.

5. Department of Biological Chemistry, University of California, Davis, Davis, CA 95616, U.S.A.

*Corresponding author

Send correspondence to: Dr. Naomi Balaban, Department of Pathology, Research Bldg. 3, University of California Davis,

Medical center, Sacramento, CA 95817, USA. Tel. 916-734-3218. Fax 916-734-2698. Email: [email protected]

Running Title = Regulation of Pathogenesis

1

Copyright 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on October 16, 2000 as Manuscript M005446200 by guest on M

arch 31, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on M


ww

.jbc.org/D

ownloaded from

by guest on M


ww

.jbc.org/D

ownloaded from

by guest on M


ww

.jbc.org/D

ownloaded from

by guest on M


ww

.jbc.org/D

ownloaded from

by guest on M


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

http://www.jbc.org/

http://www.jbc.org/

http://www.jbc.org/

http://www.jbc.org/

http://www.jbc.org/

SUMMARY

Staphylococcus aureus can cause disease through the production of toxins. Toxin production is autoinduced by the protein

RNAIII activating protein (RAP) and by the autoinducing peptide (AIP), and is inhibited by RNAIII inhibiting peptide (RIP)

and by inhibitory AIPs. RAP has been shown to be a useful vaccine target molecule, and RIP and inhibitory AIPs as

therapeutic molecules to prevent and suppress S. aureus infections. Development of therapeutic strategies based on these

molecules has been hindered by a lack of knowledge of the molecular mechanisms by which they activate or inhibit

virulence. Here we show that RAP specifically induces the phosphorylation of a novel 21kDa protein while RIP inhibits its

phosphorylation. This protein was termed TRAP, for “target of RAP”. The synthesis of the virulence regulatory molecule,

RNAIII, is not activated by RAP in the trap mutant strain, suggesting that RAP activates RNAIII synthesis via TRAP.

Phosphoamino acid analysis shows that TRAP is histidine phosphorylated, suggesting that TRAP may be a sensor of RAP.

AIPs upregulate the synthesis of RNAIII also in trap mutant strains, suggesting that TRAP and AIPs activate RNAIII

synthesis via distinct signal transduction pathways. Furthermore, TRAP phosphorylation is downregulated in the presence of

AIP, suggesting that a network of signal transduction pathways regulate S. aureus pathogenesis.

2

by guest on March 31, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

INTRODUCTION

Staphylococcus aureus is a gram-positive bacteria that can cause many different types of diseases, ranging from minor skin

infections to pneumonia, endocarditis, and toxin shock syndrome (1). Many of the diseases caused by S. aureus have been

associated with the toxins the bacteria produce (2,3,4). Toxic exomolecules include proteases, hemolysins, enterotoxins and

toxic shock syndrome toxin (TSST-1) (1) that not only cause disease but also contribute to the survival of the bacteria in the

host (5).

In culture, the bacteria produce toxic exomolecules only when in higher densities, at the post exponential phase of growth. In

the early exponential phase, when in lower densities, the bacteria express surface molecules such as fibronectin binding-

proteins and fibrinogen binding-protein that allow the bacteria to adhere to and colonize host cells. The ability of the bacteria

to switch between expression of surface adhesion molecules and toxin exomolecules (1) is regulated primarily by an RNA

molecule termed RNAIII (6,7,8). It is hypothesized that it enables the bacteria to adhere to host cells when in low numbers,

but to disengage and spread when too crowded, thus allowing dissemination and establishment of the infection.

RNAIII is encoded by the agr locus (6) and regulates at least 15 genes coding for potential virulence factors. agr mutants are

non pathogenic and show a decreased synthesis of extracellular toxins and enzymes, such as alpha-, beta-, and delta-

hemolysin, leucocidin, lipase, hyaluronate lyase, and proteases, and at the same time an increased synthesis of adhesion

molecules, coagulase and protein A (2,9). The agr locus contains two divergent transcription units, RNAII and RNAIII,

driven by the promoters P2 and P3, both of which are active only from the mid exponential phase of growth (9). RNAII

contains four open reading frames (ORFs): agrA, agrB, agrC, and agrD. The agrA and agrC genes encode a classical two-

component signal transduction pathway composed of the AgrC signal receptor and the AgrA response regulator. The agrD

gene product is a propeptide that is processed and secreted through AgrB, which is an integral membrane protein. The

resultant mature autoinducing peptide (AIP) (10) is the ligand that binds to and activates the phosphorylation of AgrC (11),

which in turn is thought to phosphorylate AgrA, leading to upregulation of RNAIII synthesis (12).

The synthesis of RNAIII is regulated by a quorum sensing mechanism (13). Molecules produced and secreted by the bacteria

(autoinducers) accumulate, and when they reach a threshold concentration, RNAIII is synthesized. The autoinducers of

3


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

RNAIII that have been described to-date are the RNAIII activating protein (RAP) (14,15,16) and the agr-encoded

autoinducing peptides (AIPs) (10,17,18). RAP is a ~38kDa protein containing an NH2-terminal sequence IKKYKPITN

(GenBank AF205220) (16). The AIPs are octapeptides encoded by the agr, are processed from AgrD, and activate RNAIII by

inducing the phosphorylation of their receptor AgrC. Interestingly, AIPs produced by some S. aureus strains inhibit the

expression of agr in other strains, and the amino acid sequences of peptide and receptor (AgrC) are markedly different

between such strains, suggesting a hypervariability-generating mechanism (18). Biochemical analysis of AIPs has suggested

that they contain an unusual thiol ester-linked cyclic structure, which is absolutely necessary for full biological activity (10).

RNAIII synthesis can be inhibited by antibodies directed against RAP. Mice vaccinated with RAP were shown to be

protected from a S. aureus infection. The protection level correlated with the titer of anti-RAP antibodies, suggesting that

RAP is a promising vaccine candidate (15). RNAIII synthesis can be inhibited by AIPs of non-self (10,18), and by RNAIII

inhibiting peptide (RIP) (14,15,16,20). The RIP peptide is produced by coagulase negative staphylococcus (suggested to be

S. warnerii or S. xylosus) (16,19) and has the sequence YSPXTNF, where X can be a cysteine, a tryptophan, or a modified

amino acid. Both native RIP and a synthetic analogue YSPWTNF are extremely effective in inhibiting RNAIII synthesis in

vitro and in suppressing S. aureus infections in vivo (15,20). RIP (native or synthetic) has been shown to prevent S. aureus

SD cellulitis in mice (15). Synthetic RIP has been shown to prevent keratitis (tested in rabbits against S. aureus 8325-4),

osteomyelitis (tested in rabbits against S. aureus MS), mastitis (tested in cows against S. aureus Newbould 305, AE-1, and

environmental infections) and septic arthritis (tested in mice against S. aureus LS-1) (20). These findings strongly evidence

the potential value of RIP as a therapeutic agent. The therapeutic potential of inhibiting RNAIII synthesis was confirmed by

Mayville et al. (10), where it was demonstrated that peptides (AIPs) that inhibit RNAIII synthesis in vitro do in fact inhibit S.

aureus infections in vivo.

Whereas the therapeutic potential of RAP, RIP and inhibitory AIPs is not in dispute, many questions remain unanswered and

hinder the development of vaccines and therapeutics. These include understanding the detailed mechanism by which RAP,

RIP and AIPs regulate RNAIII synthesis; the precise mutual interactions between RAP, RIP and AIPs and the signal

transduction pathway that leads to RNAIII synthesis and concludes in virulence.

