Phylogeny of 54 Representative Strains of Species in the Family Pasteurellaceae as Determined

Vol. 174, No. 6JOURNAL OF BACTERIOLOGY, Mar. 1992, p. 2002-20130021-9193/92/062002-12$02.00/0Copyright X) 1992, American Society for Microbiology

Phylogeny of 54 Representative Strains of Species in the FamilyPasteurellaceae as Determined by Comparison

of 16S rRNA SequencesFLOYD E. DEWHIRST,1* BRUCE J. PASTER,2 INGAR OLSEN,3 AND GAYLE J. FRASER1

Departments ofPhannacology1 and Microbiology,2 Forsyth Dental Center, Boston, Massachusetts 02115,and Department ofMicrobiology, Dental Faculty, University of Oslo, Oslo, Norway3

Received 3 September 1991/Accepted 14 January 1992

Virtually complete 16S rRNA sequences were determined for 54 representative strains of species in the familyPasteureUlaceae. Of these strains, 15 were Pasteurella, 16 were ActinobaciUlus, and 23 were Haemophilus. Aphylogenetic tree was constructed based on sequence similarity, using the Neighbor-Joining method.Fifty-three of the strains fell within four large clusters. The first cluster included the type strains ofHaemophilus influenzae, H. aegyptius, H. aphrophilus, H. haemolyticus, H. paraphrophilus, H. segnis, andActinobacilus actinomycetemcomitans. This cluster also contained A. actinomycetemcomitans FDC Y4, ATCC29522, ATCC 29523, and ATCC 29524 and H. aphrophilus NCTC 7901. The second cluster included the typestrains ofA. seminis and PasteureMa aerogenes and H. somnus OVCG 43826. The third cluster was composedof the type strains ofPasteureUla multocida, P. anatis, P. avium, P. canis, P. dagmatis, P. galinarum, P. langaa,P. stomatis, P. volantium, H. haemoglobinophilus, H. parasuis, H. paracuniculus, H. paragaUlinarum, and A.capsulatus. This cluster also contained PasteureUla species A CCUG 18782, Pasteurella species B CCUG 19974,Haemophilus taxon C CAPM 5111, H. parasuis type 5 Nagasaki, P. volantium (H. parainfluenzae) NCTC 4101,and P. trehalosi NCTC 10624. The fourth cluster included the type strains of Actinobacillus lignieresii, A.equuli, A. pleuropneumoniae, A. suis, A. ureae, H. parahaemolyticus, H. parainfluenzae, H. paraphrohaemolyti-cus, H. ducreyi, and P. haemolytica. This cluster also contained Actinobacilus species strain CCUG 19799(Bisgaard taxon 11), A. suis ATCC 15557, H. ducreyi ATCC 27722 and HD 35000, Haemophilus minor groupstrain 202, and H. parainfluenzae ATCC 29242. The type strain of P. pneumotropica branched alone to forma fifth group. The branching of the PasteureUlaceae family tree was quite complex. The four major clusterscontained multiple subclusters. The clusters contained both rapidly and slowly evolving strains (indicated bydiffering numbers of base changes incorporated into the 16S rRNA sequence relative to outgroup organisms).While the results presented a clear picture of the phylogenetic relationships, the complexity of the branchingwill make division of the family into genera a difficult and somewhat subjective task. We do not suggest anytaxonomic changes at this time.

The family Pasteurellaceae Pohl 1981 (51) is currentlycomposed of species in the genera Pasteurella Trevisan 1887(63), Actinobacillus Brumpt 1910 (14), and HaemophilusWinslow et al. 1917 (65). While only 27 species wererecognized within this family in Bergey's Manual ofSystem-atic Bacteriology (17, 30, 35, 46), over 70 species or taxafrom human, mammalian, avian, and reptilian sources havebeen described (4-11, 38, 41, 47, 48). Essentially all thesetaxa are listed and discussed in a review by Mutters et al.(40). Their review is particularly important in that it desig-nates reference strains for each of the described, but notformally recognized, taxa. Overviews of research on thefamily Pasteurellaceae can be found in the proceedings ofconferences held in Copenhagen in 1980 (31) and Guelph in1989 (45) and in the monograph "Pasteurella and Pasteurel-losis" (1).The taxonomy of the family Pasteurellaceae as a whole

and of its component genera has been examined by severalmethodologies. Major studies based on phenotypic traitsinclude those on Haemophilus by Kilian (29) and Broom andSneath (12) and onActinobacillus and Pasteurella by Sneathand Stevens (59). The studies by Sneath suggested anoverlapping interrelationship between Pasteurella and Acti-

* Corresponding author.

nobacillus. Major advances in understanding the phylogenyof the members of the family Pasteurellaceae have comefrom the DNA-DNA hybridization studies by the Marburggroup as exemplified by the work of Pohl, Mannheim,Mutters, and colleagues (34, 39, 50, 51) and from rRNA-DNA hybridization studies by De Ley et al. (21). Thesestudies have defined species belonging to sensu strictodefinitions of the genera Pasteurella (39), Haemophilus (15),and Actinobacillus (24, 51). These studies have shown thatthe phylogenetic structure of the Pasteurellaceae is complexand that more than three genera are required to accommo-date the vast array of species in this group. However, manyspecies have not fallen into defined clusters, and the branch-ing of genus-level clusters remains unclear. To further clarifythe phylogeny of this complex family, we decided to under-take an exhaustive study involving full 16S rRNA sequenc-ing of strains representing the more than 70 describedspecies or taxa. Comparison of 16S rRNA sequences hasproved extremely useful for determining phylogenetic rela-tionships among eukaryotic and prokaryotic organisms (66,67). Unlike hybridization studies, it is feasible to use com-plete distance matrices where the similarity of every se-quence to every other sequence is determined (4,900 com-parisons for 70 organisms). Treeing algorithms that correctlyaccount for differing branch lengths are then applied to thedistance matrix data to produce phylogenetic trees. The

2002

on April 13, 2019 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

PHYLOGENY OF STRAINS OF THE PASTEURELLACEAE FAMILY 2003

present report describes our interim findings for studiesperformed during the past 3 years in which we obtained full16S rRNA sequence data for over 50 strains. Within the nextyear, we hope to obtain 20 to 30 additional sequences forstrains representing the remaining described species or taxawithin the family Pasteurellaceae.

MATERLALS AND METHODS

Bacterial strains, sources, and sequence accession numbers.The strains sequenced in this study, and reference strainsused for comparison in constructing phylogenetic trees, aredescribed in Table 1. Included in this table are the strainnumbers, the source of the strains, the GenBank accessionnumber for the 16S rRNA sequences, and the literaturesources for reference sequences. In Table 1, and throughoutthis report, square brackets are used to indicate that aspecies does not belong to the sensu stricto definition of itsgiven genus (brackets around genus) or that the organism ismisnamed (brackets around whole name). Our use of squarebrackets differs from that of De Ley et al. (21). Throughoutthe text, names refer to type strains unless a strain number isgiven.

Bacterial culture conditions. Strains of Actinobacillus andPasteurella were cultured aerobically at 37°C for 24 h inbrain heart infusion broth (Difco). Haemophilus strains werecultured in brain heart infusion broth supplemented with Xand V factors. H. paragallinarum was grown on GC agar(BBL) at 37°C anaerobically for 24 h. H. paraphrohaemolyti-cus was grown on GC agar at 37°C aerobically for 24 h.Haemophilus taxon C, Haemophilus minor group strain 202,and H. parasuis Nagasaki were cultured aerobically for 6 to7 days in PPLO broth (Difco) supplemented with 10% yeastextract (Difco), 5% rabbit serum (Biologos), 0.1% dextrose,and 0.025% NAD (Sigma).

Isolation and purification of rRNA. RNA was isolated andpartially purified by a modification of the procedure of Paceet al. (43) as previously described (44).

16S rRNA sequencing. rRNA was sequenced by a modifiedSanger dideoxy-chain termination technique in which prim-ers complementary to conserved regions were elongatedwith avian myeloblastosis virus reverse transcriptase (33).The primers used in this study are given in Table 2. For moststrains, primers 2 or 3 and 4 to 9 were used. Some strainsrequired the use of primer 1 to complete the sequence of the5'-terminal 100 bases. The details of our sequencing protocolhave been described previously (22, 44).Data analysis. A program set for data entry, editing,

sequence alignment, secondary structure comparison, simi-larity matrix generation, and dendrogram construction for16S rRNA data was written in Microsoft QuickBASIC foruse on IBM PC-AT and compatible computers. RNA se-quences were entered and aligned as previously described(44). Our sequence data base contains approximately 300sequences comprising those determined in our laboratory,published sequences, and unpublished sequences providedto us by other scientists. Similarity matrices were con-structed from the aligned sequences by using only thosesequence positions for which all strains had data. Thesimilarity matrices were corrected for multiple base changesby the method of Jukes and Cantor (28). Phylogenetic treeswere constructed by the Neighbor-Joining method (58, 61).The reproducibility of tree nodes was analyzed by using theNeighbor-Joining bootstrapping programs PSFIND andNJBOOT written by T. S. Whittam. One hundred bootstraptrees were generated and examined. The reproducibility of

tree nodes was also examined by generating 15 trees using 14different beta and gamma Proteobacteria species as out-groups, or no outgroup. The species used as outgroups areindicated in Table 1.

