Upload
juan-caro-galan
View
17
Download
0
Tags:
Embed Size (px)
DESCRIPTION
Porcine reproductive and respiratory syndrome virus continues to be a significantproblem for pork producers. The aim of this body of work was to help stakeholderscontrol and prevention infection with this virus. A literature review of currentlyavailable diagnostic tests and guidelines for their interpretation serves as a resource forproducers, practitioners, and researchers. The research focus was to evaluate two novelmethods to develop improved modified live vaccines. The efficacy of viral chimerasconstructed from a commercially available vaccine and a virulent wild-type isolate andthe ability to attenuate wild-type isolates with a unique cell passage process are reported.Both techniques proved to be capable of developing potential vaccine candidates.
Citation preview
Iowa State UniversityDigital Repository @ Iowa State University
Graduate Theses and Dissertations Graduate College
2013
Porcine Reproductive and Respiratory SyndromeVirus: Diagnostic update and search for novelmodified live vaccinesJoshua Scott EllingsonIowa State University
Follow this and additional works at: http://lib.dr.iastate.edu/etd
Part of the Veterinary Medicine Commons, and the Virology Commons
This Thesis is brought to you for free and open access by the Graduate College at Digital Repository @ Iowa State University. It has been accepted forinclusion in Graduate Theses and Dissertations by an authorized administrator of Digital Repository @ Iowa State University. For more information,please contact [email protected].
Recommended CitationEllingson, Joshua Scott, "Porcine Reproductive and Respiratory Syndrome Virus: Diagnostic update and search for novel modified livevaccines" (2013). Graduate Theses and Dissertations. Paper 13006.
Porcine Reproductive and Respiratory Syndrome Virus: Diagnostic update and
search for novel modified live vaccines
by
Joshua Scott Ellingson
A thesis submitted to the graduate faculty
in partial fulfillment of the requirements for the degree of
MASTER OF SCIENCE
Major: Veterinary Microbiology
Program of Study Committee:
James A. Roth, Co-Major Professor
Michael B. Roof, Co-Major Professor
Kay S. Faaberg
Iowa State University
Ames, Iowa
2013
Copyright © Joshua Scott Ellingson, 2013. All rights reserved.
ii
TABLE OF CONTENTS
ACKNOWLEDGEMENTS vi
ABSTRACT vii
CHAPTER 1. GENERAL INTRODUCTION 1
Introduction 1
Thesis Organization 4
References 7
CHAPTER 2. PRRSV DIAGNOSITICS: REVIEW OF LITERATURE 9
Abstract 9
1. Introduction 9
2. Diagnostic Approach 11
2.1 Determine Objective 11
2.2 Determine Population 11
2.3 Determine Test and Interpret Individual Test Results 12
2.4 Determine Sample Size 39
2.5 Interpretation of All Available Test Results 41
2.6 Classification of the Herd 41
3. Conclusion 43
References 50
CHAPTER 3. VACCINE EFFICACY OF PORCINE REPRODUCTIVE
AND RESPIRATORY SYNDROME VIRUS CHIMERAS 62
Abstract 62
1. Introduction 63
2. Materials and Methods 65
2.1 Cells and Viruses 65
2.2 Construction of PRRSV cDNA Clones 66
2.3. Rescue of Viruses 67
2.4 Swine Study 68
2.5 Clinical Evaluation 70
2.6 Serology 70
2.7 Viremia Detection by Virus Isolation and Quantitative RT-PCR 70
2.8 Nucleotide Sequence Analysis 71
2.9 Statistics/biometrics 71
3. Results 72
3.1 Recovery of Viruses 72
3.2. HerdChek ELISA 73
3.3. Virus Isolation 74
3.4. Real Time RT-PCR 75
3.5. Nucleotide Sequence Analysis 76
iii
3.6. Average Daily Weight Gain 76
3.7. Clinical Observations 77
3.8 Lung Pathology 78
4. Discussion 78
Acknowledgements 81
References 91
CHAPTER 4. DEVELOPMENT OF ATTENUATED PORCINE 94
REPRODUCTIVE AND RESPIRATORY SYNDROME VIRUS ISOLATES
THROUGH CONTINUOUS CELL PASSAGE BY LIMITING DILUTION
Abstract 94
1. Introduction 94
2. Materials and Methods 97
2.1 Cell Passage 97
2.2 Viral Isolates 98
2.3 Nucleotide Sequence Analysis 98
2.4 Respiratory Safety Trial 100
2.5 Reproductive Safety Trial 101
2.6 Serology 102
2.7 Average Daily Weight Gain 102
2.8 Reproductive Safety Trial Viremia 102
2.9 Reproductive Safety Study Animal Clinical Observations 103
2.10 Statistics/biometrics 103
3. Results 104
3.1 Sequence Analysis 104
3.2 Respiratory Safety Trial Lung Pathology 104
3.3 Average Daily Weight Gain 105
3.4 HerdChek ELISA 105
3.5 Gilt Reproductive Performance 106
3.6 Mortality of Piglets, Pigs, and Gilts 106
3.7 Viremia 107
3.8 Reproductive Safety Study Clinical Observations 107
4. Discussion 108
References 120
CHAPTER 5. DISCUSSION 124
General Conclusions 124
References 125
iv
LIST OF TABLES
CHAPTER 2. PRRSV DIAGNOSITICS: REVIEW OF LITERATURE
Table 1. Sample Size to Detect at Least One Positive Sample from Herd 45
Table 2. Sample Size Required to Estimate Prevalence Where the 45
Expected True Prevalence is 50%.
Table 3. Criteria Required for PRRS Status Categorization of 46
Breeding Herds
CHAPTER 3. VACCINE EFFICACY OF PORCINE REPRODUCTIVE AND
RESPIRATORY SYNDROME VIRUS CHIMERAS
Table 1. Primers Used in Preparation of Recombinant PRRSV 82
Infectious Clones
Table 2. Nucleotide and Amino Acid Changes to Recombinant Viral
Parent Due to Clone Construction 83
Table 3. Treatment List 84
CHAPTER 4. DEVELOPMENT OF ATTENUATED PORCINE
REPRODUCTIVE AND RESPIRATORY SYNDROME VIRUS ISOLATES
THROUGH CONTINUOUS CELL PASSAGE BY LIMITING DILUTION
Table 1. Primers Used in Preparation and Sequencing of PRRSV 112
Isolates
Table 2. Summary of Statistical Methods of Analysis for Collected 113
Parameters
Table 3. Nsp2 Mutations Causing Amino Acid Changes from 114
Positive Piglets at Twenty-one Days of Age
Table 4. Mean Gilt Reproductive Performance per Litter 115
v
LIST OF FIGURES
CHAPTER 1. GENERAL INTRODUCTION
Figure 1. PubMed identified PRRSV manuscripts published per year 6
CHAPTER 2. PRRSV DIAGNOSITICS: REVIEW OF LITERATURE
Figure 1. Guidelines for PRRS Antigen and Serological Test Selection 47
and Interpretation in Accordance with Natural Progression of Infection
Figure 2. Detection of Virus: PRRS Diagnostic Decision Tree 48
Figure 3. Detection of Antibody: PRRS Diagnostic Decision Tree 49
CHAPTER 3. VACCINE EFFICACY OF PORCINE REPRODUCTIVE AND
RESPIRATORY SYNDROME VIRUS CHIMERAS
Figure 1. Genome Schematic of PRRSV, the Two Infectious Clones 85
Initially Derived, Chimeras, and Deletion Mutant Prepared for the
Present Study
Figure 2. Mean PRRS ELISA 2XR S/P ratios 86
Figure 3. Viral Load, Determined by Virus Isolation on MARC-145 87
cells, in Swine Serum at All Time Points After Intramuscular
Inoculation with 4.79 Logs of Virus
Figure 4. Viral Load as Determined by qRT-PCR and Plotted as Viral 88
RNA Copies/ml Serum
Figure 5. Growth Effects of Chimeric and Parental Viruses on Swine 89
Figure 6. Average Lung Scores Recorded at 35 Days Post Vaccination 90
and 14 Days Post Challenge
CHAPTER 4. DEVELOPMENT OF ATTENUATED PORCINE
REPRODUCTIVE AND RESPIRATORY SYNDROME VIRUS ISOLATES
THROUGH CONTINUOUS CELL PASSAGE BY LIMITING DILUTION
Figure 1. Pig Respiratory Trial: Lung Pathology 116
Figure 2. Pig Respiratory Trial: Development of PRRSV Specific 117
Antibody as Measured by IDEXX ELISA
Figure 3: Gilt Reproductive Trial: Gilt Viremia as Detected by RT-PCR 118
Figure 4. Gilt Reproductive Trial: Piglet Viremia as Detected by 119
RT-PCR
vi
ACKNOWLEDGEMENTS
I would like to thank my major professors, Drs. James Roth and Michael Roof,
and Dr. Kay Faaberg, for serving on my committee and for all of their guidance,
knowledge, and support throughout the course of this research.
In addition, I would also like to thank my friends and colleagues at Iowa State
University, Boehringer Ingelheim Vetmedica Inc., and AMVC for their willingness to
provide great collaboration, assistance, mentorship, and direction throughout my studies
and professional development.
Finally, thanks to my family for their steadfast encouragement and to my wife for
her hours of patience, support, and love.
vii
ABSTRACT
Porcine reproductive and respiratory syndrome virus continues to be a significant
problem for pork producers. The aim of this body of work was to help stakeholders
control and prevention infection with this virus. A literature review of currently
available diagnostic tests and guidelines for their interpretation serves as a resource for
producers, practitioners, and researchers. The research focus was to evaluate two novel
methods to develop improved modified live vaccines. The efficacy of viral chimeras
constructed from a commercially available vaccine and a virulent wild-type isolate and
the ability to attenuate wild-type isolates with a unique cell passage process are reported.
Both techniques proved to be capable of developing potential vaccine candidates.
1
CHAPTER 1. GENERAL INTRODUCTION
Introduction
Porcine reproductive and respiratory syndrome virus (PRRSV) was first
recognized in the early 1990s as a cause of severe reproductive losses, respiratory
disease, increased mortality, and reduced growth rates in pigs [1-3]. Current control and
prevention strategies rely heavily on the use of diagnostics to develop herd health
management strategies to optimize production. A thorough understanding of the
diagnostic approach, available tests, and test result interpretation are vital components to
developing the best strategies for disease control. However, diagnostic tests are rapidly
changing and it is a challenge for veterinarians and other stakeholders to remain current
with available techniques and technologies. Another challenge to successful control and
prevention programs revolves around the imperfect tools currently available to increase
and stabilize herd immunity against PRRS. Current commercial vaccines are widely
used and help limit losses but have room for improvement. This research focuses on the
search for improved vaccines.
PRRSV is an enveloped, single stranded RNA virus classified within the family
Arteriviridae under the order Nidovirales. Species of PRRSV form two major genetic
lineages and are classified into two genotypes, type 1 (European) or type 2 (North
American). There is a large amount of genetic diversity within PRRS isolates, which
creates problems for diagnostic testing and developing cross protective vaccines. The
prototype genomes for type 1 (Lelystad virus) and type 2 (VR-2332) genotypes vary by
approximately 44% in nucleotide sequence composition. Known sequence variation
2
within a genotype varies by up to 30% in type 1 and 21% in type 2 viruses [4]. The
PRRSV genome is approximately 15,000 kilobases and is organized into at least 10 open
reading frames, numbered (1a, 1b, 2, 2b, 5a, and 3-7,) [4, 5]. Transmission of the virus
occurs via intranasal, intramuscular, oral, intrauterine, and vaginal exposure. Pigs can
develop infection via parenteral exposure, direct contact with infected pigs, contact with
contaminated fomites, exposure to insect vectors, and exposure via infectious aerosols
[6-8].
Clinically, PRRS causes problems in swine breeding herds and in growing pigs
which can vary from asymptomatic to devastating disease. The large variety of clinical
signs are influenced by isolate virulence, susceptibility of host animals, host immune
status, concurrent infections, and other management factors. Disease in the breeding
herd is characterized initially by anorexia, pyrexia, and hyperpnea which are followed by
reproductive failure (abortions, irregular returns to estrus, and reduced live born piglets)
and high preweaning mortality in suckling piglets. In growing pig herds infection is
characterized by anorexia, lethargy, cutaneous hyperemia, hyperpnea, rough hair coats,
reduced weight gains, and increased severity of endemic infections.
To prevent disease associated with PRRS, producers focus on preventing the
entrance of new viral isolates into herds through strict biosecurity measures for all
materials, people, and pigs entering the farm. Other prevention strategies focus on
increasing the host adaptive immune system for potential future infections. Immune
enhancement can be accomplished through contact with other infected animals,
intentional exposure with infectious virus, or vaccination. Contact with infected animals
3
becomes difficult to routinely accomplish as the herd becomes immune to the virus over
time and may stop shedding virus. Intentional exposure to infectious virus has
significant inherent risks and requires high quality standard controls. Use of vaccine is a
much safer and more consistent approach to increase herd immunity.
There are a variety of PRRSV vaccines available around the world which
includes modified live vaccine (MLV) products, killed products, and subunit vaccines.
In general, there is scant evidence that immunization with non-replicating or subunit
products by themselves provide protection against homologous or heterologous
infection. However, numerous studies have shown that live attenuated isolates are
capable of reducing clinical signs and lesions by homologous and heterologous virus [9].
Further, in-depth reviews of killed vs. MLV products, strategies, and results have been
completed elsewhere and thus are not reviewed in this thesis [9-14].
Currently available MLV products were attenuated by continuous passage of an
isolate in cell culture until random genetic changes decreased the virulence of the virus
in pigs. This process is a proven technique to develop effective vaccines, but is
laborious, time consuming, and relatively low yielding. The final products replicate to
some degree in pigs, and provide an unpredictable level of efficacy against subsequent
heterologous challenges. The safety of vaccines prone to mutation and capable of
replicating in the pig host has raised some concern over the possibility of reverting to
virulence in the field. Furthermore, attenuated vaccines are generally indistinguishable
from pathogenic wild type isolates with most diagnostic testing options making it
difficult to differentiate vaccinated from infected animals. Clearly, the swine industry
4
would benefit from the development of vaccines capable of being produced quickly,
with increased safety, and with characteristics allowing for the differentiation of pigs
vaccinated from those infected. The original research reported in this thesis focuses on
the development of these technologies.
Thesis Organization
Chapter 2 serves as a literature review of PRRSV diagnostics. A comprehensive
review of PRRS diagnostics has not been completed since 2002 [15]. Since then, the
growing quantity of available research continues to add to our expanding knowledge of
the virus. The PubMed® database identified 1,216 articles published in peer-reviewed
journals since 2002 pertinent to PRRSV [figure 1][16]. Of those, many report
significant advances in technologies and techniques to collect/transport/detect viral
antigens, viral RNA, and anti-PRRSv antibodies in a growing amount of samples. A
review of diagnostics is pertinent to the evaluation of vaccine efficacy, development of
future vaccines, and is extremely important for development of management strategies to
control and/or eliminate PRRSV from a herd. This manuscript is to be submitted for
publication to Animal Health Research Reviews.
The following chapters cover original work which focused on strategies to
develop improved PRRSV MLVs. Chapter 3 contains original research on the
development and efficacy of PRRSV chimeras within a growing pig controlled challenge
model. This manuscript was published in Vaccine 28 (2010) 2679-2686. The first
author’s role in the research was to develop, execute, interpret, and document the animal
testing phases of the study. The infectious chimeras were provided by Dr. Kay
5
Faaberg’s laboratory for testing. Chapter 4 contains original research on the generation
of attenuated isolates and their screening for virulence within pregnant gilt and growing
pig challenge models. The first author’s role in this work included the development,
execution, interpretation, and documentation of the animal testing phases of the study.
The passaged isolates were created and provided by the Boehringer Ingelheim
Vetmedica Incorporated Research and Development team.
For both trials, the daily animal care was executed by an unbiased third party
while the first author was involved with the animal vaccinations, euthanasia, and
necropsies. Diagnostics were performed by the first author with the exception of
ELISAs and sequencing which were performed by external third parties.
6
Figure 1. PubMed identified Porcine Reproductive and Respiratory Syndrome
Virus manuscripts published per year.
0
50
100
150
200
250
PRRSV Manuscripts Produced/Year
7
References
[1] Terpstra C, Wensvoort G, Pol JM. Experimental reproduction of porcine epidemic
abortion and respiratory syndrome (mystery swine disease) by infection with Lelystad
virus: Koch's postulates fulfilled. The Veterinary quarterly. 1991;13:131-6.
[2] Collins JE, Benfield DA, Christianson WT, Harris L, Hennings JC, Shaw DP, et al.
Isolation of swine infertility and respiratory syndrome virus (isolate ATCC VR-2332) in
North America and experimental reproduction of the disease in gnotobiotic pigs. Journal
of veterinary diagnostic investigation : official publication of the American Association
of Veterinary Laboratory Diagnosticians, Inc. 1992;4:117-26.
[3] Dea S, Bilodeau R, Athanassious R, Sauvageau RA, Martineau GP. Quebec.
Isolation of the porcine reproductive and respiratory syndrome virus in Quebec. The
Canadian veterinary journal La revue veterinaire canadienne. 1992;33:552-3.
[4] Zimmerman JJ KL, Ramirez A, Schwartz KJ, Stevenson GW Diseases of Swine. In:
Zimmermann JJ BD, Dee SA, Murtaugh MP, Stadejek T, Stevenson GW, Torremorell
M,, editor. Porcine Reproductive and Respiratory Syndrome Virus (Porcine Arterivirus).
10 ed: Wiley-Blackwell; 2012. p. 461-86.
[5] Oh J, Lee C. Proteomic characterization of a novel structural protein ORF5a of
porcine reproductive and respiratory syndrome virus. Virus research. 2012;169:255-63.
[6] Pitkin A, Deen J, Dee S. Further assessment of fomites and personnel as vehicles for
the mechanical transport and transmission of porcine reproductive and respiratory
syndrome virus. Canadian journal of veterinary research = Revue canadienne de
recherche veterinaire. 2009;73:298-302.
[7] Otake S, Dee S, Corzo C, Oliveira S, Deen J. Long-distance airborne transport of
infectious PRRSV and Mycoplasma hyopneumoniae from a swine population infected
with multiple viral variants. Veterinary microbiology. 2010;145:198-208.
[8] Yoon KJ, Zimmerman JJ, Chang CC, Cancel-Tirado S, Harmon KM, McGinley MJ.
Effect of challenge dose and route on porcine reproductive and respiratory syndrome
virus (PRRSV) infection in young swine. Veterinary research. 1999;30:629-38.
[9] Murtaugh MP, Genzow M. Immunological solutions for treatment and prevention of
porcine reproductive and respiratory syndrome (PRRS). Vaccine. 2011;29:8192-204.
[10] Hocker J. Evaluation of protection provided by inactivated Porcine Reproductive
and Respiratory Syndrome Virus (PRRSV) vaccines Iowa State University; 2006.
8
[11] Johnson W. Porcine reproductive and respiratory syndrome virus (PRRSV)
immunization strategies, virulence of various isolates, and efficacy of DNA vaccination:
Iowa State University; 2009.
[12] Kimman TG, Cornelissen LA, Moormann RJ, Rebel JM, Stockhofe-Zurwieden N.
Challenges for porcine reproductive and respiratory syndrome virus (PRRSV)
vaccinology. Vaccine. 2009;27:3704-18.
[13] Thanawongnuwech R, Suradhat S. Taming PRRSV: revisiting the control strategies
and vaccine design. Virus research. 2010;154:133-40.
[14] Hu J, Zhang C. Porcine reproductive and respiratory syndrome virus vaccines:
current status and strategies to a universal vaccine. Transboundary and emerging
diseases. 2013.
[15] Christopher-Hennings J, Faaberg KS, Murtaugh MP, Nelson EA, Roof MB,
Vaughn EM, Yoon KJ, Zimmerman JJ. Porcine reproductive and respiratory syndrome
(PRRS) diagnostics: Interpretation and limitations. J Swine Health Prod. 2002;10:213-8.
[16] PubMed.gov. Porcine Reproductive and Respiratory Syndrome Virus Search
Results. National Center for Biotechnology Information (NCBI); 2013. p. Search results
for Porcine Reproductive and Respiratory Syndrome Virus.
9
CHAPTER 2: PORCINE REPRODUCTIVE AND RESPIRATORY SYNDROME
VIRUS: A REVIEW OF TEST MECHANISMS, DIAGNOSTIC STRATEGIES
AND INTERPRETATION
A paper to be submitted to Animal Health Research Reviews
Joshua Scott Ellingson
Abstract
Porcine Reproductive and Respiratory Syndrome is one of the most economically
devastating pathogens affecting the swine industry. Prevention, control, and elimination
strategies rely on the proper application of diagnostics to describe the current infection
and exposure status of individual pigs and herds. The correct use of diagnostics includes
determining the diagnostic objective, identifying the animal subpopulation to sample,
choosing appropriate tests to use, calculating the number of samples necessary, and
classifying the herd in a meaningful way based on all available data. Diagnostic
technologies and strategies are evolving with each new research discovery which
challenges veterinarians, researchers, producers, and other stakeholders to remain
current with best practices. Diagnostic approaches, available tests, and guidelines for
interpretation are reviewed herein.
1. Introduction
Porcine Reproductive and Respiratory Syndrome (PRRS) is one of the most
economically significant pathogens affecting the swine industry worldwide. PRRS has
been reducing producer profits since the late 1980’s and has since become endemic in
most pork producing regions. A recent economic analysis estimated the total cost to the
United States swine industry at $664 million annually or $1.8 million per day [1].
10
Current prevention and control strategies include intensive biosecurity practices,
vaccination and rigorous diagnostic surveillance strategies at the individual farm level.
Recognizing the difficulty in preventing the transmission of porcine reproductive and
respiratory syndrome virus (PRRSV) from positive farms to adjacent negative farms,
larger scale “area regional control and elimination” (ARC&E) projects have been
initiated. These programs have been developed to coordinate the communication of
PRRS status, control strategies, and elimination plans for large geographic regions
including as many as 500 individual farms. To date, the success of PRRS control and
elimination programs at the individual farm and regional level has had variable results.
Effective PRRS control, elimination, and prevention plans require significant
capital investment of producers, steadfast commitment from the farm staff, and effective
diagnostic tests to correctly classify the status of animals. Equally important as having
rapid, sensitive, and specific diagnostic tests available is the requirement for correct test
result interpretation. Interpretation is the final piece to the diagnostic process which
helps safeguard producers from economic losses associated with infection.
Significant time and financial resources have been invested to continually
improve and refine diagnostic approaches and assays. Available PRRSV diagnostics
evolve regularly, making it challenging for veterinarians and industry stakeholders to
remain current. This paper reviews diagnostic approaches, available assays, and
guidelines for interpretation.
11
2. Diagnostic Approach
2.1 Determine objective
Diagnostics are performed to satisfy a defined objective. Objectives may include:
detection of infection, determination of prevalence within a population, confirmation of
exposure/vaccination, or to determine the timing of infection [2]. All diagnostic
approaches can have an effect on management decisions for individual animals or the
entire herd or funds are being wasted. For example, if a boar tests positive for PRRSV
via PCR semen would not be sold, but semen would be sold and distributed if the test
result was negative. Discretion must be used to ensure the prudent use of producer funds
for diagnostic workups. Diagnostic approaches should be synthesized to answer a
particular objective with an acceptable level of confidence in the most efficient manner.
2.2 Determine Population
Once the objective has been defined, the next step is to determine the population
to sample. Testing can either be directed at an individual animal or an entire population.
When testing individuals, assays with the highest sensitivity are sought to attain the
highest level of confidence. Timing plays a critical role in testing individuals as viremia,
viral shedding, antibody responses, and histological lesions have finite durations.
Likewise, interpreting individual test results may not reflect the status of the entire herd
as the timeline of infection will vary for each individual animal. With herd level testing,
animal selection is very important. Objectives should determine the animal population
to target which can include: young, old, recently comingled, or diseased animals.
12
Individual test results provide specific animal status while herd level diagnostics provide
an inference of the population.