4


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Because of the sequence similarity between the NH2- terminal sequence of RAP and RIP (YKPITN as compared to

YSPXTN), and because RIP has been shown to compete with RAP on the activation of RNAIII synthesis, we hypothesized

that RAP and RIP may bind to the same receptor, one as an agonist (RAP) and the other as an antagonist (RIP). To test for

this hypothesis, RIP derivatives were synthesized according to the putative NH2-terminal sequence of RAP and tested for

their ability to inhibit RNAIII synthesis in vitro and for their ability to prevent S. aureus cellulitis in vivo. The results of these

experiments indicate that the peptides most successful in inhibiting RNAIII synthesis and cellulitis were those that most

resembled the NH2-terminal of RAP and contained the sequence YKPITN (16). These results further suggest that RAP and

RIP may in fact act as an agonist (RAP) and an antagonist (RIP) to the same receptor.

Here we show that RAP activates and RIP inhibits the phosphorylation of a 21kDa protein. We termed this protein TRAP, for

“target of RAP”. Amino acid sequence analysis of TRAP indicates that it is a 167 amino acid polypeptide that is unique to S.

aureus. RAP does not activate RNAIII synthesis in a trap– mutant, suggesting that RAP activates RNAIII synthesis via

TRAP. We also show here that the phosphorylation of TRAP is inhibited by AIP of self, which uses the agr signal

transduction system to activate RNAIII synthesis. Taken together, our results indicate that the trap and the agr signal

transduction systems interact with one another, resulting in upregulation of RNAIII synthesis and in a coordinated production

of virulence factors.

EXPERIMENTAL PROCEDURES

Bacterial strains

Wild type S. aureus strain RN6390B (ATCC 55620). agr-null S. aureus mutant strain RN6911 (6). RIP-producing,

coagulase negative Staphylococcus strain RN833 (ATCC 55619) (14,15,16,19). S. aureus strain RN4220, a mutant of the

wild type S. aureus strain 8325-4 that is capable of accepting foreign DNA (21). S. aureus strain OU20, containing a

disrupted trap, grown at 42oC in the presence of 10µg/ml erythromycin. Unless mentioned otherwise, all bacteria were grown

in CY broth supplemented with β-glycerophosphate (21) at 37oC with shaking from early exponential phase of growth.

5


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Preparation of RAP

To purify RAP, RN6390B cells were grown to the post exponential phase of growth. Growth culture was centrifuged at 6,000

xg for 10 minutes at 4oC. The supernatant was collected and filtered through a 0.22µm filter to remove residual cells. The

supernatant was lyophilized (FlexiDry MP Lyophilizer) and resuspended in water to a tenth of the original volume (total

10x). 15ml of 10x supernatant was applied to a 10kDa cutoff membrane (Centriprep 10 (Amicon)). This enabled us both to

concentrate the material further and to remove material which is smaller than 10kDa. 1ml concentrated material greater than

10kDa was washed twice in PBS by resuspending it in 15ml PBS and re-concentrating it on the Centriprep 10 and the

material greater than 10kDa collected (>10), which is usually at a 25x-40x concentration. This material contains no AIP and

was used for RAP/RIP or RAP/AIP competition assays (see below) as well as for the further purification of RAP. To further

purify RAP, 600 µl of >10 were fractionated on a gel filtration FPLC column (Superose 12, Pharmacia) in 1mM phosphate

buffered saline pH 7.2 (0.1x PBS), at a flow rate of 0.5 ml/min, and 1ml fractions collected. Fractions were concentrated to a

tenth of their original volume by lyophilization and tested for RNAIII by northern blotting, as described below. Active gel

filtration fraction (1ml) was collected and RAP was further purified by anion exchange chromatography (HPLC SynchroPak

Q300, Keystone Scientific, Inc.) in water pH 7.2. Bound material was eluted by a salt gradient of 0-1M NaCl in water in 1ml

fractions. 38kDa RAP eluted at 0.75M NaCl. Active fraction was lyophilized and resuspended in 100µl water (10x active

fraction, or RAP). To test for activity, 50µl 10x active fraction (RAP) was applied to 450µl early exponential cells (containing

about 2x109 cells) which prepared as described below, in vivo phosphorylation assays.

Preparation of AIP and RIP

To partially purify AIP from RN6390B post exponential culture supernatants or native RIP from RN833 post exponential

supernatants, cells were grown to the post exponential phase of growth. Growth culture was centrifuged at 6,000 xg for 10

minutes at 4oC. The supernatant was collected and filtered through a 0.22µm filter to remove residual cells. The supernatant

was lyophilized (FlexiDry MP Lyophilizer) and resuspended in water to a tenth of the original volume. 15ml of 10x

concentrated supernatant was applied to a 3kDa cutoff membrane (Centriprep 10 (Amicon)) and material smaller than 3kDa

(flow through) was collected and used to test for activity. To test for activity, 50µl of the flow through was applied to 450µl

early exponential cells (containing about 2x109 cells) which prepared as described below, in vivo phosphorylation assays or

6


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

activation of RNAIII synthesis.

In vivo Phosphorylation Assays

S. aureus RN6390B cells (4ml) were grown in CY/GP from lag phase of growth (OD650 of 0.03) until early exponential

phase of growth of OD650 of about 0.2 (equivalent to about 1x109 cells/ml). Cells were collected by centrifugation at

3000xg for 30 minutes or 2min at 12,000xg. Supernatants were discarded and cell pellet was resuspended in 0.9ml phosphate

free buffer (PFB, 20mM KCL, 80mM NaCl, 20mM NH4Cl, 0.14mM Na2SO4, 100mM Tris pH 7.4, 2.5mM MgCl2, 0.1mM

CaCl2, 2µM FeCl2, 0.4% glucose, 9µg/ml thiamine, 0.8mM potassium phosphate buffer pH 7.4, 0.25mM L-arginine,

0.21mM L-histidine, 0.62mM L-lysine, 0.13mM L-glutamic acid, 0.056mM glycine, 0.32mM L-alanine, 0.46mM L-

valine, 0.36mM L-isoleucine, 0.82mM L proline, 0.016mM L-phenylalanine, 0.50mM L-serine, 0.34mM L-threonine,

0.016mM L-tyrosine, L-0.27mM cystein, 0.21mM L-methionine, 0.13mM L-asparagine, 0.029mM Nicotinic acid.

0.13mM L-glutamine) and 28µCi radiolabeled orthophosphate (32P) (ICN Biochemicals). Cells were grown with shaking for

40 min at 37oC in the presence of the following material (prepared as described above): 50µl of total post exponential

supernatant (total 10x, containing 80% AIP and 20% RAP (16)), 50µl AIP, 50µl RAP, 50µl native RIP, with synthetic RIP

(10µg RIP/4x106 cells) or with 50µl control buffer. For growth phase experiments, cells in PFB and 32P were grown for the

times indicated. Cells were collected by centrifugation for 2min 12,000 x g, supernatants removed and cells pellets were

washed once in PBS to remove unincorporated 32P. Radiolabeled cells were resuspended in 20µl of 50µg/ml lysostaphin in

10mM Tris pH 8.0 1mM EDTA for 10min at room temperature, Laemmeli sample buffer was added (without boiling), and

sample (total cell homogenate) was separated by SDS 7.5-15% PAGE. Gel was autoradiographed and density of bands

determined. Gel was then stained in coomassie to ensure that equal amounts of protein were in fact loaded on the gel.