RESULTS AND DISCUSSION

16S rRNA sequences. Virtually complete 16S rRNA se-quences, except for 50 bases at the 3' end, were determinedfor 52 of the 54 strains. Within the sequenced region, 98% ofthe bases, about 1,450 bases, were unambiguously deter-mined. For two strains, partial sequences were obtained.ForA. suis CCM 5586T, 1,155 bases were determined. Therewas a single base difference, G for A at position 257,compared with A. suis ATCC 15557. For [H.] haemoglobin-ophilus NCTC 8540, 335 bases were determined. There wasa single base difference, U for C at position 176, comparedwith [H.] haemoglobinophilus NCTC 1659T. The sequencesof 14 representative species, aligned with and numberedrelative to Escherichia coli (13), are shown in Fig. 1. Thesequences for the 52 fully sequenced strains are available forelectronic retrieval from GenBank under the accession num-bers listed in Table 1.

Comparisons with previously published Pasteurella se-quences. Chuba et al. (19) published short partial 16S rRNAsequences (445 bases) for seven members of the familyPasteurellaceae. We found the following number of discrep-ancies between sequences for the organisms examined inboth studies: A. actinomycetemcomitans, 4; A. equuli, 5; A.lignieresii, 6; H. aphrophilus, 6; H. influenzae, 8; and P.multocida, 20. We believe that our sequences are accuratebased on having rechecked our sequencing gels at thediscrepant positions, compared conservation of secondarystructure, and examined consistency with the 54 Pasteurel-laceae sequences in our data base. Each of the Chuba et al.(19) sequences contains four errors in a region conserved inall members of the Pasteurellaceae (406 to 436): a gap versusG at 419, and gaps versus GUA at 428 to 430. While thisreport was in preparation, the sequence for H. ducreyi CIP542' was determined by polymerase chain reaction amplifi-cation of the 16S rRNA gene (56). There are eight discrep-ancies between this sequence and ours as follows: A versusG at 81, gap versus G at 82, G versus A at 539, A versus Cat 629, G versus A at 747, gap versus U at 751, A versus Gat 1137, and gap versus G at 1144. Reexamination of oursequencing gels for three strains of [H.] ducreyi substanti-ates our sequence (GenBank M75078, M75079, and M75084)at all positions except 629.

Sequence signatures and DNA probes. Single-base signa-tures for the family Pasteurellaceae are presented in Table 3.Signatures are positions within the sequence where the basepresent differs from that found in other bacteria. Included inTable 3 are the position number, the base found in allPasteurellaceae strains, the base(s) found in other taxa, anda list of exceptions: those taxa which share the Pasteurel-laceae signature. The large number of signatures makesdesign of DNA probes specific for the family Pasteurel-laceae relatively easy. Sequencing primer 2 was designed asa Pasteurellaceae-specific DNA probe. It recognizes allPasteurellaceae strains except those of [A.] actinomycetem-comitans and P. anatis, which have single-base mismatches.Validation of this probe will be reported elsewhere.

Position of the PasteureUlaceae within the Proteobacteria. Toplace the Pasteurellaceae within the class Proteobacteria,we calculated a similarity matrix for 6 representative Pas-teurellaceae species and 17 reference beta and gamma

VOL. 174, 1992


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

2004 DEWHIRST ET AL.

TABLE 1. Sources and accession numbers of strains studied

Organisma Strainb Source' GenBankd Referencee

Actinobacilli[A.] actinomycetemcomitans[A.] actinomycetemcomitans[A.] actinomycetemcomitans[A.] actinomycetemcomitans[A.] actinomycetemcomitans[A. capsulatus][A. capsulatus]A. equuliA. lignieresiiA. lignieresiiA. pleuropneumoniae (H. pleuropneumoniae)[A. ] seminisA. suis (H. suis)A. suis (H. suis)A. ureae (P. ureae)Actinobacillus species (A. capsulatus)

Bisgaard taxon 11HaemophiliH. aegyptiusH. aphrophilusH. aphrophilus (H. parainfluenzae)[H.] ducreyi[H.] ducreyi[H.] ducreyi[H.] haemoglobinophilus[H.] haemoglobinophilusH. haemolyticusH. influenzae[H.] paracuniculus[H.] paragallinarum[H.] parahaemolyticus[H.] parainfluenzae[H.] parainfluenzae (H. paraphrophilus)[H.] paraphrohaemolyticusH. paraphrophilus[H.] parasuis[H.] parasuis type 5H. segnis[H.] somnus[Haemophilus] minor group[Haemophilus] taxon C

Pasteurellae[P.] aerogenesP. anatisP. avium (H. avium)P. canisP. dagmatisP. gallinarum[P.] haemolyticaP. trehalosi (P. haemolytica biotype T)P. langaaP. multocida[P.] pneumotropicaP. stomatisP. volantium (H. parainfluenzae)P. volantiumPasteurella species APasteurella species B

Reference strainsGamma proteobacteriaEscherichia coligCitrobacterffreundiigSerratia marcescensgProteus vulgarisgVibrio parahaemolyticusgAeromonas hydrophilagRuminobacter amylophilusg

FDC Y4ATCC 29522ATCC 29524ATCC 29523ATCC 33384TNCTC 11408TCCUG 12396TNCTC 8529TATCC 19393NCTC 4189TATCC 27088TATCC 15768TATCC 15557CCM 5586THenriksen 3520/59TCCUG 19799

NCTC 8502TATCC 33389TATCC 7901ATCC 27722HD 35000CIP 542TNCTC 1659TNCTC 8540NCTC 10659TATCC 33391TATCC 29986TNCTC 11296TNCTC 8479TATCC 33392rATCC 29242NCTC 10670TATCC 29241TNCTC 4557TNagasakiATCC 33393TOVCG 43826202CAPM 5111

ATCC 27883TATCC 43329TNCTC 11297TATCC 43326TATCC 43325TNCTC 11188TNCTC 9380TNCTC 10624ATCC 43328TNCTC 10322TNCTC 8141TATCC 43327rNCTC 4101NCTC 3438TCCUG 18782CCUG 19794

rrB cistronATCC 29935ATCC 13880TMonteilATCC 17802TATCC 7966TDSM 1361T

FDCATCCATCCATCCATCCNCTCCCUGNCTCATCCNCTCATCCATCCATCCCCMKWBICCUG

NCTCATCCATCCAlbritton (KC57)Albritton (KC61)Albritton (KC1)NCTCNCTCNCTCATCCATCCNCTCNCTCATCCATCCNCTCATCCNCTCRapp-GabrielsonATCCLittleRapp-GabrielsonRapp-Gabrielson

ATCCATCCNCTCATCCATCCNCTCNCTCNCTCATCCNCTCNCTCATCCNCTCNCTCCCUGCCUG

Continued on followingpage

M75035fM75036M75037M75038M75039M75062M75069M75072M35017M75068fM75074M75047fM75071f

M75075M75067

M75044M75041fM75040M75084M75079M75078fM75054

M75045M35019fM75061fM75057M75073M75081fM75082M75076M75042M75065fM75066M75043M75046M75077M75056

M75048M75054M75058fM75049M75051M75059M75080M75063M75053M35018fM75083fM75050M75060M75070M75055fM75052

J01695fM59291M59160J01874M59161M59148NA

13AA16AA36

J. BACTIERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


TABLE 1-Continued

Organisma Strainb Sourcec GenBankd Referencee

Oceanospirillum linuig ATCC 11336T M22365 APseudomonas aeruginosag ATCC 25330 M34133 AAcinetobacter calcoaceticusg ATCC 33604 M34139 ACardiobacterium hominig ATCC 15826T M35014 23Suttonella indologenes ATCC 25869T M35015 23Dichelobacter nodosus 198AR M35016 23

Beta proteobacteriaNeisseria gonorrhoeaeg NCTC 8375T X07714 57Eikenella corrodensg ATCC 23834T M22512 22Alcaligenes faecalisg ATCC 8750T M22508 22[Pseudomonas] cepacia ATCC 25416T M22518 22

a Organisms are listed according to current nomenclature. Square brackets are used to indicate that an organism does not belong in the genus or speciesindicated. Name of strain in culture collection or previous name is given in parentheses.

b Abbreviations used for culture collections: ATCC, American Type Culture Collection, Rockville, Md.; CCUG, Culture Collection, University of Goteborg,Goteborg, Sweden; DSM, Deutsche Sammlung von Mikroorganismen, Braunschweig, Germany; KWBI, Kaptein W. Wilhelmsen og frues BaktgeriologiskeInstitutt, University of Oslo, Rikshostpitalet, Oslo, Norway; NCTC, National Collection of Type Cultures, Central Public Health Laboratory, London, UnitedKingdom; OVCG, Ontario Veterinary College, Guelph, Ontario, Canada.

c Strains were obtained directly from the indicated culture collection (abbreviated as above) or from the following individuals: P. B. Little, Department ofPathology, Ontario Veterinary College, University of Guelph, Guelph, Ontario, Canada; V. J. Rapp-Gabrielson, Department of Microbiology, North Dakota StateUniversity, Fargo; or W. L. Albritton, Provincial Laboratory of Public Health for Northem Alberta, University of Alberta, Edmonton, Alberta, Canada.

d 16S rRNA sequences for these strains are available for electronic retrieval from GenBank under the following accession numbers. Through cross distributionof data bases, these sequences should also be available from European and Japanese data bases. NA, not available.

I Literature references to sequences not obtained in this report. A, unpublished sequences deposited in GenBank by C. Woese.f Indicates that sequence is included in Fig. 1.g Indicates species used in outgroup analysis.

