INFECTION AND IMMUNITY, May 2004, p. 2791–2802 Vol. 72, No. 50019-9567/04/$08.00�0 DOI: 10.1128/IAI.72.5.2791–2802.2004Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Proteolytic Processing of the Mycoplasma hyopneumoniaeCilium Adhesin

Steven P. Djordjevic,1 Stuart J. Cordwell,2 Michael A. Djordjevic,3Jody Wilton,1 and F. Chris Minion4*

New South Wales Agriculture, Elizabeth Macarthur Agricultural Institute, Camden, New South Wales 2570,1 Australian ProteomeAnalysis Facility, Macquarie University, New South Wales 2109,2 and Genomic Interactions Group, Research School of

Biological Sciences, Australian National University, Canberra, Australian Capital Territory 2601,3 Australia,and Department of Veterinary Microbiology and Preventive Medicine, Iowa State

University, Ames, Iowa 500114

Received 28 August 2003/Returned for modification 15 October 2003/Accepted 7 January 2004

Mycoplasma hyopneumoniae is an economically significant swine pathogen that colonizes the respiratoryciliated epithelial cells. Cilium adherence is mediated by P97, a surface protein containing a repeating element(R1) that is responsible for binding. Here, we show that the cilium adhesin is proteolytically processed on thesurface. Proteomic analysis of strain J proteins identified cleavage products of 22, 28, 66, and 94 kDa.N-terminal sequencing showed that the 66- and 94-kDa proteins possessed identical N termini and that the66-kDa variant was generated by cleavage of the 28-kDa product from the C terminus. The 22-kDa productrepresented the N-terminal 195 amino acids of the cilium adhesin preprotein, confirming that the hydrophobicleader signal sequence is not cleaved during translocation across the membrane. Comparative studies of M.hyopneumoniae strain 232 showed that the major cleavage products of the cilium adhesin are similar, althoughP22 and P28 appear to be processed further in strain 232. Immunoblotting studies using antisera raisedagainst peptide sequences within P22 and P66/P94 indicate that processing is complex, with cleavage occurringat different frequencies within multiple sites, and is strain specific. Immunogold electron microscopy showedthat fragments containing the cilium-binding site remained associated with the cell surface whereas cleavageproducts not containing the R1 element were located elsewhere. Not all secreted proteins undergo multiplecleavage, however, as evidenced by the analysis of the P102 gene product. The ability of M. hyopneumoniae toselectively cleave its secreted proteins provides this pathogen with a remarkable capacity to alter its surfacearchitecture.

Mycoplasma hyopneumoniae, the etiological agent of enzo-otic pneumonia, significantly impacts swine production (28).During colonization, M. hyopneumoniae forms an intricate as-sociation with the ciliated epithelial lining of the porcine re-spiratory tract, leading to chronic respiratory disease. Coloni-zation disrupts the normal function of the mucociliaryescalator through ciliostasis, loss of cilia, epithelial cell death,and acute inflammation. This results in a purulent exudate(composed primarily of neutrophils and mononuclear cells) inthe airways (17). Disease resolution occurs only after a pro-longed period (if at all). M. hyopneumoniae colonization alsopredisposes the host to more-severe infections from secondarypathogens (2). For example, it is now clear that colonization byM. hyopneumoniae leads to more-severe and longer-lasting dis-ease with the porcine respiratory and reproductive syndromevirus (34). Thus, the impact of M. hyopneumoniae on swineproduction has not been fully realized.

It is known that the initial event in colonization by M. hyo-pneumoniae is binding to swine respiratory cilia (19, 32). In theabsence of binding activity, colonization does not occur (38).Identification of the molecules involved in cilium binding oc-

curred only after the discovery of adherence-blocking mono-clonal antibodies (MAbs) (36) and development of appropri-ate binding assays (37). These studies led to the cloning of thegene for the cilium adhesin of virulent strain 232 and identifi-cation of the cilium-binding region (9, 10, 21). (For clarity,subscripts will be used to distinguish proteins or adhesin frag-ments from different mycoplasma strains; i.e., P97232 desig-nates the P97 cilium adhesin fragment of strain 232.) Thesestudies also showed that the initial 126-kDa preprotein productof the cilium adhesin gene underwent a major cleavage eventat amino acid 195 to generate P97232 (9). The cilium-bindingmotif of P97232, which resides in the carboxy-terminal R1 re-peat region, consists of fifteen copies of the repeated 5-amino-acid motif AAKPV/E (9, 21). In geographically diverse strainsof M. hyopneumoniae, the cilium adhesin possesses variablenumbers of R1 repeat units, ranging from 8 in strain C1735/2to 15 in strain 232; the strain J adhesin possesses 9 copies of theR1 repeat units (35). A second repeat region, R2, consists ofthe 10-amino-acid motif GTPNQGKKAE that ranges from 3to 5 in the number of copies in strains of M. hyopneumoniaeand that is located downstream of R1 in the C terminus of theadhesin (9, 35). This sequence differs slightly in strain J (GAPSQGKKAE). In addition, other proteins (such as P102, thesecond gene in the two-gene cilium adhesin operon) (10) mayplay crucial roles in adherence.

One of the more perplexing observations with the cilium

* Corresponding author. Mailing address: Department of Veteri-nary Microbiology and Preventive Medicine, Iowa State University,Ames, IA 50011. Phone: (515) 294-6347. Fax: (515) 294-1401. E-mail:fcminion@iastate.edu.

2791

adhesin has been the multiple immunoblot banding patternobserved with whole-cell antigen and adherence-blockingMAbs that recognize the R1 repeat sequence of the P97 ad-hesin (36). Size variation of surface lipoproteins is now recog-nized as a common mechanism used by mycoplasmas to gen-erate antigenic diversity (27). This is usually demonstrated asan evenly spaced ladder pattern resulting from a change in thenumber of repetitive units in gene sequences during DNAreplication. The immunoblot profile represented by the ciliumadhesin of M. hyopneumoniae is atypical and has not beenobserved in other mycoplasma species, suggesting that a dif-ferent mechanism might be responsible. Also, P97 size varia-tion in the immunoblot profiles among different M. hyopneu-moniae strains is common (36). To examine this phenomenonin more detail, we studied the laboratory-adapted, nonadher-ent J strain and the virulent 232 strain, which binds cilia andcauses disease in pigs. Here we show that multiple posttrans-lational cleavage events are responsible for the size variation ofthe cilium adhesin protein revealed in immunoblot analysis.Immunogold electron microscopy showed that the R1 cilium-binding fragment remained closely associated with the externalsurface of the M. hyopneumoniae membrane, while other frag-ments of P97 had different staining patterns. Finally, examina-tion of P102 gene products showed that selective cleavage oftranslocated proteins was occurring in M. hyopneumoniae.

MATERIALS AND METHODS

Bacterial strains and plasmids. M. hyopneumoniae strains 232 (36) and J(NCTC 10110) were grown in modified Friis broth and harvested as described byZhang et al. (36) and Djordjevic et al. (7), respectively, at the mid- to late logphase when the pH of the media reached 6.8. All broth media were filtersterilized through 0.22-�m-pore-size filters. Mycoplasmas were harvested bycentrifugation and extensively washed with phosphate-buffered saline (PBS) toremove the remaining medium contaminants. Escherichia coli TOP10 [F� mcrA�(mrr-hsdRMS-mcrBC) �80lac �M15 �lacX74 deoR recA1 araD139 �(ara-leu)7697 galU galK rspL endA1 nupG] containing pISM405 was grown on Luria-Bertani agar or in Luria-Bertani broth (29) containing 100 �g of ampicillin/ml.Isopropyl-�-D-thiogalactopyranoside induction was carried out by addition toachieve a final concentration of 1 mM. Bacterial cultures were routinely grown at37°C, and liquid cultures were aerated by shaking at 200 rpm.

M. hyopneumoniae growth studies. Sterile tubes (each containing 6 ml of Friisbroth) were simultaneously inoculated with 300 �l of M. hyopneumoniae strain Jculture and incubated as described previously (7). M. hyopneumoniae cells wereharvested at 8, 16, 20, 24, 28, 40, 48, 52, and 56 h postinoculation, and the cellpellets were used for immunoblotting studies. Growth of M. hyopneumoniae wasmonitored spectrophotometrically at an optical density of 560 nm as describedpreviously (36). Optical density values at 560 nm versus time (in hours) afterinoculation were plotted to estimate the growth phase of M. hyopneumoniae ateach of the time points.