For RAP/RIP or RAP/AIP competition experiments, 450µl cells in PFB and 32P prepared as described above were incubated

with 50µl RAP (40x >10) which was partially purified from post exponential supernatants (see above, preparation of RAP),

together with 50µl, 25µl, and 12.5µl native RIP or AIP (prepared as described above) and the volume adjusted to 550µl with

CY. This gave us an estimated RAP:RIP or RAP/AIP ratio of 1:1, 1:0.5 and 1.025.

7


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Activation of RNAIII synthesis

Early exponential 6390B (450µl) were incubated with 50µl of the sample in question (prepared as described above: RAP,

AIP, total 10x, native RIP, CY or PBS) for 30min while shaking at 37oC. Cells were collected by centrifugation (2min

12,000xg) and RNA purified as described below. If cells were incubated with synthetic RIP, the amount peptide used was

10µg/4x106 cells.

Detection of RNAIII and TRAP transcript: RNA purification and northern blotting

Equal number of cells were resuspended in 50µl lysostaphin in TES buffer (200µg/ml lysostaphin (Sigma) in 100mM Tris pH

7.2, 1mM EDTA, 20% sucrose) and incubated for 10 minutes at room temperature. 50µl of 2% SDS containing Proteinase K

(100 µg/ml) was added and vigorously vortexed for 1 minute followed by 10min incubation at room temperature. The sample

was frozen and thawed twice. 15µl RNA sample was mixed with 11% deionized glyoxal, 16mM phosphate buffer pH 7.0 and

55% DMSO (final concentrations) and incubated for 1hr at 65oC. RNA loading buffer (Ambion) was added and sample (of

about 5x108 cells) applied to a 1% agarose gel in 10mM phosphate buffer pH 7.0 supplemented with 5mM Iodoacetic acid

(Sigma). Gel was northern blotted by dry transfer, membrane stained in methelene blue to view RNA and ensure that the

same amounts of RNA were transferred. Membrane was prehybridized using rapid-hyb (Amersham) followed by

hybridization with PCR radiolabeled RNAIII specific DNA (6), or with PCR radiolabeled 3’ trap (nt 400-550). Gels were

autoradiographed and intensity of band determined using quantitative analysis program (Molecular Analyst).

TRAP-P purification

Cell pellet of 500 ml early exponential S. aureus cells (grown as described above) was resuspended in 30 ml PFB, 560 µCi

32P and 3ml RAP, and grown for 1hr with shaking at 37oC. Cells were collected by centrifugation, washed in PBS, and

resuspended in 2.5ml of water containing 100µg/ml lysostaphin (Sigma) and incubated on ice for 20min. 7.5ml water were

added, and cells were further incubated on ice for 20min and cells disrupted by extensive sonication (Sonic Dismembrator,

Fisher Scientific, microtip probe) (3 times for 10 seconds each time on ice). Sonicated material was centrifuged (10min

12,000xg), and soluble material collected. Soluble material was concentrated by lyophilization (Savant, Speedvac Plus

8


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

SC110A) to 800µl. Material was fractionated on gel filtration HPLC column (Bio-Sil SEC-125 300x7.8mm, BioRad) in

1mM phosphate buffered saline pH 8.0 at a flow rate of 1ml/min. 1ml fractions were collected and tested for radioactivity in

a scintillation counter (Beckman, LS600 MultiPurpose Scintillation Counter). Samples containing high counts per min

(CPM) in comparison with the rest of the fractions were selected and separated by SDS 15% PAGE and gel

autoradiographed. The fraction containing the radiolableled 21kDa protein (phosphorylated TRAP) was used to further purify

TRAP by anion exchange chromatography (HPLC SynchroPak Q300, Keystone Scientific, Inc.) in 0.1x PBS pH 7.5. Bound

material was eluted by a salt gradient of 0-1M NaCl in 0.1x PBS pH 7.5. Fractions containing high CPM were separated by

SDS 15% PAGE and gel autoradiographed to determine the fraction-containing TRAP. Phosphorylated TRAP eluted at

0.75M NaCl. 21kDa radioactive band was cut and submitted for amino acid sequencing (see below).

Amino acid sequence analysis

Anion exchange TRAP-containing fraction was applied on SDS PAGE, the gel stained in coomassie and autoradographed.

Protein band corresponding with phosphorylation was cut and N-terminally sequenced or subjected to tryptic digest for

acquiring internal sequences. Specifically, gel was dried, rehydrated in 50mM ammonium bicarbonate pH 7.8 and incubated

with 0.5µg trypsin overnight at 37oC. Peptides were extracted by 70% acetonitrile/5% formic acid, and fractionated on a C18

HPLC (Vydac, 4.6x25) in 0.1% TFA. Peptides were eluted at a 115 min gradient of 0-70% acetonitrile. Peptides were

collected and amino acid sequenced commercially by Edman degradation chemistry (ABI 477 sequencer, Protein Structure

Laboratory, UC Davis). Sequences were compared to the S. aureus Genome Sequencing Project database and the sequence of

TRAP determined. Primers corresponding to the 5’ and the 3’ end of the gene were constructed, trap was amplified by PCR,

and DNA sequence confirmed.

Inactivation of trap

An internal 317bp fragment (#73- #390) of the trap gene was amplified by PCR using the following primers: 1. 5’-

CGCGCGGATCCCAACTATTCCAATTTTCAG - 3’ (containing BamHI site) and 2. 5’ -

CGCGAAGCTTCTTAAAGTCTTCGTATG-3’ (containing HindIII site). The amplified PCR fragment was cloned into the

BamHI/ HindIII sites of the pAUL-A vector (kindly provided by S. Del-Cardayre), which is a shuttle vector between S.

9


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

aureus and E. coli. This plasmid contains an erythromycin resistance marker and carries a temperature sensitive mutation at

the S. aureus origin of replication, and therefore is capable of replication in S. aureus cells only in the permissive temperature

of 30oC. S. aureus strain RN4220 cells (a restriction deficient derivative of strain 8325-4 which is therefore capable of

accepting foreign DNA (21) were transformed with the above construct by electroporation as described (22), and

transformants were grown on NYE agar (23) in the presence of 10µg/ml erythromycin in the permissive temperature of 30oC

over night. Transformants were grown on NYE agar in the presence of 10µg/ml erythromycin in the restrictive temperature of

42oC over night. Colonies were analyzed for integration of the plasmid into the chromosome at the trap site via a Campbell

insertion process. The analysis was done by PCR, employing primers that are homologous to the plasmid region (universal

reverse primer 5’ GTAAAACGACGGCCAGT 3’) and absent in the chromosome, and a primer that is homologous to the

pre- 5’ end of the trap gene and is not present on the plasmid construct (5’ GTGGTAATGACTAGTTTATCATCGT 3’ (nt

–59 to –34). A DNA fragment of 500 bp was generated using the above primers, indicating the integration of the plasmid and

disruption of trap.

Phosphoamino acid analysis

Purified radiolabeled TRAP-P was applied to SDS-PAGE. Slices of acrylamide, containing labeled TRAP-P, were excised

and submerged in 3 N KOH at 105 °C for 5 h. Resulting hydrolysate was diluted 25-fold with water containing internal

standards of phosphoserine and phosphotyrosine. Phosphoamino acids were separated by ion-exchange chromatography

(24). O-Phthalaldehyde was added to the eluate, and the resulting fluorescence was detected on-line (24). Radioactivity was

quantified by liquid scintillation counting. Phospholysine and phosphohistidine were synthesized as described previously

(24). All other standards were purchased from Sigma. In this system, phosphoarginine and phospholysine elute before

phosphoserine, phosphothreonine elutes close to phosphoserine, and phosphohistidine elutes between phosphoserine and

phosphotyrosine (24).