Proteobacteria. This matrix is available upon request fromthe corresponding author. Shown in Fig. 2 is a phylogenetictree derived from the similarity data by using the Neighbor-Joining method. The family Pasteurellaceae is located in thegamma division of the Proteobacteria. Families closelyrelated to the Pasteurellaceae are the Enterobacteriaceae,Vibionaceae, and Aeromonadaceae. More distant relativeswithin the gamma division include the Pseudomonas fluo-rescens complex, the Moraxellaceae, and the Cardiobacte-raceae. The branching order of the Enterobactenaceae,Vibrionaceae, Pasteurellaceae, andAeromonadaceae shownin Fig. 2 differs slightly from that reported previously (20,21). The differences may be due to our use of a treeingalgorithm that accommodates differing branch lengths. Ad-ditional sequence data for species in the families Vbrion-aceae and Aeromonadaceae should further clarify the exactbranching in this part of the gamma division of Proteobac-tena.

Phylogeny of the PasteureUlaceae. A similarity matrix wasdetermined for E. coli and 48 representative strains. Wheremultiple strains had identical sequences, only one repre-

TABLE 2. Sequencing primersaNo. Position Sequence Specificity

1 109-123 5'-GCATTACTCACCCGT-3' P, M2 233-256 5'-ACCAACTACCTAATCCCACTTGGG-3' P3 344-358 5'-ACTGCTGCCTCCCGT-3' E4 519-536 5'-GWATTACCGCGGCKGCTG-3' U5 786-803 5'-CTACCAGGGTATCTAATC-3' E6 907-926 5'-CCGTCAATTCMTTTRAGTTT-3' U7 1096-1113 5'-GGTTGCGCTCGTTGCGGG-3' E8 1392-1406 5'-ACGGGOGGTGTGTRC-3' U9 1493-1513 5'-TACGGYTACCTTGTTACGACT-3' E

a The sequences are complementary to 16S rRNA at the positions listed (E.coli numbering). Base codes are standard IUB codes for bases and ambiguity.Specificity: P, Pasteurellaceae; M, miscellaneous genera; E, most eubacteria;U, universal.

sentative strain was used in the analysis. A 49-by-49 distancematrix was computed. This matrix is available upon requestfrom the corresponding author. Only those positions wheredata were present for all sequences were included in thesimilarity comparison (1,246 bases). Within this regionamong the Pasteurellaceae sequences, there were 1,043conserved and 203 variable base positions. Strains within thePasteurellaceae differ among themselves on average about6%. Species in the Pasteurellaceae have an average differ-ence of about 12% with species in the neighboring familyEnterobacteniaceae. A dendrogram illustrating the phylog-eny of the Pasteurellaceae is shown in Fig. 3. The majorityof the strains sequenced fall into four major clusters. Threeof these clusters contain as subsets the sensu stricto generaHaemophilus, Pasteurella, and Actinobacillus (21). Whilethis work is in general agreement with previous DNA-DNAand RNA-DNA studies, there are some discrepancies whichare discussed below.

(i) Cluster 1, including the genus Haenwphilus sensu stricto.Cluster 1 is composed of three subclusters. Cluster 1Cincludes H. influenzae, H. aegyptius, and H. haemolyticus.This cluster represents the genus Haemophilus sensu stricto(15). We have not sequenced "H. internedius" strainswhich are included in this cluster by Burbach (15). Cluster1B includes H. aphrophilus, H. paraphrophilus, H. segnis,and H. aphrophilus ATCC 7901. De Ley et al. (21) excludethis cluster from the genus Haemophilus. Cluster IA iscomposed of strains of [A.] actinomycetemcomitans. Pottsand coworkers (53, 54) and Tanner et al. (62) previouslysuggested that this species be transferred to the genusHaemophilus based on DNA-DNA homology studies. Thissuggestion was rejected because while these studies demon-strated a relationship between [A.] actinomycetemcomitansand H. aphrophilus, they did not demonstrate a convincingrelationship between [A.] actinomycetemcomitans and H.influenzae, the type species of the genus (26). The currentresults clearly show that [A.] actinomycetemcomitans isrelated to Haemophilus clusters 1B and 1C. However,

VOL. 174, 1992


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

10 20 30 40 50 60 70 80 90 100 110

130 140 150 160 170 180 190 200 210 220 230 240

250 260 270 280 290 300 310 320 330 340 350 360

GGAAAUGCGCAAUGGGGGCAACCa UGACGCAGCCAUGCCGCGUGAAGAGA GGCCUUCGGGUGAA--------GAUG CCACAUGGAUWGCGCAAUGGGGGCAACCCUaGCGCAGCCAUGCCGCGtJAL GUGUGZGGGCWGCCGUGCGGAA^GC AACWAAA1lGGAAUALGCGCGAUG CGGAG CAUGCCG UGC CLLGCC^GCCU^tUGCCC

GGUUGCGCnÛGGGGGGAACCCUJGACGCAGCCAUJGCCGC GGCCWCGGGWGLY UGGGWAUGAGt)GAGGUUSMXAAWGGAUWGCGCAAUGGGGGGACIGACGACCAUGCCGCGUGAAUGAAAAGC ZG-G- AlOAUA GILAGCUAW AUGGAAUAWGCGC&AUGGGGGGAACCCLUGACGCAGCCAUGCCGCGUGAAUUGAAGAGGCCUUCGGGCLtAAtClCGGJC GWGgA GCUCUdUaAWJIGGAAUAWGCGCAUWGGGGGGAACCCU GACGCAGCCAUGCCGCAA1GA-GAGGCZRGGCCWCGAXqJCC G G AiCGCAÛACALXMA

GGUWCaCAAUGGGGGGAACCCUgAUGCAGCCAUGCCGCGLJALGAAGCUCGWUACWCULAGGUGAGGAAUGGCGWGGAiGCGC AGCRCAAUGGGGGGAACCCUGAUGCAGCCAUGCCGCGUGAAUAAGAAGCCUUGUUCG_GGAAGUCLAGUGAnA Gi0I A Al-CGACAUACAWUGGAAUAWGCntnAUtGGGGGACCGAUCGCCWAUGCGC APGCCAGMGCC)CGGaGUUAA 1-WCGGWUtC--AA UI CAGA- IG WAGGAAUAUGCACAAÛGGGGGGAACC CUgAUGCAGCCAUGCCCGUGAAUAAGGCCUUCGGGGGUAAAUUCUUCGGLIAGCGAGAGIA1^-GAL G GUAAtGGAAUAUGCGCnAUGGGGGCAACCCUGACGCAGCCAUGCCGCGUAUAAGAAGGCCWCGGGWGIAGUGCWJCLGGUnGCGA ZUWA AipASA -AGUAGGAAUAUGCaCaAUGGGGGAACCCUGAUGCAGCtGCCGCtGAUGAAGAAGUGCCAJGGGCACGUAGGGGUAWbtUGGLGCglGUCGGAAUJAGCGCaAUGGGGGGAACCCUGACGCAGCCAJGCCGCGUGAAUGAAGAAGGCCLLCGUUCGWUAAA GIAGGUAJGA CCIGIZACCAAGGAAUAWGCACAAUGGGCGCAAGCCUGAUGCAGCCAUJGCCGCGIGAUGAAUGAAGGCCtUUCGGGUWAAUUACUGCGGGGAGGAAGGGAG CCULAGCtJCAUU

370 380 390 400 410 420 430 440 450 460 470 480

IGAGGA

AacHapHinAsePsAPavPuHpcHpsAsuAliHpiHduPneEco

AacHapHinAsePMAPavPMHpcHpsAsuAliHpiHduPneEco

AacHapHinAsePMAPavPuHpcHpsAsuAliHpiHduPneEco

AacHapMinAsePsAPavPUNpc

HpsAsuAliHpiHduPneEco

490 500 510 520 530 540 550 560 570 580 590 600

FIG. 1. Aligned sequences of members of the family Pasteurellaceae. The numbering system is that of E. coli (13). The sequences are

reported by using the IUB single-letter code for nucleotide bases and ambiguities. Lowercase letters indicate some uncertainty in baseidentity. Dashes indicate gaps inserted for alignment of sequences, and dots indicate regions that were not sequenced.

2006

Aac .AAHap .A.ANi nAAAse .aAlPsA .A.APav . .A(Pmu . .AtHpc ..AtHps .AAIAsu ..AAli ..AlHpi . . .IHdu ..AtPne .AAEco AAAI

MM acaUnA HapGUAA inGUAA AseGUAA PsAGUAA PavGUAA PauGUaA HpcGUAA HpsGUAn AsuGUAA AliGtJaA HpiGUAA Hdu,GUAA PneGUAA Eco120