2.3 Determine test and interpret individual test results in light of clinical signs
Once the objective and targeted population has been determined, the appropriate
test should be selected. PRRSV diagnostic tests can be broken up into two main
categories: 1) viral detection or 2) viral exposure. Viral detection requires collection of
virus laden tissue, bronchoalveolar lavage (BAL) fluid, thoracic fluid, semen, blood, oral
fluid, or environmental samples and relies heavily on molecular techniques, but can also
be accomplished with virus isolation and less specific techniques such as electron
microscopy or tissue immunohistochemistry. Detection of viral exposure is based on
antibody production and requires blood, oral fluid collection, or muscle transudate.
Detection of Virus
RT-PCR
Molecular technologies have been an area of rapid development and extensive
use by pig producers for detection of PRRSV. Numerous (polymerase chain reaction)
PCR assays have been described since the first assays were developed in the mid-1990s
[3, 4]. The reverse transcriptase (RT-PCR) is used to detect PRRS ribonucleic acid
(RNA) in clinical specimens, now including: serum, oral fluid, lung, tonsil, lymph node,
BAL fluid, heart, kidney, spleen, thymus, semen, and thoracic fluid. Compared with
other available tests, RT-PCR is also the test of choice for fetuses when vertical
transmission is suspected [5]. Viral RNA is first extracted from the specimen, converted
to DNA through a reverse transcriptase step, and then the complementary viral DNA is
13
exponentially amplified by polymerase chain reaction. A variety of methods can then be
used to detect the presence of amplified DNA in samples.
Many swine focused laboratories can complete RT-PCR for same day the
results. The structural proteins coded for by open reading frame (ORF) 6 and 7 are
typically targeted for detection as these regions of the genome are highly conserved.
ORF 6 codes for the matrix protein (M) while ORF 7 codes for the nucleocapsid protein
(N) [6, 7]. The benefits of PCR include: rapid detection of PRRS RNA, ability to
quantify viral loads, high sensitivity, high specificity, ability to identify most
heterologous isolates, and ability to test numerous diagnostic specimens (tissue
homogenates, serum, and body fluids/secretions). Oral fluid samples should be tested
using RT-PCRs verified to function adequately in the oral fluid matrix for ensured
results quality [8, 9].
The disadvantages of PCR assays include: high sensitivity (relatively easy for
contaminates to cause false positives), inability to identify some genetically diverse
isolates (due to primer or probe mismatching), lack of uniform performance between
laboratories, and inability to differentiate infectious from inactivated virus [10]. Pooling
of serum, semen, blood swabs or tissue specimens is routinely performed in the field to
reduce diagnostic cost, but does reduce the sensitivity of RT-PCR, especially when the
prevalence of infection is low and samples contain relatively small viral quantities [9,
11].
Currently, two commercial real-time reverse transcriptase-polymerase chain
reaction assays are available in North America and other parts of the world (VetMax NA
14
and EU PRRS, Applied Biosystems, Foster City, California and VetAlert NA and EU
PRRSV PCR, Tetracore, Rockville, Maryland) [12]. Both kits detect both type 1
(European; EU) and type 2 (North American; NA) PRRSV isolates. Samples are
identified as positive when the amplification curve of DNA crosses the threshold limit
(<37) for a positive sample. The quantitative (qRT-PCR) assays give each positive
sample a cycle threshold (Ct) value which is the cycle at which the curve crosses the
threshold limit of detection. Lower Ct values indicate higher levels of viral RNA in the
sample. Both assays have multiple primers and probes to detect a variety of isolates, but
neither is perfect. Of 423 clinical cases evaluated with both assays, 27 cases tested
positive with one assay and negative for the other [12].
A recently developed multiplex assay includes primers and probes to detect and
differentiate infection with type 1, type 2, and a highly pathogenic type 2 strain (HP-
PRRSV) with good sensitivity and specificity [13]. The HP-PRRSV strain emerged in
China in 2006 and is characterized by high fever, morbidity, and mortality. The 90
nucleotide deletion in the nonstructural protein 2 (nsp2) coding region of HP-PRRSV
serves as a marker to differentiate HP-PRRSV from other strains [14]. Additional
differential molecular assays have also been described to differentiate HP-PRRSV from
other type 2 isolates with the use of either a duplex real-time RT-PCR using minor
groove binder probes or a SYBR Green-based RT-PCR [15, 16]. Similar strategies
could be employed in the future to help differentiate infected from vaccinated animals if
a differential modified live vaccine can be developed.
15
Flinders Technology Associates (FTA) cards have been assessed for potential use
as a transport medium for PRRS RT-PCR. FTA cards contain a mixture of chemicals
which lyse cells and inactivate bacterial and viral pathogens while preserving nucleic
acids. Samples held within FTA cards can be used for molecular diagnostics and can be
shipped in standard letter mail envelopes at room temperature, which may facilitate
testing in remote locations. The cards are reported to be a safe, simple, and sensitive
alternative method to transport serum, blood, and tissue samples for PRRSV RT-PCR.
However, a significant decrease in sensitivity should be expected from oral fluid samples
[17].
The development of loop-mediated isothermal amplification (LAMP) reduces the
need for advanced equipment necessary to perform PCR. This technology allows
amplification of DNA at a constant temperature in simple devices (water bath or heat
block) and eliminates the need for expensive laboratory equipment such as thermal
cyclers [10]. The amplified product is directly related to sample turbidity or a change of
color when color indicator systems are used [18, 19]. This advance in technology does
come with lower test sensitivity as compared to other RT-PCR assays, but may allow for
additional production systems and veterinary clinics to perform more of their own in-
house testing for presence of PRRS virus [19].
RT-PCR Interpretation
The individual kinetics of PRRS isolate replication varies significantly in vivo.
In general, virus can be expected to be found at higher levels and for longer periods
when naïve animals are infected [10]. Pig age also has an effect on viremia. For both
16
virulent and attenuated PRRSV, peak viremia and duration were substantially greater
than those in finishing pigs and mature adult animals [20]. Serum viral levels typically
peak at 4-7 days post inoculation (DPI) before declining to undetectable levels by 29-35
DPI in individual pigs while virus does persist longer in tonsil and lymph nodes than in
serum, lung, and other specimens [figure 1] [10, 20]. RT-PCR can be used to identify
PRRS RNA in infected pigs for up to 86 DPI in lymph nodes [21], 92 DPI in semen [4],
[22], 105 DPI in oropharyngeal scrapings [23], and 251 DPI in serum and tonsil
homogenates [24]. However, testing tonsils, oropharyngeal scrapings and lymph nodes
generally has a poor success rate when beyond 90 DPI [10]. Oral fluid samples can be
expected to be positive for 14-90 days after infection [25]. Individual oral fluid samples
from boars were positive for at least 21 days [26]. Viral RNA can also be found with
RT-PCR in most tissues from viremic live born piglets and occasionally in fetal thoracic
fluid and tissues from mummies and stillborn piglets.
The inability of RT-PCR to differentiate infectious from non-infectious virus is
important to consider when interpreting test results. Inactivated PRRS RNA is stable in
solutions while the infectivity of virus has a half-life of approximately 6 days in cell
culture medium [27]. Aerosolized virus maintains infectivity best at low temperatures
and low humidity, with a peak of about 3 hours under experimental conditions [28].
Differentiating infectious from inactivated virus is typically only important when
evaluating environmental samples (transportation equipment, air samples, etc.).
Interpretation of negative results may include: no viral nucleic acid present (pig
not infected), inability of PCR primers or probes (real-time RT-PCR) to detect
17
genetically diverse isolates (present but not detected), degradation of virus due to poor
sample quality, individual pig not currently infected despite a low prevalence of virus in
population, and pig is infected but the tested specimen does not contain viral nucleic
acid. False negative results are a major concern with RT-PCR, as no assay is capable of
detecting all field strains especially in regard to type 1 isolates [12, 29]. Coupling
molecular testing strategies with antibody based techniques are recommended for
surveillance of negative herds to increase the probability of detecting infection.
Furthermore, determination of herd statuses with pooled samples tested via RT-PCR
should be executed with caution as pooled samples can test negative, while individual
samples may be positive.
Interpretation of positive results includes the following scenarios: pig is viremic
with infectious virus (vaccinated or wild type infection), inactivated virus recovered and
amplified, and virus contamination from sample collection or testing process (false
positive) due to high sensitivity. All unexpected results should be immediately
communicated to the laboratory for follow up testing and to alert diagnosticians of a
potential need for assay improvement to recognize the continually mutating PRRS
viruses [12, 30].
Virus isolation (VI)
Virus isolation can be performed on any virus laden tissues (after
homogenization) or fluids. Samples should be chilled and held at (4°C) for less than 48
hours due to the sensitivity of the virus to pH and temperature changes [27, 31-33] or
frozen at -70°C for future testing. For best results samples should be received at the
18
laboratory within 48 hours. Virus isolation can be performed on Pulmonary Alveolar
Macrophages (PAMs) or sublines (CL-2621, MARC-145) of the African Green Monkey
kidney cell line (MA-104) [31, 34]. In addition to the established cell types used for in
vitro growth, additional permissive cell types have been reported. Several genetically
modified cell lines have recently been developed to facilitate PRRSV replication in vitro
including: immortalized PAM cells expressing the CD163 protein, immortalized porcine
monomyeloid cells expressing the human telomerase reverse transcriptase, PK-15 cells
expressing sialoadhesin protein, and porcine, feline, and baby hamster kidney cells
expressing the CD163 protein [35-38]. Other non-genetically modified cell lines have
also been identified to support PRRSV replication in vitro. St. Jude porcine lung (SJPL)
epithelial cells are phenotypically distinct and react differently to PRRS infection as
compared to MARC-145 cells [39]. Porcine endometrial endothelial (PEE) cells have
also proven to be permissive to PRRSV replication in vitro and may provide future
insights into associated reproductive disease pathogenesis [40].
The presence of Fc receptors on PAMs may account for their increased
sensitivity for isolating virus in the presence of antibodies as compared to MA-104 cell
types. For optimum recovery of virus, VI should be performed on both PAMs and
subline cell types as isolates vary significantly in their ability to replicate in each [41,
42]. The pig source of PAMs is also important as those from Landrace breeds poorly
support the growth of PRRSV in vitro [43]. MA-145 cells may preferentially favor
replication of modified live vaccine viruses as MA-104 cells were used for in vitro cell
19
adaption. Furthermore, it has been reported PAMs are required for the successful
isolation of some European and European-like viruses [44, 45].
The positive indicator for virus isolation, cytopathic effects (CPE), is not
pathognomonic for PRRSV replication. Therefore secondary confirmation steps can
include: RT-PCR, negative-stain electron microscopy (EM), or visualization of viral
antigens within cells by fluorescent antibody (FA) techniques using PRRS-specific
monoclonal antibodies [46]. Lot to lot validation should be performed with samples
known to contain specific concentrations of virus to verify results.
VI Interpretation
Timelines to detect infection in vivo via VI are essentially the same as those
described for RT-PCR, with the exception of having to wait 5-8 days for test results with
the VI procedure versus potential same day results for RT-PCR. Possible explanations
for negative results from VI assay include: pig has not been infected, pig is infected but
no infectious virus in sample (neutralizing antibodies/degradation of virus in sample), or
pig is infected but virus is unable to infect cell culture line used. For fetal samples, virus
isolation is approximately half as sensitive as RT-PCR and is more prone to the negative
effects of sample autolysis [5].
Antigen Labeled Microscopy (IHC and FA)
The typical gold standard for a pathological diagnosis is to correlate the
suspected disease agent with identifiable tissue lesions. Microscopic evaluation of fixed
tissues allows for histopathological evaluation and the utilization of
immunohistochemistry (IHC) techniques to visualize viral antigens within cells or
20
contiguous to microscopic lesions [47]. IHC can be performed on fresh and properly
fixed (10% neutral buffered formalin) lung, tonsil, lymph nodes, heart, brain, thymus,
spleen, and kidney [47-49]. Immunohistochemistry is reported to be highly specific
(100%) and moderately sensitive (67%) [50]. Identification of PRRSV antigen in lung
tissue by IHC has been found to require the examination of a minimum of five sections
of anterioventral lung to identify >90% of PRRS infected pigs [49]. The highest
sensitivity is appreciated when tissues are processed within 48 hours of fixation, which
helps prevent antigen degradation and loss of positive cells [48].
If not feasible to get tissues into the laboratory promptly, antigen can also be
detected in frozen lung sections by fluorescent antibody (FA) or indirect fluorescent
antibody (IFA) techniques [31, 50, 51]. BAL fluid and cell cultures can also be analyzed
by FA or IFA for detection/confirmation of PRRSV. The FA test is quicker to perform
and less expensive than IHC, but has the disadvantage of requiring fresh or frozen tissue.
Both the IHC and FA tests require monoclonal antibodies to detect viral nucleocapsid
antigen in the cytoplasm of infected cells and thus both tests may not detect genetically
diverse isolates. Both tests also rely on the laboratory operator’s ability to detect antigen
and differentiate it from nonspecific background staining. To increase test specificity,
positive tests can be confirmed with VI and/or RT-PCR.
IHC and FA Interpretation
Identification of virus using IHC is best in the early stages of infection (1-28
DPI), limited in the mid stages of infection (30-70 DPI) and not recommended in the
latter stages (> 90 DPI) due to low sensitivity [10]. IHC can identify vertically
21
transmitted virus in most tissues from infected live-born piglets. Evaluation of BAL
samples with FA can be performed directly (without first amplifying potential virus in
cell culture) in the early stages of infection, directly or immediately after incubation in
cell culture of lavage fluid in the mid stages of infection, and is not recommended in the
latter stages of infection. Evaluation of lungs from live-born piglets can also be
successful with FA.
Interpretation of negative samples may include the following scenarios: pig is not
infected, pig is infected but has no virus in sections examined, operator is unable to
identify antigen-antibody complexes, or pig is infected with a genetically diverse isolate
not bound by monoclonal antibodies. Positive FA results can either be due to true
infection or due to the poor specificity of antibody used in the assay (false positive).
Field Test Strips
The recent development of immunochromatographic test strips for the detection
of PRRS virus has been described [52]. The strip tests have the benefits of speed,
convenience, and requiring less technical skill or sophisticated laboratory equipment.
The test is performed by adding serum or tissue homogenate to a mixture of gold-labeled
monoclonal antibodies to the PRRSV N and M proteins. If present, virus binds to the
antibody and the antigen-antibody complexes are captured on chromatographic test
strips. Positive samples are detected using a labeled antibody which binds to the
monoclonal antibodies. Unbound monoclonal antibodies move past the test line and are
captured by a separate set of monoclonal antibodies which produce a band representing a
control line. From trial work performed in China, a sensitivity of >93% and specificity
22
of >96% was reported when samples were compared to RT-PCR testing [53]. However,
these assays are not currently commercially available in the USA.
Test Strip Interpretation
Field test strips have not been widely used to date. Caution should be taken
when interpreting results in light of reported sensitivity and specificity data due to
relative lack of diversity of viruses tested. Positive results could be due to: true presence
of virus, sample contamination, or result of poor specificity of monoclonal antibodies
used in the test strip. Negative results could be the result of: true negative specimens,
positive animals not shedding virus currently, positive animals with no virus in tissue
examined, inability of the test to identify low levels of virus, and inability of the
monoclonal antibodies to identify genetically diverse isolates.
Swine Bioassay
The swine bioassay is a variation of the third fulfillment of Koch’s postulates
which states “the pathogen from a pure culture must cause disease when inoculated into
a healthy susceptible animal.” The swine bioassay was first described to evaluate semen
for PRRSV, where 15 ml of whole semen is injected intraperitoneally into 4-8 week old
PRRSV naïve pigs [4]. The inoculated pigs are placed in strict isolation and monitored
weekly for seroconversion for a total of 5 weeks. The bioassay is very laborious,
requires additional use of animals for diagnostic purposes, and is very slow. This assay
is no longer of routine diagnostic value, but could be used with modifications if
genetically diverse PRRS isolates surface in the future as it is the most sensitive
diagnostic assay available to date to find live virus.
23
Bioassay Interpretation
The swine bioassay interpretation relies on the ability of the virus from the
presumed positive animals to infect naïve pigs. Potential causes of negative results
include: no infectious virus present, virus is present in host but neutralizing antibodies
prevent infection, or virus is present in host but absent/in low concentrations in sample.
Positive results could be due to presence of infectious virus in sample, contamination of
naïve pigs with a different strain or false positive reaction on the confirmatory test used
on the sentinels.
Electron Microscopy
Electron microscopy (EM) was used as an early diagnostic tool shortly after
PRRS was first described. Evaluation of virus isolated on PAMs with an electron
microscope should reveal spherical, enveloped, 45-55 nm in diameter, virus particles
with a 30-35 nm nucleocapsid [54]. Electron microscopy is not used for routine
diagnostics due to the time constraints for testing, sophisticated equipment necessary,
and requirement of specialized technologists. However, similar to the swine bioassay it
could have some utility if variant isolates emerge which can’t be recognized by current
molecular or antibody based techniques.
EM Interpretation
Interpretation of negative results could include the following: no virus present,
viral particles present but morphologically unidentifiable, viral particles present but not
in sufficient concentration to be identified by operator, or virus is present in host but
unable to grow in cell culture medium used for amplification of virus.
24
Detection of Antibody
Serology
Serology has historically been favored by swine practitioners because serum is
easily collected in large quantities for multiple tests which are readily available. Oral
fluid samples and muscle transudate can now also be used to detect antibodies in pigs
[55, 56]. The documentation of seroconversion using acute and convalescent samples is
the definitive method to diagnose PRRS exposure. Increasing titers of PRRS specific
antibody provides good evidence for recent PRRSV exposure. However, serology is not
a valid approach for a diagnosis of PRRS in previously infected or vaccinated herds,
because current serological assays cannot clearly differentiate among antibodies
resulting from an initial infection, reinfection, or vaccination [10]. Single serum samples
can be used to confirm exposure or vaccination compliance in previously naïve pigs, but
cannot be used to prove PRRS is the clinical diagnosis. The tests used to detect the
presence of PRRS specific antibodies include: enzyme-linked immunosorbent assay
(ELISA), indirect fluorescent assay (IFA), virus neutralization (VN), immunoperoxidase
monolayer assay (IPMA), and immunochromographic test strips. Multiple serological
assays are often used for confirmation of questionable samples. The three most
commonly utilized serologic diagnostic tests include the ELISA, IFA, and VN assay. To
put the use of these tests in perspective, the Iowa State University Veterinary Diagnostic
Laboratory ran the following serological tests for PRRSV in 2012: 146,560 HerdCheck®
X3 PRRS ELISA, 7,658 HerdCheck® X3 PRRS ELISA for oral fluids, 2,977 indirect
25
fluorescent antibody tests (1,786 North American and 1,191 for European strains), and
395 PRRS neutralization assays [57].
ELISA
The ELISA is the most commonly used serological test for detection of PRRS
antibodies due to its sensitivity, specificity, speed, and reproducibility. The commonly
used commercial ELISA (HerdChek® X3 PRRS ELISA, IDEXX Laboratories,
Westbrook ME) is considered the reference standard for the detection of antibodies to
PRRSV [10]. This is an indirect ELISA which utilizes the N protein as the target
antigen for both North American and European viral strains. The N protein is the most
abundant viral protein, is highly immunogenic, and induces an early antibody response
in pigs [58]. Recombinant N protein is coated on plates, serum is added, and anti-
PRRSV antibodies are visualized with the addition of an anti-pig Horseradish
Peroxidase-Conjugated Immunoglobulin G (IgG-HRP) conjugate as a second step
(making this an indirect assay). This test replaces the PRRS 2XR kits (IDEXX
Laboratories) and offers significantly improved specificity (99.9%) while maintaining a
high level of sensitivity (98.8%) [59]. Per kit instructions, results are expressed as a
sample-to-positive (S:P) ratio, which is calculated by taking the optical density (OD) of
a given sample on the PRRSV coated well minus the sample OD on the normal host cell
(NHC) antigen coated well divided by the positive control OD on the PRRSV antigen
coated well minus the positive control OD on the NHC coated well. For the HerdChek®
X3 PRRS ELISA S:P ratios ≥ 0.4 are considered positive.
26
The HerdChek® X3 PRRS ELISA protocol can be adapted to the oral fluid
matrix to calibrate the reactivity of the assay to the lower concentration of antibody
present in oral fluids relative to serum. Immunoglobulins M (IgM), IgA, and IgG can all
be readily detected in oral fluid and from a population of animals. The kinetics of each
immunoglobulin in oral fluid are very similar to those found in serum, with the
exception of IgA being identified quicker and for a longer duration in oral fluids [60].
Furthermore, the PRRSV oral fluid ELISA has proven to have a high level of
repeatability and reproducibility amongst laboratories [61]. Testing of oral fluids for
antibodies using pen-based oral fluids is a non-technically demanding and cost-effective
approach for monitoring commercial herds.
A double recognition (DR) ELISA (Ingezim PRRS DR, Inmunología y Genética
Aplicada SA, Madrid, Spain) has recently been developed and is commercially available
for detection of European isolate generated antibodies. The principle of the DR-ELISA
is based on the simultaneous binding of antibody sandwiched between precoated and
enzyme-conjugated antigens [62]. Plates are coated with recombinant N protein,
washed, serum (diluted with horseradish peroxidase-conjugated N protein) is added for
one step incubation, and finally the reaction is revealed by addition of substrate and
stopped prior to reading [63]. Per kit instructions, S:P ratios > 0.175 are considered
positive. The DR-ELISA has a reported specificity of 99% and drastically increased
sensitivity for detecting antibody at 7 DPI (88% vs. 22% for HerdChek® X3 PRRS
ELISA) [64]. The DR-ELISA is better suited to identify IgM due to the use of coated
and conjugated antigen. The pentameric conformation of IgM allows one antibody to
27
bind up to ten antigens as compared to IgG which is theoretically limited to binding two
antigens. The DR-ELISA performance beyond 21 DPI is reportedly very similar to the
HerdChek® X3 PRRS ELISA [63]. The higher sensitivity for detection of early
infection makes the DR-ELISA a more suitable test for naïve farms.
Other ELISA tests have been described, including CIVTEST Suis: PRRS which
uses native proteins of Lelystad virus (EU prototype strain) for antigen (Laboratorios
HIPRA, SA, Girona, Spain) and Ingezim PRRS Compac which utilizes an E.coli-
expressed nucleocapsid protein from a type 1 isolate as an antigen (Inmunología y
Genética Aplicada SA, Madrid, Spain). As well as the blocking ELISAs Bio-Vet PRRS-
Blocking which uses an E.coli-expressed nucleocapsid protein as an antigen (Bio-Vet
Laboratories, Saint-Hyacinthe, Quebec) and Ingezim PRRS Europa/America/Universal
which utilize viral proteins produced in E.coli as antigen (Inmunología y Genética
Aplicada SA, Madrid, Spain).
Blocking ELISAs are performed by coating test plates with an antigen lysate as
for the indirect ELISA. Diluted test serum is then added and allowed to react with the
test antigen if containing antigen specific antibodies. After washing, specific enzyme-
labeled antibody directed against the test antigen is added, resulting in competition with
the test serum antibodies. Negative serum samples result in maximum color
development, whereas samples with specific antibodies specific antibodies show less
color development with increasing antibody.
Numerous studies have shown nonstructural proteins 1, 2, and 7 also induce high
levels of antibody during PRRSV infections [65-67]. An ELISA was developed with
28
nsp2 and nsp7 as the target antigens for pigs infected with both North American and
European isolates. The assay was positive 14 through 126 DPI. The results using nsp2
or nsp7 as target antigens correlated well with the commercial 2X ELISA kit.
Furthermore, the nsp7 ELISA resolved 98% of samples with suspected false-positive
results from the 2X ELISA and was able to differentiate type 1 versus type 2 infection in
469 of 470 samples [67]. Therefore, these other antigen targets may have use as future
commercial, confirmatory, or differentiating tests.
Several differential ELISAs have been developed to distinguish viral exposure to
PRRS isolates with nsp2 deletions from other isolates [68, 69]. An indirect ELISA to
differentiate HP-PRRSV from other Chinese type-2 strains has been developed with
reportedly good sensitivity and specificity [69]. This assay uses the lack of antibodies
against the 30 amino acid deletion sequence within the nsp2 portion of the HP-PRRS
genome as a target for differentiation. A similar approach could be utilized to
differentiate infected from vaccinated animals if a modified live vaccine with significant
genomic changes from field strains can be developed in the future.