10


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

RESULTS

RAP activates and RIP inhibits RNAIII synthesis and the phosphorylation of a 21kDa protein

Early exponential wild type S. aureus cells were incubated for 40min in the presence of RAP, synthetic RIP (Genemed

Synthesis, Inc. CA), or with PBS only as a control. Cells were collected, RNA purified, northern blotted, and membranes

incubated with radiolabeled RNAIII specific DNA as a probe. As previously demonstrated (14, 16) and as shown in Fig. 1,

RAP activates and RIP inhibits RNAIII synthesis. The pathway by which the autoinducer RAP activates and the peptide RIP

inhibits RNAIII synthesis was not known, but it was hypothesized that RAP and RIP interact with the same receptor, one as

an agonist (RAP), the other as an antagonist (RIP). Therefore, it seemed reasonable to assume that like other quorum sensing

molecules, they would regulate a bacterial two component system by phosphorylation (25). To identify the signal

transduction pathway regulated by RAP and RIP, in vivo phosphorylation assays were performed. Early exponential wild

type S. aureus were incubated in phosphate free buffer supplemented with radiolabeled orthophosphate, together with RAP in

PBS, with PBS, or with RIP (native or synthetic). After a 40min incubation period, the cells were collected by centrifugation,

treated with lysostaphin, followed by the addition of sample buffer, and without boiling, total cell homogenate was applied to

both 7.5 % and 15% SDS PAGE and the gel stained in coomassie or autoradiographed. As shown in Fig. 2, RAP activates

and RIP inhibits the specific phosphorylation of a 21kDa protein which we termed TRAP. Endogenous RAP is produced as

the cells grow (14), probably contributing to the positive signal in the control PBS group (Fig. 2 lane 1). To determine if RIP

competes with RAP on TRAP phosphorylation, cells were incubated with RAP together with increasing amounts of native

RIP (at RAP:RIP ratio of: 1:1, 1:0.5, and 1:0.25), and in vivo phosphorylation assays were carried out. As demonstrated in

Fig. 3, the higher the amount of RIP present, the lower the amount of TRAP phosphorylation, suggesting that RIP competes

with RAP on the phosphorylation of TRAP.

To determine whether RAP induces the synthesis of TRAP and not only its phosphorylation, the in vivo phosphorylation

assays were carried out in the presence of 100µg/ml chloramphenicol (Cm), to inhibit potential translation processes. The

results of these experiments (not shown) indicate that RAP activates TRAP phosphorylation also in the presence of Cm,

suggesting that RAP activates TRAP phosphorylation and not synthesis.

Structure of TRAP

11


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

To purify TRAP, wild type early exponential S. aureus cells were in vivo phosphorylated, cells were disrupted by extensive

sonication, and soluble material containing phosphorylated TRAP (TRAP-P) was fractionated on an HPLC gel filtration

column. Positive fractions (determined by peak radioactivity and confirmed by separating a sample on SDS PAGE) were

applied to an HPLC anion exchange column and bound material was eluted by a 0-1M NaCl gradient. Positive fraction

containing TRAP-P eluted at approximately 0.75M NaCl.

To determine the amino acid sequence of TRAP, purified TRAP was internally digested by trypsin, and peptide digests were

amino acid sequenced. Acquired sequences were compared to the S. aureus database and the sequence of TRAP was

determined to be a 167 amino acid polypeptide (Fig. 4) (GenBank accession number for nucleotide sequence: BankIt301902

AF202641). The sequence of TRAP (Fig. 4 A,B) is unique to S. aureus and shows no significant sequence homologies to

known proteins or genes but for 5’ end of the Bacillus subtilis penicillin-binding protein gene (pbpF), with which it shares

28% identity (26). 2D proton NMR spectra (not shown) reveal a folded protein made up of both α-helices and β-sheet

secondary structure elements, in agreement with sequence and threading analysis (Fig. 4C) generated by the PHD package

(27).

RAP does not activate RNAIII synthesis in the trap mutant strain

The trap gene was inactivated by gene disruption. An internal 317bp fragment of the trap gene lacking regions of about 100

bp from the 5’ and the 3’ ends of the gene was cloned into pAUL (Fig. 5A), a temperature sensitive shuttle vector (kindly

provided by S. Del Cardayre), and plasmid used to transform S. aureus RN4220 cells. Transformants were analyzed for

integration of the plasmid into the chromosome at the trap site via a Campbell insertion process. The analysis was done by

PCR, employing primers that are homologous to the vector and to the 5’ sequences of the pre-trap gene not present on the

plasmid construct. A DNA fragment of about 500 bp was generated, indicating the integration of the plasmid and the

disruption of trap, resulting in a trap– mutant strain (S. aureus OU20). Sequence analysis of OU20 indicated the replacement

of the 3’ end of the trap gene (from nt 390) with pAUL DNA. S. aureus OU20 was in vivo phosphorylated in the presence of

RAP, and total cell homogenate applied to SDS PAGE, and TRAP-P detected by autoradiography. As shown in Fig. 5B,

while RAP activated the phosphorylation of TRAP in the trap+ strain (lane 1), it did not activate phosphorylation in the trap–

12


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

OU20 strain (lane 2), suggesting that in fact the trap gene was disrupted.

To test whether RAP activates the synthesis of RNAIII via TRAP, early exponential S. aureus trap+ and trap– cells were

incubated together with RAP, and after 40min cells were collected, RNA extracted, and RNAIII was analyzed by northern

blotting, using radiolabeled RNAIII specific DNA as a probe. As shown in Fig. 5C, while RNAIII synthesis was activated by

RAP in the parent trap+ strain, it was not activated in the trap– strain, suggesting that the presence of an intact trap gene is

necessary for RAP to activate RNAIII synthesis. To test whether RNAIII can be synthesized in the absence of TRAP during

bacterial growth, trap+ and trap– cells were grown for several hours from the early exponential phase of growth, and RNAIII

and TRAP tested by northern blotting. As shown in Fig. 5D, RNAIII synthesis was greatly reduced in the trap– mutant strain,

but was not abolished. These results suggest that trap is important for the activation of RNAIII synthesis, but that the

synthesis of RNAIII can never the less be activated at a later stage in the absence of TRAP, possibly by alternate pathways

such as sar (28,29). As also shown in Fig. 5D, trap transcription is in fact absent in the trap– strain, and is constitutive in the

trap+ strain. Of note is the fact that the translation of TRAP also appears to be constitutive in the wild type trap+ strain (data

not shown). The fact that trap is constitutively transcribed and translated while its phosphorylation is regulated, further

supports out results indicating that RAP regulates TRAP phosphorylation and not synthesis.

TRAP is histidine phosphorylated

Two-component systems act through phosphorylation of the substrate domain of the sensor protein and subsequent transfer

of the phosphate to an aspartate residue in the regulator protein. The initial phosphorylation is catalyzed by a protein histidine

kinase domain in the sensor protein and results in an N-phosphorylated histidine residue, which is stable in alkaline

conditions but not in acidic conditions (24).

To test whether TRAP may be histidine-phosphorylated, we tested the sensitivity of phosphorylated TRAP to acidic and

basic conditions. Phosphorylated TRAP was incubated in pH ranging from 1-10, for 10 min at room temperature. The

mixture was then applied to SDS PAGE and the gel autoradiographed. As shown in Fig. 6A, phosphorylation of TRAP was

13


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

found to be stable at pH greater than 8.0 but labile in lower pHs, consistent with a possible N phosphorylation of a histidine.