AacHapHinAsePsAPavPmuHpcHpsAsuAliHpiHduPneEco

AacHapHinAsePsAPavPm,uHpcHpsAsuAliHpiHduPneEco

AacHapHinAsePsAPavPmuHpcHpsAsuAliHpiHduPneEco

AacHapMinAsePSAPavPMUHpcHpsAsuAliHpiHduPneEco

Go


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

VOL. 174, 1992 PHYLOGENY OF STRAINS OF THE PASTEURELLACEAE FAMILY 2007

Aac GJGGAACCGGUACGGnWCLCUCGGGtCGAtAAJAGAGrAAAACAGJAGGtGAUCtAAAGGAGAACAacHap G)GGAACCGGUACGGn GCUJCGCJGGJCaAtAAAAGAGrA"AIACAGGJACGGAAGUAAAGGAGAACHapHi n GJGGAGCCGCAACGGr GCUJCGCGGACAGAUAAGAGGAALCCCUUGGJGAUCUGGUtGAGAACHi nAsAsJe GAUCCGGUAC AGsUGAAUAAeGGGICAAUuUUGGGGUrAINCAGJAACGJGAUCLAAAGLG&GAICsPsA GAGJAACCGGWALJGALJCUUAAtgUAUGGAUUGGGGUGAUCCUUGGUAAGGaAAGGAGAACPsAPay AGGAGCCACAACXGGAAGAWAAIGGXAUGGALAAGAGr)GACAGGACGGAUCUGGUUGGAUC PavPuuGUUAACCGGUACjGACGALJCGCJGAUUGGnUUgGGGUGAUCAGGACGGAUCUGGUtGAGAIC PnuHpc GUJGAGCCGCJACLGGAGAAUAAGGAUUGGJUAJAGAGrAGAACAGGACGGAUCUGGUJGAGAACHpcHps GU)AACCGGAJALLGGAGA CAAGGAJCAAtALJGGGGrAAACCCUUGGJGAUCUGGUtGAGAACHpsAsu GAGGAGCCGCUACJGnUGALJAAUGJACAAUCPUGGGGiAAWCCUtACGGAUCUGGUtGAGAACAsuALiAGl AACCGGUnCUGaLtGAA)AAUGJACAAU GAGgAAUCAGGACQGAUCUGGUUGGAUC AtiHpi GUUAACCGGUACtGGAIGAUCUCGGCCAAUCUAGAGrJGACAGGAGGUAAGGAAAGGAGUACHpiHdu HAGJAACCGGWACGGAUCLACUCGICAUGGAMGGGGIAAUCAGJUGGtGAUCLaAAGJGGAUC duPne GLGGAACCGGUaCLGGAGAUCGCGGACaGGataGAGnAAUCAGGACGGAUCUGGULGAGAACPneEco GAGJAACCGGUACLGGAtGACJAAUGAGLJALCCtAAGGGAAL)CG)tACGJAAGGAAACGAGAACEco

610 620 630 640 650 660 670 680 690 700 710 720

Aac GAGGAGACCAGGGUUCGCCGUUCAACUGGGAAAGLAGUCUGUGCCCCJAACGGCAAUGGAGGtJAacHap GAGCAGCGCCAGGAGJCGCCCUUCAACUGGGAAAGLJGUCCGUG)CCCGAAGtGCAWGGWUCJHapH in HAGCAGCGCCAGGAGJCJAGtCULGGAGGGGACAAAGUAAICCJGALCAGUUACCGJGUUGGUGGtinAse GAGCAGCGCCGGAAAtGCCJAGGGAGGGGACACGAUGLCCJGALCAGIGAAGULC-A GGUGGUAsePsA GAGCAGCGCCUGGGUCJAGtCULGGAGGJGGGaAA CUGIGCAGL CGC-lUGGAAGGUPsAPay AGCAGCGCCIJGGGUCJAGLCtGGGAGGGGACACGAXaAACUGAUCCCGAAGUUGLAGGAUGC PayPmu GAGGAGACCUGGAGACGCCCUIGrAACLGGACAAGALAACCGGAUCCCGAAGGUrANGGAGGC PMuHpc AGCAGCGCCUGGAAA HCCtCUpGGAGGcGGACACGAAAALACLGLALCAGCJL&AGULCALAGGAUCGipHps HAGCAGCGCCUGAAUCJAGUAGJCAACtGGACAAAGUAAACUGALCAGtGAAGUUGUr4GLJGCpsAsu GAGGAGACC GGAUUCGAGUAGGnAGGGGGGAAAGLJAAACtGUGCAGtGAAGJGJG WGGAGAUAsuAllGAGGAGACCLJGAULALGCCCAGJCAACLGGACACGAAaAACUGUGJCCCJUACCJ)GLJGGA GAt AllHpi GAGGAGACCWGAUJAJGCCJAAGCAACUGGGAAAGLAGUCCGtAJCCGGUACAGCAAJGGUGr HpiHdu GAGCAGCGCCUGAUUCJAGLCULGGAGGJGGGAAAGW%AACUGAUCCCJ CAGJGUAGGMJGCJHduPne GAGCAGCGCCAGGAGJCJAGUAGJCAACLGGACACGALAAACUGALCAGtGAAGUU'-IUGGGGGUPneEco GGGCAGCGCCtGAGAALGCCCGUCAACUGGGAAAGUAAACUGAUCCCGAAGULCAUGAGL GCEco

730 740 750 760 770 780 790 800 810 820 830 840

Aac -UAGCUGJCCAGUAGGUAUGCGCGGAUCGCCAGAAACCAUAUgCGGCCCCACGJGGAGGLAAJAacHap -W-GLJGGCGJGUAGGUAUGCGCJGGGJCGCCAGUAAUAAGrJnCGG-CCCACGGACULGUAW HapH in -AAJCGGACGAGJACtGUAUGCGCGGAUCGCCAGUAAUAUGAAGCGGCGCCAC JGACUtGUAAJHi nAse -rJ-GUGtGCGACJAGJAAACACCLGGALAGCGAGUAACCAUALJAGGGCGAAgGtGACLGGUUAJAs.PsA -W-GUGUCCUGUAGJAAACACCLGGAtAGCGAGUAACCAU-ANGCGGCCCCACGGACULGUAJW PSAPay PayGCXGGJCCUGUAGJAUAUGCGC)GGAUCGCCAGUACUAAGAGCGGCCGAAGGtGACtJtGMINIAaPmu -rJ-GUGtGCGACJAGJAAMGCGCJGGGAGCGAGUA CCAUALJAGGGCGAAGGJGGAGGULM PauHpc HUGACUGJCCtAC)AGGUAUGCGCGGALAGCGAGLJAALCAUAWAGGGCGAaGGUGGAGJGLJpcHps -nGACUGJCCUGUAGGUAUGCGCGGAtAGCGAGLJAAUAAnAAGCGG-cCCACGGACUUGUAUHpsAsu -W-GCGUCCAGUAGGUAUGCGCGGAtAGCGAGUaACCAUMuAGGGCGa&GGUGGa)UGUaUAsuAl i -UnAtJGJCCAGIACIGUAUGCGCGGAUCGCCAGUAAUAAGAUAGGGCGAAGGUGGAMGUAM AtlHpi -AJACGGGCGACACJGUAUGCGCGGGGAGCGaGAJACrm GALJAGGGCGAnGGGAGHpiHdu HW-GCGCCCAGUAGGUAUGCGCGGAtAGCGAGUAACJAAn&GCGGCCCCACGJGGAGGUUAduPne -W-GWGGCGJGUAGJAAACACCUGGGJCGCCAGAACJAAGAUAGGGCGAAGGJGGAJLGUAAUPneEco CWAGGJGLJCGGUAGGUAtCACCtGGAtAGCGAGUAACJAAGAAGCGGCCCCACMGACUUGXMUEco

850 860 870 880 890 900 910 920 930 940 950 960

Aac UGUcAGGAACUACACCGAACGAAGAUAAAGGJUtGUAGGGUJGGCGUCGAGCGCUACCGGGGAAacHap UCAGACCAGACXACJCCUAACAGAUUGAAAAGGGGCACGACAGGCGUCGAGCJUGCGUGJUGJAHapH in UCAGACCAGACAACJCCUAACUAAGGtCGGUACUUCUCGACUGGCGJCGAGCGC)ACCJLJUAHinAseUCAGACCAGACJJCUCJUGCUCUGAAtGGGUtG GGCUCGACAGGCGtGLGAGCGCUACCUAGtG AsPsA UCAGMGGAACLJCUCJLJAACAAAGAUAAAGM GJCUCGACWAAAGGUCUGLGCUACCUUGJAPsAPay UCAGACCAGACRACALCAGCUCAGACtGJGGUcgAIUCUCGACUGGCGUCGAJGUUGCGICUUGG avPmu UGUrCCAGACACAUAGAACtAGAACCGGUACGtGCCGGAUAAAAGGUGAGGtGCGCGtCU GUAPmuuHpc UGUcAGGAACUACAUUGCUCAGAACCAAAGGUGGCUCGAUAGGCGUCGAGGgCGCGUGGGUAHpcHps HCAGACCAGACAACAtCUAACUAAGAICGGUAuUUCUcGACUGGCGUCGAGCgCUACCUUGGpsAsu UCAGACCAGACACAUUGCUCUGACAGJGGUCAAtGCCGACAGGCGJCJC)GUUGCGUGGGJAAsuAlti UCAGACCAGACUCLAUUGCUCUGACUtAAAAGGGJCWGGACUAAAGGUCUGU)GCGUGJLJJAALlHpi HCAGACCAGACAACJCCXGCUCGGAACAAAGAAGUCWGUUAAAGGUCUGtGJGCGtC)UGG piHdu HCAGaCCAGACXACANCUAACAAAGAUAAAGGLJJCWGGAUU)AAGGUCUGtG)MCGUGGULGduPneUGUrACCAGAC1ACJCWXGCACAAAGGCiG UWtGCUGGAUWAAAGJCGAGCGCUACCUUMG PneEco UCAGACCAGACAACGULJAACAGAGLXCGGUAAUUCUCGACGGGCGIGUCUGUUGCGUGJUG)AEco