Construction and expression of mycoplasmal proteins. Hexahistidyl P97 andP102 fusion proteins were constructed using pTrcHisA (Invitrogen, Carlsbad,Calif.) and pQE9 (Qiagen, Alameda, Calif.) cloning vectors. Primers FMhp3(5�-GAACAATTTGATCACAAGATCCTGAATATACC) and RMhp4 (5�-AATTCCTCTGATCATTATTTAGATTTTAATTCCTG) (the underlined se-quences represent BclI) were used to amplify a 3,013-bp fragment representingbp 315 to 3321 of the P97 gene sequence containing amino acids 105 to 1107. Thetemplate for the amplification of P97 sequences was pMYCO161 (14). Thisplasmid contained the entire open reading frame (ORF) of P97 minus theN-terminal 74 amino acids. In addition, the five TGA codons had been modifiedto TGGs by site-directed mutagenesis (14). The PCR fragment was digested withBclI and inserted into the BamHI site of vector pTrcHisA. A construct with theproper fragment orientation was identified by restriction digestion and DNAsequencing and was designated pISM405. The plasmid was transformed into E.coli TOP10 cells for expression of recombinant proteins. The induction andpurification procedure used for recombinant mycoplasma proteins has beendescribed previously (20). The resulting 116-kDa recombinant P97-polyhistidine

fusion protein contained the R1 and R2 repeat regions as well as the majorcleavage site at amino acid 195 in the P97 sequence.

Two hexahistidyl fusion proteins were constructed in pQE9. One of these, p97N, spanned nucleotides 462 to 2421 of the P97 gene sequence (amino acids 150to 802 that lacked R1 and R2 sequences). To construct p97 N, primers p97-NF(5�- GGGTCGACCAAGATCCTGAATATACC) and p97-NR (5�-GGCTGCAGTTAGGCTGCTTTTAAGAAAAATGC) (the underlined sequences repre-sent SalI and PstI, respectively) were used to amplify a 1,959-bp fragment of theP97 gene from pMYCO161. This hexahistidyl fusion protein was used to gener-ate P97 N-terminal serum in rabbits (see below). To construct pR2, a fragmentspanning nucleotides 2936 to 3342 (amino acids 979 to 1114) of the J straincilium adhesin homologue p94 (accession number AF001398) was amplifiedusing primers pR2F (5�-GGGGATCCCAGGAAGTCAAGGTAACTAGT) andpR2R (5�-GGCTGCAGCCCGGGTTAGGATCACCGGATTTTGAATC) (theunderlined sequences represent BamHI and PstI, respectively). This fragmentwas cloned into pQE9, and the hexahistidyl fusion protein was used to generateR2 serum.

To clone the gene for P102, primers TH130 (5�-GCTTTATTGGATCCGAGTCAGCTAAAAGTAGC) and TH131 (5�-AAAATTCTGCAGTTATTTAACATAGTTTCTAATCAACCC) (the underlined sequences represent BamHI andPstI, respectively) were used to amplify a 2,568-bp fragment from plasmidpISM1217 (11) representing base pairs 144 to 2712 of the P102 gene sequence.The fragment was digested with BamHI and PstI and ligated into BamHI/PstI-digested, dephosphorylated pTrcHisA plasmid DNA. Site-directed mutagenesiswas performed on the resulting plasmid (pISM1249) through the use of a Quick-Change site-directed mutagenesis kit (Stratagene, La Jolla, Calif.) to remove thefive TGA codons in the cloned gene sequence, converting them to TGG.pISM1316.6, the final plasmid, was sequenced to confirm the sequence modifi-cations and proper frame of the gene.

Antisera. The MAb F1B6 has been described previously (36). It binds to theR1 region of the cilium adhesin that has at least three repeat sequences (21).Peptides with sequences TSSQKDPST (�NP97) and VNQNFKVKFQAL(NP97) were used to raise antibodies against P97/P66 and P22, respectively. AnImject maleimide-activated immunogen conjugation kit (Pierce Chemical Co.,Rockford, Ill.) was used to bind the peptides to keyhole limpet hemocyanin. P97N-terminal and R2 sera were each generated by subcutaneous immunization ofa New Zealand White rabbit with hexahistidyl products purified by nickel-affinitychromatography. Rabbits were each immunized on two occasions 1 month apart,and immune responses to the immunized antigen were monitored by immuno-blotting. Prebleed sera were collected prior to immunization with hexahistidylantigens for the preparation of control serum. Rabbits were euthanized, andserum was collected as described previously (35). Anti-P102 antiserum wasprepared from purified recombinant P102. The peptide conjugates and recom-binant P102 were then used to generate mouse hyperimmune antisera by themethod of Luo and Lin (18). The resulting antisera were tested by enzyme-linkedimmunosorbent assay using ovalbumin-peptide conjugate and purified recombi-nant P97 or P102 antigens and by immunoblot analysis with the recombinantantigens (data not shown). Alkaline phosphatase-conjugated goat anti-mouseimmunoglobulin heavy-plus-light-chain [Ig(H�L)] antibodies were purchasedcommercially (Southern Biotechnology Associates, Inc., Birmingham, Ala.).Goat anti-mouse IgG plus IgM labeled with 10-nm-diameter colloidal gold par-ticles (EY Laboratories, Inc., San Mateo, Calif.) were used in immunogoldelectron microscopy studies.

Immunoblot analysis. Sodium dodecyl sulfate-polyacrylamide gel electro-phoresis (SDS-PAGE) was performed as described by Laemmli (16) or usingCriterion Tris-HCl gels of various percentages and gradients with SDS-PAGEsample buffer (Bio-Rad Laboratories, Inc., Hercules, Calif.). For the mediumcontrol experiments, purified recombinant P97 was incubated with fresh andspent Friis media. Spent medium was prepared from a mid- to late-log-phaseculture harvested at 36 h that had been centrifuged and filtered through a0.1-�m-pore-size filter. Purified recombinant P97 (2.5 �g) in 20 �l of PBS wasdiluted 1:1 in fresh or spent medium and incubated overnight at 37°C. A total of10 �l of the mixture was then loaded onto SDS-PAGE gels, blotted to nitrocel-lulose, and developed with F1B6 MAb.

Trypsin treatment of M. hyopneumoniae. Mycoplasmas (0.5 g) were treatedwith trypsin essentially as described previously (35). Briefly, trypsin was added tocell suspensions of M. hyopneumoniae at concentrations of trypsin of 0, 0.3, 0.5,1, 3, 10, 50, and 300 �g/ml and incubated at 37°C for 15 min. Cell suspensionswere then immediately lysed in sample buffer and heated to 95°C for 10 min.Lysates were analyzed by SDS-PAGE and immunoblotting using F1B6 MAb.

2-DGE. Two-dimensional (2-D) gel electrophoresis (2-DGE) was carried outessentially as described by Cordwell et al. (3). First, dimension-immobilized pHgradient (IPG) strips (Amersham Pharmacia Biotech, Uppsala, Sweden) (180

2792 DJORDJEVIC ET AL. INFECT. IMMUN.

mm in length; linear pH 6 to 11) were prepared for focusing by submersion in2-DGE-compatible sample buffer (5 M urea, 2 M thiourea, 0.1% carrier am-pholytes 3 to 10, 2% [wt/vol] CHAPS, 2% [wt/vol] sulfobetaine 3 to 10, 2 mMtributyl phosphine [Bio-Rad]) overnight. M. hyopneumoniae whole-cell protein(250 �g) was diluted with sample buffer to a volume of 100 �l for application tothe anodic end of each IPG strip via an applicator cup. Isoelectric focusing wasperformed with a Multiphor II electrophoresis unit (Amersham Pharmacia Bio-tech) for 85 kV � h at 20°C. IPG strips were detergent exchanged, reduced, andalkylated in buffer containing 6 M urea, 2% SDS, 20% glycerol, 5 mM tributylphosphine, 2.5% (vol/vol) acrylamide monomer, a trace amount of bromophenolblue dye, and 375 mM Tris-HCl (pH 8.8) for 20 min prior to loading the IPGstrip onto the top of an 8 to 18% T–2.5% C (piperazine diacrylamide) 20-cm by20-cm polyacrylamide gel. Second-dimension electrophoresis was carried out at4°C using 3 mA/gel for 2 h followed by 20 mA/gel until the bromophenol blue dyehad run off the end of the gel. Gels were fixed in 40% methanol–10% acetic acidfor 1 h and then stained overnight in Sypro Ruby (Molecular Probes, Eugene,Oreg.). Images were acquired using a Molecular Imager Fx apparatus (Bio-Rad).Gels were then double stained in Coomassie blue G-250.