Phosphoamino acid analysis indicates that in fact TRAP-P contains phosphohistidine. Purified radiolabeled TRAP-P was

applied to SDS PAGE. Gel band containing TRAP-P was subjected to alkaline hydrolysis followed by chromatography (24).

The labeled phosphoamino acid eluted at the position of phosphohistidine, which is distinct from phosphoarginine,

phospholysine, phosphothreonine, phosphoserine or phosphotyrosine (Fig. 6B). Histidine phosphorylation indicates that

TRAP may in fact be a sensor of RAP.

Regulation of TRAP phosphorylation

RNAIII is produced only from mid exponential phase of growth, while TRAP is continuously transcribed (Fig. 5D). If RAP

activates RNAIII via TRAP phosphorylation, it seemed reasonable to assume that TRAP phosphorylation and RNAIII

synthesis should be coupled. To determine when TRAP is phosphorylated during bacterial growth, wild type S. aureus were

grown from early to late logarithmic phase of growth in the presence of 32P. Cells were collected at time intervals, and

assayed both for TRAP phosphorylation and for RNAIII synthesis. As shown in Fig. 7A,B, peak phosphorylation of TRAP is

reached at the mid exponential phase of growth. Peak phosphorylation of TRAP directly correlates with RNAIII synthesis,

supporting our hypothesis that RAP regulates RNAIII synthesis via TRAP phosphorylation.

As shown in Fig. 7A,B, TRAP reaches its peak phosphorylation by mid exponential phase of growth, but is dephosphorylated

by late logarithmic phase of growth. The RNAIII gene, on the other hand, once activated, remains upregulated throughout

growth (Fig. 7B). The fact that TRAP is dephosphorylated by late log indicates that TRAP phosphorylation is necessary only

for the induction of the RNAIII gene but not for its ongoing transcription.

AIP activates RNAIII synthesis but inhibits TRAP phosphorylation

RNAIII production has been shown to be autoinduced also by AIP, an octapeptide encoded by the agr itself. AIP activates

RNAIII synthesis by activating a two component system, also encoded by the agr. Specifically, once the agr is activated in

the mid exponential phase of growth, an octapeptide is produced (processed from AgrD), inducing the phosphorylation of a

46kDa protein AgrC (11), hypothesized to phosphorylate AgrA (12), leading to upregulation of RNAIII synthesis. To

14


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

determine the interaction of the agr and the TRAP signal transduction systems, we tested whether TRAP can be

phosphorylated also in an agr-null strain.

An agr-null S. aureus strain RN6911 (a mutant strain that contains a tetM gene instead of agr (6)) was grown from early to

late logarithmic phase of growth in the presence of 32P. Cells were collected at time intervals, applied on SDS PAGE and

autoradiographed. As shown in Fig. 7C, TRAP is phosphorylated also in the agr-null strain. Like in the wild type, peak

phosphorylation is reached at the mid exponential phase of growth. However, unlike in the wild type strain, TRAP was not

dephosphorylated by the late logarithmic phase of growth, suggesting that the agr itself, once activated in the mid exponential

phase, produces a factor which down regulates TRAP phosphorylation.

To determine if AIP is the dephosphorylating, agr-encoded factor, we incubated wild type cells with AIP, with RAP, or with

culture supernatants containing both RAP and AIP in a RAP:AIP ration of 20:80 (16). TRAP phosphorylation was tested by

in vivo phosphorylation assays, and RNAIII synthesis was tested by northern blotting. As shown in Fig. 8A,B, while RAP

activates RNAIII synthesis and activates TRAP phosphorylation, AIP activates RNAIII synthesis but inhibits TRAP

phosphorylation.

To test if AIP competes with RAP on TRAP phosphorylation, cells were grown in the presence of RAP together with

increasing amounts of AIP. As shown in Fig. 8C, the level of TRAP-P is dependent on the ratio between the two

autoinducers. The more AIP in the culture supernatant as compared to RAP, the less TRAP phosphorylation occurred. These

results can explain why TRAP is dephosphorylated from the mid exponential phase of growth, which is when agr is

activated, and when AIP is produced.

RAP and AIP activate RNAIII synthesis via different signal transduction pathways

RAP does not activate RNAIII synthesis in a trap– strains (Fig. 5C), suggesting that RAP activates RNAIII via TRAP

phosphorylation. To test whether AIP and RAP activate RNAIII synthesis by interacting with the same signal transduction

pathway, we tested whether AIP can activate RNAIII synthesis in a trap– strain. trap+ and trap– strains were grown in the

presence of RAP or AIP and tested for RNAIII synthesis. As shown in Fig. 8D, RAP did not activate RNAIII in the trap –

15


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

strain, while AIP activates RNAIII synthesis both in the trap+ and trap – strain. These results suggest that AIP does not

activate RNAIII via TRAP and that RAP and AIP activate RNAIII synthesis via different signal transduction pathways.

While AIP activates RNAIII synthesis via the agr system (phosphorylation of AgrC (11)), RAP activates RNAIII synthesis

via the TRAP system (phosphorylation of TRAP).

16


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

DISCUSSION

Our work demonstrates that the autoinducer of virulence RAP activates and the inhibitor of virulence RIP inhibits the

phosphorylation of a 21kDa protein termed TRAP. Amino acid sequence analysis of TRAP indicates that the 167 amino acid

polypeptide is unique to S. aureus. RAP does not activate RNAIII synthesis in a S. aureus strain containing a disrupted trap,

suggesting that an intact trap gene is necessary for the activation of RNAIII synthesis by RAP. Phosphoamino acid analysis

of TRAP-P indicates that TRAP is histidine phosphorylated, indicating that TRAP may be a sensor of RAP. Secondary

structure predictions suggest it, however, to be globular α-helix β-sheet protein, that does not have a trans- membrane

region that is classical for a histidine kinase. TRAP may therefore either be part of a non-classical histidine kinase (30), or

bound to a yet to be identified, membrane associated molecule (Figure 9).

TRAP reaches its peak phosphorylation by mid exponential phase of growth, but is dephosphorylated by late logarithmic

phase of growth. The gene for RNAIII, on the other hand, once activated, remains upregulated throughout. The fact that

TRAP is dephosphorylated by late log indicates that TRAP phosphorylation is necessary only for the induction of the RNAIII

gene but not for its ongoing transcription.

TRAP is phosphorylated also in the agr-null strain. Like in the wild type, peak phosphorylation is reached at mid exponential

phase of growth. However, unlike in the wild type strain, TRAP is not dephosphorylated by late log, suggesting that the agr

itself, once activated in the mid exponential phase, produces, or regulates the production of, a factor, which down regulates

TRAP phosphorylation.