970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080

Aac AAGUGUAGCCCAGGGACCAACUAGAGCGG-GJGJGGAtCAGAAUCGUAAACGGAGUGGUAGCAtCAacHap AU GG AAtCCCAGGGACCACUGXGCGG-LJGCGGAtCAGAC)GCGGAAACGGAGUGGUAGCAtCHapH in AAGUGWAUCGACACCACLACUGAGCGG-UGtCGACCAGAAUCAtGUACGAGAGnGAGCUAGCH inAse AUUGGXAGCCCAGGGACCACUGUGCUG-AGtCGACCAGACGCGUAAaCGGAGUGGUAGCAtCAsePsA AULGGLJAUCGACACCACUACLJGXGCGA-CGJGGCUAAAGCGCGGUACGAGAGGGGUAGJAGCPsAPavy AGAGGUAUCGACACCACLLACL GAGCGA-ACGGGGAICAGAALGCGGUACJGGAGLGGAGCUAGJ PayPimuAj XGGAAGCCCAGGGACCUUCUGXGCGG-ACGttGACCAGAAtGCGJAnAUGGAGUGGUAGCA PmiuHpc aUUGGrwUCCCAGGGACCJAUCAIGAGCGA-CGUGACCAGAAGCALGUACGGGAGtGGAGCUAGCHpcHps AUUGGUAUCgACACCAC AUCAGUGCGG-CGCGGAUAAGGtGCAJGUACgGGAGGGGUAGCAtCHpsAsu AUUGGtnAUCGACACCAC AUCIJGIGCACGUJGCGGCUAGGGCGCGGUACGAGAGGGGUAGCAGCAsuAl i AlULJGLJAUCGACACCACWUCAUWCACAWGUGGAUAAGGCGCGGUACGAGAGgGAGCtCAUtHpi AAGAGGUAUCGACACCACUACLXGGCGG-CGCGACCAGAAtGCG)AmCGAGAGGGAGCtCAtCHpiHdu HAGKGGAnGCCCAGGGaCCXACLJJLJCACUUG)AGGAUAAGGCGCGJArAtGAGAGGGAGCUAG)duPneAU1W GLtaGCCCAGGGACCAACUAGAGCGG UUGJGGAUAAGGCGCrJAAACGGAGUGGUAGCAU PneEco AAGAGGXAGCCCAGGGACCACLkGAGCGG-CGCGGAUAAGGCGCGGUACGAGAGJGGUAGJAGCEco

1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200

FIG. 1-Continued.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


1300 1310 1320

1420 1430 140

AacHapHinAsePsAPavPsuHpcHpsAsuAliHpiHduPneEco

AacHapHinAsePMPavPMuHpcHpsAsuAliHpiHduPneEco

WaCCgAgGGc_GG C CACGQGlJngacu ................. Aac ActinobecitLus actinmycetemcomitans FDC Y4ACCGUUAGGGGGCQJUUACCACCQIAIJGAUUCAUGAC ...................Hap Heemophilus aphrophilus ATCC 33389 TA UGG...AGGGCQ CACG IAIGAU IUGACUGGGG.............Hinm Haemophilus influenzae ATCC 33391 T

c AG-GGGGGcGAACCJAC JAUgUCA...................... Ase Actinobacillus seminis ATCC 15768 TACCGCAAGGGGUU _GIAC_CAC-GWGkIAZCA..................... PsA Pasteurella species A CCUG 18782UACOCaAG ACCGG A ...................... Pav Pasteurella aviuL. NCTC 11297A__CC.GGGGGG UACCACG UCAI. ................. Pi Pasteurella inltocida ACTC 10322 T

UA_CUCA.A.A.GGGGGGCQAAU UA ................ Hpc Haemophilus paracuniculus ATCC 29986 TIANAAACGGGGG- CACGGUAUGAUUCAu..................... Hps Haemophilus parasuis NCTC 4557 TUCcnuCgGGGGGGcG.kUA--ACGGIAUG Ca ................... Asu Actinobacillus suis ATCC 15557 TACC_CU GGGGGCGLRJACCA C.UG CGGGG............. Ali Actinobacillus lignieresii NCTC 4189 T

WM=UUCG G UIACCA U AJUGaCJGGGG............. Hpi Haemophilus parainfluenzae ATCC 33392 TAC_OCJCGGGAGGGCQJACCAC.AIJGAIIXAAC.................. Hdu Haemophilus ducreyi CPI 542 TACUAGGGCC U XAUUCA ...................... Pne Pasteurella pneumotropica NCTC 8141 TUACUCGGGAGGGCGCUUACCACUUUUJGALAtAGACUGGGQIGUGAGtUAACA Eco Escherichia coli1450 1460 1470 1480 1490 1500

FIG. 1-Continued.

because A. actinomycetemcomitans differs phenotypicallyand has a long evolutionary branch, it can be argued that thisspecies should be placed in its own genus. What is unargu-able is that [A.] actinomycetemcomitans is not a member ofthe genus Actinobacillus (cluster 4A). [A.] actinomycetem-comitans ATCC 29522, FDC Y4, and ATCC 29524 are

serotype b, ATCC 29523 is serotype a, and ATCC 33384T isserotype c (68). The 16S rRNA sequences for serotypes b, a,and c differ from one another by more than many specieselsewhere on the tree. Change of serotype to subspecies maybe warranted following further analysis.

Strains obtained from culture collections as H. parainflu-enzae and H. paraphrophilus fell into three different areas ofthe phylogenetic tree, as previously reported by Pohl (51).The type strain of H. paraphrophilus and [H. parainfluen-zae] ATCC 7901 (actually H. aphrophilus) fall in cluster 1B,the type strain of H. parainfluenzae and [H. paraphrophilus]ATCC 29242 (actually H. parainfluenzae) fall in cluster 4B,and [H. parainfluenzae] NCITC 4101 (reclassified as P.volantium) falls in cluster 3A. It is recognized that thesespecies are genetically heterogeneous and contain manymisidentified strains (15, 29, 50, 51, 62).

(ii) Cluster 2. Cluster 2 is composed of three species

TABLE 3. Sequence signatures for the family Pasteurellaceae

Positiona Pasteu- Eubacteria' Exceptions'rellaceae"

237 A C, U, G Acinetobacter248 G C, a Bacteroides, Rickettsia2761 C G, u562 A, g U, C, g Ruminobacter599 G C, u, a None639] C G,a,u665 G A Treponema, Rickettsia667 A G None739 U C723 A U Serpulina831 G U, a, c None8551 C G, A, u868 U C Capnocytophaga, spirochetes1298 A U, C None1439 1 A G, U, C Aeromonas, Legionella14621 U C, A, G

Position using E. coli numbering. Positions connected by brackets repre-sent paired bases.

b Bases found in Pasteurellaceae species. Bases are abbreviated as in Fig. 1.' Bases found in other eubacteria. Lowercase letters denote bases found in

less than one-fourth of the sequences.d Genera with species possessing the same base as Pasteurellaceae.

10 1230 I;

AecHapHinAsePsAPavPauHpcHpsAsuAliHpi

PrEco

AecHapNinAsePsAPavPMHpcNptAsuAliHpiNduPreEco

AacHapHinAsoPMPavPMHpcHpsAsuAliHpiNduPrleEco

!60 1270 1280 129012

133

1240

UUxGUWCAGUWCG

kAUCAG

;UCG

M4UCAC1360

UWCAGUWCG

UCG

UWCAGMCGLMG1360

NGCGCNGCNGC

ccw

1GCCW139030 1340 13!5iO 1370 1380 1400 1410

J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


Scale (Percent)

Escherichia coliCitrobacter freundiiSerratia marcescens

Proteus vulgarisVibrio parahaemolyticus

Haemophi lus aphrophilusHaemophi 1us influenzae

r Pasteurella canisPasteurella multocida

Actinobacillus suisActinobacillus lignJeresii

Aeromonas hydrophi laRuminobacter amylophilus

Oceanospiri llum linumPseudomonas aeruginosa

Acinetobacter calcoaceticusCardiobacterium hominis- Suttonella indologenes

Dichelobacter nodosusNeisseria gonorrhoeaeEikenella corrodensAlcaligenes faecalis[Pseudomonas] cepaci a

Family or Taxa

I Enterobac teriaceae

- Vibrionaceae

I Pasteurellaceae

- Aeromonadaceae

- Pseudomonas fluorescens Complex- Moraxellaceae

Cardiobacteriaceae

] Neisseriaceae

-Alcaligenaceae-Pseudomonas solanacerum Complex

FIG. 2. Phylogenetic tree for the beta and gamma divisions of Proteobacteria. The scale bar represents a 10% difference in nucleotidesequence as determined by measuring the lengths of horizontal lines connecting two species.

previously cast out of their given genera: [H.] somnus, [A.]seminis, and [P.] aerogenes. These species are less closelyrelated to one another than are members of other clusters.This is in part due to the long branch of [H.] somnus, whichhas accumulated many changes in its 16S rRNA sequencerelative to other species. Previous investigators found anti-genic cross-reactivity between [H.] somnus and [A.] seminis(55, 60) but failed to find a convincing relationship byDNA-DNA (49, 64) and DNA-RNA (21) hybridization stud-ies. The stability of this cluster to outgroup switching andbootstrapping (see below) convinces us that it is a legitimatecluster.

(iii) Cluster 3, including the genus PasteureUa sensu stricto.Clusters 3A and 3B contain the species generally recognizedas Pasteurella sensu stricto (39). Included in cluster 3A are

P. anatis, P. avium, P. gallinarum, P. langaa, Pasteurellaspecies A, P. volantium, [Haemophilus] taxon C CAMP5111, and [H.] paragallinarum. The inclusion of [H.]paragallinarum in cluster 3A is consistent with DNA-DNAhybridization data, which showed [H.] paragallinarum toshare 35% identity with Pasteurella species A, P. volantium,and P. gallinarum, about the same level of similarity as wasfound between Pasteurella species A and the species P.avium and P. volantium (41, 48). Cluster 3B contains P.canis, P. dagmatis, P. multocida, P. stomatis, and Pas-teurella species B CCUG 19794. We find a very cleardelineation between clusters 3A and 3B which is not alwaysapparent in DNA-DNA studies (39). The deeper members ofclusters 3A and 3B have many base signatures which clearlydifferentiate these groups. For example, all cluster 3A or-ganisms except P. langaa contain the sequence 5'-GAAACGAUGGCUAAUACCGCAUAG-3' at positions 159 to 182,whereas cluster 3B organisms contain the sequence 5'-GAAACUCICAGCUAAUACCGC-iUAK-3' (mismatch posi-tions are underlined, K = G or U). A DNA probe, 5'-CTATGCGGTATTAGCCATCGT'ITC-3', should recognizecluster 3A organisms (except P. langaa) and have five to sixmismatches with cluster 3B organisms. All members ofcluster 3B are indole positive (or indole variable), whilecluster 3A organisms are indole negative. Cluster 3A organ-

isms have avian hosts, while cluster 3B organisms havemammalian hosts.

