Polymorphism of HLA in the Romanian population

Polymorphsm of HLA in the population

E. Reed, E. Ho, F. Lupu, P. McManus, R. Vasilescu, A. Foca-Rodi, N. Suciu-Foca. Polymorphism of HLA in the Romanian population. Tissue Antigens 1992: 39: 8-13.

Abstract: We have investigated the HLA-class I and class IT polymorphism in a popuIation of 83 Romanians using conventional serology together with PCR amplification and oligonucleotide typing of HLA-class I1 genes. Romanians show a higher frequency of HLA-All, B13, B18, B37, B39, B51 and DR2 than other European populations. HLA-DRBl*1501 and 1601 account for the high frequency of the serologic specificity DR2. In Romanians, HLA-DR2 is in linkage disequilibrium with HLA-B18 and HLA-Bw52 rather than with HLA-B7 as is the case in other Europeans. Unexpected HLA-DR2 haplotypes include HLA-DRB1 * 1502, DQA1*0102, DQB1*0601; HLA-DRB1*1602, DQA1*0102, DQB1*0502. Other unusual haplotypes include HLA-DRB 1 *0405, DQAl*O3, DQB 1 *0302; HLA-DRB 1 * 1305, DQAl*O103, DQBl*O603; and HLA- DRB1*1405, DQA1*0101, DQB1*05032. Analysis of the genetic distance between Romanians and other Europeans who have been studied serologi- cally are consistent with the hypothesis that Romanians descend from Roman ancestors who colonized Dacia between the 1st century B.C. and 1st century A.D.

Romanian

Elaine Reed, Eric Ho, Floria Lrpu, Peter McManus, Rodica Vasilescu, Aurica Foca-Rodi and Nicole Such-Foca Department of Pathology, College of Physicians and Surgeons of Columbia University, New York, New York, U S A

Key words: haplotypic associations - HLA pole rnorphism - Romanian HLA

Received 5 August, accepted for publication 27 August 1991

ldtroduction The polymorphism of HLA genes has been exten- sively studied in most European populations. Ro- manians, however, have been the subject of only one previous publication (1). This population is of interest because there are certain unsolved ques- tions regarding its origin.

One theory proposes that the place of origin of the Vlach (Wallachian) people was the Southern part of the Balkans. According to this theory, groups of Balkan shepherds migrated towards the north, occupying the territory of Bulgaria and of Munthenia (Wallachia), a southern province of Ro- mania (2). The second theory emphasizes the Rom- an origin of Romanians, supposed to be descend- ants of Roman colonists who were brought to Dac- ia by the emperor Trajan after the conquest in 106 A.D. (3, 4).

The first inhabitants of present-day Romania were the Geto-Dacians, a branch of Thracians (12th century B.C.). Scythians, Illyrians, Celts, Ba- starnae and Sarmatians came to settle on the territory of Dacia between the 1st century B.C. and the 1 st century A.D. The socio-economic development of Geto-Dacians favored the formation of an independent and centralized state under King Buere- bista around the year 70 B.C. The Dacian state

8

spread between the Tisza River and the lower Danube, including the territory of Transylvania, Wallachia, Moldavia and Bessarabia as far as the Black Sea. In 85 A.D. the Roman emperor Domiti- an’s expedition against the Dacians consolidated his position north of the Danube. The complete conquest of Dacia followed two vigorous cam- paigns by the emperor Trajan (in 103 and 105-1 06); the process of Romanization was swift. In Ro- mania, Latin completely supplanted the Dacian and Thracian languages (3).

In 214, Dacia was conquered by the Goths. The destruction of the Gothic empire by the Huns, 200 years later, followed by that of the Bulgars at the end of the 5th century and of the Avars in the late 6th century, prepared the ground for a wide Slavic dis- semination from their homeland in the Ukraine, north of the Carpathians (4). Between the 10th and 13th centuries small Romanian principalities of Russian Orthodox religion and Latin language were formed. In the 17th century, after a brief period of unification and independence, the Southern (Walla- chia) and Eastern (Moldavia) principalities fell under Turkish occupation, while the central state of Transylvania was conquered by Hungary and then by Austria (1696) (3,4). It was only 160 years later (1 859) that Wallachia and Moldavia regained their independence, forming the United Romanian State,

HLA in Romanians

to which the Romanian provinces of Bucovina and Bessarabia (Northeast), Transylvania (Central) and Banat (West) proclaimed their adherence in 191 8. Bessarabia and Bucovina were lost to the Soviet Union after World War I1 (3).