ELISA Interpretation
It is important to keep in mind the high degree of variation in individual animal
immune responses and to use care not to over interpret the significance of differences
between S:P ratios [44, 65, 70, 71]. These ratios are not generally considered a “titer”
since it does not use a serial dilution of the serum to obtain a result that is
immunologically meaningful [72]. The level of antibody also cannot be used as an
indicator of isolate virulence [20]. ELISA samples collected at a single time point can
29
be difficult to interpret and should not be used to estimate the particular stage of
infection [73].
Maternally derived antibodies will persist for 3-5 weeks, while new infections
will first become positive for IgM at 5-7 DPI and IgG 7-10 DPI [74-76]. Antibody
levels typically peak at 30-50 DPI prior to declining to negative levels by ~ 300 DPI [10,
77]. Antibodies in oral fluids have been detected for up to 126 DPI [60]. Oral fluids
have also been found to detect exogenous PRRSV antibody in pigs fed diets including
spray-dried porcine plasma [78]. If exogenous sources are suspected to be causing false
positives, feed samples can be submitted and assayed for PRRSV antibody directly or
serum samples can be tested since the feed antibodies are not expected to reach the
serum intact. Positive sample interpretations can include: exposure to PRRS virus or
vaccine, detection of maternally derived antibodies, detection of exogenous antibody, or
classification due to low specificity of the test (false positive).
Possible causes for negative samples can include: no exposure, pigs recently
exposed but have not seroconverted (prior to day 7 of infection for DR-ELISA and day 9
for HerdChek® X3 PRRS ELISA), pigs are harboring virus in lymphoid tissues yet have
become seronegative, pigs have cleared the infection and reverted to seronegative, or
pigs are negative due to low test sensitivity [79]. Persistently infected pigs which are
negative by ELISA can be revealed through isolation of infectious virus or detection of
viral RNA in tonsil, lymphoid tissues, or oropharyngeal scraping [23, 80].
The impact of pooling samples should also be considered when evaluating test
results. Compared to testing samples individually, pooling serum samples to detect
30
antibodies results in a decreased sensitivity and increased specificity. Reducing the S:P
cutoff value recommended by the manufacturer has the opposite effect (increases
sensitivity and decreases specificity). A recommended protocol which increases herd
level sensitivity and specificity compared to testing samples individually includes testing
samples in pools of 2-10 and keeping the total number of tests the same [81]. However,
this does result in increased sample collection costs as more samples are required.
FMIA
The fluorescent microsphere immunoassay (FMIA) uses multiple fluorescent
microspheres for the simultaneous detection of multiple antibodies or antigens in
biological samples. These assays use multiple beads which each have a distinct dye to
distinguish them from each other when using flow cytometry. Individual beads can be
conjugated to different antigens or antibody to capture specific molecules within a
sample. Samples are measured using the fluorescence of a secondary antibody if the
target successfully binds with the bead. The advantage of FMIA is the ability to detect
multiple antigens or antibodies simultaneously with small sample volumes.
The ability of FMIA to detect antibodies in oral fluids was evaluated due to the
relatively low sensitivity of antibody detection in oral fluid samples when using
traditional assays [82]. Recombinant nsp7 and N proteins of type 1 and 2 genotypes
were coupled to microspheres. Serum or oral fluid was combined with the antigen-
coupled microspheres and allowed to incubate to allow for antigen-antibody binding. A
secondary labeled antibody was then added as an indicator and the combination was
again allowed to incubate. The results showed the oral fluid-based FMIAs achieved
31
>92% sensitivity and 95% specificity while the serum samples had greater than 98%
sensitivity and 95% specificity. Antibodies against the N protein were more sensitive
for the detection of early infection while the nsp7 directed antibodies were detected at
higher concentrations and for a longer duration. In serum the antibodies against both
proteins were detected as early as day 7 and persisted for greater than 202 days [82].
FMIA Interpretation
Interpretation of results for the FMIA assay is very similar to those for the
ELISA. The exceptions would be the FMIA is more sensitive for the detection of early
infections as compared to the traditional ELISA.
IFA
The indirect fluorescent antibody (IFA) test is performed by placing serum onto
virus-infected cells in microtiter plate wells, adding fluorescein-labeled anti-porcine
antibodies, and then screening for antigen-antibody reactions with the use of a
fluorescent microscope. This procedure can provide relative antibody titers by using
serial dilution of samples. The IFA detects IgM and IgG antibodies. The IFA generally
has good specificity, but sensitivity is impacted by the technical skill of laboratory
technicians, cell types used, laboratory protocol (media, incubation times, etc.) and
antigenic differences between the PRRS isolate used in the IFA and the field virus
inducing antibodies in the pig [44]. Typically, the IFA is used to confirm suspected
false-positive ELISA results, but has also been used to detect PRRS antibodies in muscle
transudate (meat juice) and oral fluid samples in surveillance programs [55, 56].
32
IFA Interpretation
The IFA is typically able to detect antibodies earlier in the infection stage than
available commercial ELISAs. An IFA can detect IgM as early at 5 DPI and IgG as
early as 9-14 DPI [74]. The duration of antibody detection is slightly different than the
ELISA as the IFA will detect IgM for 21-28 DPI and IgG for 90-145 DPI prior to going
negative. Peak IgG levels will be detected at 30-50 DPI, similar to ELISA. Antibodies
can be detected in piglet umbilical cord blood but typically only in those which are VI or
RT-PCR positive [10].
Potential scenarios for negative tests include: pigs not exposed, pigs recently
exposed but have not seroconverted (prior to 5 DPI for IgM and 9 DPI for IgG), pigs are
persistently infected (harboring virus in lymphoid tissues) and have become
seronegative, pigs have cleared the infection and reverted to seronegative, pigs are
negative due to low test sensitivity, pig was exposed to a genetically diverse isolate
compared to the isolate used to in the test, or operator is unable to detect/differentiate
antigen-antibody complex.
VN
Virus neutralization assays detect antibody capable of neutralizing a given
amount of PRRSV in cell culture. A combination of sample serum dilutions and a
constant amount of virus are incubated to allow any neutralizing antibodies present to
bind to infectious virus. After incubation, the mixture is then added to sensitive cells
which are assessed for visible CPE 3-5 days later. If no neutralizing antibody is present,
CPE should be apparent. However, in the presence of neutralizing antibodies, no CPE
33
will be apparent at lower serum dilutions and a titer can be determined where CPE
becomes apparent. Use of both PAMs and celllines are recommended due to the
significant differences in the infectious process of the two cell types [83]. The VN test is
highly specific, but has poor sensitivity. VN tests have no standardized protocols or set
of reagents to be used, and most laboratories have developed similar but independent
systems [44]. VN assays are typically used only for research purposes due to its time-
consuming nature, technical difficulty, and cost to perform.
VN Interpretation
Neutralizing antibodies have not been clearly linked to immunity or protection
against virulent virus, thus the interpretation to clinical situations is difficult. If the
homologous virus is not used in the assay, results should be interpreted with caution due
to the varying ability of neutralizing antibodies to bind heterologous virus. Neutralizing
antibodies have been identified as early as 11 DPI [84], but often do not develop until
30-60 DPI, if at all [31]. Furthermore, some pigs develop relatively low levels of
neutralizing antibody [58]. Neutralizing antibodies typically peak 60-90 DPI and persist
for up to 365 DPI. Possible explanations for negative VN assays include: pigs were not
exposed, pigs were recently exposed but have not seroconverted (prior to 30 DPI), pigs
are persistently infected and have become seronegative, pigs have cleared the infection
and reverted to seronegative, or the isolate used in the assay is genetically diverse to the
field isolate and unable to bind.
34
Field Test Strips
Similarly to the recent development of immunochromatographic test strips to
detect viral antigen are lateral test strips to detect PRRSV specific antibodies. This assay
(Biosign™PRRSV) uses Escherichia coli-expressed viral N protein for detecting
PRRSV specific antibodies in serum. Strip test sensitivity and specificity were
compared for serum from both clinical and experimentally infected pigs with a
commercially available ELISA kit (HerdChek® PRRS ELISA). The test was able to
detect anti-PRRS antibodies with greater than 93% sensitivity and 98% specificity when
compared to the commercial ELISA [85]. Another described lateral test strip uses
recombinant N and M protein for the detection of anti-PRRS antibodies, reported a
sensitivity and specificity of >97.8% when compared to the commercially available
indirect ELISA (CIVTEST™ SUIS PRRS) kit [86]. Benefits of these tests include: no
requirements for highly trained technicians or sophisticated laboratory equipment, speed,
ability to store the kits at room temperature, and relatively low cost [85, 86]. Like other
antibody assays these tests may not recognize genetically diverse antibodies. These test
kits are not commercially available in the USA currently, but could have utility for
stakeholders.
Test Strip Interpretation
Similarly to the antigen detection field test strip, these tests have also not been
widely used to date. Caution should be used when interpreting results in light of
reported sensitivity and specificity data due to relative lack of diversity of isolate based
testing. Positive results could be due to true presence of antibody or nonspecific
35
reactivity to target antigens on strip. Negative results could be the result of: no pig
exposure, recent exposure but inadequate time for seroconversion, pigs are persistently
infected and have become seronegative, pigs have cleared the infection and reverted to
seronegative, or pigs are negative due to inability to identify genetically diverse isolates.
IPMA
The immunoperoxidase monolayer assay (IPMA) is very similar to the IFA, but
utilizes a peroxidase-labeled secondary antibody and chromogen for color visualization
of positive samples. These assays can be read with a standard light microscope. The
IPMA was the first serological test reported for the diagnosis of PRRS [45]. This assay
is sometimes used to differentiate between genotypes for ELISA positive samples [87].
The IPMA has a high specificity and sensitivity, but is laborious to perform, requires
sophisticated equipment, and can’t be automated for large-scale use [88]. The IPMA is
mainly used in Europe while the similar IFA test is most commonly used for PRRS
diagnostics in North America [89].
IPMA Interpretation
The IPMA by design incorporates more potential epitopes for antibody binding
than most ELISA tests which may improve detection of heterologous isolates. However,
the choice of virus used in the assay greatly affects the results and can lead to false
negatives with very heterologous strains [87]. The IMPA can first detect PRRSV
specific antibodies at 7-14 DPI [89]. IMPA based assays have identified IgA first in
serum at 14 DPI and maximum concentrations at 25 DPI prior to declining to negative
levels at 35 DPI [90].
36
Isolate Characterization
Often producers and veterinarians need more information than qualitative or
quantitative results of presence of virus to facilitate management decisions such as
moving animals onto another farm, tracking isolate spread, and determining if a new
isolate is present in a population of pigs.
RFLP
The first technology which attempted to further characterize isolates came with
the use of ORF 5 restriction fragment length polymorphism (RFLP) [91, 92]. This
technology utilizes three different restriction enzymes (MluI, HincII, and SacII) to cut at
specific sequences of nucleic acids. Results are reported as a numerical code with the
cut pattern of each respective enzyme [92]. Current known possibilities for the codes
include: 4 possibilities for the first code, 96 possibilities for the second code, and 11
possible different cut patterns for the third code [93]. For example, an isolate with a cut
pattern report of 1-8-4 would have no cut sites for MluI (code 1), three specific cut sites
for HincII (code 8), and four cut sites for SacII (code 4). This technology was originally
designed to differentiate vaccine virus from challenge viral strains [92]. However, it is
increasingly being recognized as an insensitive method for characterizing genetic
relatedness among viruses, as RFLP patterns unpredictably and inconsistently change
through conversion and reversion during in vivo replication [10, 94-96]. Theoretically,
a single nucleotide change can alter the RFLP cut pattern without changing the
pathogenicity, antigenicity, replication kinetics, or other clinically relevant viral
characteristics.
37
RFLP Interpretation
Isolate characterization by RFLP has limitations due to the relative amount of
significant data they provide. Many laboratories still report the expected RFLP patterns
for isolates which underwent sequence analysis. This information is provided as a result
of frequent customer requests if such information is not provided with initial results.
Sequence analysis
The use of sequencing and phylogenetic analysis is now widely available and
provides a much more precise and accurate description of isolate genetic makeup by
providing an exact genomic composition for the section examined. Sequences are
attained directly from PCR products of diagnostic samples to avoid potential bias of
selection, mutation, or nucleotide changes by passage in cell culture [10]. Sequencing is
typically only performed on ORF5 and may or may not include ORF6. ORF5 has been
identified as one of the most variable genes while ORF6 is the most conserved gene
[97]. Sequencing of ORF5 allows for monitoring of herd level viral changes over time.
To complete sequence analysis viral RNA must be intact and in sufficient quantity.
Generally, sequencing requires more viral RNA than is necessary for RT-PCR and it is
fairly common for a sample to be RT-PCR positive, but unable to be sequenced.
Attaining genomic sequences from infected tissues and serum generally has good results,
while oral fluids can be troublesome. To optimize the ability to get sequence analysis
from oral fluids, current recommendations are to freeze the samples and transfer to the
laboratory immediately to preserve sample integrity [55].
38
Sequences of ORF5 are highly variable and with the widespread use of PRRSV
sequencing, there is now an extensive library of sequences available for comparison.
Diagnostic laboratories typically provide the sequence analysis information in
comparison to known modified-live vaccine strains for comparison to help differentiate
wild type virus from vaccine isolates. Dendrograms and identity matrices are additional
tools which can help depict phylogenetic relationships based on isolate similarity to
facilitate comparison of noteworthy isolates. Laboratories can typically generate farm
specific dendrograms upon request. Dendrograms are created by aligning the nucleotide
sequence or predicted amino acids sequence of a sample set in an ordered fashion
according to the similarity of sequences. Specialized computer programs evaluate all
possible sequences and groups them accordingly with the end result being a
phylogenetic tree (dendrogram). The relationship of samples is based on all changes
being the result of random, independent mutations during the natural evolution of the
virus. Dendrograms can help determine if the reappearance of PRRS on a farm is due to
the introduction of a new strain or due to the reemergence of a strain previously
identified. Sequence analysis can’t be used to predict virulence of isolates or select the
most efficacious vaccines due to the lack of information on genes responsible for
pathogenesis and clinical immunity.
Sequence Analysis Interpretation
Sequence analysis data is interpreted in light of evaluating relatively small
amounts of genetic information (600-603bp for ORF5) in comparison to the entire
genome (~15,000bp). PRRSV sequence changes within 1% or less are consistent with
39
known amounts of changes over short periods of time (100-730 days), as defined by
experimental studies [44, 98, 99]. A rate of change outside this range increases the
likelihood of the isolates being unrelated. Additionally, it is possible for a sample to
contain more than 1 isolate.
Dendrograms should be considered with caution, as it is important to consider the
possibility of nonrandom mutations. Recombination and genetic selection through
immunological resistance have both been reported and would have a significant effect on
the construction of a dendrogram and the conclusion of a whether a new virus is present
within the herd [100-104].
2.4 Determine Sample Size
Once the objective (detection vs. prevalence) is determined, target population is
defined, and test is selected, the number of animals to sample needs to be determined.
When the objective is to detect at least 1 positive sample from a population, the number
of animals to sample depends on the number of animals in the group (may include a
particular room, barn, or site), estimated prevalence of disease in the population (0% -
50%) (any prevalence greater than 50% will require the same number of samples),
confidence level of detection, in addition to test sensitivity and specificity [2, 105]. A
recommended strategy for ongoing surveillance of breeding herds is to test a
representative sample on a monthly basis to achieve a probability of detection of 95%
[106]. When the objective is to detect infection, sampling does not need to be random,
but can be directed to higher-prevalence groups. Necessary sample sizes can be
calculated with the use of spreadsheets, specialized computer programs, or through the
40
use of available tables (for which the calculations have already been completed) such as
those included [tables 1 and 2].
For example, 95 times out of 100, thirty random samples will contain at least one
positive sample if the true prevalence is 10% or greater. If the prevalence is reduced to
5% sampling 60 animals randomly is required to detect 1 positive sample with a 95%
confidence level. For negative herds, to prove with 100% certainty the herd is truly
negative, all animals would have to be sampled. These tables assume 100% test
sensitivity, which rarely occurs for any test.
When the objective is to determine prevalence within a population similar criteria
need to be defined and include: population size, expected disease prevalence, confidence
level of detection, and accuracy of your prevalence estimation. Estimating group
prevalence is performed by picking a number between 0% - 100%. Recommendations
are to error towards 50% prevalence, as a 50% prevalence carries the greatest standard
error of a proportion which decreases as the prevalence goes in either direction.
Choosing a sample size closer to 50% will require more samples to be tested and result
in the most accurate estimation of the true prevalence. Likewise, the smaller the
accuracy level the more samples are required which results in a more accurate final
prevalence estimation [105]. Sample sizes to estimate prevalence of disease can also be
calculated with the use of spreadsheets, specialized computer programs, or through the
use of tables. For example, with an expected prevalence of 50%, an accuracy of 10%,
confidence level of 95%, and a population of 2,000, 92 samples would be required to
41
estimate the prevalence of disease. However, if the accuracy level is increased to 5%,
the sample size jumps to 322.
Tests with lower sensitivities can be overcome by testing more animals to attain a
higher level of confidence in results, while tests with poor specificity should be avoided
altogether. To compensate for tests with imperfect sensitivity, take the calculated
sample size and divide it by the actual or estimated sensitivity of the planned test. If the
samples are to be used for more than one test, divide by the test with the lowest reported
sensitivity to adjust the necessary sample size [105].
2.5 Interpretation of All Available Test Results
Upon receipt of test results, it is important to evaluate each as a separate piece of
evidence given each test’s inherent limitations discussed previously. If multiple test
results are available, all results should be considered to make a clinical diagnosis. Over
the course of infection, some tests will be positive while others will still be negative
[figure 1]. Along with the individual animal variation, when testing populations, the
infection dynamics of the entire population is likely not exactly the same. Figures 1-3
summarize the potential causes of each possible test outcome and describe the expected
test outcome depending on state of infection at the time of sample collection.
2.6 Classification of the Herd
The final piece to the diagnostic process is the selection of terminology to
classify a population of animals. Standardized terminology has been recommended to
facilitate communication between veterinarians, swine producers, genetic companies,
and other industry stakeholders [107]. The following guidelines are those which have
42
been proposed as minimum requirements for testing to classify herds and do not
necessarily reflect the best approach to attain a diagnosis for a particular herd.
Breeding herd classifications include: positive unstable, positive stable, positive
stable and undergoing elimination, provisional negative, and negative [107]. PRRSV
shedding status is classified as negative, uncertain, or positive. An uncertain status is
used when diagnostic data suggests a negative shedding status, but there is insufficient
statistical power to generate enough confidence for the official negative status.
Exposure status is classified as negative or positive. The default status is positive
unstable when herds have not been tested. To be classified as undergoing elimination,
herds must have initiated an elimination procedure which begins when the last
seropositive breeding replacements are introduced or when the last intentional exposure
occurs in the herd, whichever event occurs later. Herd classification is based on both
shedding and exposure status of the herd [107].
Recommended testing criteria for assessment of PRRSV shedding status of
weaning-age pigs for inclusion into positive stable categories include: testing a minimum
of 30 serum samples per testing event, pooling samples in groups of 5 (if pooling),
testing a minimum of 4 times to account for variation in prevalence, and not more
frequent than every 30 days to confirm status. If a herd has no positive samples over a
90 day period or after completion of 4 consecutive negative herd tests (if sampling every
30 days) and with no clinical signs in the breeding herd, then the herd can be
appropriately classified into a positive stable category [107].
43
Growing pig population categories are more straightforward with only positive
and negative categories. Negative populations must have no positive ELISA tests from
30 submitted samples taken from multiple age groups if present and have no clinical
signs consistent with PRRSV infection. All other populations are classified as positive,
including: those with positive ELISA tests, clinical signs consistent with PRRS, and
herds without sufficient diagnostics [107].
3. Conclusion
The diagnostic approach for Porcine Reproductive and Respiratory Syndrome
virus is a complicated process. The nature of the virus, dynamics of pig flow
management, variety of control measures utilized in the field, and the continually
evolving available technologies for testing make PRRS control and prevention strategies
difficult. However, routine surveillance and disease diagnostics are an essential
component to successful control and elimination programs [108].
Available tests have improved significantly over the years, but no available test is
perfect. The possibility of false positive and negative results should always be
considered. If results are different from those expected, additional testing should be
requested if necessary for the clinical case. Molecular techniques are capable of
detecting viral RNA from a growing list of specimens which also allow for evaluation of
viral epidemiology through sequencing. Antigen detection techniques can be utilized to
confirm virus in cell cultures or clinical samples and to correlate the presence of virus
with pathological lesions. Serological approaches are used to detect previous exposure
44
to virus and also can be performed on a growing list of more conveniently collected
sample types.
It is vital for veterinarians and stakeholders to have an understanding of the
diagnostic approach to PRRS which includes determination of: diagnostic objective,
population to test, appropriate test, required sample size, test results, and herd status.
Test selection and interpretation of results are vital components towards the ongoing
success of pork production within PRRSV endemic regions. PRRS will likely remain a
difficult problem to solve for producers, especially with limited knowledge of
pathogenesis and imperfect tools to prevent and manage infections. However, having a
thorough understanding of PRRSV diagnostic procedures is undoubtedly an important
part of the equation.
45
Table 1. Sample Size to Detect at Least One Positive Sample from Herd [105]
Table 2. Sample Size Required to Estimate Prevalence Where the Expected True
Prevalence is 50%. [105]
46
Table 3. Criteria Required for PRRS Status Categorization of Breeding Herds
[107].
Category Shedding
Status
Exposure
Status
Clinical
Signs
Evidence Required
I Positive
Unstable
Positive Positive Current
clinical
outbreak
Chronically recurring viral
shedding
II-A
Positive
Stable
Uncertain Positive No clinical
signs
> 90 days of PCR (-) weaning
age and growing pigs if present
(> 4 consecutive PCR (-) tests,
30 days apart or sooner
II-B
Positive
Stable
(Undergoing
Elimination)
Uncertain Positive No clinical
signs,
elimination
program
started
> 90 days of PCR(-) weaning
age and growing pigs if present
(> 4 consecutive PCR (-) tests,
30 days apart or sooner
III
Provisional
Negative
Negative Positive No clinical
signs, herd
rollover
started
> 60 days after the initial
introduction of ELISA (-)
breeding replacements with
proof of maintained (-) exposure
status
IV Negative Negative Negative
(new premise
startup or
total
depop/repop)
No clinical
signs
> 365 days of No ELISA (+)
adult breeding animals after the
category III status
or
> 30 days of no ELISA (+) after
complete population with
negative replacements
47
Figure 1. Guidelines for PRRS Antigen and Serological Test Selection and
Interpretation in Accordance with Natural Progression of Infection.