Postseparation analyses. Protein spots were excised from gels with a sterilescalpel and placed in a 96-well tray (8). Gel pieces were washed with 50 mMammonium bicarbonate–100% acetonitrile (60:40 [vol/vol]) and then dried in aSpeed Vac (Savant Instruments, Holbrook, N.Y.) for 25 min. Gel pieces werethen hydrated in 12 �l of a 12-ng/ml concentration of sequencing-grade modifiedtrypsin (Promega, Madison, Wis.) for 1 h at 4°C. Excess trypsin solution wasremoved, and the gel pieces were immersed in 50 mM ammonium bicarbonateand incubated overnight at 37°C. Eluted peptides were concentrated and de-salted using C18 Zip-Tips (Millipore Corp., Bedford, Mass.). The peptides werewashed on the column with 10 �l of 5% formic acid. The bound peptides wereeluted from the Zip-Tip in matrix solution (10 mg of �-cyano-4-hydroxycinnamicacid [Sigma]/ml in 70% acetonitrile) directly onto the target plate. Matrix-assisted laser desorption ionization–time-of-flight (mass spectrometry) [MALDI-TOF (MS)] mass spectra were acquired using either a Voyager DE-STR appa-ratus (PerSeptive Biosytems, Framingham, Mass.) or a TofSpec2E apparatus(Micromass, Manchester, United Kingdom). Both instruments were equippedwith 337-nm nitrogen lasers. All spectra were obtained in reflectron-delayedextraction mode, averaging 256 laser shots per sample. Two-point internal cali-bration of spectra was performed on the basis of the use of internal porcinetrypsin autolysis peptides (842.5 and 2211.10 [M�H]� ions). A list of monoiso-topic peaks corresponding to the mass of generated tryptic peptides was used tosearch a modified translated version of the M. hyopneumoniae genome (F. C.Minion, unpublished data). Successful identifications were made on the basis ofthe number of matching peptide masses and the percentage of sequence cover-age afforded by those matches. N-terminal Edman sequencing was performed aspreviously described (24).

For electrospray-ionization (ESI) tandem MS-MS peptide sequencing of theP102 C-terminal fragment, peptides were eluted from microcolumns in 1 to 2 �lof 50% methanol–1% formic acid directly into borosilicate nanoelectrosprayneedles (Micromass). Tandem ESI MS was performed using a Q-Tof of hybridquadrupole/orthogonal-acceleration TOF mass spectrometer (Micromass).Nanoelectrospray needles containing the sample were mounted in the source,and stable flow was obtained using capillary voltages of 900 to 1,200 V. Precursorion scans were performed to detect mass:charge (m/z) values for peptides withinthe mixture. The m/z of each individual precursor ion was selected for fragmen-tation and subjected to collision with argon gas at collision energies of 18 to 30eV. Fragment ions (corresponding to the loss of amino acids from the precursorpeptide) were recorded and processed using MassLynx version 3.4 software(Micromass). Amino acid sequences were deduced (using MassSeq software)(Micromass) according to the mass differences between y- or b-ion ladder seriesand confirmed by manual interpretation. Peptide sequences were then used tosearch the M. hyopneumoniae genome (Minion, unpublished).

Immunoelectron microscopy. M. hyopneumoniae strain 232 cells were grown tomid-log phase, pelleted by centrifugation, and washed with PBS. The final cellpellets were fixed with 3% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH7.2) at 4°C overnight. The pellets were then washed three times (15 min betweenchanges) with 0.1 M sodium cacodylate buffer and postfixed with 1% osmiumtetroxide in 0.1 M sodium cacodylate buffer for 2 h at room temperature. Thepellets were then washed with distilled water, passed through an acetone series,and embedded in Embed 812 and Araldite (Electron Microscopy Sciences, FortWashington, Pa.). Thin sections (80 to 90 nm in thickness) were then washed sixtimes with TS buffer (10 mM Tris, 150 mM sodium chloride, pH 7.4) and thenreacted with F1B6 ascites fluid (diluted 1:50), anti-�NP97 ascites fluid (1:10),anti-NP97 ascites fluid (1:10), or anti-P102 ascites fluid (1:10) overnight at 4°C.The grids were washed five times with TS buffer and then reacted with goat

anti-mouse IgG plus IgM labeled with 10-nm-diameter colloidal gold particles(EY Laboratories, Inc.) diluted 1:25 for 30 min at room temperature. The cellswere then washed five times with TS buffer, dried, contrasted with osmiumvapors for 2 min, and stained with uranyl acetate-lead citrate. The sections wereexamined on a Hitachi 500 electron microscope at 75 kV.

RESULTS

Immunoblot analysis. Zhang et al. showed multiple bandingpatterns of the cilium adhesin by SDS-PAGE using MAbsF1B6 and F2G5 (36). Subsequent studies showed that thoseMAbs reacted to the R1 repeat region of the P97232 adhesin ofstrain 232 near the carboxy terminus of the protein (10). Toextend these studies, antisera were raised to peptides locatedat two additional regions of the unprocessed P97232 gene prod-uct located on either side of the major cleavage site at aminoacid 195 (Fig. 1A). The peptide N-terminal sequencing resultsobtained with fragments of P97232 (identified on 2-D gels) arealso shown in Fig. 1A. The results obtained with M. hyopneu-moniae strain J cell lysates reacted with F1B6 are shown in Fig.1B (lane 1). The most strongly reactive proteins had masses of94, 66, 45, 33, and 29 kDa, although other more faintly reactingproteins are evident, especially between 120 and 66 kDa. Thelargest strongly reactive protein (94 kDa) represented what hasbeen thought to be the mature adhesin, as described previously(35). Evidence for processing of the cilium adhesin is shownwith peptide antisera �NP97 and NP97. Peptide antiserum�NP97 reacted with a subset of F1B6-reactive proteins withmasses of 94, 72, and 66 kDa in J strain lysates (Fig. 1B, lane2). Although proteins of 94 and 66 kDa were predicted to reactwith the �NP97 serum, we did not expect a protein with a massof approximately 72 kDa to be identified by this serum. Afaintly staining F1B6-reactive protein which migrates to thesame position of the blot as the 72-kDa fragment recognized by�NP97 serum was also identified.

J strain lysates reacted with peptide antiserum NP97 showedtwo proteins, one that migrated just above P94J and a secondof 72 kDa (Fig. 1B, lane 3). In consistency with our model forprocessing of the cilium adhesin in strain J (Fig. 1A), NP97serum did not react with P66J or P94J. Our data suggests thatthe 72-kDa protein is a processing product of the cilium ad-hesin recognized by both peptide antisera. Although the onlyprotein with a mass greater than P94J predicted by our modelis the cilium adhesin preprotein (with a predicted mass of 123kDa), we cannot rule out the possibility that other minor cleav-age products may be generated. Consistent with this is thepresence of two faintly staining, F1B6-reactive proteins withmasses greater than 94 kDa (lane 1), one of which most likelyrepresents P123J, the preprotein. Although P22 was not ob-served with NP97 serum (Fig. 1B, lane 3), a protein with thismass was identified using antisera raised to a recombinant,polyhistidine-tagged N-terminal fragment of P97 that did notcontain R1 or R2 (Fig. 1D). Furthermore, this antiserum iden-tified other fragments of the cilium adhesin (Fig. 1D), indicat-ing that processing of this molecule is more complex than iscurrently understood (see below).