The work reported in this paper represents an analysis of HLA class I and class I1 polymorphism in a population of 83 Romanians who emigrated to the United States after 1948.

Material and methods Study population

The study population consisted of 83 unrelated na- tive Christian Romanians who emigrated to the United States after 1948. Sixty-one percent of the individuals tested came from Munthenia, 9% from Moldavia, 16.4%. from Transylvania and 13.6% from Banat. Eleven Romanian families were in- cluded for segregation analysis.

Serology

HLA-A,B,C and HLA-DRY HLA-DQ typing was performed on purified T- and B-lymphocyte suspen- sions, respectively, using the complemen t-mediated lymphocytotoxicity assay as previously described (5) . The typing reagents used were obtained from the 1 1 th International Histocompatibility Work- shop, from One Lambda, Inc. (Los Angeles, CA) and from a local set of reference sera.

Amplification of genornic DNA

The preparation and amplification of genomic DNA was performed as previously described (6). The primers used in this study were provided by the 1 1 th International Histocompatibility Workshop. The first domain of HLA-DRB1 was amplified using the primer pair DRBAMP-A (5’-CCCCA- CAGCACGTTTCTTG) and DRBAMP-B (5’- CCGCTGCACTGTGAAGCTCT). Further sub- typing of the DRBl genes was performed by group-specific amplification using the following primers: 1) DR1 group with DRBAMP-I (5’- TTCTTGTGGCAGCTTAAGTT) and DRBAMP- B; 2) DR2 group with DRBAMP-2 (5’-TTCCT- GTGGCAGCCTAAGAGG) and DRBAMP-B; 3) DR4 group with DRBAMP-4 (5’-GTTTCT- TGGAGCAGGTTAAAC) and DRBAMP-B; DRw52 associated group with DRBAMP-3 (5’- CACGTTTCTTGGAGTACTCTAC) and DRB- AMP-B; and DRB3 with DRBAMP-52 (5’- CCCAGCACGTTTCTTGGAGCT) and DRB- AMP-B. The first domain of DQAl , DQB 1, DPA 1 and DPBl were amplified, using as primers the following oligonucleotides: DQAAMP-A (5’-

ATGGTGTAAACTTGTACCAGT) and DQA- AMP-B (5’-TTGGTAGCAGGGTAGAGTTG); DQBAMP-A (5’-CATGTGCTACTTCACCAA-

TCTGCACAC); DPAAMP-A (5’-GCGGACCAT-

TGAGTGTGGTTGGAACG); DPBAMP-A (5’-

AMP-B (5’-GCCGGCCCAAAGCCCTCACTC).

CGG) and DQBAMP-B (5’-CTGGTAGTTGTG-

GTGTCAACTTAT) and DPAAMP-B (5’-GCC-

GAGAGTGGCGCCTCCGCTCAT) and DPB-

DR 1 -DRB 1 , DR2-DRBI, DR52 associated- DRBI, DR4-DRB1, DRB3 and DPBl reaction mixtures were subjected to 30 cycles of amplification at 95°C (.l.O min), 61°C (1.30 min) and 72°C (1 min). DRB1, DQA1, DQBl and DPAl mixtures were amplified for 30 cycles at 95°C (1.0 rnin), 55°C (1.30 min) and 72°C (1 min).

Dot blot and SSOP hybridization

Dot blotting and hybridization were performed as previously described (6) using sequence-specific oligonucleotide probes (SSOP) provided by the 11 th International Histocompatibility Workshop. After hybridization, each membrane was rinsed two times

Table 1. HLA-A, B. C and OR gene frequencies in 83 unrelated Romanians

HLA-A GF HLA-6 GF HLA-B GF HLA-OR GF

A1 0.108 A2 0.289 A3 0.136 A l l 0.102 A23 0.024 A24 0.102 A25 0.024 A26 0.024 A28 0.024 A29 0.012 A30 0.024 A37 0.078 A32 0.049 Aw33 0.012 Aw34 0.000 Aw36 0.000 Aw43 0.000 Aw66 0.000 Aw74 0.000 AX 0.050

