Upload
rozene
View
46
Download
1
Tags:
Embed Size (px)
DESCRIPTION
Random Design Building Bridges Between Science and Faith. H igher O rder T hinking in Biology Education. Science. Language. Communication. Culture. Mathematics. Music. History. Art. Religion. Information Science. Connecting the Dots. Higher Order in Biology Molecules to Mankind. - PowerPoint PPT Presentation
Citation preview
Random Design
Building Bridges Between Science and Faith
Higher Order Thinking in Biology Education
Connecting the Dots
Music Mathematics
Religion
Language
Art
Science
InformationScience
History
Communication Culture
Higher Order in BiologyMolecules to Mankind
I think I believeI am
Higher Order Thinking Requires:
• Openness/receptive to new dots
• Acquisition of new Dots
• Dots accurate and well-defined
• Processing Time
Barriers to Higher Order Thinking
• Limiting input of new dots
• Misunderstanding dots
• Focusing on wrong dots
• Language and Communication– Personal– Community/Transferance
Language Problem!Modern Day ‘Tower of Babel’
Examples:• Science• Evolution• Creationist• Random• Naturalism• Christian• Mutation
* Emotional obstacles
Coming to Terms with TermsDefinitions of Evolution
• Evolution, change through time (generic)• Evolution, (genetic mechanisms and development)• Evolution, (atheistic) • Chemical evolution (first life)
Is evolution a theory or a fact?
Evolution is a theory AND a fact!Fact - biological evolution has, and is occurring.
Theory – explains many diverse facts from different scientific disciplines.
Science and Faith
The Crux of the Issue: Scientists are suspicious that Christians
want to insert religious beliefs into science
Christians fear that science seeks to remove God from the picture altogether.
Are these suspicions and fears warranted?
Who will stop the cycle?
Understanding Randomness
• Apparent random processes are biological realities.– Sperm/egg– Biochemical/physical reactions– Immunity– Random Mutation and Selection (Evolution)
DNA
Sugar
Hemoglobin Cells
Antibodies
Genetic Record: Chromosome Comparisons of Humans and Apes
Understanding Randomness
Haphazard, coincidence, chance, purposeless.
Equal opportunity of occurrence! Biology as an equal opportunity process.
If random is defined as purposeless, then connecting this dot to a purposeful God is
IMPOSSIBLE!
Is Anything Truly Random?
21344321143223411342
21344321143223411342
21344321143223411342
Is Anything Truly Random?
01123581321345589 (Fibonacci Numbers)
Is Anything Truly Random?
213313424413241441323323223131 213313424413241441323323223131
Adenine = 1 Thymine = 2 Cytosine = 3 Guanine = 4
TACCACGTGGATGAGGACTCCTCTTCAGA AUGGUGCACCUGACUCCUGAGGAGAAGUCU
Met - Val - His - Leu -Thr - Pro - Glu - Glu - Lys –Ser (Hemoglobin gene codes for Hemoglobin Protein)
It is music to the ear! Listen!
A Super Intelligence Would Know No True Randomness
• EVERYTHING, regardless of deep complexity and apparent random nature, would actually possess logical, orderly, and purposeful connections.
**Randomness and evolution need not detract from belief in God: They can be viewed as part of a purposeful plan.
Fundamental Questions:
--Does the creative logic revealed by science demonstrate the existence of a Creator?
OR--Does the existence of innately creative natural laws eliminate God from the
picture altogether?
Honest answers to honest questions…
Random (Equal Opportunity) DesignRandom (Equal Opportunity) DesignA New Model for Science EducationA New Model for Science Education
Building Bridges Instead of Barriers
A New Direction Needed:• Win/Win: Each side granted core needs
• Commit to solutions - Set positive examples.
• Strengthen/affirm science and religious belief.
• Recognize role of language/emotions.
• Embrace and respect student diversity
Random (Equal Opportunity) DesignRandom (Equal Opportunity) DesignA New Model for Science EducationA New Model for Science Education
Random Design - a powerful process for creating higher order, especially in living beings. Harnessing
the laws of randomness, it functions by first generating large arrays of potential building blocks from which the most suitable candidates are sequentially incorporated
into an ever-advancing architectural design.
Random (Equal Opportunity) Design Random (Equal Opportunity) Design A New Model for Science EducationA New Model for Science Education
How does Random Design Work?
Random Design has three components:
1. The Driver imparts directionality to the world.2. The Mixer uses combinatorial mathematics to create infinite new possibilities for diversity – the raw material for extending order and structure.3. The Selector.
Random (Equal Opportunity) DesignRandom (Equal Opportunity) Design A New Model for Science Education A New Model for Science Education
How does Random Design Work? Question:
Presented with a problem to solve and no limitations of time and resources, which of the following approaches would most likely arrive at the best solution?
A. Think the problem through as best as possible, then try what seems to be the one best idea.
B. Think the problem through as best as possible, then try the best 10 ideas.
C. Try all potential possibilities.
This expansive approach is biology’s solution as well. In short, it is Random Design.
Examples: • Four chemical bases of DNA -- infinite # of genes.• Infinite genes -- infinite # of proteins.• Infinite # of proteins -- infinite diversity of life.
Key Point: Random Design has virtually no Limits!
The magic of combinatorial mathematics continuously searches for the very best solutions to life’s dynamic and never-ending challenges - the best, and perhaps only creative process up to the task of beginning, nurturing, and sustaining life on earth.
Random (Equal Opportunity) DesignRandom (Equal Opportunity) DesignA New Model for Science EducationA New Model for Science Education
Strengthening Science:Recognizes that science must be free to pursue
truth wherever it leads.
Refuses to redefine or compromise integrity of science to meet religious standards.
Does not explain biological processes and mechanisms in supernatural terms.
Random (Equal Opportunity) DesignRandom (Equal Opportunity) DesignA New Model for Science EducationA New Model for Science Education
Strengthening Religious Faith:• Permanent secure place for plausibility of
Creator.• Ecumenical, offering a larger more expansive
vision of God as Creator.• Restores credibility of religious
representatives.• Viable platform to restore trust and
relationships.
The Alpha and the Omega