Cluster 3C is an odd assortment of species that have notpreviously been related to one another or to other membersof cluster 3. This group includes [H.] paracuniculus, [A.capsulatus] NCTC 11408T and CCUG 12396T, P. trehalosiNCTC 10624, [H.] haemoglobinophilus, [H.] parasuis, and[H.] parasuis type 5 Nagasaki. [H.] haemoglobinophilusNCTC 8540 fell with the type strain (355 bases). [H.]parasuis type 5, which was previously shown by DNA-DNAhybridization (37) to differ from other H. parasuis strains (61to 72% identity), represents a separate species based on 16SrRNA distance. Previous investigators found that A. capsu-latus strains fell in cluster 4A with the true Actinobacillus(11, 24, 40, 42). Therefore, our initial finding that strainNCTC 11408T did not fall in the expected phylogeneticcluster prompted us to sequence the 16S rRNA of threeadditional strains. We obtained strain 11408T a second timefrom National Collection of Type Cultures (NCTC) and thesame strain from Culture Collection, University of Goteborg(CCUG), strain 12396T. The partial sequence (340 bases) ofthe reacquired NCTC strain was identical to that previouslyobtained. Similarly, the full 16S rRNA sequence for strainCCUG 12396T was identical to that of NCTC 11408T. Wethen obtained what we thought was a different strain of A.capsulatus, CCUG 19799. The 16S rRNA sequence of thisstrain was markedly different from the previously sequencedstrains and fell in the expected position in cluster 4A.Unfortunately, strain CCUG 19799 = Carman 8-11272 = SSIP585 is not a strain of A. capsulatus but is an A. suis-likestrain which has been placed in Bisgaard's taxon 11 biovar 2(11). Thus, we are left with an unanswered question as towhether currently available strains NCTC 11408T andCCUG 12396T are the same as SSI strain p243T and relatedto strains P244, P564, P572, and CIP 704.80 as shown byEscande et al. (24). The structure of cluster 3 poses inter-esting taxomomic questions. Should Pasteurella sensustricto be limited to cluster 3B species, or if it also includescluster 3A species, how can it exclude species from cluster 3C?

(iv) Cluster 4, includingActinobacillus sensu stricto. Cluster

Proteobacteria

gamma -

beta -

VOL. 174, 1992


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


a)X < m U

4-,U)

0LL

(a

cu4

1mHucUm

QJQjuThm

uu m ~ H

U~ O

4; ag cm--, co~ ¶1)