1Adapted and expanded upon from [109]
48
Figure 2. Detection of Virus: PRRS Diagnostic Decision Tree
Detection of VirusInfectious virus present (vaccine or wt strain)
Positive Noninfectious virus present
Sample contamination, no virus in pig
PCR
No viral RNA present
Inability to detect low levels of virus present
Negative Sample degradation, unable to detect virus in sample
Primer/probe mismatch, unable to detect virus in sample
No viral RNA in sample, but pig is persistently infection
No viral RNA in sample, but low prevalence of virus in herd
Positive Infectious PRRSv virus present
CPE present, but no infectious PRRS in sample
VI Infectious virus not present
PRRS isolate not capable of replicating in cell line used
Negative Infectious virus present, but bound with neutralizing antibody
Sample degraded, virus unable to replicate
Technician unable to identify CPE
Positive PRRS antigen in tissue
Poor specificity of monoclonal antibodies, no PRRS antigen in tissue
IHC No antigen in tissues
Pig acutely viremic with insufficient time to deposit antigen in tissue
Negative No antigen in tissue section examined, but antigen present in tissue
Operator unable to identify antigen present in tissue
Monoclonal antibodies unable to bind heterologous isolate present in tissue
Positive PRRS antigen identified
FA Poor specificity of monoclonal antibodies, no PRRS antigen in sample
No antigen in sample
Pig acutely viremic with insufficient time to deposit antigen in sample
Negative No antigen in sample section examined, but antigen present in sample
Operator unable to identify antigen present in sample
Monoclonal antibodies unable to bind heterologous isolate present in sample
Viral antigens present in sample
Positive Sample contamination
Non-specific binding of monoclonal antibodies, no PRRS viral antigens present
Test Stips
No viral antigens present in sample
Negative No viral antigens in sample, but positive pig
Viral antigens present in low quantity
Inability to identify antigens from heterologous isolates
Positive Infectious virus present
Contamination of susceptible pigs with a different strain of PRRS
Swine Bioassay
No infectious virus present
Negative Virus present, but bound by host neutralizing antibodies
Virus present in host, but absent/low quantity in naïve pig inoculum
Positive PRRS particles present
Particles identified with similar size, shape, and morphology
EM
No particles present
Negative Particles present, but morphologically unidentifiable
Particles present, but below threshold of identification
Virus present in host, but isolate not capable of replicating in cell culture used
49
1Adapted and expanded upon from [72]
Figure 3. Detection of Antibody: PRRS Diagnostic Decision Tree
1Adapted and expanded upon from [72]
Test Result Potential Cause
Detection of AntibodyExposure to PRRSv (vaccine or wt virus)
Positive Detection of maternally derived antibodies (persist for 3-5 wks), no PRRSv exposure
Non-specific antibody binding to antigens on plate, no PRRSv exposure
Detection of exogenous sources of PRRSv antibody (oral fluid only), no exposure
ELISA
No exposure to PRRSv
Recent exposure to PRRSv, but no antibodies developed yet (<9 DPI)
Negative Inability to detect low quantity of antibodies
Infection cleared, now seronegative
Persistently infected pig, now seronegative
Inability to detect antibodies against very heterologous isolates
Exposure to PRRSv (vaccine or wt virus)
Positive Detection of maternally derived antibodies, no PRRSv exposure
Non-specific antibody binding to antigens on plate, no PRRSv exposure
IFA
No exposure to PRRSv
Recent exposure to PRRSv, but no antibodies developed yet (<5 DPI (IgM) & <9 DPI (IgG))
Negative Inability to detect low quantity of antibodies
Exposure to a heterologous isolate of PRRS as compared to isolate used in test
Infection cleared, now seronegative
Persistently infected pig, now seronegative
Positive Neutralizing antibodies present
Loss of assay viral infectivitiy
VN No exposure to PRRSv
Inability to neutralize heterologous isolate used in test
Negative Exposure to PRRSv, but insufficient time to develop neutralizing antibodies (<11 DPI))
Inability to identify quantity of neutralizing antibodies
Infection cleared, now seronegative
Persistently infected pig, now seronegative
Positive Exposure to PRRSv (vaccine or wt virus)
Non-specific antibody binding to antigens on strip, no PRRSv exposure
Test Stips
No exposure to PRRSv
Exposure to PRRSv, but insufficient time to develop antibodies
Negative Inability to identify quantity of neutralizing antibodies
Infection cleared, now seronegative
Persistently infected pig, now seronegative
Inability to identify heterologous antibodies against heterologous isolates
Exposure to PRRSv (vaccine or wt virus)
Positive Detection of maternally derived antibodies, no PRRSv exposure
Non-specific antibody binding to antigens on plate, no PRRSv exposure
IPMA
No exposure to PRRSv
Recent exposure to PRRSv, but no antibodies developed yet (<5 DPI (IgM) & <9 DPI (IgG))
Negative Inability to detect low quantity of antibodies
Exposure to a heterologous isolate of PRRS as compared to isolate used in test
Infection cleared, now seronegative
Persistently infected pig, now seronegative
50
References:
[1] Holtkamp D KJ, Zimmerman J, et al. An economic evaluation of PRRS elimination
in the United States swine herd. Project 10-158. Clive, IA: National Pork Board; 2011.
[2] Zimmerman JJ KL, Ramirez A, Schwartz KJ, Stevenson GW. Diseases of Swine. 10
ed: Wiley-Blackwell; 2012.
[3] Van Woensel P, Van der Wouw J, Visser N. Detection of porcine reproductive
respiratory syndrome virus by the polymerase chain reaction. Journal of virological
methods. 1994;47:273-8.
[4] Christopher-Hennings J, Nelson EA, Nelson JK, Hines RJ, Swenson SL, Hill HT, et
al. Detection of porcine reproductive and respiratory syndrome virus in boar semen by
PCR. Journal of clinical microbiology. 1995;33:1730-4.
[5] Benson JE, Yaeger MJ, Christopher-Hennings J, Lager K, Yoon KJ. A comparison
of virus isolation, immunohistochemistry, fetal serology, and reverse-transcription
polymerase chain reaction assay for the identification of porcine reproductive and
respiratory syndrome virus transplacental infection in the fetus. Journal of veterinary
diagnostic investigation : official publication of the American Association of Veterinary
Laboratory Diagnosticians, Inc. 2002;14:8-14.
[6] Meulenberg JJ, Hulst MM, de Meijer EJ, Moonen PL, den Besten A, de Kluyver EP,
et al. Lelystad virus, the causative agent of porcine epidemic abortion and respiratory
syndrome (PEARS), is related to LDV and EAV. Virology. 1993;192:62-72.
[7] Meng XJ, Paul PS, Halbur PG, Lum MA. Phylogenetic analyses of the putative M
(ORF 6) and N (ORF 7) genes of porcine reproductive and respiratory syndrome virus
(PRRSV): implication for the existence of two genotypes of PRRSV in the U.S.A. and
Europe. Archives of virology. 1995;140:745-55.
[8] Chittick WA, Stensland WR, Prickett JR, Strait EL, Harmon K, Yoon KJ, et al.
Comparison of RNA extraction and real-time reverse transcription polymerase chain
reaction methods for the detection of Porcine reproductive and respiratory syndrome
virus in porcine oral fluid specimens. Journal of veterinary diagnostic investigation :
official publication of the American Association of Veterinary Laboratory
Diagnosticians, Inc. 2011;23:248-53.
[9] Gerber PF, O'Neill K, Owolodun O, Wang C, Harmon K, Zhang J, et al. Comparison
of commercial real-time RT-PCR assays for reliable, early and rapid detection of
heterologous strains of porcine reproductive and respiratory syndrome virus (PRRSV) in
experimentally infected or negative boars using different sample types (semen, oral
fluids, serum, blood swabs). Journal of clinical microbiology. 2012.
51
[10] Zimmerman JJ KL, Ramirez A, Schwartz KJ, Stevenson GW Diseases of Swine. In:
Zimmermann JJ BD, Dee SA, Murtaugh MP, Stadejek T, Stevenson GW, Torremorell
M,, editor. Porcine Reproductive and Respiratory Syndrome Virus (Porcine Arterivirus).
10 ed: Wiley-Blackwell; 2012. p. 461-86.
[11] Rovira A, Clement T, Christopher-Hennings J, Thompson B, Engle M, Reicks D, et
al. Evaluation of the sensitivity of reverse-transcription polymerase chain reaction to
detect porcine reproductive and respiratory syndrome virus on individual and pooled
samples from boars. Journal of veterinary diagnostic investigation : official publication
of the American Association of Veterinary Laboratory Diagnosticians, Inc. 2007;19:502-
9.
[12] Harmon KM, Abate SA, Chriswell AJ. Comparison of two commercial real-time
reverse transcriptase polymerase chain reaction assays for porcine reproductive and
respiratory syndrome virus. JSHAP. 2012;20:184-8.
[13] Wernike K, Hoffmann B, Dauber M, Lange E, Schirrmeier H, Beer M. Detection
and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by
multiplex real-time rt-PCR. PloS one. 2012;7:e38251.
[14] Zhou L, Zhang J, Zeng J, Yin S, Li Y, Zheng L, et al. The 30-amino-acid deletion in
the Nsp2 of highly pathogenic porcine reproductive and respiratory syndrome virus
emerging in China is not related to its virulence. Journal of virology. 2009;83:5156-67.
[15] Chai Z, Ma W, Fu F, Lang Y, Wang W, Tong G, et al. A SYBR Green-based real-
time RT-PCR assay for simple and rapid detection and differentiation of highly
pathogenic and classical type 2 porcine reproductive and respiratory syndrome virus
circulating in China. Archives of virology. 2012.
[16] Chen NH, Chen XZ, Hu DM, Yu XL, Wang LL, Han W, et al. Rapid differential
detection of classical and highly pathogenic North American Porcine Reproductive and
Respiratory Syndrome virus in China by a duplex real-time RT-PCR. Journal of
virological methods. 2009;161:192-8.
[17] Linhares DC, Rovira A, Torremorell M. Evaluation of Flinders Technology
Associates cards for collection and transport of samples for detection of Porcine
reproductive and respiratory syndrome virus by reverse transcription polymerase chain
reaction. Journal of veterinary diagnostic investigation : official publication of the
American Association of Veterinary Laboratory Diagnosticians, Inc. 2012;24:328-32.
[18] Li Q, Zhou QF, Xue CY, Ma JY, Zhu DZ, Cao YC. Rapid detection of porcine
reproductive and respiratory syndrome virus by reverse transcription loop-mediated
isothermal amplification assay. Journal of virological methods. 2009;155:55-60.
52
[19] Rovira A, Abrahante J, Murtaugh M, Munoz-Zanzi C. Reverse transcription loop-
mediated isothermal amplification for the detection of Porcine reproductive and
respiratory syndrome virus. Journal of veterinary diagnostic investigation : official
publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.
2009;21:350-4.
[20] Klinge KL, Vaughn EM, Roof MB, Bautista EM, Murtaugh MP. Age-dependent
resistance to Porcine reproductive and respiratory syndrome virus replication in swine.
Virology journal. 2009;6:177.
[21] Bierk MD, Dee SA, Rossow KD, Otake S, Collins JE, Molitor TW. Transmission of
porcine reproductive and respiratory syndrome virus from persistently infected sows to
contact controls. Canadian journal of veterinary research = Revue canadienne de
recherche veterinaire. 2001;65:261-6.
[22] Christopher-Hennings J, Nelson EA, Hines RJ, Nelson JK, Swenson SL,
Zimmerman JJ, et al. Persistence of porcine reproductive and respiratory syndrome virus
in serum and semen of adult boars. Journal of veterinary diagnostic investigation :
official publication of the American Association of Veterinary Laboratory
Diagnosticians, Inc. 1995;7:456-64.
[23] Horter DC, Pogranichniy RM, Chang CC, Evans RB, Yoon KJ, Zimmerman JJ.
Characterization of the carrier state in porcine reproductive and respiratory syndrome
virus infection. Veterinary microbiology. 2002;86:213-28.
[24] Wills RW, Doster AR, Galeota JA, Sur JH, Osorio FA. Duration of infection and
proportion of pigs persistently infected with porcine reproductive and respiratory
syndrome virus. Journal of clinical microbiology. 2003;41:58-62.
[25] Ramirez A, Wang C, Prickett JR, Pogranichniy R, Yoon KJ, Main R, et al. Efficient
surveillance of pig populations using oral fluids. Preventive veterinary medicine.
2012;104:292-300.
[26] Kittawornrat A, Prickett J, Chittick W, Wang C, Engle M, Johnson J, et al. Porcine
reproductive and respiratory syndrome virus (PRRSV) in serum and oral fluid samples
from individual boars: will oral fluid replace serum for PRRSV surveillance? Virus
research. 2010;154:170-6.
[27] Zimmerman JJ, Jacobs AC, Hermann JR, Munoz-Zanzi C, Prickett JR, Roof MB, et
al. Stability of Porcine reproductive and respiratory syndrome virus at ambient
temperatures. Journal of veterinary diagnostic investigation : official publication of the
American Association of Veterinary Laboratory Diagnosticians, Inc. 2010;22:257-60.
53
[28] Hermann J, Hoff S, Munoz-Zanzi C, Yoon KJ, Roof M, Burkhardt A, et al. Effect
of temperature and relative humidity on the stability of infectious porcine reproductive
and respiratory syndrome virus in aerosols. Veterinary research. 2007;38:81-93.
[29] Wernike K, Bonilauri P, Dauber M, Errington J, LeBlanc N, Revilla-Fernandez S,
et al. Porcine reproductive and respiratory syndrome virus: interlaboratory ring trial to
evaluate real-time reverse transcription polymerase chain reaction detection methods.
Journal of veterinary diagnostic investigation : official publication of the American
Association of Veterinary Laboratory Diagnosticians, Inc. 2012;24:855-66.
[30] Indik S, Schmoll F, Sipos W, Klein D. Genetic variability of PRRS virus in Austria:
consequences for molecular diagnostics and viral quantification. Veterinary
microbiology. 2005;107:171-8.
[31] Benfield DA, Nelson E, Collins JE, Harris L, Goyal SM, Robison D, et al.
Characterization of swine infertility and respiratory syndrome (SIRS) virus (isolate
ATCC VR-2332). Journal of veterinary diagnostic investigation : official publication of
the American Association of Veterinary Laboratory Diagnosticians, Inc. 1992;4:127-33.
[32] Bloemraad M, de Kluijver EP, Petersen A, Burkhardt GE, Wensvoort G. Porcine
reproductive and respiratory syndrome: temperature and pH stability of Lelystad virus
and its survival in tissue specimens from viraemic pigs. Veterinary microbiology.
1994;42:361-71.
[33] Van Alstine WG, Kanitz CL, Stevenson GW. Time and temperature survivability of
PRRS virus in serum and tissues. Journal of veterinary diagnostic investigation : official
publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.
1993;5:621-2.
[34] Kim HS, Kwang J, Yoon IJ, Joo HS, Frey ML. Enhanced replication of porcine
reproductive and respiratory syndrome (PRRS) virus in a homogeneous subpopulation of
MA-104 cell line. Archives of virology. 1993;133:477-83.
[35] Lee YJ, Park CK, Nam E, Kim SH, Lee OS, Lee du S, et al. Generation of a porcine
alveolar macrophage cell line for the growth of porcine reproductive and respiratory
syndrome virus. Journal of virological methods. 2010;163:410-5.
[36] Sagong M, Park CK, Kim SH, Lee KK, Lee OS, Lee du S, et al. Human telomerase
reverse transcriptase-immortalized porcine monomyeloid cell lines for the production of
porcine reproductive and respiratory syndrome virus. Journal of virological methods.
2012;179:26-32.
54
[37] An TQ, Tian ZJ, He YX, Xiao Y, Jiang YF, Peng JM, et al. Porcine reproductive
and respiratory syndrome virus attachment is mediated by the N-terminal domain of the
sialoadhesin receptor. Veterinary microbiology. 2010;143:371-8.
[38] Calvert JG, Slade DE, Shields SL, Jolie R, Mannan RM, Ankenbauer RG, et al.
CD163 expression confers susceptibility to porcine reproductive and respiratory
syndrome viruses. Journal of virology. 2007;81:7371-9.
[39] Provost C, Jia JJ, Music N, Levesque C, Lebel ME, Del Castillo JR, et al.
Identification of a new cell line permissive to porcine reproductive and respiratory
syndrome virus infection and replication which is phenotypically distinct from MARC-
145 cell line. Virology journal. 2012;9:267.
[40] Feng L, Zhang X, Xia X, Li Y, He S, Sun H. Generation and characterization of a
porcine endometrial endothelial cell line susceptible to porcine reproductive and
respiratory syndrome virus. Virus research. 2012.
[41] Bautista EM, Goyal SM, Yoon IJ, Joo HS, Collins JE. Comparison of porcine
alveolar macrophages and CL 2621 for the detection of porcine reproductive and
respiratory syndrome (PRRS) virus and anti-PRRS antibody. Journal of veterinary
diagnostic investigation : official publication of the American Association of Veterinary
Laboratory Diagnosticians, Inc. 1993;5:163-5.
[42] de Abin MF, Spronk G, Wagner M, Fitzsimmons M, Abrahante JE, Murtaugh MP.
Comparative infection efficiency of Porcine reproductive and respiratory syndrome virus
field isolates on MA104 cells and porcine alveolar macrophages. Canadian journal of
veterinary research = Revue canadienne de recherche veterinaire. 2009;73:200-4.
[43] Ait-Ali T, Wilson AD, Westcott DG, Clapperton M, Waterfall M, Mellencamp MA,
et al. Innate immune responses to replication of porcine reproductive and respiratory
syndrome virus in isolated Swine alveolar macrophages. Viral immunology.
2007;20:105-18.
[44] Christopher-Hennings J, Faaberg KS, Murtaugh MP, Nelson EA, Roof MB,
Vaughn EM, Yoon KJ, Zimmerman JJ. Porcine reproductive and respiratory syndrome
(PRRS) diagnostics: Interpretation and limitations. J Swine Health Prod. 2002;10:213-8.
[45] Wensvoort G, Terpstra C, Pol JM, ter Laak EA, Bloemraad M, de Kluyver EP, et al.
Mystery swine disease in The Netherlands: the isolation of Lelystad virus. The
Veterinary quarterly. 1991;13:121-30.
[46] Nelson EA, Christopher-Hennings J, Drew T, Wensvoort G, Collins JE, Benfield
DA. Differentiation of U.S. and European isolates of porcine reproductive and
55
respiratory syndrome virus by monoclonal antibodies. Journal of clinical microbiology.
1993;31:3184-9.
[47] Halbur PG, Andrews JJ, Huffman EL, Paul PS, Meng XJ, Niyo Y. Development of
a streptavidin-biotin immunoperoxidase procedure for the detection of porcine
reproductive and respiratory syndrome virus antigen in porcine lung. Journal of
veterinary diagnostic investigation : official publication of the American Association of
Veterinary Laboratory Diagnosticians, Inc. 1994;6:254-7.
[48] Van Alstine WG, Popielarczyk M, Albregts SR. Effect of formalin fixation on the
immunohistochemical detection of PRRS virus antigen in experimentally and naturally
infected pigs. Journal of veterinary diagnostic investigation : official publication of the
American Association of Veterinary Laboratory Diagnosticians, Inc. 2002;14:504-7.
[49] Yaeger MJ. The diagnostic sensitivity of immunohistochemistry for the detection of
porcine reproductive and respiratory syndrome virus in the lung of vaccinated and
unvaccinated swine. Journal of veterinary diagnostic investigation : official publication
of the American Association of Veterinary Laboratory Diagnosticians, Inc. 2002;14:15-
9.
[50] Halbur PG, Paul PS, Frey ML, Landgraf J, Eernisse K, Meng XJ, et al. Comparison
of the antigen distribution of two US porcine reproductive and respiratory syndrome
virus isolates with that of the Lelystad virus. Veterinary pathology. 1996;33:159-70.
[51] Rossow KD, Collins JE, Goyal SM, Nelson EA, Christopher-Hennings J, Benfield
DA. Pathogenesis of porcine reproductive and respiratory syndrome virus infection in
gnotobiotic pigs. Veterinary pathology. 1995;32:361-73.
[52] Zhou SH, Cui SJ, Chen CM, Zhang FC, Li J, Zhou S, et al. Development and
validation of an immunogold chromatographic test for on-farm detection of PRRSV.
Journal of virological methods. 2009;160:178-84.
[53] Li XS, Fu F, Lang YK, Li HZ, Wang W, Chen X, et al. Development and
preliminary application of an immunochromatographic strip for rapid detection of
infection with porcine reproductive and respiratory syndrome virus in swine. Journal of
virological methods. 2011;176:46-52.
[54] Botner A, Nielsen J, Bille-Hansen V. Isolation of porcine reproductive and
respiratory syndrome (PRRS) virus in a Danish swine herd and experimental infection of
pregnant gilts with the virus. Veterinary microbiology. 1994;40:351-60.
[55] Prickett JR, Cutler S, Kinyon JM. Stability of porcine reproductive and respiratory
syndrome virus and antibody in swine oral fluid. JSHAP. 2010;18:187-95.
56
[56] Molina RM, Chittick W, Nelson EA, Christopher-Hennings J, Rowland RR,
Zimmerman JJ. Diagnostic performance of assays for the detection of anti-Porcine
reproductive and respiratory syndrome virus antibodies in serum and muscle transudate
("meat juice") based on samples collected under experimental conditions. Journal of
veterinary diagnostic investigation : official publication of the American Association of
Veterinary Laboratory Diagnosticians, Inc. 2008;20:735-43.
[57] Johnson J. Prevalence of PRRSV Serological Tests Performed in 2012 at the ISU
VDL. Personal Communication. 2013.
[58] Nelson EA, Christopher-Hennings J, Benfield DA. Serum immune responses to the
proteins of porcine reproductive and respiratory syndrome (PRRS) virus. Journal of
veterinary diagnostic investigation : official publication of the American Association of
Veterinary Laboratory Diagnosticians, Inc. 1994;6:410-5.
[59] Iowa State University University. Improved PRRS ELISA (HerdChekX3®
Introduced. Veterinary diagnostic and production animal medicine on line report. Ames,
IA: Iowa State University College of Veterinary Medicine; 2010.
[60] Kittawornrat A, Prickett J, Wang C, Olsen C, Irwin C, Panyasing Y, et al. Detection
of Porcine reproductive and respiratory syndrome virus (PRRSV) antibodies in oral fluid
specimens using a commercial PRRSV serum antibody enzyme-linked immunosorbent
assay. Journal of veterinary diagnostic investigation : official publication of the
American Association of Veterinary Laboratory Diagnosticians, Inc. 2012;24:262-9.
[61] Kittawornrat A, Wang C, Anderson G, Ballagi A, Broes A, Carman S, et al. Ring
test evaluation of the repeatability and reproducibility of a Porcine reproductive and
respiratory syndrome virus oral fluid antibody enzyme-linked immunosorbent assay.
Journal of veterinary diagnostic investigation : official publication of the American
Association of Veterinary Laboratory Diagnosticians, Inc. 2012;24:1057-63.
[62] Watcharatanyatip K, Boonmoh S, Chaichoun K, Songserm T, Woratanti M,
Dharakul T. Multispecies detection of antibodies to influenza A viruses by a double-
antigen sandwich ELISA. Journal of virological methods. 2010;163:238-43.
[63] Diaz I, Venteo A, Rebollo B, Martin-Valls GE, Simon-Grife M, Sanz A, et al.
Comparison of two commercial enzyme-linked immunosorbent assays for the diagnosis
of Porcine reproductive and respiratory syndrome virus infection. Journal of veterinary
diagnostic investigation : official publication of the American Association of Veterinary
Laboratory Diagnosticians, Inc. 2012;24:344-8.
[64] Venteo A, Rebollo B, Sarraseca J, Rodriguez MJ, Sanz A. A novel double
recognition enzyme-linked immunosorbent assay based on the nucleocapsid protein for
57
early detection of European porcine reproductive and respiratory syndrome virus
infection. Journal of virological methods. 2012;181:109-13.
[65] Johnson CR, Yu W, Murtaugh MP. Cross-reactive antibody responses to nsp1 and
nsp2 of Porcine reproductive and respiratory syndrome virus. The Journal of general
virology. 2007;88:1184-95.
[66] Jankova J, Celer V. Expression and serological reactivity of Nsp7 protein of PRRS
genotype I virus. Research in veterinary science. 2012;93:1537-42.
[67] Brown E, Lawson S, Welbon C, Gnanandarajah J, Li J, Murtaugh MP, et al.
Antibody response to porcine reproductive and respiratory syndrome virus (PRRSV)
nonstructural proteins and implications for diagnostic detection and differentiation of
PRRSV types I and II. Clinical and vaccine immunology : CVI. 2009;16:628-35.
[68] Kim DY, Kaiser TJ, Horlen K, Keith ML, Taylor LP, Jolie R, et al. Insertion and
deletion in a non-essential region of the nonstructural protein 2 (nsp2) of porcine
reproductive and respiratory syndrome (PRRS) virus: effects on virulence and
immunogenicity. Virus genes. 2009;38:118-28.
[69] Xiao YH, Wang TT, Zhao Q, Wang CB, Lv JH, Nie L, et al. Development of
Indirect ELISAs for Differential Serodiagnosis of Classical and Highly Pathogenic
Porcine Reproductive and Respiratory Syndrome Virus. Transboundary and emerging
diseases. 2012.
[70] Molina RM, Cha SH, Chittick W, Lawson S, Murtaugh MP, Nelson EA, et al.