One of the factors produced by the agr is the octapeptide AIP that also activates RNAIII synthesis. However, the agr locus is

temporally regulated, and therefore the AIP is only produced from mid exponential phase of growth (17). We show here that

while RAP activates RNAIII synthesis as well as TRAP phosphorylation, the AIP activates RNAIII synthesis but inhibits

TRAP phosphorylation. Furthermore, while RAP does not activate RNAIII synthesis in a trap– strain, AIP does upregulate

RNAIII synthesis in a trap– strain, suggesting that RAP and AIP activate RNAIII synthesis via different signal transduction

pathways. The fact that TRAP phosphorylation is downregulated in the presence of the AIP may explain why TRAP is

17


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

dephosphorylated at mid exponential phase of growth, coinciding with AIP production. The interplay between the two signal

transduction pathways suggests that TRAP and the agr gene products could be part of a phosphorelay system. The

phosphorelay is an extended and more complex version of the two component system, involving multiple activation signals

processed by at least two histidine kinases (30,31). We propose that while RAP (signal A) activates the TRAP signal

transduction (kinase A), the AIP (signal B) activates the agr system (kinase B), which probably leads to activation of a

phosphatase and to the dephosphorylation of TRAP (Figure 9).

It has been suggested that RNAIII synthesis is only regulated by the peptides encoded by the agr (AIPs) and that RIP is part

of the AIP family of peptides (19). While this may be the case, several experimental data do not support this hypothesis (16).

1. AIPs must contain a thiolactone structure to be active while the RIP peptides are synthesized without a cysteine and a

thiolactone structure and are active as linear peptides. 2. Both RIP and AIP of self inhibit TRAP phosphorylation, but while

RIP inhibits RNAIII synthesis, AIP of self activates RNAIII synthesis. 3. AIP activates RNAIII synthesis in a trap– strain

while RAP does not, suggesting that AIP and RAP activate RNAIII synthesis via different signal transduction pathways.

Furthermore, RIP prevents infections cause by various strains of S. aureus in different infection models, suggesting that unlike

the AIPs, RIP is not strain specific in its inhibitory activity.

In summary, we propose (Figure 9) that autoinduction of virulence occurs in a two step process. As the colony multiplies, the

autoinducer RAP accumulates and induces the phosphorylation of its target molecule TRAP, resulting in upregulation of agr

to produce RNAII (Balaban et al., unpublished). Once agr is activated (in the mid exponential phase of growth), AIP and its

receptor AgrC are produced. AIP upregulates the phosphorylation of its receptor, AgrC (11), leading to phosphorylation of

AgrA, to upregulation of RNAIII synthesis (9) and to down regulation of TRAP phosphorylation . Production of RNAIII, in

parallel with upregulation of sar (32) and sae (33), causes the expression of toxic exomolecules and the suppression of

adhesion molecules, resulting in dissemination and in disease. In the presence of anti-RAP antibodies, RIP or inhibitory

AIPs, RNAIII is not produced, and the pathogenic potential of the bacteria is greatly reduced (10, 15, 16, 20).

18


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

ACKNOWLEDGMENTS

We thank Andrea Carbone, UC Davis for her assistance in phosphoamino acid analysis, Dr. Ilya Borovok for helpful

discussions, and Prof. Gerald Cohen and Prof. Yair Aharonowitz for their generosity. We thank S. Del-Cardayre, for kindly

providing the pAUL-A plasmid. We thank Dr. Young Moo Lee and Tara Martinez, Protein Structure Laboratory, UC Davis,

for their assistance in resolving the amino acid sequence of TRAP. We thank B.A. Roe, Yudong Qian, A. Dorman, F. Z.

Najar, S. Clifton and J. Iandolo, University of Oklahoma, who, with funding from the NIH and the Merck Genome Research

Institute, are carrying out the S. aureus Genome Sequencing Project. This project was supported by UCDHSRA, InterMune

Pharmaceuticals, AHA, and CTR.

19


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

REFERENCES

1. Lowy, F.D. (1998). New England Journal of Medicine 339, 520-532.

2. Abdelnour, A., Arvidson, S., Bremell, T., Ryden, C. and Tarkowski, A. (1993). Infect Immun. 61, 3879-3885.

3. Moreau, J. M., G. M. Sloop, L. S. Engel, J. M. Hill, and R. J. O’Callaghan. (1997). Curr. Eye. Res. 16, 1221-1228.

4. Gillaspy, A.F., Hickmon, S.G., Skinner, R.A., Thomas, J.R., Nelson, C.L. and Smeltzer, M.S. (1995). Infect Immun. 63,

3373-3380

5. Schmitt, C.K., Meysick, K.C. and O’Brien, A.D. (1999). Emerg Infect Dis. 5, 224-234.

6. Novick, R.P., Ross, H.F., Projan, S.J., Kornblum, J., Kreiswirth, B. and Moghazeh, S. (1993). EMBO J. 12, 3967-3975.

7. Balaban, N. and Novick, R.P. (1995). FEMS Microbiol. Letts. 133, 155-161.

8. Moerfeldt, E., Taylor, D., Von Gabain, A. and Arvidson, S. (1995). EMBO J. 14, 4569-4577.

9. Novick, R.P., Projan, S.J., Kornblum, J., Ross, H.F., Ji, G., Kreiswirth, B., Vandenesch, F. and Moghazeh, S. (1995). Mol

Gen Genet. 248, 446-458.

10. Mayville, P., Ji, G., Beavis, R., Yang, H., Goger, M., Novick, R.P. and Muir, T. (1999). Proc Natl Acad Sci USA 96,

1218-1223.

11. Lina, G., Jarraud, S., Ji, G., Greenland, T., Pedraza, A., Etienne, J., Novick, R.P. and Vandenesch, F. (1998). Mol

Microbiol. 28, 655-662.

12. Morfeldt, E., Panova-Sapundjieva, I., Gustafsson, B. and Arvidson, S. (1996). FEMS Microbiol Lett 143, 195-201.

13. Kleerebezem, M., Quadri, L.E., Kuipers, O.P. and de Vos, W.M. (1997). Mol Microbiol. 24, 895-904.

14. Balaban, N. and Novick, R.P. (1995). Proc. Natl. Acad. Sci. USA 92, 1619-1623.

15. Balaban, N., Goldkorn, T., Nhan, R.T., Dang, L.B., Scott, S., Ridgley, R.M., Rasooly, A., Wright, S.C., Larrick, J.W.,

Rasooly, R. and Carlson, J.R. (1998). Science 280, 438-40.

20


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

16. Balaban, N. Singh, B., Goldkorn, R.T. Rasooly, A. Torres, J.V. and Uziel, O. (2000). Science 287, 391a.

17. Ji, G., Beavis, R. and Novick, R.P. (1995). Proc. Natl. Acad. Sci. 92, 12055-12059.

18. Ji, G., Beavis, R. and Novick, R.P. (1997). Science. 276, 2027-2030.

19. Novick, R.P., Ross, H.F., Figueiredo A.M.S., Abramochkin, G. and Muir T. (2000). Science 287, 391a.

20. Balaban, N., Cullor, J.S., Hume, E.B., Medina-Acosta, E., Vieira da Motta, O., O’Callaghan, R., Rossitto, P.V., Shirtliff,

M.E., Serafim da Silveira L. and Torres, J.V. (2000). Peptides. In Press.