-~~~~~~

cz

~~~Qj Q u cQmc

4-,

a)C-

Ll

Cn

mr

m(1

UqUH

m um1r m

0

z

LOH(cm

co

01

J. BACTERIOL.

m

01cu

mm

C-,"I

C))

.C,


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


4A contains those species recognized as true actinobacilli:A. lignieresii, Actinobacillus species strain CCUG 19799, A.equuli, A. pleuropneumoniae, A. suis, andA. ureae (39, 52).[H.] parahaemolyticus is also a member of this cluster. Thislatter finding is surprising based on DNA-DNA hybridizationstudies (15, 21), and we will therefore sequence rRNA fromadditional strains of this species. Not actually forming aseparate cluster, but branching ever more deeply, are cluster4B organisms [H.] paraphrohaemolyticus, [H.] ducreyi(three strains), [P.] haemolytica, [H.] parainfluenzae, [H.]parainfluenzae ATCC 29242, and [Haemophilus] "minorgroup" strain 202 (32). [H.] ducreyi was previously shown tobe unrelated to true haemophili in cluster 1 (2, 3, 18).However, suspicions that it was not a member of thePasteurellaceae were unfounded as shown by DNA-RNAhybridization (21). While this report was being prepared,Rossau et al. (56) reported the 16S rRNA sequence for thetype strain and also concluded that it is a legitimate memberof the Pasteurellaceae. Pohl (50, 51) had previously demon-strated that [H. paraphrophilus] ATCC 29242 is a misnamedH. parainfluenzae. Cluster 4 is interesting taxonomically, asit is a cluster in which each species branches slightly deeperthan the one above, giving no logical point at which to endthe genus Actinobacillus sensu stricto.

(v) Cluster 5, [P.] pneumotropica. [P.]pneumotropica is themost deeply branching organism of the family Pasteurel-laceae. Its 16S rRNA lacks five base changes that differen-tiate Pasteurellaceae from other gamma proteobacteria.Yet, at the same time, it has some of the signatures found inPasteurella sensu stricto organisms (cluster 3). Using differ-ent organisms for an outgroup (or no outgroup), P. pneumo-tropica branched as a deep member of cluster 1 73% of thetime. In none of our analyses did [P.] pneumotropica fallwith cluster 3. The phylogenetic position of this speciesdeserves further examination.

Reliability of trees. For many years, phylogenetic treeswere reported with no indication of their reliability. Thosewho generated trees were aware that changing outgroups,including more or fewer bases in the analysis, or usingdifferent treeing algorithms often changed the tree obtained.Sometimes changes are minor, such as the exchanging oftwo branches or slight changes in branch lengths. However,even the exchanging of branches can cause great scientificdebate, as, for example, in the relationship between chim-panzee, human, gorilla, and orangutan (27). Analysis of thestability of trees generated from sequence data is a new field,and methods such as the bootstrap and jackknife have onlyrecently been developed (25). A bootstrap program for usewith the Neighbor-Joining treeing algorithm has recentlybeen written by T. S. Whittam. In our analysis, hypervari-able regions were not excluded so that differences betweenclosely related species could be seen; however, this doesdecrease the bootstrap values obtained. Therefore, the boot-strap values reported are a conservative estimate of thereliability of the tree. An alternative way of examining thereliability of the tree is to use different outgroups. In Fig. 3,there are numbers above and below each node in the tree.The number above the nodes is the percentage of bootstrap-ping trials in which the taxonomic units to the right of the

node occur together. The number below the nodes is thepercentage of outgroup switching trials in which the taxo-nomic units to the right of the node occur together. Exami-nation of the tree shows that the stability of nodes is directlyproportional to the length of the branch from the node tooutgroup sequences (branch to left of node). The stability of8 of 10 of the subclusters is 100% to outgroup switching. Thestability of cluster 3A is 100% below P. anatis but only 40%overall, due to P. langaa and P. anatis switching to deeperpositions in the tree. Bootstrapping values are lower butsupport the existence of most subclusters. The stability ofclusters 1, 2, and 4 is 85 to 100% by outgroup swapping.Clusters 1 and 2 are present in the majority of trees bybootstrapping. The major changes seen in the overall treewhen using different outgroups are the frequent movementof the root of the tree to a position between P. langaa and P.anatis and movement of P. pneumotropica to cluster 1. Thetree in Fig. 3 is correct in most of its details but probably hassome discrepancies with a true phylogenetic tree. We be-lieve that this tree is close to the true tree and that itrepresents a major step forward in understanding the phylo-genetic relationships among the members of the familyPasteurellaceae.

While we think that taxonomy should reflect phylogeny,we do not propose any taxonomic reordering of the familyPasteurellaceae in this report. There are several reasons fordeferring taxonomic realignment. First, we plan to sequence20 to 30 additional strains belonging to the family Pasteurel-laceae, including a majority of the unnamed Bisgaard taxa(40). These additional data will allow 16S rRNA sequencecomparison analysis for essentially all of more than 70described taxa within the Pasteurellaceae. Second, it seemsprudent to allow time to resolve discrepancies between 16SrRNA analyses and other methods where they exist. Finally,the reordering of a large taxonomic group should reflect thethinking of microbiologists in more than one laboratory;therefore, we suggest that the implications of this and othermolecular studies should be addressed by the Committee onSystematic Bacteriology Subcommittee on Pasteurellaceaeand Related Organisms and that this body should have a rolein creating new genera and renaming species. Because asolid 16S rRNA sequence data base is now available for over50 taxa in the family Pasteurellaceae, and because we andmany other investigators around the world are willing tocollaborate in determining 16S rRNA sequences, we wouldhope that any future descriptions of new species within thefamily Pasteurellaceae would include full 16S rRNA se-quence information.

ACKNOWLEDGMENTSWe thank V. J. Rapp-Gabrielson, Department of Microbiology,

North Dakota State University, Fargo, for providing cultures of H.parasuis Nagasaki, Haemophilus taxon "minor group," and Hae-mophilus taxon C strain CAMP 5111. We thank W. L. Albritton,University of Alberta, Edmonton, Alberta, Canada, for cell pelletsof H. ducreyi ATCC 27722, HD 35000, and CIP 542. We thank P. B.Little, Ontario Veterinary College, University of Guelph, Guelph,Ontario, Canada, for providing a cell pellet of H. somnus 43826. Wethank M. Nei and T. S. Whittam, Department of Biology, Institute

FIG. 3. Phylogenetic tree for the family Pasteurellaceae. The scale bar represents a 5% difference in nucleotide sequence as determinedby measuring the lengths of horizontal lines connecting two species. The numbers above each node are the percentage of times that the strainsto the right of the node occur together by bootstrapping. Numbers below each node are the percentage of times that the strains to the rightof the node occur together using different outgroups. *, sequence for strain given in Fig. 1.

VOL. 174, 1992


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


of Molecular Evolution and Genetics, Pennsylvania State Univer-sity, University Park, for providing Neighbor-Joining and bootstrap-ping computer programs, respectively.

This work was supported by Public Health Service grants DE-04881 and DE-08303 from the National Institute of Dental Researchand grants from the Dental Faculty, University of Oslo.

REFERENCES1. Adlam, C., and J. M. Rutler. 1989. Pasteurella and pasteurel-

losis. Academic Press, Inc. (London), Ltd., London.2. Albritton, W. L. 1989. Biology of Haemophilus ducreyi. Micro-

biol. Rev. 53:377-389.3. Albritton, W. L., J. K. Setlow, M. L. Thomas, and F. 0. Sottnek.

1986. Relatedness within the family Pasteurellaceae as deter-mined by genetic transformation. Int. J. Syst. Bacteriol. 36:103-106.

4. Bisgaard, M. 1984. Comparative investigations of Pasteurellahaemolytica sensu stricto and so-called P. haemolytica isolatedfrom different pathological lesions in pigs. Acta Pathol. Micro-biol. Immunol. Scand. Sect. B 92:201-207.

5. Bisgaard, M. 1986. Actinobacillus muris sp. nov. isolated frommice. Acta Pathol. Microbiol. Immunol. Scand. Sect. B 94:1-8.

6. Bisgaard, M., and R. Mutters. 1986. A new facultatively anaer-obic gram-negative fermentative rod obtained from differentpathological lesions in poultry and tentatively designated taxon14. Avian Pathol. 15:117-127.

7. Bisgaard, M., and R. Mutters. 1986. Characterization of somepreviously unclassified "Pasteurella" spp. obtained from theoral cavity of dogs and cats and description of a new speciestentatively classified with the family Pasteurellaceae Pohl 1981and provisionally called taxon 16. Acta Pathol. Microbiol.Immunol. Scand. Sect. B 94:177-184.

8. Bisgaard, M., and R. Mutters. 1986. Re-investigations of se-lected bovine and ovine strains previously classified as Pas-teurella haemolytica and description of some new taxa withinthe Pasteurella haemolytica-complex. Acta Pathol. Microbiol.Immunol. Scand. Sect. B 94:185-193.

9. Bisgaard, M., R. Mutters, and W. Mannheim. 1983. Character-ization of some previously unreported taxa isolated from guineapigs (Cavia porcellus) and provisionally classed with the "HPA-group," p. 227-244. In H. Leclerc (ed.), Gram-negative bacteriaof medical and public health importance: taxonomy-identifica-tion-applications, vol. 114. Les Colloques de l'INSERM,Paris.

10. Bisgaard, M., J. E. Phillips, and W. Mannheim. 1986. Charac-terization and identification of bovine and ovine Pasteurel-laceae isolated from the oral cavity and rumen of apparentlynormal cattle and sheep. Acta Pathol. Microbiol. Immunol.Scand. Sect. B 94:9-17.

11. Bisgaard, M., K. Piechulla, Y.-T. Ying, W. Frederiksen, and W.Mannheim. 1984. Prevalence of organisms described as Actino-bacillus suis or haemolytic Actinobacillus equuli in the oralcavity of horses. Comparative investigations of strains obtainedand porcine strains of A. suis sensu stncto. Acta Pathol.Microbiol. Immunol. Scand. Sect. B 92:291-298.

12. Broom, A. K., and P. H. A. Sneath. 1981. Numerical taxonomyof Haemophilus. J. Gen. Microbiol. 126:123-149.

13. Brosius, J., M. L. Palmer, P. J. Kennedy, and H. F. Noller. 1978.Complete nucleotide sequence of a 16S ribosomal RNA genefrom Escherichia coli. Proc. Natl. Acad. Sci. USA 75:4801-4805.

14. Brumpt, E. 1910. Precis de parasitologie, 1st ed. Masson andCo., Paris.

15. Burbach, S. 1988. Ph.D. thesis. Reklassifizierung der GattungHaemophilus Winslow et al. 1917 auf Grund der DNA Basense-quenzhomologie. Philipps-Universitat, Marburg/Lahn, Ger-many.

16. Carbon, P., J. P. Ebel, and C. Ehresmann. 1981. The sequenceof the ribosomal 16S RNA from Proteus vulganis. Sequencecomparison with E. coli 16S RNA and its use in secondarystructure model building. Nucleic Acids Res. 9:2325-2333.

17. Carter, G. R. 1984. Genus I. Pasteurella Trevisan 1887, p.552-557. In N. R. Krieg and J. G. Holt (ed.), Bergey's manual

of systematic bacteriology, vol. 1. The Williams & Wilkins Co.,Baltimore.

18. Casin, I., F. Girmont, P. A. D. Girmont, and M.-J. Sanson-LePors. 1985. Lack of deoxyribonucleic acid relatedness betweenHaemophilus ducreyi and other Haemophilus species. Int. J.Syst. Bacteriol. 35:23-25.