Immune response against porcine reproductive and respiratory syndrome virus during
acute and chronic infection. Veterinary immunology and immunopathology.
2008;126:283-92.
[71] Johnson W, Roof M, Vaughn E, Christopher-Hennings J, Johnson CR, Murtaugh
MP. Pathogenic and humoral immune responses to porcine reproductive and respiratory
syndrome virus (PRRSV) are related to viral load in acute infection. Veterinary
immunology and immunopathology. 2004;102:233-47.
[72] Zimmerman JJ KL, Ramirez A, Schwartz KJ, Stevenson GW. Diseases of Swine.
10 ed: Wiley-Blackwell; 2012.
[73] J. R. Serological monitoring in infected sow herds. The PRRS Compendium.
2003;2:75-86.
[74] Joo HS, Park BK, Dee SA, Pijoan C. Indirect fluorescent IgM antibody response of
pigs infected with porcine reproductive and respiratory syndrome syndrome virus.
Veterinary microbiology. 1997;55:303-7.
58
[75] Park BK, Joo HS, Dee SA, Pijoan C. Evaluation of an indirect fluorescent IgM
antibody test for the detection of pigs with recent infection of porcine reproductive and
respiratory syndrome virus. Journal of veterinary diagnostic investigation : official
publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.
1995;7:544-6.
[76] Loemba HD, Mounir S, Mardassi H, Archambault D, Dea S. Kinetics of humoral
immune response to the major structural proteins of the porcine reproductive and
respiratory syndrome virus. Archives of virology. 1996;141:751-61.
[77] Manickam C, Dwivedi V, Patterson R, Papenfuss T, Renukaradhya GJ. Porcine
reproductive and respiratory syndrome virus induces pronounced immune modulatory
responses at mucosal tissues in the parental vaccine strain VR2332 infected pigs.
Veterinary microbiology. 2013;162:68-77.
[78] Johnson JK MR, Zimmerman JJ. Exogenous source of PRRSV antibody in positive
oral-fluid ELISA results. Journal of Swine Health & Production2012. p. 215.
[79] Yoon KJ, Christopher-Hennings J, Nelson EA. Diagnosis. The PRRS Compendium.
2003;2:59-74.
[80] Fangman TJ KS, Coleman M. Tonsilar crypt exudate to evaluate shedding and
transmission of porcine reproductive and respiratory syndrome virus after inoculation
with live field virus or vaccination with modified live virus vaccine J Swine Health Prod.
2007;15:219-23.
[81] Rovira A, Cano JP, Munoz-Zanzi C. Feasibility of pooled-sample testing for the
detection of porcine reproductive and respiratory syndrome virus antibodies on serum
samples by ELISA. Veterinary microbiology. 2008;130:60-8.
[82] Langenhorst RJ, Lawson S, Kittawornrat A, Zimmerman JJ, Sun Z, Li Y, et al.
Development of a fluorescent microsphere immunoassay for detection of antibodies
against porcine reproductive and respiratory syndrome virus using oral fluid samples as
an alternative to serum-based assays. Clinical and vaccine immunology : CVI.
2012;19:180-9.
[83] Van Breedam W, Costers S, Vanhee M, Gagnon CA, Rodriguez-Gomez IM,
Geldhof M, et al. Porcine reproductive and respiratory syndrome virus (PRRSV)-
specific mAbs: supporting diagnostics and providing new insights into the antigenic
properties of the virus. Veterinary immunology and immunopathology. 2011;141:246-
57.
[84] Yoon IJ, Joo HS, Goyal SM, Molitor TW. A modified serum neutralization test for
the detection of antibody to porcine reproductive and respiratory syndrome virus in
59
swine sera. Journal of veterinary diagnostic investigation : official publication of the
American Association of Veterinary Laboratory Diagnosticians, Inc. 1994;6:289-92.
[85] Lyoo YS, Kleiboeker SB, Jang KY, Shin NK, Kang JM, Kim CH, et al. A simple
and rapid chromatographic strip test for detection of antibody to porcine reproductive
and respiratory syndrome virus. Journal of veterinary diagnostic investigation : official
publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.
2005;17:469-73.
[86] Cui S, Zhou S, Chen C, Qi T, Zhang C, Oh J. A simple and rapid
immunochromatographic strip test for detecting antibody to porcine reproductive and
respiratory syndrome virus. Journal of virological methods. 2008;152:38-42.
[87] Frossard JP, Fearnley C, Naidu B, Errington J, Westcott DG, Drew TW. Porcine
reproductive and respiratory syndrome virus: antigenic and molecular diversity of
British isolates and implications for diagnosis. Veterinary microbiology. 2012;158:308-
15.
[88] Nodelijk G. Porcine reproductive and respiratory syndrome (PRRS) with special
reference to clinical aspects and diagnosis. A review. The Veterinary quarterly.
2002;24:95-100.
[89] Botner A. Diagnosis of PRRS. Veterinary microbiology. 1997;55:295-301.
[90] Labarque GG, Nauwynck HJ, Van Reeth K, Pensaert MB. Effect of cellular
changes and onset of humoral immunity on the replication of porcine reproductive and
respiratory syndrome virus in the lungs of pigs. The Journal of general virology.
2000;81:1327-34.
[91] Umthun AR, Mengeling WL. Restriction fragment length polymorphism analysis of
strains of porcine reproductive and respiratory syndrome virus by use of a nested-set
reverse transcriptase-polymerase chain reaction. American journal of veterinary
research. 1999;60:802-6.
[92] Wesley RD, Mengeling WL, Lager KM, Clouser DF, Landgraf JG, Frey ML.
Differentiation of a porcine reproductive and respiratory syndrome virus vaccine strain
from North American field strains by restriction fragment length polymorphism analysis
of ORF 5. Journal of veterinary diagnostic investigation : official publication of the
American Association of Veterinary Laboratory Diagnosticians, Inc. 1998;10:140-4.
[93] Rossow KD. PRRS ORF5 Cut Patterns. Personal communicaiton. 2013.
[94] Cha SH, Chang CC, Yoon KJ. Instability of the restriction fragment length
polymorphism pattern of open reading frame 5 of porcine reproductive and respiratory
60
syndrome virus during sequential pig-to-pig passages. Journal of clinical microbiology.
2004;42:4462-7.
[95] Yoon KJ, Chang CC, Zimmerman J, Harmon K. Genetic and antigenic stability of
PRRS virus in pigs. Field and experimental prospectives. Advances in experimental
medicine and biology. 2001;494:25-30.
[96] Cai HY, Alexander H, Carman S, Lloyd D, Josephson G, Maxie MG. Restriction
fragment length polymorphism of porcine reproductive and respiratory syndrome viruses
recovered from Ontario farms, 1998-2000. Journal of veterinary diagnostic investigation
:official publication of the American Association of Veterinary Laboratory
Diagnosticians, Inc. 2002;14:343-7.
[97] Kapur V, Elam MR, Pawlovich TM, Murtaugh MP. Genetic variation in porcine
reproductive and respiratory syndrome virus isolates in the midwestern United States.
The Journal of general virology. 1996;77 ( Pt 6):1271-6.
[98] Rowland RR, Steffen M, Ackerman T, Benfield DA. The evolution of porcine
reproductive and respiratory syndrome virus: quasispecies and emergence of a virus
subpopulation during infection of pigs with VR-2332. Virology. 1999;259:262-6.
[99] Yuan S, Mickelson D, Murtaugh MP, Faaberg KS. Complete genome comparison
of porcine reproductive and respiratory syndrome virus parental and attenuated strains.
Virus research. 2001;79:189-200.
[100] Liu D, Zhou R, Zhang J, Zhou L, Jiang Q, Guo X, et al. Recombination analyses
between two strains of porcine reproductive and respiratory syndrome virus in vivo.
Virus research. 2011;155:473-86.
[101] Murtaugh MP, Yuan S, Faaberg KS. Appearance of novel PRRSV isolates by
recombination in the natural environment. Advances in experimental medicine and
biology. 2001;494:31-6.
[102] Yuan S, Nelsen CJ, Murtaugh MP, Schmitt BJ, Faaberg KS. Recombination
between North American strains of porcine reproductive and respiratory syndrome virus.
Virus research. 1999;61:87-98.
[103] Xu Z, Chang X, Xiao S, Chen H, Zhou R. Evidence for the adaptive evolution of
ORF5 gene of Porcine reproductive and respiratory syndrome virus isolated in China.
Acta virologica. 2010;54:281-5.
[104] Murtaugh MP, Stadejek T, Abrahante JE, Lam TT, Leung FC. The ever-expanding
diversity of porcine reproductive and respiratory syndrome virus. Virus research.
2010;154:18-30.
61
[105] Chase C PD. Sampling the Herd: When is Enough? AASV Annual Meeting2000.
p. 465-77.
[106] Dufresne L, Polson DD, Holck JT, Roberts J. . PRRS Compendium. Des Moines,
IA: National Pork Board; 2003.
[107] Holtkamp DJ, Polson DD, Torremorell M. Terminology for classifying swine
herds by porcine reproductive and respiratory syndrome virus status. JSHAP.
2011;19:44-56.
[108] Velasova M, Alarcon P, Williamson S, Wieland B. Risk factors for porcine
reproductive and respiratory syndrome virus infection and resulting challenges for
effective disease surveillance. BMC veterinary research. 2012;8:184.
[109] Dufresne L, Polson DD, Holck JT, Roberts J. Serological Monitoring in Negative
and Low Prevalence Populations. Des Moines, IA: National Pork Board; 2003.
62
CHAPTER 3. VACCINE EFFICACY OF PORCINE REPRODUCTIVE AND
RESPIRATORY SYNDROME VIRUS CHIMERAS
A paper published in Vaccine 28 (2010) 2679-2686
Joshua S. Ellingson, Yue Wang, Sarah Layton, Janice Ciacci-Zanella, Michael B. Roof
and Kay S. Faaberg
Abstract
The vaccine efficacy of six PRRSV Type 2 infectious clones, including five
chimeras and a strain-specific deletion mutant, were examined using a respiratory
challenge model in growing swine. The chimeras were constructed from different
combinations of a licensed modified live vaccine (Ingelvac® PRRS MLV) and a virulent
field isolate (wt MN184) which differ by 14.3% on a nucleotide basis, while the deletion
mutant tested had a broad deletion in the nsp2 region of strain MN184. The appearance
of antibodies and virus characterization revealed regions of the genome that could
influence PRRSV replication in vivo. Swine growth, clinical signs and lung lesions were
also monitored. Average daily weight gain was negatively and directly impacted by
some vaccines, and after challenge, vaccination with different constructs led to variable
weight gain. We determined that 3 of the tested chimeras, including two previously
published chimeras [1] and one in which strain MN184 ORF5-6 was placed on the
background of Ingelvac® PRRS MLV were able to prevent lung consolidation to a
similar extent as traditionally prepared cell-passaged attenuated vaccines. The study
suggested that only specific chimeras can attenuate clinical signs in swine and that
attenuation cannot be directly linked to primary virus replication. Additionally, the strain
MN184 deletion mutant was not found to have been sufficiently attenuated nor
63
efficacious against heterologous challenge with strain JA-142.
1. Introduction
Porcine reproductive and respiratory syndrome virus (PRRSV) emerged to cause
clinical problems in animals in the early 1990s on separate continents [2, 3]. Since then,
the virus has spread to most swine producing regions of the world. PRRSV has been
found to vary as much as 40% in nucleotide sequence and has been separated into two
genotypes, European (Type 1) and North American (Type 2), based upon their original
isolation location and date. As a result of this overwhelming diversity, the swine immune
response is often not cross protective. PRRSV also induces a poor immune response in
most animals. This incomplete protection appears to be due to several factors including
the nature of the virus, the genetics of swine host and the complication of co-infection
with other pathogens [4, 5]. One traditional method of vaccine preparation, culturing the
virus over several in vitro cell passages in order to attenuate clinical symptoms, has
resulted in several available products for use in the field [6, 7]. However, this can lead to
incomplete protection against heterologous PRRSV strains and an uncertainty in
selection of the appropriate vaccine for routine use [5]. A newer approach has been to
evaluate infectious cDNA clones of PRRSV, which can represent chimeras or site-
specific changes that may potentially increase the immune response, and may also have
specifically engineered deletions and/or insertions to provide markers for vaccine
identification [1, 8-16].
Limited reports using this new approach have suggested that specific PRRSV
chimeras can provide direct attenuation of clinical signs in either a respiratory model or
64
a reproductive failure model [1, 10]. Our previous studies have demonstrated that two
reciprocal chimeras (rMLVORF1/MN184 and rMN184ORF1/MLV) of Type 2 PRRSV
strains, Ingelvac®
PRRS MLV and wild-type (wt) isolate MN184, could attenuate
clinical signs of young swine after heterologous challenge with PRRSV strain SDSU73
in a respiratory challenge model [1]. Therefore, it was hypothesized that additional
chimeras created from the same parent strains, but with different regions of the genome
exchanged, would be more efficacious in the face of virulent challenge than
commercially available products and perhaps provide an alternate method of PRRSV
attenuation.
To extend these original studies, we examined the two original [1] as well as
three additional chimeras, plus a deletion mutant recombinant of wt strain MN184, under
different challenge conditions. The new genomic areas of study were chosen to consider
the contributions of key regions of a virulent strain in inducing protection against
subsequent heterotypic virus exposure. PRRSV ORF5-6 code for the major viral
attachment domain, ORF7 encodes the nucleocapsid protein that surrounds the genome
and interacts with the structural proteins in the virion, and the 3'UTR is critical to
successful transcription of subgenomic RNAs and replication [17, 18]. The additional
chimeras were synthesized using an Ingelvac® PRRS MLV backbone. In addition, the
replicase region known as nonstructural protein 2 (nsp2) has been shown to be
immunogenic, contains hypervariable segments, encodes a protease responsible for
replicase cleavage and harbors B-cell epitopes [12, 19-25]. Thus, in order to examine a
possible role for nsp2 in protection, recombinant strain MN184 was modified by
65
removing 618 bases of the nsp2 coding region. The six engineered viruses were used as
vaccines in parallel with two conventionally attenuated PRRSV strains, Ingelvac® PRRS
MLV and newly prepared MN184 (MN184-P102). The vaccinated animals were then
challenged with wt Type 2 strain JA-142. The appearance of antibodies and virus
characterization were followed over the course of the study. The results of these assays
revealed regions of the genome that influence PRRSV replication in vivo. Swine growth,
clinical signs and lung lesions were also monitored. Average daily weight gain was
negatively and directly impacted by some vaccines, and after challenge, vaccination with
different constructs led to variable weight gain. We also found that only the original
chimeras and the one in which strain MN184 ORF5-6 was placed on the background of
Ingelvac® PRRS MLV were able to prevent lung consolidation after strain JA142
challenge to a similar extent as the cell-passaged attenuated vaccines. The outcomes of
this study suggested that only specific chimeras can attenuate clinical signs in swine and
that attenuation cannot be directly linked to primary virus replication. Additionally, a
large deletion in the nsp2 region of strain MN184 was not sufficient to reduce the
pathogenicity of that strain, or serve as an adequate vaccine against heterologous
challenge with strain JA-142.
2. Materials and methods
2.1. Cells and Viruses
MA-104 cells (ATCC CRL2621) or MARC-145 cells, both African Green
monkey kidney cell lines which support the growth of PRRSV, were cultured in
minimum essential medium (EMEM, SAFC Biosciences M56416) with 10% fetal
66
bovine serum (Invitrogen) at 37°C, 5% CO2. PRRSV vaccine Ingelvac® PRRS MLV and
wt isolate MN184 were previously described [1, 26]. Two recombinant viruses, rMLV
and rMN184, and two chimeric viruses, rMLVORF1/MN184 and rMN184ORF1/MLV,
were rescued from cDNA clones (GenBank EF484031-EF484034) described previously
[1]. Other recombinant viruses were generated as described below. MN184-P102 was
prepared by successive passages of MN184C (GenBank EF488739) on MARC-145 cells
at Boehringer Ingelheim Vetmedica, Incorporated. PRRSV strain JA-142 (AY424271)
was used as a heterologous challenge virus for the swine studies and has also been
characterized previously [27, 28].
2.2. Construction of PRRSV cDNA Clones
Different sections of pMLV were replaced with comparable sections of pMN184
using specific restriction enzyme sites (Fig. 1) or the primers listed in Table 1. The
correct nucleotides of the exchanged regions of every clone were confirmed by DNA
sequencing. The nucleotide and amino acid changes as a result of the cloning are listed
in Table 2.
pMLV/MN184ORF5-6 (GenBank Accession FJ629369) possessed nucleotides
(nt) 1-13650 and 14823-15452 of pMLV; nt 13651-14822 were exchanged for pMN184
13257-14429 by PciI and SmaI restriction digest of subclone IV of each full-length
plasmid (Fig. 1). pMLV/MN184ORF7-3’UTR (GenBank Accession FJ629370)
consisted of nt 1-14822 of pMLV; nt 14823-15452 were replaced by pMN184 14430-
15060 by SmaI digestion of subclone IV of each full-length plasmid. In both constructs,
the new subclone IV replaced its counterpart in pMLV. The specific regions targeted
67
span nucleotides 13,789-14,391 (ORF5), 14,376-14,900 (ORF6) and 14,890-15,452
(ORF7 and 3'UTR) of the parental virus, Ingelvac® PRRS MLV.
pMLV/MN184-3’UTR (GenBank Accession FJ629371) was obtained in the
following manner. One PCR product was amplified using pMLV and primer pair MLV-
ORF6-F/MLV-ORF7-R and another product representing the 3'UTR of MN184 was
amplified from pMN184 using 184-3′UTR-F/184-3′UTR-R. Overlapping PCR was then
completed with both PCR products and MLV-ORF6-F/184-3′UTR-R. The PCR product
was then digested with SmaI and PacI and cloned into subclone IV of pMLV, which was
then used to replace part IV in pMLV. The final pMLV/MN1843’UTR construct
possessed nucleotides nt 1-15261 of MLV with only the 3’UTR (15262-15452) replaced
with 14869-15058 of pMN184.
As reported, wt strain MN184 has a tripartite deletion totaling 393 bases in the
nsp2 region when compared to other sequenced viruses [20]. It was of interest to assess
additional nucleotide deletions in regards to MN184 strain virulence reduction and the
capacity of the mutated virus to protect against strain JA-142 challenge. One PCR
product was amplified using pMN184 and primer pair 184-3122-F/184-4083-R, which
was then digested with XhoI and AgeI, cloned into subclone II of pMN184 and then into
a full-length viral plasmid. As a result, a 618 nucleotide segment of nonstructural protein
2 (nt 2504-3121) was removed from pMN184 to produce the final pMN184Δ618
construct (14, 440 bp; GenBank Accession FJ629372).
2.3. Rescue of Viruses
The cDNA clones were linearized with PacI and then transcribed in vitro
68
(mMessage Machine Kit, Applied Biosystems). RNA transcripts (2.5 g) of each clone
were subsequently transfected into confluent MA-104 cells using DMRIE-C
(Invitrogen), as described previously [1]. The transfection supernatants were collected
when cytopathic effect (CPE) was approximately 80% and cell debris was then removed
by centrifugation at 4000 x g. Recombinant viruses were passaged on MA-104 cells a
total of 4 times to yield viral stocks sufficient in volume and titer to allow for
vaccination studies. The rescued viruses were named rMLV/MN184ORF5-6,
rMLV/MN184ORF7-3’UTR, rMLV/MN184-3’UTR and rMN184Δ618. Total RNA was
extracted from an aliquot of passage 4 supernatant of each rescued virus and analyzed by
RT-PCR followed by 3’ end sequencing of approximately 4000 bases.
2.4. Swine Study
The study utilized 100, healthy 3-week old, commercial crossbred piglets from a
PRRSV seronegative herd to examine PRRSV vaccine efficacy in a respiratory
challenge model. Animals were housed in a conventional setting at Veterinary Resources
Inc. in Ames, Iowa and were under the supervision of a veterinarian. Throughout the
duration of the study, all animals received food and water ad libitum. All laboratory
personnel and animal caretakers involved with the study were blinded to the treatments
given to the respective groups.
The study consisted of 10 groups, including 6 infectious clones (groups 1-6), wt
MN184 at passage 102 (MN184-P102; group 7), Ingelvac® PRRS MLV (group 8),
heterologous challenge virus wt JA-142 (group 9), and a strict control group (group 10)
(Table 3). Animals were required to test negative for PRRSV antibody by HerdChek®
69
PRRS ELISA 2XR and then randomly assigned by weight into each treatment group
prior to vaccination (IDEXX Laboratories Inc., Westbrook, ME). Viral titers were
determined by TCID50/ml (Table 3) [29, 30]. All viruses were diluted with minimum
essential medium (MEM; Sigma, St. Louis, MO.) containing 2% fetal bovine serum
(FBS) (Sigma, St. Louis, MO.) in order to deliver a target of 4.79 logs of virus in 2 ml,
intramuscularly, to each animal. The challenge control (group 9) and strict control
(group 10) groups received only dilution medium. For testing purposes, 10 – 15 ml of
blood was collected from each animal on Days 0, 3, 7, 14, 21, 28, 31, and 35. Serum was
separated from the clotted blood and stored for a maximum of 24 hours at 4°C for
testing. Aliquots were then frozen at -70°C.
The challenge model used in this study is consistent with the model used in the
original characterization of the chimeras [1]. This model calls for virulent challenge
three weeks after vaccination (Day 21) and necropsy at five weeks post-vaccination
(Day 35). Challenge timing was chosen since the vaccine component of the chimeras,
Ingelvac® PRRS MLV, has proven to be efficacious three weeks post-vaccination even
though the vaccine virus may still be causing some viremia [31]. Therefore, it was
expected that the chimeras would exhibit similar characteristics. Necropsy at two weeks
post challenge allowed for maximal detection of lung lesions that correlate with in vitro
testing procedures [32]. The animals in groups 1-9 were challenged intranasally with 3.8
logs in 2 ml (1ml per nostril) of virulent JA-142 strain of PRRSV at cell passage 4. At
necropsy all animals were humanely euthanized and assessed for gross lung lesions.
70
2.5. Clinical Evaluation
General observations of each animal in the study were taken from Day 0 through
Day 19 and anything abnormal was noted. From Day 20 through Day 35, clinical
observations were noted and anything considered abnormal was recorded. Individual
observations consisting of behavior, respiration, and cough were also recorded based on
a numerical index from 1 to 4 that reflected the severity of the diseased state for each
category. For instance, a normal animal received a score of 3 (3 x 1 each for behavior,
respiration and cough), an animal exhibiting maximum clinical signs received a 9 (3 x
3), and a deceased animal received a cumulative score of 12 (3 x 4). In addition, animals
were weighed 3 days before vaccination (Day -3), at challenge (Day 21), and at necropsy
(Day 35) for average daily weight gain testing. The lungs of all animals in the study
were evaluated at necropsy for percent consolidation due to PRRSV infection. Lungs
were scored for each individual lobe, as well as an overall level of gross lung pathology
using a standard scoring system [33]. The observation score equaled the sum of all the
individual lobe scores.
2.6. Serology
Serum samples were analyzed for PRRSV antibody using the IDEXX
HerdCheck® PRRS ELISA 2XR. The tests were performed as described by the
manufacturer’s instructions. Samples were considered positive for PRRSV antibodies if
the sample-to-positive (S/P) ratio was at least 0.4.
2.7. Viremia Detection by Virus Isolation and Quantitative RT-PCR
To qualitatively determine viremia, virus isolation was performed on all serum
71
samples from all collection days. Each animal was tested by inoculating 100μl of serum
individually onto 3 day old MA-104 cells in a 48-well tissue culture plate which was
then evaluated 8 days later for signs of cytopathic effect. The percent of positive animals
at each bleed date was then recorded. To attain a relative quantity of viral RNA present,
quantitative RT-PCR (qRT-PCR) was also performed on all serum samples. The
QIAamp® Virus BioRobot
® MDx Kit was used in conjunction with the BioRobot
Universal System from Qiagen (Qiagen Inc., Valencia, CA) to extract the viral RNA
from the serum per manufacturers recommendations. To detect US PRRSV nucleic acid,
the North American Tetracore qRT-PCR kit (Tetracore, Inc., Rockville, MD) was used
as described previously [29].