To examine the effect of growth cycle on cilium adhesinprocessing, synchronous cultures of strain J were harvested atearly log (8 h), mid-log (16 to 28 h), and stationary (40 to 56 h)phases and cell lysates were examined by immunoblotting withMAb F1B6 (Fig. 1C), P97 N-terminal serum (Fig. 1D), and

VOL. 72, 2004 M. HYOPNEUMONIAE CILIUM ADHESIN PROTEOLYTIC PROCESSING 2793

FIG. 1. Map of the cilium adhesin of M. hyopneumoniae and immunoblot analysis using MAb F1B6 and anti-peptide, P97 N-terminal, and R2antisera. (A) The map shows antibody epitope locations, repeat regions, and selected cleavage sites identified by peptide mass fingerprint analysis,fragment masses, and N-terminal sequences. The major cleavage event at amino acid 195 (large arrow) and another event at amino acid 891 (smallarrow) are shown. The locations of the R1 and R2 repeat regions are represented by gray-shaded boxes. The locations of the epitope for MAbF1B6, �NP97 peptide, and NP97, P97 N-terminal (P97 N-term), and P28 antisera are shown as bars above or below the map. The coiled-coilregions are represented by the black boxes. The cleavage products of strains J and 232 are shown as gray-shaded bars below the map. Theirmolecular masses and N-terminal sequences are shown to the right of the map. ND, not determined. *, the peptide TSSQKDPSTLR was identifiedby peptide mass fingerprinting P70 from strain 232, suggesting that this molecule has the same N-terminal sequence as P97. (B) Immunoblotpatterns of M. hyopneumoniae strain J reacted with F1B6 (1:3,000), �NP97 (1:20), and NP97 (1:20). An SDS–12% polyacrylamide gel was usedto resolve J strain cell lysates. Molecular mass markers (MBI Fermentas) are shown on the left. Equivalent amounts of M. hyopneumoniae cell

2794 DJORDJEVIC ET AL. INFECT. IMMUN.

P28 serum (Fig. 1E). With F1B6, two strongly staining proteinsof 94 and 66 kDa were observed at all time points (Fig. 1C).Interestingly, a strongly reactive protein at 37 kDa appeared toincrease in intensity between 8 to 28 h but waned in intensitythereafter. Two F1B6-reactive proteins of 35 and 33 kDasteadily increased in intensity at each time point, reachingmaximum intensity at 56 h. A 30-kDa protein first appeared at20 h and continued to increase in intensity until 56 h (Fig. 1C).Faintly staining proteins of 120 (possibly representing the pre-protein), 100, 75 to 90, and 60 to 40 kDa were evident at timepoints between 16 and 56 h, but their intensity appeared toincrease only slightly within this period. These data suggestthat P94J and P66J and three proteins with masses between 33and 37 kDa represent the predominant F1B6-reactive adhesincleavage fragments that are present throughout the growthcycle of M. hyopneumoniae strain J.

Similar blotting experiments using M. hyopneumoniae J (leftpanel) strain lysates collected at different times during thegrowth phase and reacted with P97 N-terminal serum identi-fied strongly reactive proteins with masses of 94, 82, 72, 66, 24,and 22 kDa and faintly reactive proteins with masses of ap-proximately 50 and 120 kDa (Fig. 1D, left panel, lanes 1 to 4).The two proteins with masses of 24 and 22 kDa (possibly P22)failed to react with F1B6. None of the strongly straining F1B6-reactive proteins with masses between 33 and 40 kDa reactedwith P97 N-terminal serum (Fig. 1D, lanes 1 to 4), suggestingthat these represent processing products of the cilium adhesinthat possess R1- and R2-containing fragments. Blot analysis ofcell lysates of strain 232 (Fig. 1D, right panel) revealed asimilar pattern, indicating that the N-terminal half of the ci-lium adhesin is processed similarly in both strains. Similar blotsreacted with R2 serum identified strongly reactive J strainproteins with masses of 94 (P94J), 60, and 28 (P28J) and severalfaintly staining proteins with masses of 45, 35, and 33 kDa (Fig.1E, left panel). A protein of 28 kDa (possibly P28232) was onlyfaintly visible on blots containing cell lysates of strain 232reacted with R2 serum, and a 60-kDa protein was not ob-served. Furthermore, cell lysates of strain 232 reacted with R2serum recognized two proteins of 45 and 36 kDa (Fig. 1E, rightpanel). These observations provide further evidence that theC-terminal third of the cilium adhesin is processed differentlyin these two M. hyopneumoniae strains.

Collectively, our immunoblotting data suggest that that thecilium adhesin of M. hyopneumoniae undergoes complex,strain-specific processing. Although cleavage events that re-move P22J and P28J from the cilium adhesin appear to be fairlycommon events, other cleavage events also occur within P66J

(although perhaps not with the same frequency). This suggeststhat �NP7 and NP97 serum should recognize more cleavagefragments than were observed as indicated in Fig. 1B. Toexamine this more carefully, we used gradient gels to resolvecell lysates of strains J and 232 and reacted the blots with thesetwo sera (Fig. 1F). The pattern of reactivity with NP97 and�NP97 sera showed that there are at least four proteins withmasses greater than 60 kDa and proteins with masses of ap-proximately 37 to 39 kDa and 50 kDa that are recognized. Ourmodel (see Fig. 7) indicates how some of these NP97- and�NP97-reactive proteins might be generated. The pattern ofreactivity observed across multiple immunoblots with F1B6MAb showed that there are at least four proteins with massesgreater than 60 kDa and other fragments between 30 and 50kDa that are recognized. Minor mass differences betweensome of these fragments from strains J and 232 are probablydue to differences in the numbers of 5-amino-acid repeats inR1 and 10-amino-acid repeats in R2. Some high-mass frag-ments may not possess R1 and R2 and are not observed withF1B6 MAb or R2 antisera. Although some of these productsmay represent transient, low-abundance cleavage products,these complex patterns of reactivity are consistent with immu-noblot profiles generated using MAb F1B6 and P97 N-terminaland R2 antisera.

2-DGE and mass spectrometry. Previous studies have dem-onstrated that the gene product for the cilium adhesin of strain232 (126-kDa preprotein, 1,036 amino acids) undergoes acleavage event at amino acid 195 (9) (Fig. 1A). During peptidemass mapping studies of J strain proteins, four spots of 22, 28,66, and 94 kDa were identified that represented different frag-ments of the adhesin (Fig. 2). The cilium adhesin of strain J issmaller than that of strain 232; thus, its fragment sizes aresometimes slightly smaller. The N-terminal sequences forthese proteins allowed unequivocal alignment with the ciliumadhesin protein sequence. P94J mapped to a region that beginsimmediately downstream of amino acid 195 and continues tothe end of the ORF.

lysate were loaded in lanes reacted with �NP97 (lane 2) and NP97 (lane 3) antibodies. The amount of protein loaded in lane 1 (reacted with MAbF1B6) was approximately one-third of that loaded in lanes 2 and 3. (C) Immunoblot patterns (12% polyacrylamide gel) of synchronized M.hyopneumoniae strain J cultures harvested at different times postinoculation. The blot was reacted with MAb F1B6 (1:1,000). Equivalent amountsof protein were loaded in each lane. Lane 1, 8 h of growth (late lag phase); lane 2, 16 h of growth (early exponential phase); lane 3, 20 h of growth(mid-log phase); lane 4, 24 h of growth (mid-log phase); lane 5, 28 h of growth (mid-log phase); lane 6, 40 h of growth (late log-early stationaryphase); lane 7, 48 h of growth (stationary phase); lane 8, 52 h of growth (stationary phase); lane 9, 56 h of growth (stationary phase).(D) Immunoblot patterns (12% polyacrylamide gel) of synchronized M. hyopneumoniae strain J (left panel) and 232 (right panel) culturesharvested at different times postinoculation. The blot was reacted with P97 N-terminal serum (1:100). Equivalent amounts of protein were loadedin each lane. Lane 1, 20 h of growth (mid-log phase); lane 2, 28 h of growth (mid log phase); lane 3, 40 h of growth (late log-early stationary phase);lane 4, 56 h of growth (stationary phase). (E) Immunoblot patterns (10% polyacrylamide gel) of synchronized M. hyopneumoniae strain J (leftpanel) and 232 (right panel) cultures harvested at different times postinoculation. The blot was reacted with R2 serum (1:100). Equivalent amountsof protein were loaded in each lane. (Left panel) Lane 1, 8 h of growth (late log phase); lane 2, 16 h of growth (early exponential phase); lane 3,20 h of growth (mid-log phase); lane 4, 24 h of growth (mid-log phase); lane 5, 28 h of growth (mid-log phase); lane 6, 40 h of growth (late log-earlystationary phase); lane 7, 48 h of growth (stationary phase). (Right panel) Lane 1, 8 h of growth (late log phase); lane 2, 16 h of growth (earlyexponential phase); lane 3, 24 h of growth (mid-log phase); lane 4, 28 h of growth (mid-log phase); lane 5, 32 h (mid-log phase); lane 6, 40 h ofgrowth (late log-early stationary phase); lane 7, 48 h of growth (stationary phase). (F) Comparison (using NP97 and �NP97 antisera) ofimmunoblot patterns of strains 232 and J. Molecular weight markers (Bio-Rad Precision Proteins Standards) (broad range) are shown on the rightof the panel. An 8 to 16% Bio-Rad Criterion gradient gel was used to separate the proteins.