19. Chuba, P. J., R. Bock, G. Graph, T. Adam, and U. Gobel. 1988.Comparison of 16S rRNA sequences from the family Pasteurel-laceae: phylogenetic relatedness by cluster analysis. J. Gen.Microbiol. 134:1923-1930.

20. Colwell, R. R., M. T. MacDonell, and J. De Ley. 1986. Proposalto recognize the familyAeromonadaceae fam. nov. 1986. Int. J.Syst. Bacteriol. 36:473-477.

21. De Ley, J., W. Mannheim, R. Mutters, K. Piechulla, R. Tytgat,P. Segers, M. Bisgaard, W. Frederiksen, K.-H. Hinz, and M.Vanhoucke. 1990. Inter- and intrafamilial similarities of rRNAcistrons of the Pasteurellaceae. Int. J. Syst. Bacteriol. 40:126-137.

22. Dewhirst, F. E., B. J. Paster, and P. L. Bright. 1989. Chromo-bacterium, Eikenella, Kingella, Neisseria, Simonsiella, andVitreoscilla species comprise a major branch of the beta groupProteobacteria by 16S ribosomal ribonucleic acid sequencecomparison: transfer of Eikenella and Simonsiella to the familyNeisseriaceae (emend.). Int. J. Syst. Bacteriol. 39:258-266.

23. Dewhirst, F. E., B. J. Paster, S. La Fontaine, and J. I. Rood.1990. Transfer of Kingella indologenes (Snell and Lapage 1976)to the genus Suttonella gen. nov. as Suttonella indologenescomb. nov.; transfer of Bacteroides nodosus (Beveridge 1941)to the genus Dichelobacter gen. nov. as Dichelobacter nodosuscomb. nov.; and assignment of the genera Cardiobacterium,Dichelobacter, and Suttonella to Cardiobacteriaceae fam. nov.in the gamma division of Proteobacteria on the basis of 16SrRNA sequence comparisons. Int. J. Syst. Bacteriol. 40:426-433.

24. Escande, F., F. Grimont, P. A. D. Grimont, and H. Bercovier.1984. Deoxyribonucleic acid relatedness among strains of Acti-nobacillus spp. and Pasteurella ureae. Int. J. Syst. Bacteriol.34:309-315.

25. Felsenstein, J. 1988. Phylogenies from molecular sequences:inferences and reliability. Annu. Rev. Genet. 22:21-65.

26. Frederiksen, W. 1987. International Committee on SystematicBacteriology Subcommittee on Pasteurellaceae and RelatedOrganisms. Int. J. Syst. Bacteriol. 37:474.

27. Gonzalez, I. L., J. E. Sylvester, T. F. Smith, S. Stambolian, andR. D. Schmickel. 1990. Ribosomal RNA gene sequences andhominoid phylogeny. Mol. Biol. Evol. 7:203-219.

28. Jukes, T. H., and C. R. Cantor. 1969. Evolution of proteinmolecules, p. 21-132. In H. N. Munro (ed.), Mammalian proteinmetabolism, vol. 3. Academic Press, Inc., New York.

29. Kilian, M. 1976. A taxonomic study of the genus Haemophilus,with the proposal of a new species. J. Gen. Microbiol. 93:9-62.

30. Kilian, M., and E. L. Biberstein. 1984. Genus II. HaemophilusWinslow, Broadhurst, Buchanan, Krumwiede, Rogers andSmith 1917, 561 AL, p. 558-569. In N. R. Krieg and J. G. Holt(ed.), Bergey's manual of systematic bacteriology, vol. 1. TheWilliams & Wilkins Co., Baltimore.

31. Kilian, M., W. Frederiksen, and E. L. Biberstein. 1981. Hae-mophilus, Pasteurella and Actinobacillus, p. 294. AcademicPress, Inc. (London), Ltd., London.

32. Kilian, M., J. Nicolet, and E. L. Biberstein. 1978. Biochemicaland serological characterization of Haemophilus pleuropneu-moniae (Matthews and Pattison 1961) Shope 1964 and proposalof a neotype strain. Int. J. Syst. Bacteriol. 28:20-26.

33. Lane, D. J., B. Pace, G. J. Olsen, D. A. Stahl, M. L. Sogin, andN. R. Pace. 1985. Rapid determination of 16S ribosomal RNAsequences for phylogenetic analyses. Proc. Natl. Acad. Sci.USA 82:6955-6959.

34. Mannheim, W. 1983. Taxonomy of the family PasteurellaceaePohl 1981 as revealed by DNA/DNA hybridization, p. 211-226.In H. Leclerc (ed.), Gram-negative bacteria of medical andpublic health importance: taxonomy-identification-applica-tions, vol. 114. Les Colloques de l'INSERM, Paris.

35. Mannheim, W. 1984. Family III. Pasteurellaceae Pohl 1981a,

J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


382vp, p. 550-552. In N. R. Krieg and J. G. Holt (ed.), Bergey'smanual of systematic bacteriology, vol. 1. The Williams &Wilkins Co., Baltimore.

36. Martens, B., H. Spiegi, and E. Stackebrandt. 1987. Sequence ofa 16S ribosomal RNA gene of Ruminobacter amylophilus: therelation between homology values and similarity coefficients.Syst. Appl. Microbiol. 9:224-230.

37. Morozumi, T., U. Pauli, R. Braun, and J. Nicolet. 1986. Deoxy-ribonucleic acid relatedness among strains of Haemophilusparasuis and other Haemophilus spp. of swine origin. Int. J.Syst. Bacteriol. 36:17-19.

38. Mutters, R., M. Bisgaard, and S. Pohl. 1986. Taxonomic rela-tionship of selected biogroups of Pasteurella haemolytica asrevealed by DNA:-DNA hybridizations. Acta Pathol. Microbiol.Immunol. Scand. Sect. B 94:195-202.

39. Mutters, R., P. Ihm, S. Pohl, W. Frederiksen, and W. Mann-heim. 1985. Reclassification of the genus Pasteurella Trevisan1887 on the basis of deoxyribonucleic acid homology, withproposals for the new species Pasteurella dagmatis, Pasteurellacanis, Pasteurella stomatis, Pasteurella anatis, and Pasteurellalangaa. Int. J. Syst. Bacteriol. 35:309-322.

40. Mutters, R., W. Mannheim, and M. Bisgaard. 1989. Taxonomyof the group, p. 3-34. In C. Adlam and J. M. Rutler (ed.),Pasteurella and pasteurellosis. Academic Press, Inc. (London),Ltd., London.

41. Mutters, R., K. Piechulla, K.-H. Hinz, and W. Mannheim. 1985.Pasteurella avium (Hinz and Kunjara 1977) comb. nov. andPasteurella volantium sp. nov. Int. J. Syst. Bacteriol. 35:5-9.

42. Mutters, R., S. Pohl, and W. Mannheim. 1986. Transfer ofPasteurella ureae Jones 1962 to the genus ActinobacillusBrumpt 1910: Actinobacillus ureae comb. nov. Int. J. Syst.Bacteriol. 36:343-344.

43. Pace, B., E. A. Matthews, K. D. Johnson, C. R. Cantor, andN. R. Pace. 1982. Conserved 5S rRNA complement to tRNA isnot required for protein synthesis. Proc. Natl. Acad. Sci. USA79:36-40.

44. Paster, B. J., and F. E. Dewhirst. 1988. Phylogeny of campylo-bacters, wolinellas, Bacteroides gracilis, and Bacteroides ure-olyticus by 16S ribosomal ribonucleic acid sequencing. Int. J.Syst. Bacteriol. 38:56-62.

45. Perets, A., S. Rosendal, and P. Shewen. 1990. Proceedings of theinternational conference on the Haemophilus, Actinobacillusand Pasteurella (HAP) group of organisms-June 1989. Can. J.Vet. Res. 54(Suppl.):1-82.

46. Phillips, J. E. 1984. Genus III. Actinobacillus Brumpt 1910,849AL, p. 570-575. In N. R. Krieg and J. G. Holt (ed.), Bergey'smanual of systematic bacteriology, vol. 1. The Williams &Wilkins Co., Baltimore.

47. Piechulla, K., M. Bisgaard, H. Gerlach, and W. Mannheim.1985. Taxonomy of some recently described avian PasteurellalActinobacillus-like organisms as indicated by deoxyribonucleicacid relatedness. Avian Pathol. 14:281-311.

48. Piechulla, K., K.-H. Hinz, and W. Mannheim. 1985. Genetic andphenotypic comparison of three new avian Haemophilus-liketaxa and of Haemophilus paragallinarum Biberstein and White1969 with other members of the family Pasteurellaceae Pohl1981. Avian Dis. 29:601-612.

49. Piechulla, K., R. Mutters, S. Burbach, R. Klussmeier, S. Pohl,and W. Mannheim. 1986. Deoxyribonucleic acid relationships of"Histophilus ovis/Haemophilus somnus," Haemophilus hae-moglobinophilus, and "Actinobacillus seminis." Int. J. Syst.Bacteriol. 36:1-7.

50. Pohl, S. 1979. Reklassifizierung der Gattung ActinobacillusBrumpt 1910, Haemophilus Winslow et al. 1917 und PasteurellaTrevisan 1887 anhand phanotypischer und molekularer daten,insbesondere der DNS-verwandtschaften bei DNS:DNS-hybri-disierung in vitro und vorschlag einer neuen Familie, Pasteurel-laceae. Ph.D. thesis. Fachbereich Biologie der Philipps-Univer-sitat, Marburg/Lahn, Germany.

51. Pohl, S. 1981. DNA relatedness among members of Haemoph-ilus, Pasteurella and Actinobacillus, p. 245-253. In M. Kilian,W. Frederiksen, and E. L. Biberstein (ed.), Haemophilus,Pasteurella andActinobacillus. Academic Press, Inc. (London),Ltd., London.

52. Pohl, S., H. U. Bertschinger, W. Frederiksen, and W. Mann-heim. 1983. Transfer of Haemophilus pleuropneumoniae andthe Pasteurella haemolytica-like organism causing porcine ne-crotic pleuropneumonia to the genusActinobacilluspleuropneu-moniae comb. nov. on the basis of phenotypic and deoxyribo-nucleic acid relatedness. Int. J. Syst. Bacteriol. 33:510-514.

53. Potts, T. V., and E. M. Berry. 1983. Deoxyribonucleic acid-deoxyribonucleic acid hybridization analysis of Actinobacillusactinomycetemcomitans and Haemophilus aphrophilus. Int. J.Syst. Bacteriol. 33:765-771.

54. Potts, T. V., J. J. Zambon, and R. J. Genco. 1985. Reassignmentof Actinobacillus actinomycetemcomitans to the genus Hae-mophilus as Haemophilus actinomycetemcomitans comb. nov.Int. J. Syst. Bacteriol. 35:337-341.

55. Rahaley, R. S. 1987. Serological comparison between Histo-philus ovis,Actinobacillus seminis and Brucella ovis. Aust. Vet.J. 54:423-425.

56. Rossau, R., M. Duhamel, G. Jannes, J. Luc Decourt, and H. VanHeuverswyn. 1991. Development of specific rRNA-derived oli-gonucleotide probes for Haemophilus ducreyi, the causativeagent of chancroid. J. Gen. Microbiol. 137:277-285.

57. Rossau, R., L. Heyndrickx, and H. Van Heuverswyn. 1988.Nucleotide sequence of a 16S ribosomal RNA gene from Neis-seria gonorrhoeae. Nucleic Acids Res. 16:6227.

58. Saitou, N., and M. Nei. 1987. The Neighbor-Joining method: anew method for reconstructing phylogenetic trees. Mol. Biol.Evol. 4:406-425.

59. Sneath, P. H. A., and M. Stevens. 1985. A numerical taxonomicstudy of Actinobacillus, Pasteurella and Yersinia. J. Gen.Microbiol. 131:2711-2738.

60. Stephens, L. R., J. D. Humphrey, P. B. Little, and D. A.Barnum. 1983. Morphological, biochemical, antigenic, and cy-tochemical relationships among Haemophilus somnus, Hae-mophilus agni, Haemophilus haemoglobinophilus, Histophilusovis, and Actinobacillus seminis. J. Clin. Microbiol. 17:728-737.

61. Studier, J., and K. Keppler. 1988. A note on the Neighbor-Joining algorithm of Saitou and Nei. Mol. Biol. Evol. 5:729-731.

62. Tanner, A. C. R., R. A. Visconti, S. S. Socransky, and S. C. Holt.1982. Classification and identification of Actinobacillus actino-mycetemcomitans and Haemophilus aphrophilus by clusteranalysis and deoxyribonucleic acid hybridizations. J. Periodon-tal Res. 17:585-596.

63. Trevisan, V. 1887. Sul micrococco della ribabia e sulla possibil-ita di riconoscere durante il periode d'incubazione, dall'esamedel sangue della persona moricata, se ha contratta l'infezionerabbica. Rend. Ist. Lombardo (Ser. 2) 20:88-105.

64. Walker, R. L., E. L. Biberstein, R. F. Pritchett, and C. Kirkham.1985. Deoxyribonucleic acid relatedness among "Haemophilussomnus," "Haemophilus agni," "Histophilus ovis," "Actino-bacillus seminis," and Haemophilus influenzae. Int. J. Syst.Bacteriol. 35:46-49.

65. Winslow, C.-E. A., J. Broadhurst, R. E. Buchanan, C. Krum-wiede, Jr., L. A. Rogers, and G. H. Smith. 1917. The familiesand genera of the bacteria. Preliminary report of the committeeof the Society of American Bacteriologists on characterizationand classification of bacterial types. J. Bacteriol. 2:506-566.

66. Woese, C. R. 1987. Bacterial evolution. Microbiol. Rev. 51:221-271.

67. Woese, C. R., E. Stackebrandt, T. J. Macke, and G. E. Fox.1985. A phylogenetic definition of the major eubacterial taxa.Syst. Appl. Microbiol. 6:143-151.

68. Zambon, J. J., J. Slots, and R. J. Genco. 1983. Serology of oralActinobacillus actinomycetemcomitans and serotype distribu-tion in human periodontal disease. Infect. Immun. 41:19-27.

VOL. 174, 1992


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Documents

Phylogeny of 54 Representative Strains of Species in the Family Pasteurellaceae as Determined