Upload
others
View
0
Download
0
Embed Size (px)
Citation preview
PDGF-A Signalling Regulates Radially Oriented Movements of Mesoderm Cells During Gastrulation in
Xenopus
by
Erich William Damm
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Graduate Department of Cell and Systems Biology University of Toronto
© Copyright by Erich William Damm 2014
ii
PDGF-A Signalling Regulates Radially Oriented Movements of Mesoderm Cells During Gastrulation in
Xenopus
Erich William Damm
Doctor of Philosophy
Department of Cell and Systems Biology University of Toronto
2014
Abstract
The molecular regulation and cellular basis of morphogenesis during Xenopus
gastrulation has been a topic of extensive study. In particular, the convergent
extension movements that occur in the chordamesoderm are well understood,
however less is known about the morphogenesis of other mesoderm regions.
Since most of the morphogenetic movements occurring during gastrulation
appear to be region autonomous, it is necessary to understand these region
specific movements and their contribution to the gastrulation process in order to
understand gastrulation as a system.
The organization of cells in a region can be indicative of the cell movements that
are occurring in that region. Using scanning electron microscopy, I have analyzed
the organization of cells in the prechordal mesoderm (PCM) of the gastrula,
which is the sub-region of anterior mesoderm that gives rise to the muscles of the
iii
head. I found that during the middle of gastrulation, PCM cells were oriented with
their long axes perpendicular to the overlying blastocoel roof (BCR) and that the
orientation of these cells is BCR dependent. By the end of gastrulation, I found
that the PCM had thinned from a multi-layered tissue to single layer of cells in
contact with the BCR, suggesting radial interaction of the PCM. Furthermore,
cells in corresponding regions on the lateral and ventral sides of the embryo were
found to be oriented similarly, suggesting that radially directed movements could
be common throughout the anterior mesoderm.
Three isoforms of the Platelet Derived Growth Factor A (PDGF-A) are expressed
in the BCR and its cognate receptor, PDGFRα, is expressed in the PCM. I have
shown that two isoforms of the PDGF-A isoforms (lf-PDGF-A and int-PDGF-A)
remain associated with the surface of secreting cells and thus signal over a short
range, while a third (sf-PDGF-A) is diffusible and can signal over long distances.
My work has shown that radial intercalation of the PCM is instructively regulated
by a concentration gradient of sf-PDGF-A, which forms in the mesoderm over a
distance of approximately 200 µm by the diffusion of molecules through
intercellular gaps. My work describes for the first time, the molecular regulation of
radial intercalation.
iv
Acknowledgements First, I would like to thank Rudi Winklbauer. Without you Rudi, none of this work
would have been possible. You are a true scientist, one who is driven by a basic
non-compromising need to explore the mechanics of nature. You are an
inspiration in the way that you relentlessly follow your passion despite any
opposition. I want to thank you for the independence and the support you have
given me throughout this project. It has been instrumental in helping me develop
independence in my research. My time in your lab has been on of the most
influential experiences of my life and I thank you for the opportunities you have
afforded me.
Profs. Ashley Bruce and Tony Harris, thank you both for your guidance, advice
and the criticisms of my work over the years. The passion for research that you
express has been inspirational.
Thank you to the past and present members of the Winklbauer lab for your
suggestions and assistance. Olivia, Tina and Hiro, thank you for training me in
everything Xenopus. Without the three of you, I would never have been able to
start this work let alone finish it.
I would like to thank the members of the 6th floor labs, my vertebrate colleagues
in the Bruce and Tropepe labs especially, for your support and sharing of
v
reagents. In particular, I’d like to thank Stephanie Lepage for the sharing of ideas
and the many supportive lunch discussions.
To all of my friends, thank you for your support and understanding over the last
six years. In particular, I’d like to thank Jonathan Mitchell who has seen me
through the good and the bad times and who has been a rock solid emotional
support. I’d also like to thank Brough Perkins for his love and support throughout
the writing process.
Lastly, but certainly not least, I’d like to thank my parents and my grandparents
for their unconditional love, trust, support and understanding throughout this
whole process. You raised me and were instrumental in shaping me into the
person I am today, in a way, you own this work as much as I do.