VOL. 72, 2004 M. HYOPNEUMONIAE CILIUM ADHESIN PROTEOLYTIC PROCESSING 2795

FIG. 2. Peptide mass fingerprint analysis of the cilium adhesin. (A) (Upper panel) 2-D electrophoresis was used to resolve M. hyopneumoniaeproteins, which were subsequently analyzed by peptide mass fingerprinting. (Upper left panel) Analysis of total J strain proteins. A region of thegel representing pH 8 to 10 is shown. The upper boxes indicate the proportion of the spots containing either P94J, P66J, or the 42-kDa fragmentof P102 as indicated. The lower larger boxed area is shown in expanded form on the right for a comparison of strains J and 232 in the region ofP28. (Lower panel) MALDI-TOF (MS) was used to analyze tryptic digests of indicated spots. The resulting fingerprints were matched to a databasecontaining theoretical tryptic digests of M. hyopneumoniae ORFs derived from genome sequencing analysis (Minion, unpublished). Each cleavageproduct (P22, P28, P66, and P94) is shown by the arrows above and below the sequence. Underlined sequences were matched by MALDI-TOF(MS). Unmatched sequences are shown in bold characters. Boxed sequences represent N-terminal protein sequences of isolated spots obtainedby Edman degradation. (B) Peptide mass mapping of a 42-kDa C-terminal fragment of P102. Underlined sequences were matched by MALDI-TOF (MS). Unmatched sequences are boldface. ESI MS-MS analysis was used to identify the sequence NSYFFPT (underlined). The N-terminalsequence AEEAKG indicates the beginning of the 42-kDa P102 fragment.

Two closely spaced proteins at 66 kDa had identical massmaps and corresponded to a region beginning immediatelydownstream of amino acid 195 of the adhesin and ending nearthe R1 repeat. N-terminal sequence analysis of P66 showed asequence (ADEKTSS) that is identical to that of P94J (Fig. 1and 2). Immunoblotting results with MAb F1B6 suggested thatP66J contains R1 (Fig. 1 and data not shown). Thus, the cleav-age event must occur immediately downstream of the R1 re-peat region. These data suggest that a fragment approximately28 kDa in size had been removed from the C terminus in some(but not all) of the P94J molecules. This observation was con-firmed when a 28-kDa fragment was identified that mapped tothe C terminus of P94J. Previously Wilton et al. showed thatantiserum raised against the 28-kDa C-terminal recombinantpeptide of the adhesin containing the R2 but not the R1 repeatregions recognized the largest adhesin band (94 to 97 kDa) indifferent strains of M. hyopneumoniae and recognized a 28-kDafragment only in strain J (35). In the present studies, 2-Dimmunoblots of J strain proteins probed with the anti-28-kDapeptide antiserum recognized both P28 and P94 proteins (datanot shown).

Tryptic peptide mass mapping showed that peptides fromP22J mapped to the first 190 amino acids of the strain J 123-kDa adhesin preprotein (Fig. 2). The N-terminal sequence ofP22J (SKKSKTF) aligned to amino acids 2 to 8 in the Nterminus (Fig. 2), suggesting that cleavage of the hydrophobicleader peptide (amino acids 8 to 22) is not necessary for trans-location of the cilium adhesin across the membrane. Similarstudies were performed with strain 232, and although the N-terminal sequence was not obtained for the P97-related pep-tides, the mass spectrometry data confirmed the identities ofP97232 and P70232 (data not shown). P28232 and P22232 werenot identified on 2-D (pI, 6 to 11) gels of strain 232 in regionsin which they appear in strain J (Fig. 2), suggesting that thesecleavage products undergo further processing in this strain.

Peptide mass mapping studies also identified a protein witha predicted mass of 42 kDa (Fig. 2A) that matched the C-terminal region of P102 (Fig. 2B). To determine whether thisprotein represented a bona fide C-terminal cleavage product ofP102 and not the product of a P102 paralog (Minion, unpub-lished), we performed ESI MS-MS of the 42-kDa protein. Thepeptide sequence NSYFFPTK unequivocally determined thatthe 42-kDa protein represented the C-terminal fragment ofP102, since this peptide was not predicted from P102 paralogsequences (Fig. 2B). The N-terminal sequence (AEEAKG) ofP42 was confirmed by Edman sequencing.

Medium effects on P97. To rule out the possibility that cleav-age of the cilium adhesin resulted from a proteolytic activity inthe medium used for growing M. hyopneumoniae in culture,purified recombinant P97232 was incubated with fresh andspent medium and then examined for proteolytic cleavage byimmunoblot analysis. Recombinant P97232 was obtained byinduction of strain TOP10 pISM405 and purification of thehistidine-tagged protein through the use of metal chelate chro-matography. Purity was confirmed by SDS-PAGE and immu-noblot analysis. Following elution from the column, P97-con-taining fractions were dialyzed against PBS. The solublerecombinant P97232 was then incubated with fresh and spentmodified Friis broth. The results of the study are shown in Fig.3. Because the medium contained 20% swine serum, large

quantities of swine Igs were present in the protein samples,causing some background staining with the anti-mouse conju-gate. However, it was still clear that neither fresh nor spentmedium contained proteolytic activity capable of cleaving sol-uble recombinant P97232 after 12 h of incubation at 37°C.Thus, cleavage of the cilium adhesin in mycoplasma cells wasmediated by mycoplasma-encoded activities that are not se-creted into the medium and was not due to medium compo-nents.

Trypsin sensitivity of R1-containing cleavage products. Im-munoblot analyses of strain J and 232 cells digested with dif-ferent concentrations of trypsin were used to investigate thecellular location of R1-containing cleavage fragments. TheF1B6 MAb typically recognized proteins with masses of 35, 66,88, 94, and 123 kDa in strain J (Fig. 4), and a similar patternwas observed for strain 232 (data not shown). Exposure ofintact M. hyopneumoniae to concentrations of trypsin rangingfrom 0.1 to 10 �g/ml showed a gradual loss of the higher-massproteins. Concentrations between 10 and 50 �g/ml resulted inthe loss of all the immunoreactive proteins (except one of 35kDa), indicating that R1-containing adhesin fragments are sur-face accessible. The pattern of digestion of R1-containing ad-hesin fragments was consistent in repeat experiments exceptthat the 35-kDa fragment was not reliably resistant to trypsin atconcentrations above 10 �g/ml. Analyses of identical blotsreacted with antiserum raised to recombinant M. hyopneu-moniae lactate dehydrogenase (previously shown to reside inthe cytosol) (31) and to antisera raised to recombinant frag-ments of pyruvate dehydrogenase subunits A and D showedthat these proteins remained detectable with trypsin concen-trations up to 500 �g/ml (data not shown). In control experi-ments in which lysed cells were exposed to trypsin, lactate

FIG. 3. Growth medium does not contain recombinant P97232cleavage activity. Recombinant P97232 was incubated in fresh and spentmedia overnight, and the products were resolved by immunoblottingusing MAb F1B6. Lanes: 1, molecular weight standards; 2, fresh me-dium; 3, spent medium; 4, fresh medium plus recombinant P97232; 5,spent medium plus recombinant P97232. The arrow indicates the po-sition of purified recombinant P97232.

VOL. 72, 2004 M. HYOPNEUMONIAE CILIUM ADHESIN PROTEOLYTIC PROCESSING 2797

FIG. 5. Immunolocalization of the cilium adhesin and cleavage products on the surface of M. hyopneumoniae strain 232. Thin sections weresuccessively labeled with normal mouse (A), mouse MAb F1B6 (B and C), mouse anti-peptide �NP97 (D to F), or mouse anti-peptide NP97 (Gand H) sera and 10-nm-diameter colloidal gold-conjugated goat anti-mouse Ig and negatively stained with 1% phosphotungstic acid. Arrowsindicate gold particles. Bars, 1 �m.

2798

dehydrogenase and pyruvate dehydrogenase subunit D wererapidly degraded (data not shown).