21. Novick, R.P. (1991). Methods Enzymol. 204, 587-636.

22. Schenk, S. and Laddaga, R. A. (1992). FEMS Microbiol. Lett. 94, 133-138.

23. Lee, C. Y., Buranen, S. L., and Ye, Z. H. 1991. Gene 103, 101- 105.

24. Wei, Y.F. and Matthews, H.R. (1991). Methods Enzymol. 200, 388-414.

25. Russo, F.D. and Silhavy, T.J. (1993). Trends Microbiol. 1, 306-310.

26. Popham, D.L. and Setlow, P. (1993). J. Bacteriol. 175,4870-4876.

27. Rost, B. and Sander, C. (1993). J. Mol Biol. 232, 584-599.

28. Cheung, A.L., Bayer, M.G., Heinrichs, J.H. (1997). J Bacteriol 179, 3963-3971.

29. Chien, Y. and Cheung, A.L. 1998. .J. Biol Chem . 273, 2645-2652.

30. Perraud, A.L., Weiss, V. and Gross, R. (1999). Trends Microbiol. 7, 115-120.

31. Tzeng, Y.L., Feher, V.A., Cavanagh, J., Perego, M. and Hoch, J.A. (1998). Biochemistry, 37, 16538 –16545.

32. Bayer, M.G., Heinrichs, J.H. and Cheung, A.L. (1996). J Bacteriol. 178, 4563-4570.

33. Giraudo A.T., Calzolari A., Cataldi A.A., Bogni C., Nagel R. (1999). FEMS Microbiol Lett. 177, 15-22.

21


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

FIGURE LEGENDS

Fig. 1. RNAIII synthesis is activated by RAP and inhibited by RIP.

Early exponential S. aureus cells were incubated for 40 min together with synthetic RIP (lane 1), with PBS as a control (lane

2) or with RAP (lane 3) as described in the methods section “Activation of RNAIII synthesis”. RNA was purified, and equal

amount of RNA were applied to the gel and the gel was northern blotted. RNAIII was detected using radiolabeled RNAIII

specific DNA as a probe. Membrane was autoradiographed and density of bands determined.

Fig. 2. The phosphorylation of TRAP is activated by RAP and inhibited by RIP.

Wild type early exponential S. aureus cells were in vivo phosphorylated in the presence of PBS only as a control (lane 1),

synthetic RIP (lane 2), or RAP (lane 3). Cells were collected, and total cell homogenate applied to 15% SDS PAGE (A,C) or

to 7.5% SDS PAGE (B). The gel was coomassie stained (A) or autoradiographed (B,C). Approximate molecular weight is

indicated in kDa.

Fig. 3. RIP competes with RAP of TRAP phosphorylation.

In vivo phosphorylation: RAP/RIP competition experiment. Wild type early exponential cells in PFB and 32P (450µl) were

incubated with 50µl RAP (>10) which was partially purified from post exponential supernatants (lane 1), with PBS as a

control (lane 2), with 50µl native RIP (lane 3) or with 50µl partially purified RAP (>10) together with 50µl, 25µl, and 12.5µl

native RIP, and the total volume adjusted to 550µl with CY (lanes 4-6). This gave an estimated RAP:RIP ratio of 1:1 (lane

4), 1:0.5 (lane 5) and 1:0.025 (lane 6). After 60 min cells were collected, and total cell homogenate applied to SDS PAGE

and gel autoradiographed.

Fig. 4 A,B. Amino acid sequence of TRAP (A) and DNA sequence of trap (B).

Fig. 4C. Secondary Structure Prediction (SSP) of TRAP generated by the PHD package (27). Cylinders and arrows denote

α-helix and β-sheet, respectively.

22


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Fig. 5A. pAUL-A containing trap nt 73-390.

Fig. 5B. In vivo phosphorylation of S. aureus containing a disrupted trap gene. Early exponential S. aureus trap and trap+

cells were in vivo phosphorylated in the presence of RAP. After 40min cells were collected, total cell homogenate applied to

SDS PAGE, and the gel autoradiographed. Lane 1: trap+. Lane 2. trap–.

Fig. 5C. The synthesis of RNAIII is not activated by RAP in the trap mutant strain. Early exponential S. aureus trap– and

trap+ cells were incubated for 40 min with PBS (RAP –) or with RAP (RAP +). RNA purified, and equal amount of RNA (10µg)

applied to the gel and the gel was northern blotted. RNAIII was detected using radiolabeled RNAIII specific DNA as a probe,

and membrane was autoradiographed.

Fig. 5D. The production of RNAIII is reduced in the trap– strain. Early exponential (1x109 cells/ml) S. aureus trap– and

trap+ cells were grown for one to four hours. Equal number of cells collected, RNA extracted, and RNAIII and TRAP transcript

tested by northern blotting and the membrane autoradiographed. Lane 1-4. Cells grown for 1-4 hrs respectively.

Fig. 6A. TRAP-P is stable in alkaline conditions. Phosphorylated TRAP was incubated for 10min at room temperature in

increasing pHs, applied on SDS PAGE, autoradiographed, and density of bands determined. Results are presented as % of

maximum phosphorylation observed (% of max).

Fig. 6B. TRAP-P contains phosphohistidine. An alkaline hydrolysate of radiolabeled TRAP-P was analyzed by

chromatography. The labeled phosphoamino acid eluted at the position of phosphohistidine (P-His), distinct from

phosphoarginine, phospholysine, phosphothreonine, phosphoserine (P-Ser) or phosphotyrosine (P-Tyr).

Fig. 7A,B. TRAP reaches peak phosphorylation at the mid exponential phase of growth: Wild type S. aureus were grown

from early to late log phase of growth in PFB together with 32P. Cells were collected at time intervals, and tested both for

23


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

RNAIII (by northern blotting) and for TRAP phosphorylation (by SDS PAGE). A. Cells were resuspended in sample buffer

and were applied to SDS 15% PAGE and the gel autoradiographed. Approximate molecular weight is indicated in kDa. B.

TRAP phosphorylation vs. RNAIII and cell #. Results are presented as % of maximum phosphorylation, RNAIII, or cell

number observed (% of max).

Fig. 7C. TRAP is phosphorylated in agr-null strains. Mutant agr-null S. aureus cells RN6911 were grown from early to late

log phase of growth in PFB together with 32P. Cells were collected, and total cell homogenate applied to SDS PAGE, and the

gel autoradiographed.

Fig. 8A,B,C. The phosphorylation of TRAP is activated by RAP and inhibited by AIP. A. Wild type early exponential S.

aureus cells were incubated for 1 hr in PFB, 32P, together with RAP (40x, >10) containing no AIP, with post exponential

total supernatant (total, containing 20% RAP and 80% AIP (16, 19)), with AIP (containing no RAP), or with PBS as a

control. Cells were collected, applied to SDS PAGE, and the gel autoradiographed. The autoradiogram was scanned and the

density of the bands determined.

B. In parallel, cells (in CY) were incubated in the presence of RAP, PBS, AIP and total supernatant for 40min and cells

assayed for RNAIII by northern blotting. Density of bands determined and results are presented as % of maximum RNAIII

observed (% of max).

C. In vivo phosphorylation: RAP/AIP competition experiment. Wild type early exponential cells in PFB and 32P (450µl)

were incubated with 50µl RAP (40x >10) which was partially purified from post exponential supernatants (lane 1), together

with 25µl AIP and 25µl CY (lane 2), or together with 50µl AIP (lane 3). This gave an estimated RAP:AIP ratio of 1:0 (lane

1), 1:0.5 (lane 2), and 1:1 (lane 3). After 40 min cells were collected, applied to SDS PAGE and gel autoradiographed and

density of bands determined (C).

Fig. 8D. RNAIII synthesis is activated by AIP but not by RAP in a trap mutant strain. Early exponential (1x109 cells/ml) S.

aureus trap– and trap+ cells were grown for 40min in the presence of RAP, PBS or AIP. Equal number of cells collected,

24


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

RNA extracted, and RNAIII tested by northern blotting and the membrane autoradiographed.