vi
Table of Contents
Chapter One: Introduction ............................................................................................................ 1
1.1: Gastrulation in Xenopus ................................................................................................... 2
1.1.1: Anatomy of the Xenopus gastrula ................................................................................. 6
1.1.2: Convergent Extension: medio-lateral and radial cell intercalation .............................. 10
1.1.3: Epiboly ........................................................................................................................ 17
1.1.4: Vegetal Rotation: Internalizing the vegetal cell mass ................................................. 19
1.1.5: Directional cell migration of the anterior mesoderm .................................................... 20
1.2: Platelet derived growth factor signaling in Xenopus gastrulation ............................. 23
1.2.1: Platelet derived growth factor ligands and receptors .................................................. 24
1.2.2: Platelet derived growth factor ligands and receptors are expressed in adjacent tissue
layers during development .................................................................................................... 32
1.2.3: Signaling downstream of platelet derived growth factor receptors ............................. 34
1.2.4: Platelet derived growth factor signaling during Xenopus gastrulation ........................ 37
1.3: Molecular gradient formation: mechanisms and kinetics. .......................................... 43
1.3.1: Mechanisms of molecular gradient formation ............................................................. 44
1.3.2: Kinetics of gradient formation: tissue level versus molecular level. ............................ 58
1.4: Outline and Objectives .................................................................................................... 60
Chapter Two: The prechordal mesoderm undergoes intercellular migration and radial
intercalation during gastrulation ............................................................................................... 63
2.1: Introduction ...................................................................................................................... 64
2.2: Results .............................................................................................................................. 66
2.2.1 The dorsal, lateral and ventral mesoderm can be subdivided into distinct cell groups
based on gene expression and morphological evidence ...................................................... 66
vii
2.2.2: During gastrulation, mesoderm cells are unipolar and produce lamelliform protrusions
.............................................................................................................................................. 76
2.2.3: LEM, prechordal and involuted chordamesoderm mesoderm cells are oriented toward
the BCR ................................................................................................................................ 83
2.2.4: Prechordal mesoderm cells undergo radial intercalation at the mesoderm/ectoderm
boundary ............................................................................................................................... 98
2.2.5: Intercellular migration drives prechordal mesoderm radial intercalation ................... 101
2.2.6: Involuted lateral and ventral mesoderm cells are oriented toward the BCR ............. 109
2.3: Discussion ...................................................................................................................... 119
2.3.1 Complementing in vitro explant studies with intact embryo studies ........................... 119
2.3.2 Mesoderm regions undergo region specific morphogenetic movements ................... 122
2.3.3 Intercellular migration and radial intercalation ........................................................... 127
2.4: Materials and Methods .................................................................................................. 131
2.4.1: Embryos and microinjections .................................................................................... 131
2.4.2: In-Situ Hybridization and In-Situ Probe Synthesis .................................................... 131
2.4.3: Scanning Electron Microscopy .................................................................................. 132
2.4.4: Transmission Electron Microscopy ........................................................................... 133
2.4.5: Confocal Microscopy ................................................................................................. 134
2.4.6: Explants .................................................................................................................... 134
2.4.7: Statistical Analysis .................................................................................................... 135
Chapter Three: PDGF-A controls prechordal mesoderm cell orientation and radial
intercalation during gastrulation ............................................................................................. 136
3.1: Introduction .................................................................................................................... 137
3.2: Results ............................................................................................................................ 139
3.2.1: Expression of PDGF-A isoforms is restricted to the inner cell layer of the blastocoel
roof ...................................................................................................................................... 139
viii
3.2.2: Inhibition of PDGF signalling interferes with pre-chordal mesoderm radial
intercalation, but not with chordamesoderm cell orientation ............................................... 149
3.2.3: sf-PDGF-A is an instructive cue required for radial orientation of prechordal
mesoderm cells ................................................................................................................... 152
3.2.4: sf-PDGF-A is required for directional intercellular mesoderm migration in an explant
system ................................................................................................................................ 164
3.2.5: An instructive role for sf-PDGF-A signaling in directional migration ......................... 167
3.3: Discussion ...................................................................................................................... 178
3.3.1: A mechanism for radial cell intercalation in the prechordal mesoderm ..................... 178
3.3.2: Distinct roles for long and short PDGF-A splice isoforms in cell orientation: contact-
dependent and long-range signaling ................................................................................... 179
3.3.3: Patterns of cell orientation and radial intercalation in Xenopus gastrulation ............ 184
3.4: Materials and Methods .................................................................................................. 185
3.4.1: Embryos and microinjections .................................................................................... 185
3.4.2: Explants .................................................................................................................... 186
3.4.3: Scanning Electron Microscopy .................................................................................. 186
3.4.4: mRNA Isolation/RT-PCR .......................................................................................... 186