B7 88 81 3 B1 4 81 8 827 635 837 638 639 Bw41 6w42 844 645 Bw46 Bw47 Bw48 849 Bw50 651 Bw52 Ew53 Bw54 Ew55 Ew56 Bw57 Ew58 Ew59 Bw60 Ew61 6w62 Bw63

0.049 0.056 0.062 0.031 0.075 0.049 0.1 02 0.043 0.024 0.037 0.01 2 u.auu 0.069 0.006 0.000 0.006 0.006 0.01 8 0.01 2 0.1 15 0.01 8 0.01 8 0.000 0.031 0.006 0.01 2 0.01 2 0.000 0.024 0.031 0.031 0.006

~

Bw64 0.000 Ew65 0.000 Bw67 0.000 Ew71 0.000 Ew72 0000 Ew73 0.000 Ew75 0.000 Bw76 0.000 Bw77 0.000 EX 0.040

HLA-C GF

Cwl 0.056 Cw2 0.075 Cw3 0.087 Cw4 0.115 cw5 0.012 Cw6 0.095 Cw7 0.143 CW8 0.000 CX 0.427

~-

0r1 0r2 0r3 DR4 DR7 DRw8 DRwS ORwl 0 drw11 0rw12 0rw13 drw14 ORX

~-

0.088 0.256 0.1 22 0.082 0.095 0.01 2 0.006 0.024 0.1 36 0.037 0.095 0.043 0.005

9

Reed et a].

in 2X SSC, 0.1% SDS and washed two times in TMAC solution as described by Wood et al. (7).

These primers and probes permit the identifi- cation of 43 DRB 1 alleles, 4 DRB3 alleles, 1 DRB4 allele, 3 DRB5 alleles, 8 DQAl alleles, 16 DQBl alleles, 2 DPAl alleles, and 19 DPBl alleles. Genom- ic DNA from 50 homozygous typing cells from the 10th International Histocompatibility Workshop were used as specificity controls for DNA amplification and hybridization.

Statistics The allele frequencies of HLA-DRB1, DRB3, DRBS, DQAI, DQB1, DPAl, DPBl were obtained

Table 2. ORB1, DRB3, ORBS, OQAl , DGBl, DPAl and DPBl gene frequencies in Romanians

(N = 166) (N = 152) (N = 166) DRB1' GF O(1Al' GF DPA1' GF

01 01 01 02 01 03 1501 1502 1601 1602 0301 0302 0401 0402 0403 0404 0405 0406 0407 0408 0409 0410 041 1 1101 1102 1103 1104 1201 1202 1301 1302 1303 1304 1305 1401 1402 1403 1404 1405 07 0801 0802 0803 0804 0901 1001

0.072 0.01 2 0.000 0.072 0.042 0.108 0.01 8 0.1 33 0.000 0.036 0.024 0.01 2 0.01 2 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.072 0.006 0.000 0.054 0.030 0.006 0.054 0.01 8 0.01 2 0.000 0.01 2 0.030 0.000 0.000 0.000 0.018 0.096 0.006 0.006 0.000 0.000 0.006 0.024

0101 0.191 0102 0.230 0103 0.053 0201 0.092 03 0.092 0401 0.013 0501 0.329 0601 0.000

(N = 134) OQB1' GF 0501 0.157 0502 0.090 05031 0.015 05032 0.037 0504 0.000 0601 0.030 0602 0.045 0603 0.060 0604 0.015 0605 0.000 0201 0.231 0301 0.216 0302 0.082 0303 0.007 0401 0.000 0402 0.015

(N = 74) ORBS' GF

0101 0.759 0201 0.241

(N = 166) DO61' GF 01 01 0201 0202 0301 0401 0402 0501 0601 0801 0901 1001 1101 1301 1401 1501 1601 1701 1801 1901

0.01 8 0.265 0.006 0.078 0.398 0.1 45 0.006 0.01 2 0.000 0.01 2 0.006 0.006 0.01 8 0.006 0.000 0.000 0.024 0.000 0.000

(N = 40) ORBY GF

0101 0.230 0201 0.176 0202 0.540 0301 0.054

0101 0.325 0102 0.150 02 0.525

by direct gene counting, assuming no "blank" alleles. The frequencies of HLA-A, B, C and DR genes were derived from serology results (8). Two locus associations, genetic and angular distance were cal- culated as previously described (8-1 l). Probable DRB 1 * , DQA 1 * , DQB 1 * haplotypes were assigned on the basis of two locus associations and known linkage disequilibria as described by Ronningen et al. (12).