Fig. 9. Interaction of TRAP and AgrC. As the colony multiplies, the autoinducer RAP accumulates and induces the

phosphorylation of its target molecule TRAP (A), resulting in the production of RNAII (B). Once agr is activated (in the mid

exponential phase of growth), AIP and its receptor AgrC are produced (9). AIP downregulates TRAP phosphorylation and

upregulates the phosphorylation of its receptor, AgrC (B) (11), which is hypothesized to phosphorylate AgrA (C), which then

acts as a transcription activator to activate P3 (12), leading to the production of RNAIII. Production of RNAIII, in parallel

with upregulation of sar and sae, causes the expression of toxic exomolecules and the suppression of adhesion molecules (C)

(6, 32, 33), resulting in dissemination and in disease. RAP; RNAIII activating protein. AIP; autoinducing peptide. TRAP;

target of RAP.

25


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

by guest on March 31, 2020 http://www.jbc.org/ Downloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://www.jbc.org/


http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://www.jbc.org/

Matthews, Rachael T. Nhan, Baljit Singh and Orit UzielNaomi Balaban, Tzipora Goldkorn, Yael Gov, Miriam Hirshberg, Nir Koyfman, Harry R.

Regulation of S. aureus pathogenesis via TRAP

published online October 16, 2000J. Biol. Chem.

10.1074/jbc.M005446200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M005446200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M005446200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2000/10/16/jbc.M005446200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2000/10/16/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2000/10/16/jbc.M005446200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

Additions and Corrections

Vol. 276 (2001) 2658–2667

Regulation of Staphylococcus aureus pathogenesis viatarget of RNAIII-activating protein (TRAP).

Naomi Balaban, Tzipora Goldkorn, Yael Gov, MiriamHirshberg, Nir Koyfman, Harry R. Matthews, Rachael T. Nhan,Baljit Singh, and Orit Uziel

Page 2658, top right: The DOI of the Paper in Press (PIP) asshown on the print version is in error. The DOI should read:10.1074/jbc.M005446200.

Page 2658, right column: The GenBank™ accession numberappeared in the PIP version but was deleted in the final print/on-line version. The sentence ending 5 lines from the bottom ofthe page should read: NH2-terminal sequence IKKYKPITN(GenBank™ accession number AF205220) (16).

Vol. 276 (2001) 8904–8909

Dinucleotides as growth-promoting extracellularymediators. Presence of dinucleoside diphosphates Ap2A,Ap2G, and Gp2G in releasable granules of platelets.

Joachim Jankowski, Joost Hagemann, Martin Tepel, Markusvan der Giet, Nina Stephan, Lars Henning, Ioanna Gouni-Berthold, Agapios Sachinidis, Walter Zidek, and HartmutSchluter

Dr. Gouni-Berthold’s name was printed incorrectly. Thecorrected version is shown above.

Vol. 275 (2000) 20814–20821

The high resolution crystal structure of yeast hexo-kinase PII with the correct primary sequence providesnew insights into its mechanism of action.

Paula R. Kuser, Sandra Krauchenco, Octavio A. C. Antunes,and Igor Polikarpov

The Protein Data Bank accession numbers for the structuresincluded in this paper were omitted. The PDB code is 1IG8 andthe RCSB code is RCSB013246.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 276, No. 23, Issue of June 8, pp. 20803–20804, 2001© 2001 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

We suggest that subscribers photocopy these corrections and insert the photocopies at the appropriateplaces where the article to be corrected originally appeared. Authors are urged to introduce thesecorrections into any reprints they distribute. Secondary (abstract) services are urged to carry notice ofthese corrections as prominently as they carried the original abstracts.

20803

FIG. 9. Intracellular distribution ofnascent apoB-containing lipopro-teins in microsomal lumen of con-trol and fructose-fed hepatocytes.Cultured primary hamster hepatocyteswere pulsed for 45 min with [35S]methi-onine, and the radioactivity was chasedfor 0 or 1 h. Labeled cells were thensubjected to homogenization and frac-tionation of microsomes. Luminal li-poproteins were extracted from micro-somes by carbonate treatment and wereseparated from the membrane fractionby centrifugation followed by fraction-ation on a sucrose-gradient. After cen-trifugation, gradient fractions were col-lected and immunoprecipitated with ananti-hamster apoB antibody. Immunopre-cipitates were analyzed by SDS-PAGEand fluorography, and apoB radioactivitywas quantitated by cutting and scintilla-tion counting of the apoB-100 band. A,luminal lipoproteins in control hepato-cytes at 0 and 1 h chase; B, luminal li-poproteins in fructose-fed hepatocytes at0 and 1 h chase.

Vol. 275 (2000) 8416–8425

Mechanisms of hepatic very low density lipoprotein overproduction in insulin resistance. Evidence for enhancedlipoprotein assembly, reduced intracellular apoB degradation, and increased microsomal triglyceride transferprotein in a fructose-fed hamster model.

Changiz Taghibiglou, Andre Carpentier, Stephen C. Van Iderstine, Biao Chen, Debbie Rudy, Andrea Aiton, Gary F. Lewis, andKhosrow Adeli

Page 8423, Fig. 9: The wrong figure was published although the legend is correct. The correct figure is shown below.

Data Interpretation: The interpretation of the data in Fig. 9 does not significantly change with this correction. However, animportant observation also reported previously should be emphasized further. As observed in the corrected Fig. 9, microsomesfrom control cells had a significant amount of dense apoB-containing lipoproteins (HDL density), at both 0 and 1 h, which wereabsent in hepatocytes from fructose-fed hamsters. The absence of HDL-dense apoB particles suggests the stimulated state ofVLDL assembly and secretion in hepatocytes of fructose-fed hamsters.

Additions and Corrections20804

Additions and Corrections

Vol. 276 (2001) 1850–1856

Alkaline response genes of Saccharomyces cerevisiaeand their relationship to the RIM101 pathway.

Teresa M. Lamb, Wenjie Xu, Aviva Diamond, and Aaron P.Mitchell

Pages 1853 and 1854: We reported in Tables IV and V that avma4-lacZ fusion gene showed alkaline-induced, Rim101p-dependent expression. Subsequent analysis showed that thesestrains carried an arn4-lacZ fusion gene rather than the vma4-lacZ fusion gene. Therefore, our conclusion that VMA4 expres-sion responds to pH and to Rim101p is in error.

Vol. 276 (2001) 2658–2667

Regulation of Staphylococcus aureus pathogenesis viatarget of RNAIII-activating protein (TRAP).

Naomi Balaban, Tzipora Goldkorn, Yael Gov, MiriamHirshberg, Nir Koyfman, Harry R. Matthews, Rachael T. Nhan,Baljit Singh, and Orit Uziel

Page 2661: The left column, line 8 from the bottom, shouldread: “ . . . universal reverse primer 59-AACAGCTATGACC-ATG-39.”

Page 2662, Fig. 5: The arrow of Ery is drawn backward.Instead of pointing clockwise, it should point counterclockwise.

These changes do not affect the conclusions of the paper.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 276, No. 15, Issue of April 13, p. 12476, 2001© 2001 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

We suggest that subscribers photocopy these corrections and insert the photocopies at the appropriateplaces where the article to be corrected originally appeared. Authors are urged to introduce thesecorrections into any reprints they distribute. Secondary (abstract) services are urged to carry notice ofthese corrections as prominently as they carried the original abstracts.

12476

Documents

Regulation of S. aureus pathogenesis via TRAP · 16/10/2000 · Regulation of S. aureus pathogenesis via TRAP Author list in alphabetical order: Naomi Balaban1,2,* Tzipora Goldkorn3,