3.4.5: Constructs, Morpholinos and mRNA Synthesis ........................................................ 186
3.4.6: In-Situ Hybridization and In-Situ Probe Synthesis .................................................... 187
3.4.7: Statistical Analysis .................................................................................................... 187
Chapter Four: The short splice isoform of PDGF-A forms a chemoattractant gradient by
diffusion of molecules through the extracellular space ....................................................... 188
4.1: Introduction .................................................................................................................... 189
4.2: Results ............................................................................................................................ 192
4.2.1: Short and long PDGF-A isoforms have different extracellular localizations .............. 192
4.2.2: sf-PDGF-A is found distant from its source, in intercellular spaces between mesoderm
cells ..................................................................................................................................... 199
ix
4.2.3: sf-PDGF-A forms an extracellular gradient that fits a single exponential decay function
............................................................................................................................................ 210
4.2.4: The effective diffusion coefficient Deff is consistent with formation of a sf-PDFG-A-
eGFP gradient by diffusion through extracellular spaces ................................................... 234
4.3: Discussion ...................................................................................................................... 238
4.3.1: The cell retention motif determines if a PDGF-A isoform can form a concentration
gradient ............................................................................................................................... 239
4.3.2: The sf-PDGF-A gradient likely forms by diffusion of molecules through intercellular
spaces ................................................................................................................................ 240
4.3.3: Potential factors influencing the effective diffusion coefficient .................................. 244
4.3.4: The regulation of molecule degradation during gradient formation ........................... 248
4.4: Materials and Methods .................................................................................................. 253
4.4.1: Embryos and Microinjections .................................................................................... 253
4.4.2: eGFP and Myc tagged constructs ............................................................................. 253
4.4.3: mRNA Synthesis ....................................................................................................... 255
4.4.4: Explants .................................................................................................................... 255
4.4.5. Scanning Electron Microscopy .................................................................................. 256
4.4.6: Transmission Electron Microscopy ........................................................................... 256
4.4.7: Antibody Staining ...................................................................................................... 256
4.4.8: Confocal Microscopy ................................................................................................. 256
4.4.9: Image Processing ..................................................................................................... 257
4.5: Appendix ......................................................................................................................... 258
Chapter Five: Final Model and References ............................................................................ 269
5.1: Prechordal mesoderm morphogenesis: the cellular basis and the molecular
regulation ............................................................................................................................... 270
5.2: References ..................................................................................................................... 274
x
List of Tables
Table 2.1: The proportion of total mesoderm occupied by individual mesoderm subtypes. ......... 74
Table A1: The calculated f1 and f2 values for the range of t values .......................................... 261
Table A2: Error function approximation values for f1 and f2 for the indicated value of t ............ 262
Table A3: Calculated C!"' (τ) values for the indicated value of t ................................................... 263
Table A4: C!"' (τ) and t values with the corresponding values τ!" for experimentally derived C!. 267
xi
List of Figures Figure 1.1: Xenopus gastrula fate map ........................................................................................... 5
Figure 1.2: Major cell movements occurring during Xenopus gastrulation ..................................... 8
Figure 1.3: Platelet Derived Growth Factor Family Ligands ......................................................... 27
Figure 1.4: PDGFRa and associated signaling pathways ............................................................ 30
Figure 2.1: The dorsal, lateral and ventral mesoderm are made up of sub-regions ..................... 69
Figure 2.2: Mapping of dorsal, ventral and lateral mesoderm regions on scanning electron
micrographs ................................................................................................................................... 72
Figure 2.3: PCM cells extend lamelliform protrusions toward the BCR in sagittal and transverse
planes ............................................................................................................................................ 79
Figure 2.4: PCM cells become significantly elongated in the sagittal plane during gastrulation ... 82
Figure 2.5: PCM cells become significantly elongated in the transverse plane during gastrulation
....................................................................................................................................................... 86
Figure 2.6: The long axes of mesoderm cells are oriented parallel to the BCR at the start of
gastrulation .................................................................................................................................... 90
Figure 2.7: Internalized PCM and chordamesoderm cells are oriented toward the BCR ............. 94
Figure 2.8: LEM, PCM and CM exhibit distinct cell morphologies when viewed from the BCR
apposed surface ............................................................................................................................ 97
Figure 2.9: PCM thins to a single cell layer by the late gastrula stage ....................................... 100
Figure 2.10: PCM undergoes radially directed cell rearrangements ........................................... 104
Figure 2.11: PCM radial intercalation in vitro .............................................................................. 107
Figure 2.12: PCM cells migrate directionally in vitro ................................................................... 111
Figure 2.13: Directional migration of PCM cells in vitro is BCR dependent ................................ 114
Figure 2.14: Involuted lateral mesoderm and LEM orientation is similar to their dorsal
counterparts ................................................................................................................................. 116
xii
Figure 2.15: Involuted ventral mesoderm and LEM orientation is similar to their dorsal