Immunogold electron microscopy. Antisera generatedagainst specific regions of the adhesin enabled analysis (usingimmunogold electron microscopy) of cleavage in vivo. Virulentstrain 232 was used in these studies, because the results wouldhave the most impact on our understanding of pathogenic mech-anisms. R1-specific MAb F1B6 and antisera raised to peptidesTSSQKDPST (�NP97 antiserum) and VNQNFKVKFQAL(NP97 antiserum) were used in these studies. The MAb F1B6remained associated with the mycoplasma membrane but notintimately associated with the cell (Fig. 5B and C), confirming aprevious report (36) and our trypsin studies described above.�NP97 antiserum reacted with membrane epitopes like MAbF1B6 did (Fig. 5D), but it also reacted with protein aggregates atlocations distal to the membrane in association with extracellularmaterial of unknown composition (Fig. 5D to F). NP97 antibodiesclustered in small aggregates in the cytosol or on the membrane

surface. Some aggregates were also observed outside the cell (Fig.5G and H). Anti-P102 antiserum reacted only with epitopes in theextracellular matrix and was never observed in association withthe membrane surface (Fig. 6).

P102 cleavage. To determine whether all surface proteinswere subject to the same extent of proteolytic digestion as P97,the fate of P102 was studied. The gene for P102 lies justdownstream of that for P97, generating a two-gene operonwith P97. Purification of recombinant P102 required tworounds of chromatography because of the low-level yield of themycoplasma gene product in E. coli (Fig. 6A). This is often thecase with mycoplasma proteins (Minion, unpublished). P102-specific antiserum was prepared from the recombinant proteinand used in immunoblot and immunogold studies. Anti-P102antibodies recognized proteins of 102, 72, and 42 kDa (accord-ing to the results of immunoblot analysis) (Fig. 6B). Immuno-gold labeling of M. hyopneumoniae showed that P102 was dis-tributed in the extracellular matrix and was not cell associated(Fig. 6C).

DISCUSSION

The cilium adhesin is a critical component of the M. hyo-pneumoniae virulence repertoire. It is the only molecule in thegenome that possesses the R1 cilium-binding domain (11), anessential element for adherence to porcine epithelial cells. Themolecule is not a lipoprotein, and it contains a single N-ter-minal transmembrane domain. Given its function in coloniza-tion, one could hypothesize that the molecule is translocated tothe cell surface through the general secretory pathway, whereit is locked into the membrane by the transmembrane domain,exposing the cilium-binding motif to the extracellular milieu.Previous studies, however, clearly showed that the adhesin iscleaved at amino acid 195, separating the transmembrane do-main from the cilium-binding epitope (9, 36) and complicatingthis model for placement of the cilium-binding activity in as-sociation with the cell surface. Obviously, the translocation ofthe adhesin and its maintenance on the cell surface are morecomplicated than originally thought. In addition, R1-specific

FIG. 6. Analysis of the surface protein P102 by immunoblotting and immunoelectron microscopy. (A) Analysis of recombinant P102 with aCoomassie blue-stained SDS-PAGE gel. Lane 1, uninduced E. coli culture; lane 2, induced E. coli culture; lane 3, purified polyHis-P102 fusion.Molecular weight markers (in thousands) are shown on the left. (B) Immunoblot of M. hyopneumoniae whole-cell lysate with anti-P102 antiserum.Molecular weight markers are shown on the left. (C) Immunoelectron microscopy of M. hyopneumoniae cells with anti-P102 antiserum. Bar, 1 �m.

FIG. 4. Trypsin digestion of M. hyopneumoniae strain J cells andimmunoblotting with MAb F1B6 (1:5,000). Each lane contains approx-imately 10 �g of J strain protein. Approximately 50 mg of mycoplasmawhole-cell protein was treated with the indicated concentration (inmicrograms per milliliter) of trypsin for 15 min at 37°C. Molecularmass markers (Bio-Rad) are shown on the left. Lanes: 1, 0 �g/ml; 2, 0.3�g/ml; 3, 0.5 �g/ml; 4, 1 �g/ml; 5, 3 �g/ml; 6, 10 �g/ml; 7, 50 �g/ml; 8,300 �g/ml.

VOL. 72, 2004 M. HYOPNEUMONIAE CILIUM ADHESIN PROTEOLYTIC PROCESSING 2799

MAbs (according to the results of immunoblot analysis) rec-ognize multiple proteins, further clouding our understandingof this molecule.

Our data demonstrate that the cilium adhesin is cleaved notat one site, as previously reported (9, 36), but at multiple sites,generating a family of peptides that remain in association withthe cell or extracellular matrix proteins (Fig. 1 and 5). Sincevirtually all fragments of the adhesin recognized by MAb F1B6and the anti-28-kDa antiserum are surface accessible (Fig. 4)(35), the simplest model would argue that cleavage occursprimarily on the extracellular side of the membrane. Cleavageat amino acid 195 may occur during translocation, since littleuncleaved preprotein (P123) was identified on immunoblotswith MAb F1B6 (Fig. 1). The cleavage event that removes P28from the preprotein may occur prior to the removal of P22 ina proportion of adhesin molecules (Fig. 7). This is shown byexperiments that identify proteins (other than P97232 and P94J)with masses greater than 66 kDa that react with antisera NP97,�NP97, MAb F1B6, P97 N terminal, and R2 (Fig. 1B to F). Wehave not identified these proteins on 2-D gels by peptide massmapping analysis to confirm this. Cleavage at other sites was aslower process, resulting in a collection of partially cleavedfragments of P97232 in the cell population (Fig. 1C). Thissuggests that cleavage at most sites and membrane transloca-tion are not integrated events. To eliminate the possibility thatcleavage of the cilium adhesin is an artifact arising from themedium, we tested fresh and spent mycoplasma media withrecombinant full-length P97232 and found no proteolytic activ-ity (Fig. 3), confirming that cleavage is a mycoplasma-associ-ated activity.

Many secreted proteins undergo proteolytic processing thatis essential to their function. Processing typically occurs at thebacterial cell surface and usually comprises one or two proteo-

lytic cleavage events (4). We also examined whether anothersurface protein undergoes extensive proteolytic cleavage in M.hyopneumoniae. Results with anti-P102 hyperimmune serashow that complex processing is protein specific. Cleavage ofP102 may be occurring at most at one or two sites (Fig. 6B).Peptide mass matching and ESI MS-MS confirmed that a 42-kDa protein represented the C-terminal cleavage fragment ofP102 (Fig. 2B). Further studies are required to confirm theidentity of the remaining protein with a predicted mass of 72kDa (Fig. 6B). Additionally, previous studies of a 65-kDa li-poprotein did not indicate proteolytic cleavage of that mole-cule while grown in culture (13). Thus, it seems likely thatproteolytic activity on the mycoplasma membrane surface isselective. How the decision is made respecting which proteinsto digest is unclear.

Comparative peptide mass mapping studies demonstratedcomplex, differential processing between strains J and 232. Insome aspects, processing was similar. Figure 2 shows the re-sults obtained with strain J, and parallel studies with strain 232identified two proteins of 70 and 97 kDa whose mass mapswere virtually identical to those of P94J and P66J. The presenceof six extra copies of the R1 repeat in the strain 232 proteinscould account for the size differences of P70232 and P97232 (Fig.2). Immunoblots probed with antiserum raised against a recom-binant 28-kDa fragment of P94J containing R2 but not R1 (Fig.1E) (35) recognized P97232 but not P70232, suggesting that cleav-age between the R1 and R2 regions generates P70232 fromP97232. That the same antisera recognized P28232 very poorly anddid not recognize it at all stages of the growth cycle (Fig. 1E) andthat we were unable to locate P28232 or P22232 on 2-D gels ofstrain 232 in regions in which they were identified in strain J (Fig.2A, upper right panel) suggests that further processing is occur-ring in strain 232 and in other strains in which P28 is not observedby immunoblotting analysis (35). P22 sequences were identical inthe two strains and should have been present in the 2-D gel, butthe P28 sequences differed in the two strains; the predicted massand pI values for P28232 were 24.6 kDa and 5.88 and for P28J

were 26.0 kDa and 8.39, respectively. Whether this can explain thelack of cilium-binding activity with strain J and its inability tocolonize and infect is still unclear.