Results and discussion The gene frequencies of HLA-A, B, C and DR alleles as established by serologic typing of 83 Romani- ans are shown in Table 1. Romanians have a relatively high gene frequency of HLA-A1 1 (10.2Y0) and low frequency of A29 (1.2%) compared to most European populations, except Hungarians and Swiss (13). Among the B-locus antigens there is a relatively high gene frequency of HLA-B13 (6.2%),

and low frequency of B7 (4.90/0) and Bw57 (2%) in Romanians, compared to other Europeans (13). Analysis of HLA-DR gene frequency shows that HLA-DR2 (25.6%) is more frequent than in other Europeans (1 3), while the frequency of DRw8 (1.2%) is relatively low in Romanians (Table 1).

The distribution of HLA-DRB, DQA1, DQBl, DPA 1 and DPBl alleles among Romanians was de- termined by oligonucleotide typing (Table 2). No de- viation from Hardy-Weinberg equilibrium was observed. The high frequency of the serologic specificity HLA-DR2 in Romanians corresponds to frequencies of 7.2.4.2, 10.8 and 1.8% of the DRB1* alleles 150 1, 1503, 1 60 1 and 1 602, respectively. Hence, the increase in DR2 is mostly related to the high frequency of DRB 1 * 150 I and 160 1.

B18 (7.50/0), B37 (4.30/0), B39 (3.7%), B51 (11.5Yo)

Table 3. HIA-B and HLA-ORB1 haplotypic associations in Romanians

HLA-B HLA-ORBI* HF delta p value

88 61 3 B1 3 B14 B1 4 61 8 81 8 837 Bw41 844 649 Bw50 Bw52 Bw55 Bw61 Bw62

0301 0404 1001 01 02 0401 1501 1104 1201 1301 01 02 1301 07 1502 0301 1405 0401

0.0723 0.01 20 0.01 81 0.01 20 0.01 20 0.0301 0.0241 0.01 81 0.01 20 0.01 20 0.01 20 0.01 20 0.01 81 0.0301 0.01 20 0.0241

0.0648 0.01 13 0.01 66 0.01 17 0.01 09 0.0427 0.0200 0.01 68 0.01 15 0.01 12 0.01 12 0.01 09 0.01 73 0.0260 0.01 15 0.0230

< 0.0005 < 0.0005 < 0.0005 < 0.0005 < 0.005 < 0.005 < 0.005 < 0.0005 < 0.0005 < 0.0005 < 0.001 < 0.005 < 0.0005 < 0.0005 < 0.0005 < 0.0005

10

HLA in Romanians

Table 4. DRBl IDRE5 and DRB1 /DRB3 haplotypic associations

DRB1' DRB5' HF delta p value

1501 01 01 0.3000 0.2766 < 0.0005 1502 01 02 0.1 500 0.1 437 < 0.0005 1601 02 0.4500 0.3933 < 0.0005 1602 02 0.0750 0.0656 <0.05

DRB1'

0301 '0301 0301 1101 1102 1104 1104 1201 1201 1202 1301 '1 301 1301 '1301 1302 1303 1303 1305 1401

'1 405 1405

DRBJ'

01 01 0201 0202 0202 0202 0202 0201 0201 0202 0201 0101 *

0201 0202 0301 0301 01 01 0202 0202 0202 0201 0202

HF delta p value

0.2027 0.081 1 0.1 486 0.1622 0.01 35 0.0946 0.0405 0.0405 0.0270 0.01 35 0.081 1 0.0405 0.0270 0.01 35 0.0405 0.01 35 0.01 35 0.0270 0.0676 0.0270 0.0405

0.1 721 0.0577 0.0768 0.1 233 0.01 03 0.0654 0.031 0 0.0353 0.01 08 0.01 25 0.0700 0.0321 0.001 1 0.0109 0.0396 0.01 08 0.0070 0.0205 0.0514 0.0239 0.0308

< 0.0005

< 0.0005

< 0.05

< 0.01

< 0.05 < 0.0005

< 0.05

< 0.0005

< 0.05 < 0.05

~~ ~ ~~ ~

* Haplotypic associations which have not been described before in other populations.