counterparts ................................................................................................................................. 118
Figure 2.16: Electron microscropy of the LEM ............................................................................ 124
Figure 3.1: The structure of Xenopus PDGF-A isoforms ............................................................ 141
Figure 3.2: Expression of PDGF-A and PDGFRa in the Xenopus gastrula ................................ 144
Figure 3.3: PDGF-A isoforms are highly conserved between species ....................................... 148
Figure 3.4: PDGF-A inhibition disrupts PCM radial intercalation ................................................ 151
Figure 3.5: PDGF-A knockdown by morpholino oligonucleotides disrupts the orientation of PCM
cells ............................................................................................................................................. 154
Figure 3.6: PDGF-A knockdown by morpholino oligonucleotides disrupts the orientation of
involuted ventral mesoderm cells ................................................................................................ 157
Figure 3.7: PDGF signaling knockdown by dominant negative ligand or receptor disrupts PCM
cell orientation ............................................................................................................................. 160
Figure 3.8: sf-PDGF-A is required for radial orientation of PCM cells ........................................ 163
Figure 3.9: Overexpression of PDGF-A constructs in the BCR does not affect PCM cell
orientation .................................................................................................................................... 166
Figure 3.10: Over-expression of sf-PDGF-A in the marginal zone disrupts PCM cell orientation
..................................................................................................................................................... 169
Figure 3.11: The effect of over-expression of sf-PDGF-A in the marginal can be rescued ........ 171
Figure 3.12: PDGF-A MO inhibits PCM radial intercalation in vitro ............................................ 173
Figure 3.13: sf-PDGF-A is required for directional migration of deep PCM cells ........................ 175
Figure 3.14: sf-PDGF-A is an instructive cue for PCM directional migration .............................. 177
Figure 4.1: Visualizing PDGF molecules .................................................................................... 195
Figure 4.2: sf-PDGF-A-eGFP can rescue the PDGF-A morphant phenotype ............................ 198
Figure 4.3: sf-PDGF-A-eGFP is localized to ectoderm intercellular spaces ............................... 202
Figure 4.4: int-PDGF-A-eGFP is localized to ectoderm cell membranes ................................... 204
Figure 4.5: lf-PDGF-A-myc localization is similar to that of int-PDGF-A-eGFP .......................... 207
xiii
Figure 4.6: sf-PDGF-A-eGFP forms a visible gradient in mesoderm tissue ............................... 209
Figure 4.7: sf-PDGF-A-eGFP is only observed in intercellular gaps .......................................... 212
Figure 4.8: sf-PDGF-A-eGFP in intercellular spaces .................................................................. 216
Figure 4.9: int-PDGF-A-eGFP remains localized to the mesoderm/ectoderm boundary ............ 218
Figure 4.10: The sf-PDGF-A gradient fits a single exponentional function ................................. 221
Figure 4.11: There is no change in average decay length (l) by increasing sf-PDGF-A expression
..................................................................................................................................................... 223
Figure 4.12: int-PDGF-A-eGFP does not form a gradient .......................................................... 228
Figure 4.13: sf-PDGF-A-eGFP forms a steady state gradient .................................................... 231
Figure 4.14: sf-PDGF-A-eGFP in extracellular spaces moves relative to cells as cells migrate 233
Figure A1: Calculation of the degradation constant for sf-PDGF-A-eGFP ................................. 265
Figure 5.1: A model for the cellular basis of prechordal mesoderm morphogenesis .................. 273
xiv
List of Appendices Appendix 1………………………………………………………………………..........................…..258
1
Chapter One: Introduction
Sections of this chapter were published in Winklbauer, R. and Damm, E. W. (2011) Internalizing the vegetal cells mass before and during amphibian gastrulation: vegetal rotation and related movements.
WIREs Dev Biol, 1 (2): 301-306
2
1.1: Gastrulation in Xenopus During the early phase of animal development coordinated cell movements
convert a relatively unstructured ball of cells into a highly organized embryo.
During this process the germ layers (ectoderm, mesoderm and endoderm) are
positioned by active cell movements and passive cell re-arrangements resulting
in the internalization of prospective mesoderm and endoderm and the spreading
of prospective ectoderm over the surface of the embryo. This process is termed
“gastrulation”, initially named after the phase of embryogenesis when the gut
begins to form. Although the set of cell movements that constitute gastrulation
vary from species to species, all animal phyla undergo gastrulation as a process
(Leptin, 2005). Many of these movements are region autonomous but have
influence on the movements of other regions of the embryo. Therefore, because
gastrulation is a process and not a single movement, any understanding of
gastrulation must be a systems level understanding with respect to
morphogenetic movements. That is, it is necessary to understand the individual
movements occurring in all of the embryo regions.
The African clawed frog, Xenopus laevis, is a major model organism for the study
of early development, and is arguably the most well understood example of
gastrulation in a vertebrate. The large externally developing embryos make this
organism ideal for microinjection and reverse genetic experiments as well as
explantation and live imaging of tissues. The embryos are also very well suited
3
for imaging with scanning and transmission electron microscopy and confocal
microscopy. Gastrulation in Xenopus starts 9 hours after fertilization and lasts for
nearly six hours. Initially, ectoderm begins to undergo epiboly and endoderm is
internalized by vegetal rotation. Mesoderm then undergoes internalization and
subsequently anterior mesoderm undergoes directional migration while the
posterior mesoderm undergoes convergent extension (Figure 1.1).
The cellular basis and molecular regulation of chordamesoderm (CM) convergent
extension has been extensively studied in Xenopus and much focus has been
placed on the role of convergent extension in the elongation of the
anterior/posterior axis of the embryo. The movements of the other mesoderm
regions have not been as extensively studied. In particular, prechordal mesoderm
(PCM) morphogenesis and the contribution of these movements to gastrulation
are not known. My work has focused on describing the cellular and molecular
basis of cell movements of the PCM, a subset of anterior mesoderm cells. I have
found that the PCM undergoes radial intercalation, contributing to the spreading
of the mesoderm layer (see Chapter Two) and that these movements are
instructively regulated by platelet derived growth factor (PDGF) signaling. In
order to emphasize the significance of PCM morphogenesis to the gastrulation
process, each of the known morphogenetic processes occurring during Xenopus
gastrulation will be discussed in detail in this section and are summarized in
Figure 1.1.