The single most important processing event in the ciliumadhesin is likely to be cleavage at amino acid 195, because itoccurs immediately after translation, possibly in concert withmembrane translocation. This cleavage results in the formationof P94J, P22J, and other potential cleavage fragments (Fig. 2and 7). The fate of P22J was unknown until peptide massmapping identified the protein in 2-D gels. A 22-kDa band instrains J and 232 was observed in immunoblot studies with P97N-terminal serum (Fig. 1D), but we could not confirm that thisprotein was P22232. To confirm that processing fragments ofthe cilium adhesin that possess sequences upstream of aminoacid 195 persist in association with the cell after cleavage,immunogold electron microscopy with peptide-specific anti-serum NP97 localized P22232 (and other fragments) intracel-lularly, in association with the surface of the bacterium, and inthe extracellular milieu (Fig. 5G and H). One would expectthese fragments to be completely membrane bound, since theypossess a transmembrane domain that is clearly not removedby a signal peptide peptidase, a component of the type IIsecretion apparatus (Fig. 1 and 2).

FIG. 7. Adhesin cleavage products identified by peptide mass map-ping and N-terminal sequence analysis and those predicted from im-munoblotting studies. Large arrows identify confirmed cleavage sites;smaller arrows indicate predicted but unconfirmed cleavage events.The locations of the epitopes for MAb F1B6, peptide �NP97 andNP97 antisera, and P97 N-terminal (P97 N-term) and P28 antisera areshown as black bars.

2800 DJORDJEVIC ET AL. INFECT. IMMUN.

Numerous particles are also found intracellularly; whilesome of these may represent tangential thin sections throughmembranes, not all of the particles can be accounted for in thisway. Other particles are found outside the cell, but they seemto be closely associated with the cell surface. Further studieswill be required to better understand the role of P22 and otherfragments that possess this N-terminal sequence at these sites.The immunogold data also indicate that P22232 and other N-terminal fragments may self-associate, because small aggre-gates of gold particles are evident throughout (unlike the ob-servations obtained with MAb F1B6 and �NP97 antiserum)(Fig. 5). This hypothesis is strengthened by the presence of astatistically significant coiled-coil domain (14-, 21-, and 28-amino-acid window settings), as predicted (by the programCOILS) (http://www.ch.embnet.org) between amino acids 180and 195 within P22232 just upstream of the major cleavage siteat amino acid 195. Coiled-coil domains are increasingly beingidentified in secreted bacterial virulence effector molecules,and functional studies suggest that these motifs play an impor-tant role in subunit assembly and translocation and in flexibleinteractions with multiple bacterial and host proteins (6).

Given the location of F1B6 and �NP97 epitopes in the P70fragment, it is reasonable to conclude that the immunogoldstaining patterns would be similar. Indeed, this was observed insome instances (Fig. 5B to D). Interestingly, however, immu-nogold patterns of F1B6 and �NP97 differed in many cases(Fig. 5E and F). The clustering of gold particles in an extra-cellular matrix at a considerable distance from the cell surfacewas never observed with MAb F1B6. This correlates with ourmodel, according to which P66J is subject to further proteolyticcleavage (Fig. 7). Further analyses are required to identify andmap these proteins. In our model (Fig. 7), both epitopes arepresent in some molecules for at least a portion of time. Oncethe two epitopes are separated by cleavage, however, the N-terminal �NP97 epitope-containing peptides (P58 and possiblyothers) are released from the cell membrane, possibly aggre-gating or associating with other proteins (Fig. 5E and F), whilethe R1 region containing the F1B6 epitope remains cell asso-ciated (Fig. 5B and C). A second coiled-coil domain at aminoacids 364 to 394 found in the N-terminal region of P66J andP70232 may enable these �NP97 epitope-specific proteins toform interactions with themselves or other molecules.

A number of potential adhesin cleavage products could begenerated from the cleavage events that are hypothesized inour model (Fig. 7). Several F1B6 and P97 N-terminal serum-reactive fragments with masses greater than 48 kDa are evident(Fig. 1). Several of these are also reactive with R2 serum (Fig.1E). F1B6-reactive fragments with masses between 26 and 37kDa are present (Fig. 1C), and several of these may also reactwith R2 serum (Fig. 1E). Although our model shows howF1B6-reactive fragments of about 50 kDa might be generated,we cannot predict the presence of R2-reactive fragments withmasses 47 to 49 kDa without proposing a further cleavageevent(s) in the middle of P123. Consistent with this is thepresence of P97 N-terminal-reactive fragments with masses ofapproximately 24 kDa that are also not predicted by ourmodel. The observation of R2, F1B6, and P97 N-terminal-reactive fragments with masses of 47 to 50 kDa might beconsistent with the generation of C-terminal cleavage frag-ments that contain R1 and R2. We have observed that the

recombinant adhesin proteins containing R1 and or R2 mi-grate atypically during SDS-PAGE (Wilton et al., unpublisheddata), further complicating the generation of models that pre-dict complex cleavage patterns.

Cleavage of the adhesin, however, presents a paradox. Howdoes the R1 cilium-binding domain remain associated with themycoplasma surface even though the hydrophobic N-terminalsequence has been removed? No other portion of the moleculeseems capable of direct membrane anchorage, so we hypoth-esize that protein-protein interactions prevent the loss of theR1-binding domain to the environment. The proposed anchor-age protein could be either mycoplasma or host derived. Manypathogenic bacteria have evolved surface molecules or recep-tors capable of binding host proteins that enhance adherence,colonization, and invasion of host epithelial surfaces (15, 26,33). For instance, binding to fibronectin by pathogenic bacteriacan enhance initial colonization of the epithelial cells on mu-cosal surfaces (12, 22, 25, 30) and trigger cellular invasion (33).In any event, these observations have radically altered the waywe think about the surface architecture of M. hyopneumoniae.

We now have evidence that other high-molecular-weight pro-teins undergo proteolytic processing on the surface (S. P. Djord-jevic, unpublished data), suggesting that this is an important phe-notype of this species. It has not been observed in any otherspecies of mycoplasmas (or not, at least, to this extent). In supportof this model, several potential proteases have been identified inthe M. hyopneumoniae genome sequence (Minion, unpublished).There have been reports of cleavage of mycoplasma lipoproteinsto form immunoreactive lipopeptides (1, 5, 23), but the ciliumadhesin is not a lipoprotein, and there is no evidence that it is lipidmodified. Even more interesting is the fact that the cleavageproducts remain associated with the cell during growth in vitroand are not lost during extensive cell washing. This suggests thatactive mechanisms exist for binding these fragments and main-taining them in association with the cell. Not all translocatedproteins undergo this extensive cleavage, as evidenced by thestudies with P102 (Fig. 6). Thus, it appears that cleavage is selec-tive and complex and that it is controlled by unknown mecha-nisms and mycoplasma components. Given the importance of thecilium adhesin to virulence, its posttranslational cleavage mayplay an important role in the disease process.

ACKNOWLEDGMENTS

We thank Sreekumar A. Menon, Tsungda Hsu, and Cary Adams forcloning and site-directed mutagenesis and Jean Olsen for assistancewith electron microscopy. The skillful technical assistance of NelsonGuerreiro and Wendy Forbes is also acknowledged.

These studies were supported in part with funds from the IowaLivestock Health Advisory Council and from the Healthy LivestockInitiative from the College of Veterinary Medicine, Iowa State Uni-versity.

REFERENCES

1. Calcutt, M. J., M. F. Kim, A. B. Karpas, P. F. Muhlradt, and K. S. Wise.1999. Differential posttranslational processing confers intraspecies variationof a major surface lipoprotein and a macrophage-activating lipopeptide ofMycoplasma fermentans. Infect. Immun. 67:760–771.

2. Ciprian, A., C. Pijoan, T. Cruz, J. Camacho, J. Tortora, G. Colmenares, R. R.Lopez, and M. de la Garza. 1988. Mycoplasma hyopneumoniae increases thesusceptibility of pigs to experimental Pasteurella multocida pneumonia. Can.J. Vet. Res. 52:434–438.

3. Cordwell, S. J., D. J. Basseal, B. Bjellqvist, D. C. Shaw, and I. Humphery-Smith. 1997. Characterisation of basic proteins from Spiroplasma melliferumusing novel immobilised pH gradients. Electrophoresis 18:1393–1398.

