Upload
dothuan
View
213
Download
0
Embed Size (px)
Citation preview
Poland - a country in central Europe
Molecular phylogeny of insects, mainly Orthoptera
Beata Grzywacz JSPS Postdoctoral Fellow
University of the Ryukyus, Okinawa 2016
Poland – general information
• Located in central Europe • Area: 312 685 km2
• Capital: Warsaw • Population: 38 495 659 (2014) • Official language: Polish • Currency: Polish Złoty PLN • Major religion: Christianity
Poland – general information
• Vistula (651mi; 1,047 kilometres long) and Oder (480 mi; 772 kilometres long) – the longest rivers • Lake Śniardwy and Lake Mamry in Masuria, Lake Łebsko and Lake Drawsko in Pomerania – the largest lakes • Polish Tatras – the highest mountain group of Poland • Beskids - the second highest mountain group in Poland • Bieszczady mountains
Poland - Phylogeography
Wisent in the ancient woodland of the Białowieża Forest and in Podlaskie Brown bear in Białowieża, in the Tatras, and in the Beskids The gray wolf and the Eurasian lynx in various forests The moose in northern Poland The beaver in Masuria, Pomerania and Podlaskie Red deer, roe deer and wild boars Migratory birds
Famous Polish People
Lech Wałęsa president, activist (1943 -)
Fryderyk Chopin pianist, composer (1810-1849)
Marie Skłodowska-Curie physicist (1867-1934)
Nicolaus Copernicus astronomer, scientist, mathematician (1473-1543)
John Paul II pope (1920-2005)
Polish inventions
Hand-held mine detector Cloth armor Colorful photo Mine detector Helicopter Car wiper Grafen Kerosene lamp Melex Walkie-talkie
Polish Nobel Prize Lauerates 1903 Maria Skłodowska-Curie - Physics 1905 Henryk Sienkiewicz - Literature 1911 Maria Skłodowska-Curie - Chemistry 1924 Władysław Reymont - Literature 1980 Czesław Miłosz - Literature 1983 Lech Wałęsa - Peace 1996 Wisława Szymborska - Literature
Polish Architecture
Great Armory building in Gdańsk
The Palace of Culture and Science in Warsaw
Wawel Royal Castle and Catedral in Krakow
The Manggha Centre of Japanese Art and Technology in Krakow
Centennial Hall in Wrocław Wieliczka Royal Salt Mine
The Polish national dishes
Sausage Broth (variety of meat broth)
Bigos
Dumplings Tomato soup
Gołąbki (type of cabbage roll)
Pork chop (type of breaded cutlet) Żurek (sour rye soup) Cucumber soup
Polish products
Oscypek
Krosno Stylish glass
Prince Polo
White cheese Marshmallow
Fudges
Bagels
My Institute
Name: Institute of Systematics and Evolution of Animals Polish Academy of Sciences, Krakow Funded: 1989 Department: Experimental Zoology
Why I choose to be a scientist?
I really enjoyed science at school. I am interested in the world we live in. The opportunity to discover something new is also really exciting. I’d definitely recommend it.
Studies insects
?
Orthoptera • Grasshoppers, locusts, crickets,
katydids
• Long bodies
• Rear legs modified for jumping
• Females with egg laying tube (ovipositor on end of abdomen)
• Often communicate with chirping sounds
Orthoptera
Introduction ?
B. constrictus, fot. P. Schlemmer
M. ornatus, fot. V. Hanzlík
Lepthophyes sp., fot Oldbilluk
• insufficient knowledge on the taxonomically important characters • uninformative descriptions based on subtle differences • overstating the isolation significance • working into national borders
Methodological problems arise
• morphologic simplicity in genitalia, tegminal venation and cercus shape • often high number of sibling taxa with restricted ranges • recent origin
Peculiarities of the group
Theoretical problems arise
• taxa with doubtful status described • unclear phylogenetic relationships between the taxa
Why is phylogeny important?
Understanding and classifying the diversity of life on Earth. Testing evolutionary hypotheses: - trait evolution - coevolution - mode and pattern of speciation - correlated trait evolution - biogeography - geographic origins - age of different taxa - nature of molecular evolution - disease epidemiology …and many more applications!
Molecular methods
1. Extract 2. Sequence (e.g. 18S and internal transcribed spacer 2 -
ITS2)
AAGCTTCATAGGAGCAACCATTCTAATAATAAGCCTCATAAAGCC
AAGCTTCACCGGCGCAGTTATCCTCATAATATGCCTCATAATGCC 3. Align
DNA
What is DNA? DNA (dexyribonucleic acid) contains the biological instructions that make each species unique.
What is DNA made? DNA is made of three parts: a phosphate group, a sugar group and one of four types of nitrogen bases).
What does DNA do? DNA contains instructions needed for an organism to develop, survive and reproduce.
How to extract DNA from animal tissue in laboratory?
PCR and sequencing
Molecular data vs Morphology
Strictly heritable entities Can be influenced by environmental factors
Data is unambiguous Ambiguous modifiers: “reduced”, “slightly elongated”, “somewhat flattened”
Regular & predictable evolution Unpredictable evolution
Ease of homology assesment Homology difficult to assess
Relationship of distantly related Only close relationships
organisms can be inffered can be confidently inffered
Why such studies are important?
preparing key to help recognize insects and distribution maps taxa have been synonimized
a revision of the orthoptran taxonomy
new taxa have been investigated
Let’s do the experiment!
Place one starwberry in a plastic zipper-lock bag
Add of DNA extracting solution
Place a piece of gauze over the opening. Of the cup, securing with a rubber band. Carefully pour the starwberry mixture into the cup.
Add a dropper full of the alcohol to the test tube. Do not mix the liquids.
Strawberry DNA extraction
DNA
Appreciation
to JSPS for giving me this great opportunity to my supervisor, Haruki Tatsuta for his continued assistance, cooperation and support to the Science Dialogue Coordinator for making all necessary arrangement to make this day reality
to my wonderful audience – The Students!
Arigato gozaimasu!!!