4
Figure 1.1: Xenopus gastrula fate map
(A-B) Fate maps of sagitally (A) and laterally (B) fractured mid-gastrula stage
embryos. The prospective fates of ectoderm, endoderm and mesoderm
subregions as determined from the literature are indicated. 1Keller, 1976; 2Dale
and Slack, 1987; 3Keller, 1991; 4Lane and Smith, 1999; 5Walters et al. 2001;
6Colas et al. 2008; 7Niehrs et al. 1993; 8Bothe et al. 2000; 9Chalmers and Slack,
2000; 10Moody, 1987ab.
5
Figure 1.1: Xenopus gastrula fate map
6
1.1.1: Anatomy of the Xenopus gastrula
The Xenopus gastrula can be divided into several regions based on the fate
maps derived from early stage cell labeling and tracing experiments and regional
marker gene expression (Figure 1.2; Keller, 1975; Keller, 1976; Moody, 1987ab;
Dale and Slack, 1987; Niehrs et al. 1993; Bauer et al. 1994; Walters et al. 2001;
Colas et al. 2008). The ectoderm can be divided into two regions based on the
fates of cells in these regions at later stages (Figure 1.2A, B). On the dorsal side
of the embryo, the prospective neuroectoderm overlies the mesoderm and will
differentiate into nervous system structures, while the animal cap, lateral and
ventral ectoderm will give rise to the larval epidermis (Dale and Slack, 1987;
Keller, 1991; Moody, 1987ab).
Several areas of mesoderm have also been identified (Figure 1.2A, B). Axial
mesoderm, including the xBrachyury (XBra) expressing dorsal mesoderm (CM),
and the Goosecoid (Gsc) expressing PCM, produces the notochord (Keller, 1976;
Keller, 1991, Lane and Smith; 1999), and the muscles of the head (Niehrs et al.
1993; Bothe and Dietrich, 2006) respectively. The dorsal, lateral and ventral
leading edge mesendoderm (LEM) regions converge toward ventral side of the
7
Figure 1.2: Major cell movements occurring during Xenopus gastrulation
(A-D) Schematic diagrams showing the major cell movements that occur over
gastrulation. Stage 10 (A), stage 10.5 (B), stage 11 (C) and stage 12 (D)
embryos are represented. Arrows indicate the directions of cell movements
(black arrows, mesoderm; blue arrows, ectoderm; orange arrows, endoderm).
Dashed orange arrows (A), pre-gastrulation emboly; solid orange arrows (A-D),
vegetal rotation; Red arrows in (D), hypothetical anterior movement of PCM. CM,
chordamesoderm; PCM, prechordal mesoderm; LEM, leading edge
mesendoderm; Ant, anterior; Pos, posterior; V, ventral; D, dorsal.
8
Figure 1.2: Major cell movements occurring during Xenopus gastrulation
9
embryo to close the mesoderm mantle during gastrulation and will form blood
islands along with the anterior ventral mesoderm during tailbud stages (Keller,
1976; Keller, 1991; Lane and Smith, 1999; Colas et al. 2008). Somitic mesoderm
(SM) is derived from the dorso-lateral to ventral XBra expressing region (Keller,
1976; Dale and Slack, 1987; Keller, 1991; Lane and Smith, 1999) and the heart
and circulatory system form from the anterior dorso-lateral mesoderm (Keller,
1976; Keller, 1991; Lane and Smith, 1999; Walters et al. 2001). Body wall
muscles are derived from the lateral plate mesoderm, which arises from the
anterior ventro-lateral mesoderm (Lane and Smith, 1999) and the pronephros
develops from the ventral XBra expressing mesoderm.
Endoderm subregions have also been identified (Figure 1.2A). The pharyngeal
endoderm is located in the dorso-anterior endoderm, adjacent to the PCM
(Keller, 1976; Chalmers and Slack, 2000), whereas the small and large intestines
are derived from the ventro-vegetal endoderm (Chalmers and Slack, 2000). The
gut-associated organs such as the liver, gall bladder, pancreas and stomach are
derived from the ventro-anterior endoderm located adjacent to the ventral anterior
mesoderm (Chalmers and Slack, 2000). To date, detailed fate and specification
maps of the gastrula are lacking, therefore only the general location of the groups
of cells that give rise to the structures and organs described above are known.
Further subdividing the gastrula into groups of cells that correspond to their future
fates would be advantageous as it would allow for a region based study of the
10
specific morphogenetic movements required during gastrulation to build these
tissues.
1.1.2: Convergent Extension: medio-lateral and radial cell intercalation Convergence and extension is a morphogenetic process that narrows and
elongates tissue. This outcome can be accomplished by several mechanisms
such as cell rearrangements (Bertet et al. 2004; Blankenship et al. 2006),
including active cell intercalation (Keller, 1985; Keller and Tibbetts, 1989,
Heisenberg et al. 2000, Sepich et al. 2000, Yamanaka et al. 2007), oriented cell
divisions (Gong et al. 2004) and cell shape changes (Solnica-Krezel and Sepich,
2012). For decades, it has been known that convergence and extension
movements play a role in the elongation of the anterior/posterior axis of the
amphibian embryo (Schechtman, 1942) and this process has since been studied
extensively in Xenopus.