VOL. 72, 2004 M. HYOPNEUMONIAE CILIUM ADHESIN PROTEOLYTIC PROCESSING 2801

4. Coutte, L., E. Willery, R. Antoine, H. Drobecq, C. Locht, and F. Jacob-Dubuisson. 2003. Surface anchoring of bacterial subtilisin important formaturation function. Mol. Microbiol. 49:529–539.

5. Davis, K. L., and K. S. Wise. 2002. Site-specific proteolysis of the MALP-404lipoprotein determines the release of a soluble selective lipoprotein-associ-ated motif-containing fragment and alteration of the surface phenotype ofMycoplasma fermentans. Infect. Immun. 70:1129–1135.

6. Delahay, R. M., and G. Frankel. 2002. Coiled-coil proteins associated withtype III secretion systems: a versatile domain revisited. Mol. Microbiol.45:905–916.

7. Djordjevic, S. P., G. J. Eamens, L. F. Romalis, and M. M. Saunders. 1994.An improved enzyme linked immunosorbent assay (ELISA) for the detec-tion of porcine serum antibodies against Mycoplasma hyopneumoniae. Vet.Microbiol. 39:261–273.

8. Gobom, J., E. Nordhoff, E. Mirgorodskaya, R. Ekman, and P. Roepstorff.1999. Sample purification and preparation technique based on nano-scalereversed-phase columns for the sensitive analysis of complex peptide mix-tures by matrix-assisted laser desorption/ionization mass spectrometry. J.Mass Spectrom. 34:105–116.

9. Hsu, T., S. Artiushin, and F. C. Minion. 1997. Cloning and functionalanalysis of the P97 swine cilium adhesin gene of Mycoplasma hyopneumoniae.J. Bacteriol. 179:1317–1323.

10. Hsu, T., and F. C. Minion. 1998. Identification of the cilium binding epitope ofthe Mycoplasma hyopneumoniae P97 adhesin. Infect. Immun. 66:4762–4766.

11. Hsu, T., and F. C. Minion. 1998. Molecular analysis of the P97 cilium adhesinoperon of Mycoplasma hyopneumoniae. Gene 214:13–23.

12. Jaffe, J., S. Natanson-Yaron, M. G. Caparon, and E. Hanski. 1996. ProteinF2, a novel fibronectin-binding protein from Streptococcus pyogenes, pos-sesses two binding domains. Mol. Microbiol. 21:373–384.

13. Kim, M. F., M. B. Heidari, S. J. Stull, M. A. McIntosh, and K. S. Wise. 1990.Identification and mapping of an immunogenic region of Mycoplasma hyo-pneumoniae p65 surface lipoprotein expressed in Escherichia coli from acloned genomic fragment. Infect. Immun. 58:2637–2643.

14. King, K. W., D. H. Faulds, E. L. Rosey, and R. J. Yancey. 1997. Character-ization of the gene encoding Mhp1 from Mycoplasma hyopneumoniae andexamination of Mhp1’s vaccine potential. Vaccine 15:25–35.

15. Kronvall, G., and K. Jonsson. 1999. Receptins: a novel term for an expand-ing spectrum of natural and engineered microbial proteins with bindingproperties for mammalian proteins. J. Mol. Recognit. 12:38–44.

16. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature 227:680–685.

17. Livingston, C. W., E. L. Stair, N. R. Underdahl, and C. A. Mebus. 1972. Patho-genesis of mycoplasmal pneumonia in swine. Am. J. Vet. Res. 33:2249–2258.

18. Luo, W., and S.-H. Lin. 1997. Generation of moderate amounts of polyclonalantibodies in mice. BioTechniques 23:630–632.

19. Mebus, C. A., and N. R. Underdahl. 1977. Scanning electron microscopy oftrachea and bronchi from gnotobiotic pigs inoculated with Mycoplasma hyo-pneumoniae. Am. J. Vet. Res. 43:1249–1254.

20. Menon, S. A., M. J. Wannemuehler, G. G. Mahairas, and F. C. Minion. 2002.Mycobacterial ESAT-6 protein enhances mouse IFN- responses to Myco-plasma hyopneumoniae P71 protein. J. Interferon Cytokine Res. 22:807–813.

21. Minion, F. C., C. Adams, and T. Hsu. 2000. R1 region of P97 mediatesadherence of Mycoplasma hyopneumoniae to swine cilia. Infect. Immun.68:3056–3060.

22. Mongodin, E., O. Bajolet, J. Cutrona, N. Bonnet, F. Dupuit, E. Puchelle, andS. de Bentzmann. 2002. Fibronectin-binding proteins of Staphylococcus au-reus are involved in adherence to human airway epithelium. Infect. Immun.70:620–630.

23. Muhlradt, P. F., M. Kiess, H. Meyer, R. Sussmuth, and G. Jung. 1998.Structure and specific activity of macrophage-stimulating lipopeptides fromMycoplasma hyorhinis. Infect. Immun. 66:4804–4810.

24. Nouwens, A. S., S. J. Cordwell, M. R. Larsen, M. P. Molloy, M. Gillings,M. D. P. Willcox, and B. J. Walsh. 2000. Complementing genomics withproteomics: the membrane subproteome of Pseudomonas aeruginosa PA01.Electrophoresis 21:3797–3809.

25. Pasula, R., P. Wisniowski, and W. J. Martin. 2002. Fibronectin facilitatesMycobacterium tuberculosis attachment to murine alveolar macrophages. In-fect. Immun. 70:1287–1292.

26. Patti, J. M., B. L. Allen, M. J. McGavin, and M. Hook. 1994. MSCRAMM-mediated adherence of microorganisms to host tissues. Annu. Rev. Micro-biol. 48:585–617.

27. Razin, S., D. Yogev, and Y. Naot. 1998. Molecular biology and pathogenicityof mycoplasmas. Microbiol. Mol. Biol. Rev. 62:1094–1156.

28. Ross, R. F. 1992. Mycoplasmal disease, p. 537–551. In A. D. Leman, B. E.Straw, W. L. Mengeling, S. D’Allaire, and D. J. Taylor (ed.), Diseases ofswine. Iowa State University Press, Ames.

29. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold SpringHarbor, N.Y.

30. Secott, T. E., T. L. Lin, and C. C. Wu. 2002. Fibronectin attachment proteinis necessary for efficient attachment and invasion of epithelial cells by My-cobacterium avium subsp. paratuberculosis. Infect. Immun. 70:2670–2675.

31. Strasser, M., J. Frey, G. Bestetti, M. Kobisch, and J. Nicolet. 1991. Cloning andexpression of a species-specific early immunogenic 36-kilodalton protein ofMycoplasma hyopneumoniae in Escherichia coli. Infect. Immun. 59:1217–1222.

32. Tajima, M., and T. Yagihashi. 1982. Interaction of Mycoplasma hyopneu-moniae with the porcine respiratory epithelium as observed by electronmicroscopy. Infect. Immun. 37:1162–1169.

33. Talay, S. R., A. Zock, M. Rhode, G. Molinari, M. Oggioni, G. Pozzi, C. A.Guzman, and G. S. Chatwal. 2000. Co-operative binding of human fibronec-tin to Sfb1 protein triggers streptococcal invasion into respiratory epithelialcells. Cell. Microbiol. 2:521–535.

34. Thacker, E. L., P. G. Halbur, R. F. Ross, R. Thanawongnuwech, and B. J.Thacker. 1999. Mycoplasma hyopneumoniae potentiation of porcine repro-ductive and respiratory syndrome virus-induced pneumonia. J. Clin. Micro-biol. 37:620–627.

35. Wilton, J. L., A. L. Scarman, M. J. Walker, and S. P. Djordjevic. 1998.Reiterated repeat region variability in the ciliary adhesin gene of Myco-plasma hyopneumoniae. Microbiology 144:1931–1943.

36. Zhang, Q., T. F. Young, and R. F. Ross. 1995. Identification and characterizationof a Mycoplasma hyopneumoniae adhesin. Infect. Immun. 63:1013–1019.

37. Zhang, Q., T. F. Young, and R. F. Ross. 1994. Microtiter plate adherenceassay and receptor analogs for Mycoplasma hyopneumoniae. Infect. Immun.62:1616–1622.

38. Zielinski, G. C., T. Young, R. F. Ross, and R. F. Rosenbusch. 1990. Adher-ence of Mycoplasma hyopneumoniae to cell monolayers. Am. J. Vet. Res.51:339–343.

Editor: J. T. Barbieri

2802 DJORDJEVIC ET AL. INFECT. IMMUN.