Confirming the low frequency of the serologic specificity HLA-DRw8, results of oligonucleotide typing show that DRB 1 *0801 and DRB 1 *0802, have a frequency of only 0.6'Keach. Certain DRBl * alleles such as 0103, 0302, 0406, 0407, 0408, 0409, 0410,041 I , 1103,1304,1402, 1403,1404,0803, and 0804 were not found in this population of 83 Rom- anians, although all except DRBl* 0410,1304,1402 and 1404 were encountered in another New York population of similar size. Of note, DRB 1 *0405 and DRB* 1405, which were previously described only in Orientals (14-17), are also present in the Romanian population. The most significant HLA-B-DRB 1 linkage disequilibria found in Romanians are listed in Table 3. Of interest, the HLA-DR2 alleles DRBl * 150 1 and 1502 in Romanians are in linkage disequilibrium with HLA-B18 and Bw52 respectively, rather than with HLA-B7 as expected in Europeans (13). This may be a reflection of the relatively low frequency of HLA-B7.

The DRB 1 -DRBS, DRB I-DRB3 haplotypic associations encountered are shown in Table 4. Rather unexpected associations were: DRB 1 *030 1 with DRB3*0201, DRB1*1301 with DRB3*0201, DRB1*1301 with DRB3*0301, and DRB1*1405 with DRB3*0201 which, to our knowledge, have not

Table 5. DQAl IDQBl, DRBlIOOAl and DRB1 /OPE1 haplotypic associations in Roman- ians DQA1' DPBl HF delta p value

01 01 0501 0.1 269 0.0969 < 0.0005 01 01 0503 0.01 49 0.01 21 < 0.01 01 02 0502 0.0896 0.0689 < 0.0005 01 02 0602 0.0448 0.0344 < 0.0005 01 03 0603 0.0373 0.0341 < 0.0005 0201 0201 0.0746 0.0534 < 0.0005 03 0302 0.0746 0.0671 < 0.0005 0401 0402 0.01 49 0.0147 < 0.0005 0501 0201 0.201 5 0.1 255 < 0.0005 0501 0301 0.21 64 0.1 454 < 0.0005

DRBl.* D Q A ~ * HF delta p value

01 01 01 01 0.0789 0.0652 < 0.0005 01 02 01 01 0.01 32 0.01 09 < 0.005 1501 01 02 0.0592 0.0427 < 0.0005 1502 01 03 0.01 32 0.01 09 < 0.005 '1 502 01 02 0.0263 0.0167 <0.05 1601 01 02 0.0987 0.0738 < 0.0005 '1602 01 02 0.01 97 0.01 56 < 0.001 0301 0501 0.1382 0.0944 < 0.0005 0401 03 0.0395 0.0362 < 0.0005 0402 03 0.01 97 0.01 75 < 0.0005 0404 03 0.01 32 0.01 21 < 0.0005 0405 03 0.0066 0.0060 < 0.005 1101 0501 0.0724 0.0487 < 0.0005 1104 0501 0.0526 0.0349 < 0.0005 1201 0501 0.0329 0.0230 < 0.001 1301 01 03 0.0329 0.0304 < 0.0005 1302 01 02 0.01 97 0.01 56 < 0.005 1303 0501 0.0132 0.0092 <0.05 '1 305 01 03 0.0066 0.0059 < 0.005 1401 01 01 0.0329 0.0272 < 0.0005

'1 405 01 01 0.0132 0.0097 C0.05 07 0201 0.0855 0.0767 < 0.0005 0801 0401 0.0066 0.0065 < 0.0005 0802 0401 0.0066 0.0065 < 0.0005 0901 03 0.0066 0.0060 < 0.0005 1001 0101 0.0263 0.021 7 c 0,0005

DRB1' DQB1' HF delta p value

0101 01 02 1501 1502 1601

'1 602 0301 0401 0402 0404 '0405 1101 1104 1201 1301 1302 1303 '1 305 1401 '1 405 07 0801 0802 0901 1001

0501 0501 0602 0601 0502 0502 0201 0302 0302 0302 0302 0301 0301 0301 0603 0604 0301 0603 0503 05032 0201 0402 0402 0303 0501