2.8. Nucleotide Sequence Analysis
Viral RNA was extracted from serum samples from each animal at day 21. To
obtain a consensus nucleotide sequence of the structural genes at this time point, RNA
extracts were pooled for each group and submitted for nucleotide sequence
determination (oligonucleotide primers available on request). Sequences were analyzed
using Geneious Pro Version 4.7.5 (Biomatters Limited). Approximately 4500 bases were
sequenced at the 3'end of the viral genome. In the case of the nsp2 deletion mutant,
rMN184Δ618, a 500 base section spanning the deletion site was examined.
2.9. Statistics/biometrics
All data were imported into SAS version 9.1 for management and preliminary
analysis. Data listings and summary statistics by treatment group including mean,
median, standard deviation, standard error, range, 95 percent confidence limits,
72
coefficient of variation, and frequency distributions were generated for all variables
where appropriate. All parameters were compared among groups 1 – 9 and pair wise
between groups 1 – 9. Group 10 (strict controls) was not included in the analyses other
than summary statistics. In compliance with the methods recommended by the United
States Department of Agriculture Animal Plant Health Inspection Service, only two-
sided results were reported and all comparisons were at α=0.05. All data were
transferred to Prism 4 (Graphpad Software, Inc.) for additional statistical analyses and
optimal formatting prior to publication. Virus isolation data used Fisher’s exact test to
determine the number of animals positive/negative per group ratio. Weights and average
daily weight gain (ADWG) were tested by two-way analysis of variance (ANOVA).
Lung scores for each group were analyzed by one-way ANOVA and Bonferroni’s
Multiple Comparison Test (95% confidence interval).
3. Results
3.1. Recovery of Viruses
Two chimeric viruses, rMLVORF1/MN184 and pMN184ORF1/MLV, were
previously generated [1]. Four other recombinant PRRSV full-length cDNA clones,
pMLV/MN184ORF5-6, pMLV/rMN184ORF7-3’UTR, pMLV/MN184-3’UTR and
pMN184Δ618 were constructed in a similar manner (Fig. 1). To verify whether these
four additional cDNA clones were infectious, linearized pMLV/MN184ORF5-6,
pMLV/rMN184ORF7-3’UTR, pMLV/MN184-3’UTR and rMN184Δ618 were
transcribed in vitro and the synthetic RNAs were subsequently transfected into MA-104
cells. Day 3 post-transfection, all four transfections resulted in the appearance of CPE,
73
indicating that the genetic exchange between the two different strains and the 618 base
deletion in the nsp2 region of MN184 did not have a severe effect on the in vitro growth
properties of the recombinants. Sequence analyses of around 4000 bases at the 3'-end of
the genome confirmed that these four viruses were recovered from the respective
recombinant PRRSV with no or a few scattered changes (data not shown). All chimeras
were passaged 4 times on MA-104 cells in parallel with parental rMLV and rMN184 as
well as Ingelvac® PRRS MLV vaccine and wt MN184. At each passage, onset of CPE in
rMLV/MN184ORF5-6 and rMLV/MN184-3’UTR infected MA-104 cells was similar to
those infected with rMLV, but appeared 1 day later for rMLV/MN184ORF7-3’UTR
infected cells. CPE for rMN184Δ618 infected cells was similar to rMN184 at all four
passages. Passage 4 viruses were titered and used to infect 10 animals/group in the
vaccination study (Table 3).
3.2. HerdChek ELISA
After vaccination, all animals in Groups 1, 2, 3, 5, 7, and 8 tested positive by
IDEXX PRRS ELISA prior to strain JA-142 virulent challenge (Day 21). Group 6
(rMN184Δ618) had 9 positive animals prior to challenge while Group 4
(rMLV/MN184ORF7-3’UTR) had only 4 positive animals and the appearance of the
antibodies in this latter group was delayed (Fig. 2 and data not shown). Antibodies
appeared in Group 1 animals 3 days prior to all other vaccination groups. In addition, the
S/P ratios suggested that all of the animals in groups 1 – 9 seroconverted to either their
respective vaccine or the challenge material by Day 31 of the study. The Strict Control
(group 10) had no positive tests throughout the duration of the study. Figure 2 indicates
74
the day when the individual groups became positive for PRRSV specific antibodies and
the trend for all treatment groups.
3.3. Virus Isolation
Virus isolation analysis confirmed that at least 3 of the 10 animals in each
treatment group were viremic by Day 3 in groups 1, 2, 3, 5, 7, and 8 (Fig. 3). Only
(10%) of the animals in Group 4 were positive on Days 3 and 14, the only positive
results obtained for rMN184ORF7-3’UTR prior to challenge. No viremia was detected
for Group 6 (rMN184Δ618) animals until Days 14 and 21, which then showed positive
results for only 10% and 20% of the animals, respectively. The results suggested that
each engineered recombinant virus was capable of some level of viral replication in the
swine host, although it is evident that rMN184ORF7-3’UTR (Group 4) and
rMN184Δ618 (Group 6) were less successful at replicating inside the animal host as
compared to the other groups, as measured by virus isolation on MARC-145 cells. We
had detected antibodies to Group 6 virus (Fig. 2) with similar kinetics to all other
treatment groups (except Group 4) that might be indicative of replication of this virus in
the absence of overt CPE due to infection of MARC-145 cells. PRRSV vaccine strains
MN184-P102 and Ingelvac® PRRS MLV confirmed viral replication within the host,
although replication of Ingelvac®
PRRS MLV from swine serum samples on cultured
cells was more apparent than replication of MN184-P102 at all-time points. Viremia
continued after virulent heterologous PRRSV challenge in all groups except the strict
control.
75
In order to assess the ability of the immune response to reduce the replication of
the JA-142 challenge virus after vaccination with each of the candidate viruses, we
compared the levels of viremia for all treatment groups to that of the Challenge Control
Group on Day 35, when presumably most virus remaining in the animals would be the
challenge PRRSV strain. Groups 1-3 (chimeric viruses) and Groups 7-8 (traditionally
prepared vaccines) had a statistically significant (p≤0.0001) lower percentage of viremia
as compared to the Challenge Control (Group 9) at this time point (Fig. 3).
3.4. Real Time RT-PCR
PRRSV RNA was detected in all pigs of treatment Groups 1 – 8 prior to
challenge except for Group 4 (rMLV/MN184ORF7-3’UTR), for which only 3 of the 10
animals were positive for viral RNA by the day of challenge (Fig. 4). On Day 10, the
various treatment viruses could be separated into two discrete categories. Those that had
high levels of circulating viral RNA (>107) include Groups 1-3 (chimeric viruses) and
Group 7 (MN184-P102) while those that had less amounts of viral RNA (<106) included
Groups 4-6 and 8. Viral RNA detected in Group 6 animals suggested that this virus
(rMN184Δ618) initially replicated at a lower rate, but eventually achieved RNA levels at
Day 21 approximately equal to the viruses initially showing a higher level of circulating
viral RNA. Group 4 animals revealed only 3 of 10 animals with circulating PRRSV
RNA until after challenge, suggesting the virus does not replicate well in swine with a
nucleocapsid gene and 3’UTR different from the rest of the pMLV genome. The
remaining two viruses, inoculated into animal Groups 5 (rMLV/MN184-3’UTR) and 8
(Ingelvac® PRRS MLV), never reached above 10
7 RNA copies/ml until after challenge.
76
On Day 28, after virus challenge with heterologous strain JA-142, PRRSV RNA
was found in all animals, providing evidence of successful challenge conditions. No
treatment groups were statistically different for viral load as compared to the Challenge
Control, suggesting little or no effect on JA-142 replication in swine by prior
vaccination, when analyzed by qRT-PCR (Fig. 4). These results are considerably
different from those obtained with virus isolation (Fig. 3).
3.5. Nucleotide Sequence Analysis
RT-PCR followed by nucleic acid sequencing of the products was completed on
pooled and extracted serum samples from day 21. Approximately 1000 bases of ORF1b,
the entire structural protein region and most of the 3'UTR were examined to ensure the
animals remained infected with the respective test virus. In all cases, no discrepancy
between the consensus nucleotide sequences with the input viral genome was found
(data not shown). Furthermore, all viruses showed very little nucleotide variation after
21 days in 10 different animals. This indicated that all of the viruses, including the
chimeras, were not undergoing demonstrable nucleotide change in the regions examined
during the course of the experiment.
3.6. Average Daily Weight Gain
To assess the gross clinical effects of PRRSV vaccination and challenge on
swine, all animals were weighed at each time point. From this data, average daily weight
gain (ADWG) was derived for Days -3 to 21 (before challenge) and Days 21 – 35 (after
challenge)(Fig. 5). Prior to virulent challenge, Group 10 (Strict Control) had a
statistically significant (p≤0.01) higher ADWG than only rMN184ORF1/MLV (Group
77
1), signifying that only Group 1 vaccination significantly reduced animal growth during
the period before challenge (identified as A in Fig. 5). After challenge, Groups 1
(rMN184ORF1/MLV), 5 (rMLV/MN184-3’UTR), 6 (rMN184Δ618), and 9 (JA-142
Challenge Control) showed significantly reduced ADWG (p≤0.01) compared to control
animals. This reduced ADWG may be due to insufficient protection of animals by prior
vaccination in Groups 1, 5 and 6. To monitor the ability of the various viruses to protect
against reduced weight gain after JA-142 challenge, ADWG was compared to Group 9
animals (Challenge Control)(identified as B in Fig. 5). In this comparison,
rMLVORF1/MN184 (Group 2), rMLV/MN184ORF5-6 (Group 3), rMN184ORF7-
3’UTR (Group 4), MN184-P102 (Group 7), and Ingelvac® PRRS MLV (Group 8)
showed a statistically significant (p≤0.05) higher ADWG than the JA-142 Challenge
Control group.
3.7. Clinical Observations
Very few animals exhibited clinical signs after primary infection with the test
viruses or with controls, with only one out of ten animals in each of Groups 5-7 showing
mild discomfort (data not shown). This suggests that all treatments, although replicating
variably in the host, did not mimic overt PRRS disease typically seen in the field. Only
one animal in Group 6 experienced sustained mild lethargy and/or an intermittent cough
after challenge (data not shown). In all, the mild clinical signs were to be expected and
were a typical response to PRRSV infection in high health herds. The symptoms were
not severe enough to have an effect on the outcome of the study, as attending
veterinarians determined that no medication was necessary for resolution of clinical
78
signs for all animals enrolled in the study.
3.8. Lung Pathology
Upon completion of the study (Day 35), all animals were necropsied and
assessed for lung pathology (Fig. 6). When compared to the Challenge Control (group
9), five treatment groups exhibited a statistically significant reduction in gross lung
lesions. Those groups were: rMN184ORF1/MLV (Group 1; P < 0.001),
rMLVORF1/MN184 (Group 2; P < 0.01), rMLV/MN184ORF5-6 (Group 3; P < 0.001),
the recently developed vaccine MN184-P102 (Group 7; P < 0.001) and, to a lesser
degree, Ingelvac® PRRS MLV (Group 8; P < 0.05). Three groups, rMN184ORF7-
3’UTR (Group 4), rMLV/MN184-3’UTR (Group 5), and rMN184Δ618 (Group 6), did
not appear to have sufficient protection against the development of pulmonary lesions in
the strain JA-142 respiratory challenge model as the average lung scores of these three
groups were not significantly different (> 0.05) than the average score of the Challenge
Control Group, which had over 50% of the lung displaying lesions. The Strict Control
(group 10) had no lung lesions, thus indicating a valid challenge and successful bio-
containment.
4. Discussion
In this report, a respiratory challenge model was used to examine the vaccine
efficacy of five chimeras and a deletion mutant engineered from PRRSV Type 2 strain
viral clones that differed by 14.3% on a nucleotide basis. Two chimeras,
rMN184ORF1/MLV (Group 1) and rMLVORF1/MN184 (Group 2) had been previously
shown to successfully protect swine against challenge with heterologous PRRSV strain
79
SDSU73 [1]. The percent nucleotide identities between the Group 1 and 2 chimeras and
SDSU73, over the available SDSU73 ORF2-7 sequence (EF442775), were 92.9% and
89.7%, respectively. For this study, the nucleotide identities based on complete genome
comparisons to strain JA-142 were 84.2% for Group 1, 90.2% for Group 2, 90.7% for
Group 3, 90.9% for Group 4, 90.9% for Group 5, 80.4% for Group 6, 83.1% for Group
7, and 91.0% for Group 8. One conclusion to draw from these comparisons is that
percent similarity is not an accurate measure for determining which vaccine formula will
provide the best protection from challenge, as has been shown previously [31]. Rather,
PRRSV protection after vaccination seems to be directed towards specific gene regions
that influence genome replication kinetics and/or viral interaction with the swine host.
Since both ORF1 reciprocal chimeras protected against strain SDSU73 and now strain
JA-142, and both replicated well in swine, we firmly established that genome
components from both viral nonstructural and structural regions can influence the ability
to protect against heterologous challenge [1]. The present work also suggests that simple
exchange of just the ORF5-6 region of strain MN184 can protect against challenge with
strain JA-142, possibly increased over the traditionally prepared Ingelvac®
PRRS MLV
vaccine. This specific data reveals similar findings as those completed using a
reproductive challenge model and infectious clones of two other PRRSV strains,
attenuated vaccine Prime Pac PRRS
and virulent NVSL #97-7895 [10]. The rMN184
nsp2 deletion mutant (Group 6) also provided interesting results. As in previous study
findings, where full-length rMN184 did not protect against challenge with strain
SDSU73 [1], rMN184618 did not protect against challenge with strain JA-142. The
80
challenge viruses were different between those two studies, so additional parallel
experiments must be completed to substantiate this preliminary finding. However, the
data suggested that deletion of much of the nsp2 hypervariable region did not improve
protection from heterologous PRRSV challenge. All of the data confirmed that PRRSV
attenuation is complex, and may involve interactions between individual viral
component and/or host factors.
Novel findings concerning viral fitness in vivo were also presented. Virus
isolation, which requires another round of MARC-145 cell infection and growth,
revealed that rMLV/MN184ORF7-3’UTR and rMN184618 both replicated at a slower
rate than most other viruses before challenge (Fig. 3). rMLV/MN184-3’UTR replicated
quite well in vitro. However, when samples were directly assessed for the level of serum
vRNA by qRT-PCR, rMLV/MN184-3’UTR along with rMLV/MN184ORF7-3’UTR
may have replicated very poorly in swine, suggesting a PRRSV strain does not easily
tolerate a nucleocapsid gene or protein and/or a 3’UTR different from the rest of the
genome. rMN184618 showed evidence of adequate replication in vivo when monitored
by qRT-PCR, different from what was detected by the virus isolation technique. The
implications of this finding are that viral fitness must be directly examined in the host,
that replication of chimeric viruses in the host animal are not predictable and, therefore,
one must assess several parameters when evaluating viruses for biological use. We have
also shown that some chimeric viruses can be readily utilized as vaccines, although
traditionally prepared vaccines can perform as well or better against specific virulent
strains.
81
Acknowledgements
The authors acknowledge critical manuscript review by Marcus E. Kehrli, Jr.,
Kelly M. Lager and Laura C. Miller, and thank Matthew Kappes for completing the
nucleotide sequence analysis. We are appreciative of Boehringer-Ingelheim Vetmedica,
Incorporated's technical and animal-handling support teams for the generation of core
animal data.
82
Table 1. Primers Used in Preparation of Recombinant PRRSV Infectious Clones.
Forward Primers Indicated by a Slash (/) Following the Name and Reverse Primers
by a Slash Before the Name. Primers Were Positioned Based on Genomic
Sequences pMLV (MLV; EF484033) or pMN184 (MN184; EF484031) (Most
Primers Anneal to Both Sequences).
Primer Nucleotide Position Sequence
Synthesis of PRRSV recombinants
MLV-
ORF6-F/
MLV 14192-14217 5′-GCTACGCGTGTACCAGATATACCAAC
/MLV-
ORF7-R
MLV 15249-15277 5′-
CAAGAATGCCAGCTCATCATGCTGAGGGT
184-3′UTR-
F/
MN184 14856-14884 5′-
ACCCTCAGCATGATGAGCTGGCATTCTTG
/184-3′UTR-
R
MN184 15011-15099 5′-GTCTTTAATTAACTAG(T)30AATTTCGGC
184-3122-F/ MN184 2494-
2503/3122-3136
5′-AAGCTCGAGCTGTGGGTTTGTGATG
/184-4083-R MN184 4065-4091 5′-AAAACCGGTCGCACAGGTCGACAAGTG
83
Table 2. Nucleotide and Amino Acid Changes to Recombinant Viral Parent Due to
Clone Construction.
Construct Region NT Changes AA Changes
pMLV/MN184ORF5-6 GP4 11 0
GP5 81 31
M 37 6
pMLV/rMN184ORF7-
3’UTR
M 5 2
N 26 6
3’UTR 9 -
pMLV/MN1843’UTR 3’UTR 9 -
pMN184618 nsp2 618 206
84
Table 3: Treatment List
Group #
Treatment
Treatment Titer
(log 10 TCID50 / ml)
Challenge
1 rMN184ORF1/MLV 5.02 JA-142
2 rMLVORF1/MN184 5.70 JA-142
3 rMLV/MN184ORF5-6 5.63 JA-142
4 rMLV/MN184ORF7-3’UTR 5.50 JA-142
5 rMN184Δ618 5.35 JA-142
6 rMLV/MN184-3’UTR 4.96 JA-142
7 MN184-P102 4.49 JA-142
8 Ingelvac®
PRRS MLV 4.09 JA-142
9 N/A N/A JA-142
10 N/A N/A N/A
85
Figure 1. Genome schematic of PRRSV, the Two Infectious Clones Initially
Derived (pMLV and pMN184 [1]), Chimeras, and Deletion Mutant Prepared for
the Present Study.
86
86
Figure 2. Mean PRRS ELISA 2XR S/P ratios.
87
Figure 3. Viral Load, Determined by Virus Isolation on MARC-145 cells, in Swine
Serum at All Time Points After Intramuscular Inoculation with 4.79 logs of Virus.
1
The challenge control and strict control groups received only dilution medium. On Day
21, all animals except the strict control group were intranasally challenged with 3.8 logs
of strain JA-142. Results for each animal of each group were collated and the percent
positive per group was then determined.
88
Figure 4. Viral Load as Determined by qRT-PCR and Plotted as Viral RNA Copies/ml Serum.
88
89
Figure 5. Growth Effects of Chimeric and Parental Viruses on Swine.
1
All experimental pigs were weighed at Days -3, 21 and end of study. The average daily gain
weight (ADG) from 10 pigs in each group was calculated at period of -3-21 and 21-35 dpi. The
mean was plotted and the standard error of the mean (SEM) represented as error bars.
Statistically significant (≤0.01) lower average daily weight gain than the Strict Control group for
the relevant time period was specified by the letter A. Statistically significant (≤0.01) higher
average daily weight gain than Challenge Control group for Days 21-35 is represented by the
letter B.
90
Figure 6. Average Lung Scores Recorded at 35 Days Post Vaccination and 14 Days Post
Challenge.
1
The results were plotted as mean values of gross lung lesions from 10 pigs in each group, and
SEM values from different pigs designated by error bars. An asterisk indicates the average lung
score of the group is lower than the challenge control group (* p < 0.05).
91
References
[1] Wang Y, Liang Y, Han J, Burkhart KM, Vaughn EM, Roof MB, et al. Attenuation of porcine
reproductive and respiratory syndrome virus strain MN184 using chimeric construction with
vaccine sequence. Virology 2008;371(2):418-29.
[2] Nelsen CJ, Murtaugh MP, Faaberg KS. Porcine reproductive and respiratory syndrome virus
comparison: divergent evolution on two continents. Journal of Virology 1999;73(1):270-80.
[3] Meulenberg JJ, Hulst MM, de Meijer EJ, Moonen PL, den Besten A, de Kluyver EP, et al.
Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome
(PEARS), is related to LDV and EAV. Virology 1993;192(1):62-72.
[4] Mateu E, Diaz I. The challenge of PRRS immunology. Veterinary Journal 2008;177(3):345-
51.
[5] Kimman TG, Cornelissen LA, Moormann RJ, Rebel JM, Stockhofe-Zurwieden N.
Challenges for porcine reproductive and respiratory syndrome virus (PRRSV) vaccinology.
Vaccine 2009;27(28):3704-18.
[6] Dee SA, Joo H. Strategies to control PRRS: a summary of field and research experiences.
Veterinary Microbiology 1997;55(1-4):347-53.
[7] Tian ZJ, An TQ, Zhou YJ, Peng JM, Hu SP, Wei TC, et al. An attenuated live vaccine based
on highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) protects
piglets against HP-PRRS. Veterinary Microbiology 2009;138(1-2):34-40.
[8] Fang Y, Christopher-Hennings J, Brown E, Liu H, Chen Z, Lawson SR, et al. Development
of genetic markers in the non-structural protein 2 region of a US type 1 porcine reproductive and
respiratory syndrome virus: implications for future recombinant marker vaccine development.
Journal of General Virology 2008;89(Pt 12):3086-96.
[9] de Lima M, Kwon B, Ansari IH, Pattnaik AK, Flores EF, Osorio FA. Development of a
porcine reproductive and respiratory syndrome virus differentiable (DIVA) strain through
deletion of specific immunodominant epitopes. Vaccine 2008;26(29-30):3594-600.
[10] Kwon B, Ansari IH, Pattnaik AK, Osorio FA. Identification of virulence determinants of
porcine reproductive and respiratory syndrome virus through construction of chimeric clones.
Virology 2008;380(2):371-8.
[11] Yoo D, Welch SK, Lee C, Calvert JG. Infectious cDNA clones of porcine reproductive and
respiratory syndrome virus and their potential as vaccine vectors. Veterinary Immunology and
Immunopathology 2004;102(3):143-54.
[12] Han J, Liu G, Wang Y, Faaberg KS. Identification of nonessential regions of the nsp2
replicase protein of porcine reproductive and respiratory syndrome virus strain VR-2332 for
92
replication in cell culture. Journal of Virology 2007;81(18):9878-90.
[13] Kim DY, Kaiser TJ, Horlen K, Keith ML, Taylor LP, Jolie R, et al. Insertion and deletion in
a non-essential region of the nonstructural protein 2 (nsp2) of porcine reproductive and
respiratory syndrome (PRRS) virus: effects on virulence and immunogenicity. Virus Genes
2009;38(1):118-28.
[14] Han J, Rutherford MS, Faaberg KS. The porcine reproductive and respiratory syndrome
virus nsp2 cysteine protease domain possesses both trans- and cis-cleavage activities. Journal of
Virology 2009;83(18):9449-63.
[15] Yu D, Lv J, Sun Z, Zheng H, Lu J, Yuan S. Reverse genetic manipulation of the overlapping
coding regions for structural proteins of the type II porcine reproductive and respiratory
syndrome virus. Virology 2009;383(1):22-31.
[16] Zhou L, Zhang J, Zeng J, Yin S, Li Y, Zheng L, et al. The 30-amino-acid deletion in the
Nsp2 of highly pathogenic porcine reproductive and respiratory syndrome virus emerging in
China is not related to its virulence. Journal of Virology 2009;83(10):5156-67.
[17] van Hemert MJ, Snijder EJ. The Arterivirus Replicase. In: Perlman S, Gallaher T, Snjder E,
editors. The Nidoviruses. Washington, DC: ASM Press, 2008: 83-101.
[18] Faaberg KS. Arterivirus Structural Proteins and Assembly. In: Perlman S, Gallaher T,
Snjder E, editors. The Nidoviruses. Washington, DC: ASM Press, 2008: 211-34.
[19] Fang Y, Kim DY, Ropp S, Steen P, Christopher-Hennings J, Nelson EA, et al.
Heterogeneity in Nsp2 of European-like porcine reproductive and respiratory syndrome viruses
isolated in the United States. Virus Research 2004;100(2):229-35.
[20] Han J, Wang Y, Faaberg KS. Complete genome analysis of RFLP 184 isolates of porcine
reproductive and respiratory syndrome virus. Virus Research 2006;122(1-2):175-82.