The cellular basis of “convergent extension” In the Xenopus embryo, convergence and extension behaviour is called
“convergent extension” and it occurs most strongly in the posterior dorsal
mesoderm (Keller et al. 1985, Keller and Danilchik, 1988). Studies of this process
have largely been done with in vitro explants in which, superficial (surface of the
embryo) and deep cells from the dorsal side of two embryos are explanted and
11
then combined (Keller et al. 1985). These “Keller Sandwich” explants include five
types of cells, animal cap cells (ectoderm), prospective neuroectoderm, CM, SM
and PCM. The explants are initially short and wide, however around the middle of
gastrulation, 11 hours post fertilization (h.p.f.), the prospective neuroectoderm
and the chordamesoderm begin to converge and extend, resulting in a dramatic
narrowing and elongation of the explant by the end of gastrulation (15 h.p.f.)
(Keller et al. 1985, Keller and Danilchik 1988). The SM showed less dramatic
convergent extension and the PCM formed a rounded group of mesenchymal
cells (Keller et al. 1985). Thus, convergent extension movements are important
for anterior/posterior axis elongation. Importantly, the other regions of mesoderm
undergo their own distinct tissue autonomous cell movements. This means that
while the effect of convergent extension on explanted tissue is dramatic, it is not
a driver for morphogenesis of other mesoderm regions.
Close analysis of converging and extending chordamesoderm in explants
revealed that the majority of cells were bipolar with their long axes oriented in a
medial to lateral direction with respect to the anterior/posterior midline of the
explant (Keller and Tibbetts, 1989, Wilson and Keller, 1991, Keller, 2004).
Additionally, cells undergoing radial intercalation, that is moving into the plane of
the surface being imaged from deeper in the explant, were observed. This
movement likely plays a role in thinning of the explant (Wilson and Keller, 1991).
Thus, the cellular basis of convergent extension is the intercalation of medially to
12
laterally oriented cells at the explant midline (dorsal midline in the embryo) with
radial intercalation thinning the tissue and likely further contributing to elongation.
Over the course of gastrulation, cells become stacked behind each other in the
anterior to posterior direction forming the notochord (Keller and Tibbetts 1989,
Keller et al. 1989).
The “convergent extension” mechanism of notochord formation first discovered in
Xenopus is highly conserved amongst vertebrates. At the start of gastrulation in
zebrafish, mesoderm cells located at more lateral positions, converge as
individual migrating cells toward the dorsal side of the embryo (Sepich et al.
2000, Yamashita et al. 2002, Myers et al. 2002). After arriving dorsally, they
become medio-laterally oriented, intercalate at the dorsal midline and become
stacked behind each other in the anterior to posterior direction to form the
notochord (Heisenberg et al. 2000, Sepich et al. 2000, Myers et al. 2002).
Furthermore, in mouse, the trunk notochord forms by a similar convergent
extension process. Trunk notochord precursor cells are internalized through the
node after which the cells become elongated in a medio-lateral direction
(Yamanaka et al. 2007). These cells then intercalate at the dorsal midline forming
two rows of notochord plate cells in the anterior posterior direction (Yamanaka et
al. 2007).
13
Elongation of a tissue can also be accomplished by radial intercalation and is
thought to be the principle method of elongation in the SM of Xenopus and
zebrafish (Wilson et al. 1989; Yin et al. 2008). In Xenopus SM explants, radial
intercalation occurs in groups of cells (Wilson et al. 1989). That is, it is more likely
that intercalation will occur near other newly intercalated cells. This suggests that
there could be regulation of cell-cell contacts in these cluster sites that make it
easier for deeper cells to move between the more superficial cells (Wilson et al.
1989). Intercalation results in the thinning and elongation of the tissue.
Interestingly, elongation of the explants is not isotropic but rather occurs without
widening of the tissue (Wilson et al. 1989). Similar behaviour is seen in vivo in
zebrafish somitic mesoderm (Yin et al. 2008). In this system, cells intercalating
from deeper in the tissue preferentially separate cells that are anterior/posterior
neighbours resulting in anisotropic spreading of the tissue (Yin et al. 2008). This
works because the intercalating cell preferentially separates two cells that were
initially in contact with each other at their anterior and posterior sides
respectively. The newly intercalated cell forms new anterior and posterior
contacts with the cells that were separated by the insertion of the new cell.
Contacts are also made between the newly intercalated cells and lateral cells.
SM cells are all similar in size, thus the newly intercalated cell occupies the same
lateral area as the cells that were displaced in the anterior/posterior directions
and extension will occur in the anterior/posterior direction without expansion
14
laterally. A similar process has been proposed to explain the anisotropic
spreading of Xenopus SM explants (Wilson et al. 1989).