0.0746 0.01 49 0.0448 0.0075 0.0672 0.01 49 0.1493 0.0299 0.0299 0.01 49 0.0075 0.0672 0.0448 0.0373 0.0448 0.01 49 0.01 49 0.0075 0.01 49 0.01 49 0.0746 0.0075 0.0075 0.0075 0.0224

0.0633 0.01 30 0.0415 0.0062 0.0574 0.01 33 0.1 185 0.0269 0.0279 0.01 39 0.0070 0.051 6 0.0331 0.0308 0.041 9 0.01 47 0.01 23 0.0067 0.01 45 0.01 43 0.0525 0.0074 0.0074 0.0074 0.01 86

< 0.0005 < 0.001 < 0.0005 < 0.05 < 0.000 < 0.0005 < 0.0005 < 0.0005 < 0.0005 < 0.0005 < 0.001 < 0.0005 < 0.001 < 0.0005 < 0.0005 < 0.0005 < 0.01 < 0.01 < 0.0005 < 0.0005 < 0.0005 < 0.0005 < 0.0005 < 0.0005 < 0.0005

* Haplotypic associations which have not been described before in other populations.

11

.Reed et al.

Table 6. Probable DRBl -DQAl-DQBl haplotypes in Romanians

Haplotype HF

DRB1* DQA1' DQB1'

01 01 01 02 1501 1502 *1502 1601 7602 0301 0401 0402 0404 '0405 1101 1104 1201 1301 1302 1303

'1 305 1401

'1 405 07 0801 0802 0901 1001

01 01 01 01 01 02 01 03 01 02 01 02 01 02 0501 03 03 03 03 0501 0501 0501 01 03 01 02 0501 01 03 01 01 01 01 0201 0401 0401 03 01 01

0501 0501 0602 0601 0601 0502 0502 0201 0302 0302 0302 0302 0301 0301 0301 0603 0604 0301 0603 0503 05032 0201 0402 0402 0303 0501

0.0746 0.01 49 0.0448 0.0075 0.0075 0.0672 0.01 49 0.1 493 0.0224 0.0224 0.01 49 0.0075 0.0672 0.0597 0.0373 0.0299 0.01 49 0.01 49 0.0075 0.0224 0.0075 0.0672 0.0075 0.0075 0.0075 0.0224

* Haplotypic associations which have not been described in other populations.

been reported before. Some of these haplotypic associations had no significant p values, yet they were documented by segregation studies and/or by the presence of a single DRB3 allele in the tested subject.

In Romanians the most frequent DQAl* alleles are: DQA1*0501 (32.9%), *0102 (23%) and *0101 (19%). The most frequent DQB1 alleles are DQB1*0201 (23%), 0301 (21.6%) and 0501 (15.7%) (Table 2). The most probable DQAl-DQBl and

Table 7. Genetic and angular distance between Romanian and other populations

DRB 1 -DQA1 and DRB 1-DQB 1 haplotypes are listed in Table 5. In addition to already established associations (12,18-27), linkage disequilibria which have not been described before have been observed.

Analysis of three locus associations between DRB 1, DQA 1 and DQB 1 reveals extended haplotypes, 5 of which seem to be unique to the Romanian population (Table 6). All DRBI-DQA1, and DRB1- DQBI associations on which the Iisted haplotypes are based had significant positive delta values (p<0.05). Of note is the finding that the DRBl* 1602 allele, which is usually associated with DQAl*O50 1 and DQB 1 *030 1, corresponding to the serologic specificity DQw7 (22), is associated in Ro- manians with DQA1*0102 and DQB1*0502 which correspond to the serologic specificity DQwl .

Also, the DRB1*0405 allele, which in Orientals is associated with DQA I *030 1 and DQB 1 *040 1 (1 5, 18,27), is encountered in Romanians in association with DQA 1 *03 and DQB 1 *0302.

Analysis of HLA-DPB1 polymorphisms shows that DPBl*O401 is the most frequent allele in Rom- anians (39.8%), followed by DPBl*O201 (26.5%) (Table 2). Of interest is the frequency of DPB 1 *020 1, which is much higher than that reported in other European populations ( 12,28). DPA 1 * O 10 1 is more frequent (75.9%) than DPA1*0201 (24.1%) as seen also in other populations (12,28).