[21] Fang Y, Schneider P, Zhang WP, Faaberg KS, Nelson EA, Rowland RR. Diversity and
evolution of a newly emerged North American Type 1 porcine arterivirus: analysis of isolates
collected between 1999 and 2004. Archives of Virology 2007;152(5):1009-17.
[22] Johnson CR, Yu W, Murtaugh MP. Cross-reactive antibody responses to nsp1 and nsp2 of
Porcine reproductive and respiratory syndrome virus. Journal of General Virology 2007;88(Pt
4):1184-95.
[23] Li Y, Wang X, Bo K, Tang B, Yang B, Jiang W, et al. Emergence of a highly pathogenic
porcine reproductive and respiratory syndrome virus in the Mid-Eastern region of China.
Veterinary Journal 2007;174(3):577-84.
[24] Tian K, Yu X, Zhao T, Feng Y, Cao Z, Wang C, et al. Emergence of fatal PRRSV variants:
unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique
93
hallmark. PLoS ONE 2007;2(6):e526.
[25] Brown E, Lawson S, Welbon C, Gnanandarajah J, Li J, Murtaugh MP, et al. Antibody
response to porcine reproductive and respiratory syndrome virus (PRRSV) nonstructural proteins
and implications for diagnostic detection and differentiation of PRRSV types I and II. Clin
Vaccine Immunol 2009;16(5):628-35.
[26] Yuan S, Mickelson D, Murtaugh MP, Faaberg KS. Complete genome comparison of
porcine reproductive and respiratory syndrome virus parental and attenuated strains. Virus
Research 2001;79(1-2):189-200.
[27] Greiner LL, Stahly TS, Stabel TJ. Quantitative relationship of systemic virus concentration
on growth and immune response in pigs. Journal of Animal Science 2000;78(10):2690-5.
[28] Ropp SL, Wees CE, Fang Y, Nelson EA, Rossow KD, Bien M, et al. Characterization of
emerging European-like porcine reproductive and respiratory syndrome virus isolates in the
United States. Journal of Virology 2004;78(7):3684-703.
[29] Johnson W, Roof M, Vaughn E, Christopher-Hennings J, Johnson CR, Murtaugh MP.
Pathogenic and humoral immune responses to porcine reproductive and respiratory syndrome
virus (PRRSV) are related to viral load in acute infection. Veterinary Immunology and
Immunopathology 2004;102(3):233-47.
[30] Reed LJ, Muench H. A simple method of estimating fifty percent end-points. Amer. J. Hyg.
1938;27:493–7.
[31] Mengeling WL, Lager KM, Vorwald AC, Koehler KJ. Strain specificity of the immune
response of pigs following vaccination with various strains of porcine reproductive and
respiratory syndrome virus. Veterinary Microbiology 2003;93(1):13-24.
[32] Harms PA, Sorden SD, Halbur PG, Bolin SR, Lager KM, Morozov I, et al. Experimental
reproduction of severe disease in CD/CD pigs concurrently infected with type 2 porcine
circovirus and porcine reproductive and respiratory syndrome virus. Veterinary Pathology
2001;38(5):528-39.
[33] Halbur PG, Miller LD, Paul PS, Meng XJ, Huffman EL, Andrews JJ. Immunohistochemical
identification of porcine reproductive and respiratory syndrome virus (PRRSV) antigen in the
heart and lymphoid system of three-week-old colostrum-deprived pigs. Veterinary Pathology
1995;32(2):200-4.
94
CHAPTER 4. DEVELOPMENT OF ATTENUATED PORCINE REPRODUCTIVE AND
RESPIRATORY SYNDROME VIRUS ISOLATES THROUGH CONTINUOUS CELL
PASSAGE BY MULTIPLE WELL LIMITING DILUTIONS
Joshua S. Ellingson, Eric Vaughn, Sarah Layton, and Michael B. Roof
Abstract
In an effort to explore alternative options to develop modified live PRRSV vaccine
candidates, an innovative cell passage processed was utilized. Virulent field isolates, MN184
and MR007, were used as parent viruses to establish in vitro growth of twelve individual cohort
isolates for each strain. Isolates were each initially established on one 96 well plate. Thereafter,
each column was separately passed concurrently by limiting dilution, allowing for natural
mutants to develop twelve potentially unique progeny isolates from each parental strain.
Isolates were passed until significant genomic changes were detected. Nsp2 deletions were
targeted, as recent evidence has indicated nsp2 deletions may be involved with isolate
attenuation. At passage 50 isolates were tested for safety in both a respiratory growing pig safety
study and a gilt reproductive safety study. Numerous parameters of safety were collected from
both studies and revealed significant attenuation of the isolates. These studies suggest the cell
passage process by limiting dilution is a viable and efficient tool for the development of multiple
clones for vaccine candidate assessment.
1. Introduction
Porcine reproductive and respiratory syndrome virus (PRRSV) is an enveloped single-
stranded positive-sense RNA virus classified under the family Arteriviridae, and genus
Arterivirus [1]. The virus causes a disease known as Porcine Reproductive and Respiratory
Syndrome (PRRS) which is classically seen as reproductive failure in breeding females and
respiratory disease in growing swine. The reproductive failure is associated with mid to late
95
term abortions, increased numbers of mummified fetuses and weak born piglets, and fewer
healthy born piglets [2]. With the aforementioned clinical signs, PRRS can have a significant
negative impact on the productivity of a herd. It has been estimated that PRRS costs the United
States pork producing industry around 664 million dollars a year [3]. Compounding the situation
is the fact that PRRSV is endemic in most swine producing countries and has a similar economic
effect elsewhere. To avoid these economic hardships, it is important for producers to have PRRS
prevention and elimination/management programs in place.
Current control strategies to prevent the spread of the virus within and between herds
includes: the proper management of breeding animals, removal of infected individuals, strict
biosecurity measures, serum inoculation, and the use of vaccines. Both inactivated and modified
live vaccines are commercially available. Inactivated vaccines provide a high level of safety but
are generally considered as ineffective or as conveying a very limited degree of efficacy.
Attenuated live vaccines have been widely used to reduce the transmission and clinical disease
caused by virulent wild-type (wt) viruses. Although modified live vaccine efficacy varies against
heterologous isolates, they remain the best vaccination option available to combat the disease.
The development of a new generation of vaccines capable of providing improved and consistent
protection against heterologous isolates with the ability to detect wt infection in vaccinated
animals would be a tremendous asset to the swine industry and is the focus of this research.
The PRRS genome is approximately 15,400 kilobases in length and is organized into at
least 10 open reading frames, numbered (1a, 1b, 2, 2b, 5a and 3-7) [4, 5]. Nonstructural proteins
(nsps) are encoded by ORF1a and 1b, which occupy three fourths of the entire genome. Due to
the essential nature of the structural proteins for production of viable virus, the nsps are an area
of focus for the generation of deletion marker vaccine candidates [6].
96
The nsp2 protein is the largest PRRSV protein and contains the most variable region in
the genome [7-9]. The nsp2 gene is also highly antigenic, containing numerous B-cell epitopes
[10]. Investigation of potential functions of nsp2 revealed that portions are critical for viral
replication while others were unnecessary [11]. The genetic flexibility of nsp2 allows for foreign
genes to be inserted successfully into the nonessential region to serve as a marker allowing for
users to successfully differentiate infected and vaccinated animals (DIVA) [6, 12]. Interestingly,
many field viruses have been identified with variously sized deletions in the nsp2 gene [8, 13-
20]. However, recent reports indicate the size and location of deletions within nsp2 are not
linked to increases in virulence or pathogenicity [21-24].
Moreover, recent work has reported nsp2 deletion mutants to be attenuated in vivo with
good stability [24-27]. Isolates with nsp2 deletions have been reported to be directly linked to
attenuation while other studies have implicated nsp2 as a potential cause [6, 28]. The cause of
attenuation may be due to the loss of nsp2’s antagonistic effects on the production of interferon
beta (IFN-β), an important part of the innate immune response against early viral replication [29,
30]. Nsp2 has also been found to counteract the antiviral function of interferon-stimulated gene
15 which functions in the regulation of antiviral immune responses [31]. Attenuation may also
be linked to viral replication, as nsp2 deletions have been reported to increase viral growth
kinetics in vitro while limiting replication in vivo [24]. It was determined that nsp2 deletions
may be one method in which isolates naturally attenuate themselves when being passed
continuously in vitro and therefore could provide guidelines to direct isolate testing as potential
vaccine candidates. In addition, deletion mutants could provide additional utility in the
development of DIVA technologies if a successful vaccine candidate could be developed.
97
In an attempt to create new deletion mutants through continuous in vitro passage, two
recently isolated circulating virulent field isolates (MN184 (MN/01/A2) and MR007) were
utilized. Each isolate was used to develop twelve theoretically distinct clones within one culture
plate using a unique cell passage process. After the first passage, progeny isolates were kept
separate from each other and were passed weekly by limiting dilution. This process is believed
to be a more efficient method to obtain and develop multiple independent clones during passage
as compared to traditional methods. Isolates with deletions within nsp2 were specifically
targeted for evaluation as a fact finding mission to determine if a correlation with attenuation
could be identified as reported by others. In vitro adapted progeny isolates were selected and
evaluated for attenuation in an initial 14 day growing pig respiratory trial and a pregnant gilt
reproductive model.
2. Materials and Methods
2.1 Cell Passage
To facilitate viral growth in vitro, 96 well cell culture plates were planted with MA-104
cells (ATCC CRL2621) and incubated with minimum essential medium (EMEM, SAFC
Biosciences M56416) with 10% fetal bovine serum (Invitrogen) and 5% CO2 at 37°C. Once
cells had incubated for 3 days, 100 µL of parent virus, either MN184 (MN/01/A2) or MR007,
were added to each well of an entire row on the culture plate. Each well was then used to make
four 1/10 dilutions down each respective column. After dilution, 100 µL of fresh media was
added over the top of each well. Plates were incubated for 3-8 days prior to being checked for
cytopathic effect. After reading the plates, the highest positive dilution of each column was
passed onto the same column of another plate with 3 day old MA-104 cells.
98
On the new plate four 1/10 dilutions were performed, media was overlaid, and plates
were again incubated. This process was performed continuously through in vitro cell passage 50.
Occasionally, if a column would display no growth the lowest dilution was passed in an attempt
to harbor enough infectious virus to maintain the passing infection. Subsequently, if there were
still no signs of CPE on the next plate another column was used to plant the next plate. Progeny
isolates were strictly kept separate, with the exception of total loss of virus, to encourage the
concurrent development of twelve unique isolates. Total loss of virus occurred twice through
passage 50. At every 10 passages positive samples were frozen at -70ºC as a backup. If a virus
was totally lost the last positive sample was thawed and used for recovery.
2.2 Viral Isolates
MR007, is an isolated virulent field virus from a 2007 PRRS outbreak that exhibits an
ORF5 1-7-4 RFLP pattern and has a JA-142 like nsp2 region. MN184 (MN/01/A2) is a very
pathogenic isolate that appeared in North America in 2002 causing high mortality and severe
reproductive disorders. This isolate has a 131 amino acid deletion in the nsp2 region as
compared to VR-2332, the type 2 prototype strain. Furthermore, MN184 has been found to have
the shortest PRRS genome found to date at 15,019 kb [11, 15]. Deletion mutants created through
the passage process were referred to as 96 well deletion mutants while MR007 #9 contained no
significant deletions in the nsp2 region but was selected to be used as a comparison to the
selected MR007 nsp2 deletion isolate.
2.3 Nucleotide Sequence Analysis
Nucleotide sequence analysis was performed from both in vitro cell cultures and from
study animal serum samples. For the in vitro samples, QIAamp Viral RNA Mini kit (Qiagen Inc,
Valencia, CA) was used for the ribonucleic acid (RNA) extractions while the Total Nucleic Acid
99
MagNA Pure kit (Roche Applied Science) was used to extract from the collected swine serum.
SuperScript® III First-Strand Synthesis (Invitrogen Corp, Carlsbad, CA) was used to create
complementary deoxyribonucleic acid (cDNA) per the manufacturer’s recommendations. The
cDNA product then underwent polymerase chain reaction (PCR) in a GeneAmp® PCR System
9700 (Applied Biosystems) 96 well machine with the following configuration: an initializing
step for 5 minutes (min.) at 95°C, 35 cycles of a denaturation step at 95°C for 30 seconds (sec.)
an annealing step at 53°C for 30 sec. followed by an extension step at 72°C for 150 sec., and
finally a single elongation step at 72°C for 5 min. Samples were held at 4°C until removal from
the thermocycler. Each PCR well was set up accordingly: 25µL of 2X AmpliTaq Gold
Mastermix (Applied Biosystems), 21µL DEPC Water (EMD Chemicals, Gibbstown, NJ), 2 µL
of cDNA template, and 1µL of each respective primer [Table 1].
The PCR products were then purified with the Wizard® DNA Clean-Up System
(Promega, Madison WI) per the manufacturer’s recommendations. Samples were then placed
into a Savant Speedvac DNA 110 (Global Medical Instrumentation, Ramsey, MN) at medium
speed for 10 min. to remove any residual isopropanol. Samples were then mixed with 10 µL of
loading dye and loaded onto a 1.5% agarose gel. Electrophoresis was performed by applying
120 volts for 45 min. Bands of the appropriate size were visualized and underwent purification
with the Wizard® SV Gel and PCR Clean-Up System (Promega).
Samples were then sent to Iowa State University (ISU) DNA Facility for sequence
analysis where the sequencing reactions were set up with the appropriate primers [Table 1]. At
ISU an Applied Biosystems 3730xl DNA Analyzer was used. Sequences were analyzed with
GeneTool Version 2.0 (BioTools Inc.). The ORF5 sequences were classified according to their
100
restriction fragment length polymorphism cut pattern as outlined by the University of Minnesota
Veterinary Diagnostic Laboratory.
2.4 Respiratory Safety Trial
For this study, twenty-five 3 week old commercial crossbred pigs naïve to PRRSV were
randomly split by weight into groups of 5 for a 14 day respiratory safety trial. All animals were
housed at a research facility and blinded to all individuals working with the animals throughout
the study. Animals received 5.0 logs of virus in a 2 ml intramuscular injection in the neck
containing either MN184 pass 51 clone #6, MR007 pass 51 clone #2, MR007 pass 51 clone #9,
wt MR007, or phosphate buffer solution (PBS) for the negative controls. The three isolates were
selected out of the 12 developing clones from each parental virus on the basis of containing nsp2
deletions (MN184 #6 and MR007 #2) or based on replication kinetics in vitro (MR007 #9
consistently replicated to lower levels as compared to cohorts). Animal facility constraints
limited the study to just 5 groups. All viruses were diluted with minimum essential medium
(MEM; Sigma, St. Louis, MO.) containing 2% fetal bovine serum (FBS; Sigma, St. Louis, MO.)
in order to deliver 5.0 logs of virus to each animal. Viral titers were determined by TCID50/ml
[32, 33].
The study concluded at day 14 upon which all animals underwent humane euthanasia and
necropsy by a licensed veterinarian. Assessment of isolate virulence was evaluated by quantity
of gross lung lesions and average daily weight gain. Blood samples were collected prior to
inoculation on study day 0 and on days 7 and 14 to evaluate ability of isolates to induce PRRS
specific antibodies.
The lungs of all animals in the pig safety study were evaluated at necropsy for percent
consolidation consistent with PRRSV infection. Lungs were scored for each individual lobe and
101
total gross lung pathology using a standardized scoring system [34]. The final observation score
equaled the weighted sum of all the individual lobe scores.
2.5 Reproductive Safety Trial
With satisfactory results from the respiratory trial, the same isolates were tested again in
a gestating gilt reproductive model to further ascertain the safety of the isolates.
The reproductive safety trial included sixteen PRRS ELISA negative commercial crossbred gilts
at 90 ± 4 days of gestation housed in a research facility and blinded to all animal caretakers and
investigators. Animals were randomly divided into four treatment groups consisting of the same
cell passaged articles from the respiratory trial and one negative control group. Females were
inoculated intranasally with 2.0 mL per nostril with either inoculum or PBS for the negative
control group. All viruses were prepared as described for the respiratory trial, with the exception
of the gilts received 5.0 logs of virus in 4.0 ml. The study ended for each gilt and her piglets 21
days after their respective day of farrowing (DOF).
Abortions and farrowing data were recorded for each female. The day of farrowing was
defined as the day the first live born pig of the litter was delivered. Gilts were observed
periodically from at least 6:00 AM to 10:00 PM daily. Litter observations included the number
of abortions, stillbirths, mummies, live piglets, and weak born live piglets for each female.
Piglets found dead due to being crushed by the dam were recorded and confirmed with a
necropsy.
All gilts had blood drawn at day 0, 7, 14, 21, day of farrowing (DOF), 7 days after
farrowing (DOF+7), 14 days after farrowing (DOF+14), and 21 days after farrowing (DOF+21).
In addition, live piglets had blood collected on DOF, DOF+7, DOF+14, and DOF+21 while dead
piglets had blood or thoracic fluid collected immediately upon examination regardless of study
102
day. Blood was collected for evaluation of viremia and development of PRRSV specific
antibodies. Additional data was collected to serve as further evidence of safety including:
clinical signs of animals, gilt rectal temperatures, piglet average daily weight gain, and
reproductive performance.
2.6 Serology
Whole blood was collected from each animal via venipuncture. Samples were returned to
the laboratory for separation from the clot by centrifugation. Serum was then decanted into
screw-cap cryogenic vials and stored for a maximum of 24 hours at 4°C or at -70°C until testing
could be performed. Serum samples were analyzed for PRRSV specific antibody using the
IDEXX HerdChek® PRRS ELISA 2XR (IDEXX Laboratories Inc, Westbrook, ME). All tests
were performed as described by the manufacturer’s instructions. Samples were considered
positive for PRRSV antibodies if the sample-to-positive (S/P) ratio was at least 0.4.
2.7 Average Daily Weight Gain
As another parameter to gauge the health status of study animals, average daily weight
gain (ADWG) was recorded. Animal weights were recorded on a scale that was calibrated prior
to each use. For the respiratory safety study, animals were weighed 3 days prior to vaccination
(Day -3) and at necropsy (Day 14). For the reproductive safety study, all piglets delivered were
weighed within 8 hours of farrowing and all remaining live piglets were again weighed 21 days
later for analysis.
2.8 Reproductive Safety Trial Viremia
Both gilt and piglet serum were tested via reverse transcriptase polymerase chain reaction
(RT-PCR) for the presence of PRRSV nucleic acid. Serum was extracted by the Roche MagNA
pure extraction robot with the Total Nucleic Acid MagNA Pure kit (Roche Applied Science).
103
The RT-PCR was performed with the AgPath-ID™ NA and EU PRRSV Multiplex (Applied
Biosystems) per the manufacturer’s instructions. The reactions were run on a Roche Lightcycler
480 96 well machine with the following configuration: an annealing step at 45°C for 10 min.,
denaturation at 95°C for 10 min., and 40 cycles of denaturation at 97°C for 2 sec. followed by an
annealing step at 60°C for 40 sec., and finally a cooling step at 40°C for 40 seconds.
2.9 Reproductive Safety Study Animal Clinical Observations
All study animals were observed daily for overall health and clinical signs associated
with PRRS. Each animal was evaluated for respiration, behavior, and cough with scores
assigned for each category. Possible scores ranged from 0 (normal) to 1 (abnormal). Abnormal
behaviors were defined as abnormal respiration, abnormal behavior such as lethargy, and the
presence of a cough. A total daily score was recorded based on the sum of the 3 individual
scores. Any dead piglets were assigned a score of 3 and then were weighed and subsequently
had a necropsy performed to determine the likely cause of death. In addition to the daily
observations, gilt rectal temperatures were taken periodically beginning with the day prior to
inoculation (day -1) through study termination (DOF+21).
2.10 Statistics/biometrics
All data for the respiratory safety and reproductive safety studies were imported into SAS
version 9.1 for management and analysis. All parameters were compared between groups
(pairwise) 1 – 4 vs. 5 for both the pig and reproductive studies and groups 1 – 3 vs. 4 for the
respiratory study. In compliance with the methods recommended by APHIS, only two-sided
results were reported and all comparisons were at α=0.05. The specific methods used to analyze
data are shown in table 2.
104
3. Results
3.1 Sequence Analysis
The viruses undergoing continuous cell passage had genomic sequence analysis
performed at approximately every 10 passages on the nsp2 region and on the ORF5 region at
passage 50. Genomic changes outside of nsp2 and ORF5 were not monitored. As expected,
several isolates had developed natural deletions in the nsp2 region throughout the process. At
cell passage 50 MN184 #6 had a continuous 6 nucleotide deletion in the nsp2 region, expected to
result in the loss of 2 amino acids. MR007 #2 at cell passage 50 exhibited a continuous 63
nucleotide deletion in the nsp2 region which resulted in the loss of a continuous 21 amino acid
sequence. MR007 #9 at pass 50 remained similar to the parent strain and was selected for testing
for comparison to other isolates.
Samples from the reproductive safety trial also underwent sequence analysis to determine
how stabile the viruses were in vivo. All PCR positive piglet blood samples from the final day of
the study (DOF +21), underwent attempted sequence analysis for nsp2 and ORF5. At least one
sequence was successfully attained from each vaccinate group. All isolates from the gilt safety
trial remained stable in the evaluated regions after in vivo replication. The nsp2 region
sequencing from each individual animal revealed only a few substitutions for each virus.
Substitutions resulting in amino acid changes are summarized in table 3 and are described in
comparison to MN184A and JA142 AY424271. The ORF5 regions were also sequenced and
revealed only a few insignificant changes (data not shown).
3.2 Respiratory Safety Trial Lung Pathology
Upon completion of the study on day 14, all animals were assessed for lung pathology
[Figure 1]. Using ANOVA to compare group mean lung scores, only the wt MR007 group had a
105
significant increase in clinical lung scores as compared to the negative control group. The
MR007 #9 group had significant reductions in lung scores as compared to the wt MR007 group.
The lung scores indicate that the cell passage process significantly reduced the virulence of the
MN184 #6 and MR007 #9 isolates while the MR007 #2 isolate containing the nsp2 deletion may
still be capable of causing some degree of respiratory disease.
3.3 Average Daily Weight Gain
For the respiratory safety study, average daily weight gain analysis revealed no
statistically significant differences for either group mean initial body weight or average daily
gain amongst all treatment groups. The wt MR007 group had a slightly higher mean initial body
weight than the other groups which may account for the lack of statistical differences in ADWG
as compared to the other groups. For the reproductive safety study, piglets in the MR007 #2
group had significantly lower mean body weight at farrowing than the negative control group.
Piglets in all treatment groups had significant reductions in ADWG as compared to the negative
control group.
3.4 HerdChek ELISA
For the respiratory safety study, on day 0 and 7 all animals were negative via the IDEXX
HerdChek® PRRS ELISA 2XR. On day 14 all animals in the MN184 Pass 51 #6 group and
most animals in group 4 (wt MR007) had seroconverted while the MR007 pass 50 treatment
groups displayed poor seroconversion [Figure 2]. The wt MR007 treatment group was only
statistically different from the poor seroconverting MR007 #2 group.
For the reproductive safety study, all animals were again negative on days 0 and 7.
However, by day 21 nearly all gilts that received virus as a treatment were positive, indicating
the pigs in the respiratory trial may have needed additional time to develop detectable levels of
106
antibody. Gilts in the MN184 treatment group all remained positive by ELISA for the duration
of the study. Piglets were found to have a considerable amount of PRRSV specific antibody.
The MR007 #9 and MN184 #6 groups displayed significant increases in positive tests as
compared to the piglets belonging to the negative control group for all sample collection dates.
The MR007 #2 treatment group piglets were found to only be statistically distinct from the
negative control group at DOF+7. ELISA findings for both studies provided evidence that all
isolates are capable of inducing a PRRSV specific antibody response. Interestingly, the onset of
antibody detected in the MN184 treatment group was earlier than the MR007 pass 51 treatment
groups.
3.5 Gilt Reproductive Performance
Females farrowed relatively normal and healthy litters as outlined in (Table 4), with the
exception of 1 gilt in the MR007 #2 group who produced only 3 stillborn piglets. Due to facility
and labor limitations, only 4 gilts were used for each isolate. With such a small sample size it is
difficult to make concrete conclusions over this data. However, there were no dramatic signs of
virulence in any of the tested isolates. No statistical differences were found for any of the
reproductive performance variables measured when compared to the control group. These
findings suggest that the described attenuation process has been successful in reducing the
amount of reproductive failure caused by each isolate.