The molecular regulation of “convergent extension” Convergent extension involves the intercalation of oriented and polarized cells at
the dorsal midline of the embryo and the cues responsible for orienting, polarizing
and guiding these cells have been investigated. Orientation of cells appears to
require the patterning of the anterior/posterior axis of the CM (Ninomiya et al.
2004). Cells have positional identities along the anterior/posterior axis and only
cells with matching positional identities intercalate with each other (Ninomiya et
al. 2004). The anterior/posterior pattern of the CM can be seen in a
countergradient of Chordin (anterior) and XBra expression (posterior). It is not
known if cell orientation is directly regulated by this countergradient or if cell
orientation and the expression of these genes are the result of patterning by
Nodal and Lefty factors (Branford and Yost, 2002; Dougan et al. 2003; Ninomiya
et al. 2004).
CM cells undergoing convergent extension are bipolar, extending lamelliform
protrusions from opposite poles of the cell (Keller and Tibbetts, 1989; Wallingford
and Harland, 2001). The control of this polarity is not fully understood but likely
involves an interplay between the anterior/posterior patterning of CM tissue and
members of the non-canonical Wnt signaling pathway (Ninomiya et al. 2004;
15
Tada and Kai, 2009). A core set of non-canonical Wnt signaling (NC-Wnt
signalling) molecules called the planar cell polarity (PCP) proteins, are important
in establishing the polarity of wing hair extension from cells in the Drosophila
wing epithelium (Gubb and Garcia-Bellido, 1982; Wong and Adler, 1993). In
vertebrates, NC-Wnt signaling involves extracellular Wnt molecules, glypicans,
membrane proteins and receptor tyrosine kinase co-receptors that interact with
Frizzled cell surface receptors. Frizzled receptors signal through Dishevelled,
which is membrane localized and subsequently facilitates interactions with
downstream signaling molecules, kinases and GTPases. These interactions
ultimately result in modulation of the actin cytoskeleton and target gene
expression (Tada and Kai, 2009).
Disruption of NC-Wnt signaling components prevents convergent extension.
Dishevelled is localized to the cell membrane of CM cells undergoing convergent
extension and apparently, disruption of Dishevelled function causes these cells to
lose polarity, which results in the inhibition of convergent extension (Wallingford
et al. 2000). Wnt11 in cooperation with glypican 4, a heparin sulfate proteoglycan
(HSPG), frizzled7 and the receptor tyrosine kinase, Ror2, functioning as a co-
receptor interacting with Wnt5a, have been shown to regulate convergent
extension in Xenopus upstream of Disheveled (Djiane et al. 2000; Tada and
Smith, 2000; Oishi et al. 2003; Hikasa et al. 2002). However, the effect of
disrupting NC-Wnt signaling in this system is unclear. A change in cell orientation
16
as a result of disrupting NC-Wnt signaling would have been missed and could
have been confused with a loss of cell polarity if the change in orientation
resulted in the cell long axis pointing into the explant rather than being oriented in
the plane being imaged. This is because measurements of cell lengths/widths
were made from Keller Explants by looking at the explant surface only
(Wallingford et al. 2000). An analysis of Keller Explants and intact embryos
fractured in multiple planes will be necessary to answer this question.
Interestingly, Wnt11 is a known target gene of XBra (Tada and Smith, 2000). This
may suggest that anterior/posterior patterning of the chordamesoderm is required
for the expression of key NC-Wnt signaling regulators.
Paraxial protocadherin (PAPC) is a transmembrane molecule that regulates
downstream signaling processes. Expression of PAPC in CM is regulated by
Wnt5a signaling through Ror2 (Schambony and Wedlich, 2007) and it has been
shown that signaling through PAPC alongside NC-Wnt signaling is required for
normal convergent extension (Unterseher et al. 2004). Surprisingly, when PAPC
function is blocked, explants elongate normally but fail to constrict (Unterseher et
al. 2004). This suggests that constriction and elongation behaviour is separable
both morphologically and molecularly. Thus, although it has been shown that it is
required, the role of NC-Wnt signaling in convergent extension has not been
clearly defined.
17
1.1.3: Epiboly During epiboly, the ectodermal blastocoel roof (BCR) undergoes morphogenetic
movements that cause it to spread anisotropically toward the blastopore over the
surface of the embryo so that by the end of gastruation, the embryo surface is
covered by ectoderm (Figure 1.1A-D). In Xenopus, epiboly starts before
gastrulation at stage 9 (7 h.p.f.) on the dorsal side of the embryo (Papan et al.