Since molecular studies on the genetic polymorphism of HLA have not been reported yet for most European populations, calculations of genetic distance have to rely on results obtained by conventional serology. Using gene frequencies of HLA-A, B, C, and DR antigens published in the VIIIth Inter- national Histocompatibility Workshop we have estimated the genetic distance between Romanians and other Europeans (Table 7). Orientals were also in- cluded in the table to emphasize the meaning of the estimated distances. Taking the average of the distance for each of the four loci (10) it appears that

Genetic distance Angular distance

HLA-A HLA-B HLA-C HLA-DR A+B+C+DR HLA-A HIA-B HLA-C HLA-OR

Italian 0.01 0 0.009 0.01 7 0.040 0.01 4 0.21 5 0.296 0.1 82 0.344 German 0.006 0.01 0 0.023 0.043 0.01 5 0.1 75 0.320 0.21 5 0.359 Yogoslavian 0.009 0.01 1 0.008 0.042 0.01 5 0.1 94 0.303 0.1 29 0.323 Austrian 0.007 10.01 3 0.049 0.01 0 0.01 6 0.176 0.327 0.31 4 0.155 Spanish 0.008 0.01 1 0.027 0.043 0.01 7 0.1 90 0.338 0.233 0.359 French 0.009 0.01 0 0.024 0.062 0.01 9 0.209 0.327 0.220 0.431 Scandinavian 0.01 0 0.01 6 0.040 0.046 0.021 0.21 4 0.407 0.282 0.373 British 0.01 2 0.01 6 0.047 0.060 0.025 0.240 0.401 0.306 0.426 Hungarian 0.01 6 0.028 0.053 0.034 0.029 0.265 0.474 0.327 0.293 Chinese 0.020 0.022 0.036 0.085 0.032 0.306 0.472 0.268 0.504 Japanese 0.050 0.028 0.066 0.106 0.049 0.485 0.538 0.363 0.564

12

HLA in Romanians

13. Baur MP, Danilovs JA. Population Analysis of HLA-A. B, C, DR and Other Genetic Markers. In: Terasaki PI, ed. Histocompatibility Testing 1980. Los Angeles: UCLA Tissue Typing Laboratory, 1980: 955-93.

14. Reinsmoen NL, Bach FH. Five clusters associated with HLA-DR4. Hum Immunol 1982: 4 249-58.

15. Gregersen PK, Goyert SM, Song QL, et al. Molecular diversity of HLA-DR4 haplotypes. Proc Narf Acud Sci

16. Sasazuki T, Koneoka H, Tsuji K, Kashiwagi N, Kaneko T. HLA-D in Japan. In: Terasaki PI, ed. Histocompatibility Testing 1980. Los Angeles: UCLA Tissue Typing Labora- tory, 1980 274-6.

17. Obata F, Ito I, Ito K, et al. Sequence analysis and HLA-DR genotyping of a novel HLA-DRw I4 allele. Immunogenetics

18. Horn GT, Bugawan TL, Long CM, Erlich HA. AIlelic sequence variation of the HLA-DQ lock Relationship to serology and to insulin-dependent diabetes mellitus susceptibility. Proc Natl Acud Sci USA 1988: 85: 6012-16.

19. Gyllensten VB, Erlich HA. Generation of single-standed DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus. Proc Natl Acud Sci USA 1988: 5: 7652-56.

20. Wu S, Lu D, Madden M, et al. Full-length DQB-DNA sequences of HLA-DR2/ DQw I subtypes: Genetic interac- tions between two DQB loci generate human class 11 HLA diversity. Hum Immunol 1990: 2 7 305-22.

21. Moraes ME, Fernandez-Vina M, Stastny P. DNA typing for Class I1 HLA antigens with allcle-specific or group specific amplification. IV. Typing for alleles of the HLA- DR2 group. Himi ltnmrinol 1991: 31: 1 3 9 4 .

22. Liu CP, Bach FH, Wu S. Molecular studies of a rare DRY LD-SdDQw3 HLA class I I haplotype. J I t w i i o i o l 1988:

33. Todd JA, Bell JI. McDevitt HO. HLA-DQB gene contrib- utes to susceptibility and resistance to insulin-dependent diabetes mellitus. Nutirrc. 1987: 329 599-604.

24. Tiercy JM, Jeannet M, Bach B. A new HLA-DRBI allele within the DRw52 supertypic specificity (DRwB-DwHAG): Sequencing and direct identitication by oligonucleotide typing. Eirr J Ininrunol 1990: 20: 237-41.