3.6 Mortality of Piglets, Pigs, and Gilts
For the respiratory safety study no animals were lost during the study. However, for the
reproductive safety study 6 piglets were lost from the DOF to DOF+21. These losses still fall
within the expected range of piglet mortality prior to weaning. One gilt in the MR007 #2
107
treatment group was euthanized due to illness resulting from a retained placenta. The gilt
delivered just 3 stillborn piglets so no piglet performance data was compromised.
3.7 Viremia
Gilt viremia as detected by RT-PCR was relatively short for most groups [Figure 3]. All
treatment groups had a significant increase in animals positive for PRRS RNA at day 14 while
the MN184 #6 group was also statistically distinct at day 7. The negative control group had 1
animal test positive at DOF+7, which was included in the statistical analysis. This was likely the
result of sample contamination sometime along processing as this was the only positive test out
of this group.
For the MR007 treatment groups, the majority of the piglets were negative on the day of
farrowing. However, by DOF+21 most piglets belonging to the MR007 #9 and MN184 #6
treatment groups were positive, presumably due to horizontal transmission of virus. All
treatment groups exhibited a significant increase in the number of piglets testing positive for
PRRS RNA, with the exception of MR007 #2 at DOF+7 which lost significance due to 4 out of
the 26 piglets in the negative control group testing positive on that day. The cause of positive
samples from the negative control group on this study day are unknown, but were likely the
results of contamination somewhere along the line of sample collection, handling, or processing
as no other negative control group samples were PCR positive prior to or after this occurrence
[Figure 4]. While all isolates were capable of replicating in vivo, the MR007 passaged viruses
were less efficient.
3.8 Reproductive Safety Study Clinical Observations
Clinical observations were recorded for the reproductive safety study as supporting data
for remaining isolate virulence. With the exception of the euthanized gilt, only a few isolated
108
events of abnormal scores of 1 were documented. No groups were statistically different from the
negative control group throughout the study. Mean gilt group rectal temperatures were also
collected and compared to the negative control group. Higher mean rectal temperatures were
noted at day 7 (MR007 #9 and MR007 #2) and day 14 (MN184 #6). Body temperatures for gilts
in all treatment groups remained normal throughout the remainder of the study. For the piglet
clinical observation scores, increases in piglet clinical abnormalities in the MR007 #9 and
MR007 #2 treatment groups were noted. All other clinically abnormal animals were not severely
affected and no abnormalities compromised the outcome of the study.
4. Discussion
The aim of this study was to develop attenuated PRRSV isolates from virulent field
strains by continuous in vitro passage for potential use as future modified live vaccines. The
ability to use naturally occurring nsp2 deletions as a determinant of isolate attenuation from in
vitro passage was also a side component of this project. Typically, when viruses replicate in cell
lines derived from a different species the viruses tend to naturally attenuate during the process of
adapting to the cell line used. Early mutations are frequently related to adaptation while later
stage mutations are more likely to be related to isolate attenuation [28, 35]. Currently available
modified live PRRS vaccines were developed by passing pathogenic isolates continuously in cell
culture to reduce virulence. Potential vaccine isolates are then tested for safety, efficacy, and
stability with in vivo models. This process is laborious, costly, and time consuming. The
development of methodologies to improve the efficiency of this process is needed.
In this report, a passage process is described in which single isolates were passed
multiple times by multiple well limiting dilutions to increase the efficiency of developing
naturally attenuated clones. Frequent sequence analysis was used to screen progeny viruses for
109
genomic changes and to guide selection of isolates for potential level of in vivo attenuation. In
the respiratory trial, all cell passage isolates had no statistical differences for lung pathology or
average daily weight gain as compared to the negative controls. The MR007 #9 group had
statistically significant reduced lung scores as compared to the parent group (wt MR007). A wt-
MN184 was not used in this study in an attempt to reduce the number of animals necessary for
this phase of investigation, but has been tested previously [32]. Johnson et al. inoculated ten 2-3
week old pigs with MN184 at cell culture passage 1 and documented the death of 2 pigs in that
group by the first 14 days of the study. Lung pathology scores were not collected for the MN184
group, but the group mortality rate speaks for the general virulence of the parental wt isolate. In
the pig respiratory trial, no animals were lost for any treatment group over the course of the
study.
Results for the reproductive safety trial mimicked those from the respiratory trial. When
compared to the negative control group, all reproductive performance parameters and gilt clinical
observations had no statistical differences for any of the tested isolates. ELISA results for both
trials indicated all isolates are capable of inducing the production of PRRSV specific antibodies
by day 21 in the gilts. Viremia detected by RT-PCR showed that the virus attained detectable
levels within the blood for only short periods of time in the gilts. Transplacental transmission of
virus with subsequent lateral transmission to littermates in all groups was documented. While
congenital transmission of virus did occur, it didn’t negatively affect the performance of all
groups. The MN184 #6 group had no statistical differences in piglet clinical observations when
compared to the negative control group which is a phenomenon that has been previously
described with currently available attenuated vaccines [36]. All passaged isolates were capable
of replication and inducing seroconversion in vivo and were less virulent than the parent viruses.
110
However, the isolates displayed some residual ability to cause disease and potential production
losses, so they will continue to be passaged in cell culture in an attempt to further attenuate the
viruses.
This work also provides evidence that nsp2 deletions may be a component of the
attenuation of in vitro passaged isolates. Naturally occurring nsp2 deletions were purposely
selected to be screened for virulence to determine if nsp2 deletions could be used to gauge levels
of in vitro attenuation. Both nsp2 deletion mutants tested (MN184 #6 and MR007 #2) were
attenuated in vivo. Results from the two safety studies revealed, the MR007 passaged isolate
with the 63 nucleotide deletion (MR007 #2) was less attenuated than the cohort isolate without a
noted nsp2 deletion (MR007 #9) at the same cell passage (passage 50). For the respiratory trial
only the MR007 #9 group was statistically different from the wt parent virus for lung pathology.
However, both isolates were statistically indistinguishable from the negative control group
indicating both were attenuated to some degree. The decreased ability of the nsp2 deletion
mutants to replicate in vivo has been reported previously, and could be the cause of the reduced
levels of viremia and slower development of antibody reported here with MR007 #2 [25, 37].
Without additional data, it is unclear if the nsp2 deletions were directly involved with isolate
attenuation or were a coincidental change.
Nsp2 deletions mutants are considered to be viable potential vaccine candidates worthy
of developing and testing. However, further research is needed to clarify their role in isolate
attenuation. The ability to identify attenuated isolates with molecular techniques would greatly
reduce the cost of developing new vaccines and significantly speed up the process. If nsp2
deletions are not involved with isolate attenuation, they still hold potential for the future
development of successful DIVA technologies.
111
Without a better understanding of viral components important for virulence and host
immunity, the industry will continue to rely on trial and error approaches for the development of
new and improved vaccines. Until then, the passage of virulent isolates in cell culture by
limiting dilution is an efficient and viable technique to concurrently develop multiple potential
vaccine candidate isolates.
112
Table 1. Primers Used in Preparation and Sequencing of PRRSV Isolates.
Primer Target Sequence
PCR Amplification of cDNA
NamNsp2U Nsp2 CTGCGGCCTTRGACAGGAACGG
NamNsp2L Nsp2 TGTCHACCCKATCCCACATGCG
PRRS-Out1 ORF5 GTACGGCGATAGGGACACC
PRRS-Out2 ORF5 CCAGAATGTACTTGCGGCC
Sequence Analysis
NamNsp2U MN#6 Nsp2 CTGCGGCCTTRGACAGGAACGG
NamNsp2L MN#6 Nsp2 TGTCHACCCKATCCCACATGCG
NspMR-U1 MN#6 Nsp2 CTGATCAGGTGTGCTTGGGG
NspMR-L1 MN#6 Nsp2 CCCCAAGCACACCTGATCAG
Nsp-MR-U2 MN#6 Nsp2 GCACCGCCACCTTCTCCAC
Nsp-MR-L2 MN#6 Nsp2 GTGGAGAAGGTGGCGGTGC
NamNsp2U MR#2/9 Nsp2 CTGCGGCCTTRGACAGGAACGG
NamNsp2L MR#2/9 Nsp2 TGTCHACCCKATCCCACATGCG
MN445U MR#2/9 Nsp2 AAGTCTTGAAGAATGCTTGGC
MN445L MR#2/9 Nsp2 GCCAAGCATTCTTCAAGACTT
MN41020U MR#2/9 Nsp2 GCATTGCCGCTGAGTGRGGAT
MN41020L MR#2/9 Nsp2 ATCCYCACTCAGCGGCAATGC
PRRS-Out1 ORF5 GTACGGCGATAGGGACACC
PRRS-Out2 ORF5 CCAGAATGTACTTGCGGCC
Letter Key:
A – Adesosine T - Thymidine K - G or T
G – Guanosine R - A or G Y - C or T
C – Cytidine H - A, C or T
113
Table2. Summary of Statistical Methods of Analysis for Collected Parameters.
Safety
Study
Parameter Specific Evaluation To
Be Conducted
Statistical Method
of Analysis
Respiratory Mean Lung
Scores
Mean lung scores for
each group
ANOVA
Respiratory
and
Reproductive
Serology Number of animals in
each group serologically
positive/total number of
animals in each group
Fisher’s Exact Test
Respiratory
and
Reproductive
Weights and
ADWG
Mean Data ANOVA
Reproductive Gilt
Reproductive
Performance
1. Total Piglets Kurskal-Wallis /
Wilcoxon Two
Sample Test 2. Stillborn
3. Healthy Live Piglets
4. Weak Live Piglets
5. Mummies
6. Live Pigs at DOF 21
Reproductive Gilt and
Piglet
Clinical
Observations
Gilts/Piglets with score
> 0 for at least one day
Fisher’s Exact Test
Reproductive Gilt Rectal
Temperatures
Mean Data ANOVA
Pyrexia Fisher’s Exact Test
Reproductive Gilt/Piglet
Viremia
Animals positive Fisher’s Exact Test
114
Table 3. Nsp2 Mutations Causing Amino Acid Changes from Positive Piglets at Twenty-one
Days of Age.
Isolate MN184A Position Nucleotide
Change
Amino Acid Change
MN184 #6 1468 A G N D
MN184 #6 2072 A G N S
MN184 #6 2087 T C L P
MN184 #6 2245 A G S G
JA142 AY424271 Position Nucleotide
Change
Amino Acid Change
MR007 #2 3034 A G N D
MR007 #2 3097 G A G S
MR007 #9 1738 G A G S
MR007 #9 2684 C T S F
MR007 #9 2941 T G G W
MR007 #9 3022 G A G S
115
Table 4. Mean Gilt Reproductive Performance per Litter.
Total
Farrowed
Stillborn Healthy
Live Piglets
Weak
Live
Piglets
Mummies DOF+21
Live
Pigs
MN184 #6 9.00 1.75 6.25 0.25 0.50 6.50
MR007 #2 8.25 2.50 5.75 0.00 0.00 5.25
MR007 #9 11.25 0.25 9.50 1.00 0.50 9.75
Negative 8.25 1.25 6.50 0.00 0.25 6.50
116
Figure 1. Pig Respiratory Trial: Lung Pathology.
1
The results were plotted as mean values of gross lung lesions from each group. The letter a
indicates the average lung score of the group is significantly higher than the negative control
while the letter b indicates the group was significantly lower than the MR007 wt group (a/b = p <
0.05).
117
Figure 2. Pig Respiratory Trial: Development of PRRSV Specific Antibody as Measured by
IDEXX ELISA.
118
Figure 3: Gilt Reproductive Trial: Gilt Viremia as Detected by RT-PCR.
119
Figure 4. Gilt Reproductive Trial: Piglet Viremia as Detected by RT-PCR.
120
References
[1] Cavanagh D. Nidovirales: a new order comprising Coronaviridae and Arteriviridae. Arch
Virol. 1997;142:629-33.
[2] Chung WB, Lin MW, Chang WF, Hsu M, Yang PC. Persistence of porcine reproductive and
respiratory syndrome virus in intensive farrow-to-finish pig herds. Can J Vet Res. 1997;61:292-
8.
[3] Holtkamp DJ, Kliebenstein JB, Neumann EJ. Assessment of the economic impact of porcine
reproductive and respiratory syndrome virus on United States pork producers. JSHAP.
2013;21:72-84.
[4] Zimmerman JJ KL, Ramirez A, Schwartz KJ, Stevenson GW Diseases of Swine. In:
Zimmermann JJ BD, Dee SA, Murtaugh MP, Stadejek T, Stevenson GW, Torremorell M,,
editor. Porcine Reproductive and Respiratory Syndrome Virus (Porcine Arterivirus). 10 ed:
Wiley-Blackwell; 2012. p. 461-86.
[5] Oh J, Lee C. Proteomic characterization of a novel structural protein ORF5a of porcine
reproductive and respiratory syndrome virus. Virus research. 2012;169:255-63.
[6] Kim DY, Kaiser TJ, Horlen K, Keith ML, Taylor LP, Jolie R, et al. Insertion and deletion in a
non-essential region of the nonstructural protein 2 (nsp2) of porcine reproductive and respiratory
syndrome (PRRS) virus: effects on virulence and immunogenicity. Virus genes. 2009;38:118-28.
[7] Yoshii M, Okinaga T, Miyazaki A, Kato K, Ikeda H, Tsunemitsu H. Genetic polymorphism
of the nsp2 gene in North American type--porcine reproductive and respiratory syndrome virus.
Arch Virol. 2008;153:1323-34.
[8] Fang Y, Kim DY, Ropp S, Steen P, Christopher-Hennings J, Nelson EA, et al. Heterogeneity
in Nsp2 of European-like porcine reproductive and respiratory syndrome viruses isolated in the
United States. Virus research. 2004;100:229-35.
[9] Shen S, Kwang J, Liu W, Liu DX. Determination of the complete nucleotide sequence of a
vaccine strain of porcine reproductive and respiratory syndrome virus and identification of the
Nsp2 gene with a unique insertion. Archives of virology. 2000;145:871-83.
[10] de Lima M, Pattnaik AK, Flores EF, Osorio FA. Serologic marker candidates identified
among B-cell linear epitopes of Nsp2 and structural proteins of a North American strain of
porcine reproductive and respiratory syndrome virus. Virology. 2006;353:410-21.
[11] Han J, Liu G, Wang Y, Faaberg KS. Identification of nonessential regions of the nsp2
replicase protein of porcine reproductive and respiratory syndrome virus strain VR-2332 for
replication in cell culture. Journal of virology. 2007;81:9878-90.
[12] Xu YZ, Zhou YJ, Zhang SR, Jiang YF, Tong W, Yu H, et al. Stable expression of foreign
gene in nonessential region of nonstructural protein 2 (nsp2) of porcine reproductive and
121
respiratory syndrome virus: applications for marker vaccine design. Veterinary microbiology.
2012;159:1-10.
[13] Fang Y, Schneider P, Zhang WP, Faaberg KS, Nelson EA, Rowland RR. Diversity and
evolution of a newly emerged North American Type 1 porcine arterivirus: analysis of isolates
collected between 1999 and 2004. Arch Virol. 2007;152:1009-17.
[14] Gao ZQ, Guo X, Yang HC. Genomic characterization of two Chinese isolates of porcine
respiratory and reproductive syndrome virus. Arch Virol. 2004;149:1341-51.
[15] Han J, Wang Y, Faaberg KS. Complete genome analysis of RFLP 184 isolates of porcine
reproductive and respiratory syndrome virus. Virus research. 2006;122:175-82.
[16] Li Y, Wang X, Bo K, Tang B, Yang B, Jiang W, et al. Emergence of a highly pathogenic
porcine reproductive and respiratory syndrome virus in the Mid-Eastern region of China. Vet J.
2007;174:577-84.
[17] Ropp SL, Wees CE, Fang Y, Nelson EA, Rossow KD, Bien M, et al. Characterization of
emerging European-like porcine reproductive and respiratory syndrome virus isolates in the
United States. J Virol. 2004;78:3684-703.
[18] Tian K, Yu X, Zhao T, Feng Y, Cao Z, Wang C, et al. Emergence of fatal PRRSV variants:
unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique
hallmark. PLoS One. 2007;2:e526.
[19] Gauger PC, Faaberg KS, Guo B, Kappes MA, Opriessnig T. Genetic and phenotypic
characterization of a 2006 United States porcine reproductive and respiratory virus isolate
associated with high morbidity and mortality in the field. Virus research. 2012;163:98-107.
[20] Yu X, Chen N, Wang L, Wu J, Zhou Z, Ni J, et al. New genomic characteristics of highly
pathogenic porcine reproductive and respiratory syndrome viruses do not lead to significant
changes in pathogenicity. Veterinary microbiology. 2012;158:291-9.
[21] Metwally S, Mohamed F, Faaberg K, Burrage T, Prarat M, Moran K, et al. Pathogenicity
and molecular characterization of emerging porcine reproductive and respiratory syndrome virus
in Vietnam in 2007. Transboundary and emerging diseases. 2010;57:315-29.
[22] Zhou L, Zhang J, Zeng J, Yin S, Li Y, Zheng L, et al. The 30-amino-acid deletion in the
Nsp2 of highly pathogenic porcine reproductive and respiratory syndrome virus emerging in
China is not related to its virulence. Journal of virology. 2009;83:5156-67.
[23] Han W, Wu JJ, Deng XY, Cao Z, Yu XL, Wang CB, et al. Molecular mutations associated
with the in vitro passage of virulent porcine reproductive and respiratory syndrome virus. Virus
genes. 2009;38:276-84.
122
[24] Ni YY, Huang YW, Cao D, Opriessnig T, Meng XJ. Establishment of a DNA-launched
infectious clone for a highly pneumovirulent strain of type 2 porcine reproductive and respiratory
syndrome virus: identification and in vitro and in vivo characterization of a large spontaneous
deletion in the nsp2 region. Virus research. 2011;160:264-73.
[25] Faaberg KS, Kehrli ME, Jr., Lager KM, Guo B, Han J. In vivo growth of porcine
reproductive and respiratory syndrome virus engineered nsp2 deletion mutants. Virus research.
2010;154:77-85.
[26] Guo B, Vorwald AC, Alt DP, Lager KM, Bayles DO, Faaberg KS. Large scale parallel
pyrosequencing technology: PRRSV strain VR-2332 nsp2 deletion mutant stability in swine.
Virus research. 2011;161:162-9.
[27] Brockmeier SL, Loving CL, Vorwald AC, Kehrli ME, Jr., Baker RB, Nicholson TL, et al.
Genomic sequence and virulence comparison of four Type 2 porcine reproductive and
respiratory syndrome virus strains. Virus research. 2012;169:212-21.
[28] Leng X, Li Z, Xia M, Li X, Wang F, Wang W, et al. Mutations in the genome of the highly
pathogenic porcine reproductive and respiratory syndrome virus potentially related to
attenuation. Veterinary microbiology. 2012;157:50-60.
[29] Sun Z, Chen Z, Lawson SR, Fang Y. The cysteine protease domain of porcine reproductive
and respiratory syndrome virus nonstructural protein 2 possesses deubiquitinating and interferon
antagonism functions. Journal of virology. 2010;84:7832-46.
[30] van Kasteren PB, Beugeling C, Ninaber DK, Frias-Staheli N, van Boheemen S, Garcia-
Sastre A, et al. Arterivirus and nairovirus ovarian tumor domain-containing Deubiquitinases
target activated RIG-I to control innate immune signaling. Journal of virology. 2012;86:773-85.
[31] Sun Z, Li Y, Ransburgh R, Snijder EJ, Fang Y. Nonstructural protein 2 of porcine
reproductive and respiratory syndrome virus inhibits the antiviral function of interferon-
stimulated gene 15. Journal of virology. 2012;86:3839-50.
[32] Johnson W, Roof M, Vaughn E, Christopher-Hennings J, Johnson CR, Murtaugh MP.
Pathogenic and humoral immune responses to porcine reproductive and respiratory syndrome
virus (PRRSV) are related to viral load in acute infection. Veterinary immunology and
immunopathology. 2004;102:233-47.
[33] Reed LJ, Muench H. A simple method of estimating fifty percent end-points. Amer J Hyg.
1938;27:493–7.
[34] Halbur PG, Miller LD, Paul PS, Meng XJ, Huffman EL, Andrews JJ. Immunohistochemical
identification of porcine reproductive and respiratory syndrome virus (PRRSV) antigen in the
heart and lymphoid system of three-week-old colostrum-deprived pigs. Vet Pathol. 1995;32:200-
4.
123
[35] An TQ, Tian ZJ, Zhou YJ, Xiao Y, Peng JM, Chen J, et al. Comparative genomic analysis
of five pairs of virulent parental/attenuated vaccine strains of PRRSV. Veterinary microbiology.
2011;149:104-12.
[36] Mengeling WL, Lager KM, Vorwald AC. Clinical effects of porcine reproductive and
respiratory syndrome virus on pigs during the early postnatal interval. Am J Vet Res.
1998;59:52-5.
[37] Ni YY, Opriessnig T, Zhou L, Cao D, Huang YW, Halbur PG, et al. Attenuation of porcine
reproductive and respiratory syndrome virus by molecular breeding of virus envelope genes from
genetically divergent strains. Journal of virology. 2013;87:304-13.
124
CHAPTER 5. DISCUSSION
General Conclusions
Porcine reproductive and respiratory syndrome virus can be an elusive pathogen to
routinely detect diagnostically and to control in commercial pork production. The ability of the
virus to constantly mutate has led to the development of a huge variety of isolates in the field.
The breadth of isolates makes it difficult to detect all infections diagnostically and to provide
commercial pigs with consistent cross protective immunity. Stakeholders will continue to work
with imperfect tools until significant advances are made in the basic understanding of
determinants of immunity and viral pathogenicity.
The swine industry would undoubtedly benefit from the development of improved
vaccines. However, despite extensive efforts, little progress has been made to improve efficacy
since the first introduction of a live, attenuated vaccine in 1994 [1]. The current lack of
understanding of viral targets for protective immunity prevents guided attempts at developing
vaccines with improved heterologous protection, increased safety, and the ability to differentiate
vaccinated from wild type infected pigs. Without a better understanding of PRRSV immunity
and pathogenesis, the development of novel vaccines will likely rely on the current laborious and
expensive trial and error approach.
The two approaches reported here remain viable options to develop improved modified
live vaccines, but have similar limitations. Construction of protective chimeras will remain a
guessing game until individual viral structures important for immunity are identified and can be
targeted. Likewise, without an understanding of the genomic basis of virulence it is impossible
to determine the degree of virulence of isolates. Potential vaccinates will require continued
testing in live animals to determine attenuation and heterologous efficacy.
125
However, there is reason to remain optimistic for the outlook of improved disease
prevention tools as scientists from around the world are actively seeking solutions. Attempted
strategies to develop improved vaccines have included: development of a vaccine after
continuous passage of a highly virulent variant isolate (HP-PRRSV) in cell culture, genetic
engineering of wild type strains, synthesis of infectious chimeras, creation of recombinant
vectors expressing PRRSV proteins, development of DNA vaccines, and creation of plant made
oral subunit vaccines [2]. Numerous strategies are being attempted by many bright investigators.
Significant advances have already been made in the diagnostics realm allowing for
improved detection of genetically divergent strains, earlier detection of infections, and continued
development of differential assays. In addition, the development of sample collection and
delivery techniques allowing for the reduction of costs and technical training required for sample
collection will be very beneficial to the pork industry.
Development of improved vaccines against PRRSV will likely remain a challenge until
the immunity and pathogenesis is better understood. Additional research in PRRS
immunobiology is urgently needed to hasten the development of better tools to help prevent,
control, and eliminate the virus.
References
[1] Murtaugh MP, Genzow M. Immunological solutions for treatment and prevention of porcine
reproductive and respiratory syndrome (PRRS). Vaccine. 2011;29:8192-204.
[2] Hu J, Zhang C. Porcine reproductive and respiratory syndrome virus vaccines: current status
and strategies to a universal vaccine. Transboundary and emerging diseases. 2013.