25. Petersdorf EW, Griffith RL. Erlich HA, et 31. Unique sequences for two HLA-DRBI genes expressed on distinct DRw6 haplotypes. Itnmmogenrtics 1990: 32: 96-103.

26. Lee KW, Johnson AH, Hurly CK. Two divergent routes of evolution gave rise to the DRwB haplotypes. J hpuiinvl

27. Guo X, Sun Y, Jabin AN, et al. DNA typing for HLA- DR, DQ, and -DP alleles in the Chinese population using the polymerase chain reaction (PCR) and oligonucleotide probes. Tissue Antigens 1991: 38: 24-30.

28. Ruberti G, Begorich AB, Steere AC, Klitz W, Erlich HA. Fathman GC. Molecular analysis of the role of the HLA- Class I1 genes DRB I , DQA I , DQBl and DPB I in susceptibility to Lyme arthritis. Hum Immirnol 1991: 31: 20-27.

USA 1986 83: 2642-6.

1990: 32: 313-20.

140: 363 1-39.

1990: 145: 31 19-25,

Address: Dr. Elltine Reed Department of Pathology College of Physicians and Surgeons of Columbia University 14-403, 630 West 168th Street New York, NY 10032 U.S.A.

Romanians are closest to Italians, an observation which supports the hypothesis of a Roman ancestry.

However, no definite conclusion can be drawn from such a limited sample because of possible heterogeneity between and within each population, and differences in technology. A better understand- ing is expected to emerge from computations based on the definition of HLA polymorphism by molecular typing.

Acknowledgments

This work has been supported by the following grants from the National Institutes of Health: RO1-A125210-03 and R01-HD22920-01A1.

References I .

7 -.

3.

4.

5 .

6.

7.

8.

9.

10.

I I .

12.

Such-Foca N, Susinno E, Godfrey M, et al. HLA-antigens in the Romanian population. Transpkmt Proc 1979: 11: 1732-4. Haraszti E. Origin of the Romanians (Vlach Origin, Mi- gration and Infiltration to Transylvania). Astor, Florida: Danubian Press Inc., 1977. Daicoviciu H. Highlights of Romanian History. Bucharest: Ofice of Information and Documentation in Social and Political Sciences, 1975. Stier HE. Kirsten E. Wuhr W. Westermann's Grosser Atlas Zur Weltgeschichte. Berlin. 1966. Reed E, Hardy M, Benvenisty A, et 31. Effect of antiidiotyp- ic antibodies to HLA on graft survival in renal allograft recipients. N Engl J Met/ 1957: 316: 1450-5. Reed E, Manus P. Suciu-Foca N. RFLP analysis of HLA- DR5 haplotypes. Tissirc, Antigens 199 I : 37: 66-73. Wood W, Gitschier J, Lasky LA, et al. Base composition- independent hybridization in tetramethylammonium chlor- ide: A method for oligonucleotide screening of highly com- plex gene libraries. A-oc Narl Actid Sci USA 19x5: 82:

Mattiuz PL, Ihde D, Piazza A. et al. New approaches to the population genetic and segregation analysis of the HLA system. In: Terasaki PI, ed. Histocompatibility Testing 1970. Copenhagen: Munksgaard, 1970: 193-206. Bodmer J, Bodmer WF. Studies on African Pygmies. IV: A cooperative study of the HLA polymorphism in the Babinga Pygmies and other African and Caucasian populations. A m J Hum Genet 1970: 22: 396-41 I. Cavalli-Sforza LL, Zonta LA, Nuzzo F, et al. Studies on African Pygmies. I. A pilot investigation of Babinga Pyg- mies in the Central African Republic (with an analysis of genetic distances). Am J Hum Genet 1969: 252-74. Pickbourne P, Piazza A, Bodmer W E Population Analysis. In: Bodmer WF, Batchelor JR, Bodmer TJ, Festenstein H. Morris PJ, eds. Histocompatibility Testing 1977. Copen- hagen: Munksgaard, 1978: 259-78. Ronningen KS, Spurkland A. Markussen G, et al. Distri- bution of HLA Class I1 alleles among Norwegian Caucasi- ans. Hum Immimol 1990: 29. 275-8 1.

1585-8.

13

Documents

Polymorphism of HLA in the Romanian population