2007a). Epiboly spreads laterally and begins on the ventral side by stage 10+ (10
h.p.f.) (Papan et al. 2007a). When epiboly starts, all regions of the BCR consist of
multiple cell layers. The dorsal and ventral marginal zone BCR are the thickest,
followed by the prospective neuroectoderm and the apex of the animal cap
(Keller, 1980). The cellular mechanism driving epiboly in Xenopus is not well
understood and is likely dependent on the region of the BCR in question,
although cells in each of these regions appear to undergo intercalation
movements that result in the thinning and spreading of the ectoderm layer
(Keller, 1980). Whether thinning is due to active cell movements or passive cell-
rearrangments has not been fully investigated and appears to be region
dependent (Marsden and DeSimone, 2001). Interestingly, the downward
movement of the ectoderm occurs simultaneously with the clockwise rotation of
the mesodermal dorsal marginal zone (Figure 1.1A), which results in mesoderm
tissue becoming apposed to the inner layer of the BCR (Papan et al. 2007a). The
rotation of mesoderm tissue is independent of BCR morphogenesis (Winklbauer
and Schurfeld, 1999) and the attachment of mesoderm and BCR at the start of
18
gastrulation suggests that forces generated by this rotation could be involved in
pulling the BCR downward toward the blastopore. The animal cap epithelium
appears to be under tension and behaves in an elastic fashion when tension is
released (Luu et al. 2011). In the embryo, this tension could be a result of dorsal
marginal zone movements, however, this specific possibility has not been
investigated. Thus, epiboly in Xenopus may be a primarily autonomous process
constituting the thinning and spreading of different regions of the BCR over the
embryo though active and passive cell re-arrangements, however, the
involvement of forces generated by the movements of the attached mesoderm
cannot be excluded.
Fibronectin has been implicated in the regulation of intercalation during epiboly in
Xenopus (Marsden and DeSimone, 2001). The inner layer of the BCR is coated
with an extracellular matrix made up of fibrillar fibronectin (Winklbauer, 1998;
Marsden and DeSimone, 2001). When fibronectin fibrillogenesis was inhibited
using function blocking antibodies, epiboly was inhibited and the BCR remained
several cell layers thick by late gastrulation (Marsden and DeSimone, 2001). This
was because cells were mis-oriented and intercalation was unproductive
(Marsden and DeSimone, 2001). Similar effects were seen when inhibiting β1
containing integrins (Marsden and DeSimone, 2001). Therefore, ectoderm cells
require interaction with fibronectin through integrins for normal intercalation
behaviour. This interaction may provide an orienting signal that is required for
19
cells to intercalate in the right direction during epiboly (Marsden and DeSimone,
2001).
1.1.4: Vegetal Rotation: Internalizing the vegetal cell mass In Xenopus, internalization of endoderm cells that make up the vegetal cell mass
may start as early as cleavage stages and progresses through gastrulation. Prior
to the start of gastrulation, the internalization process is called pre-gastrulation
emboly and involves the inward movement of vegetal cells from the vegetal base
of the embryo toward the blastocoel floor (Figure 1.1A; Bauer et al. 1994; Papan
et al. 2007ab; Wiklbauer and Damm, 2011). As cells are internalized, they leave
the vegetal base region of the embryo resulting in constriction of the base while
internalized cells insert into the blastocoel floor causing expansion and an
increase in the concavity of the floor (Figure 1.1A-D; Papan et al. 2007ab;
Winklbauer and Damm, 2011). It is not clear what drives these movements,
however active migration of cells toward the blastocoel floor and the constriction
of the outer epithelium at the base of them embryo are possible mechanisms
(Winklbauer and Damm, 2011).
After the start of gastrulation, the inward movement of vegetal cells becomes
more intense in the periphery of the dorsal vegetal cell mass (Figure 1.1B;
Winklbauer and Schurfeld, 1999). Like many of the gastrulation movements
discussed up to this point, vegetal rotation is driven by active, tissue autonomous
20
movements that can be observed in explants of vegetal tissue (Winklbauer and
Schurfeld, 1999). Peripheral cells are elongated in an animal-vegetal direction,
parallel to the BCR (Damm and Winklbauer, 2011). Furthermore, small
protrusions are occasionally seen at the animally pointing ends (Damm and
Winklbauer, 2011). The orientation and morphology of these cells is consistent
with animally oriented active cell migration. Vegetal rotation not only result in the
internalization of endoderm but apparently plays a role in the initial phase of
mesoderm internalization. The rotation of the dorsal marginal zone, which results
in the apposition of the mesoderm to the inner layer of the BCR, appears to be
the result of the expansion of the blastocoel floor and the inward movement of
cells at the base of the embryo (Winklbauer and Schurfeld, 1999). Thus, although
the molecular regulation of vegetal rotation has yet to be elucidated, the role in
gastrulation played by this movement is instrumental to the internalization of
endoderm and possibly mesoderm. Furthermore, epiboly of the dorsal marginal
zone ectoderm, which may be associated with the rotation of mesoderm in the
dorsal marginal zone, may be indirectly influenced by this process.
1.1.5: Directional cell migration of the anterior mesoderm
The anterior mesoderm can be subdivided into two regions, the PCM, which
expresses the transcription factor goosecoid (Gsc) and the leading edge
mesendoderm (LEM) (Winklbauer, 1990; Winklbauer and Nagel, 1991; Niehrs et
al. 1993). Directional migration of the LEM has been well described and is
21
thought to be an important process in the spreading of mesodermal cells over the
inner surface of the embryo. The region moves autonomously as a cohesive
group of cells toward the animal pole on the adhesive substrate of the inner BCR
(Figure 1.1B,C; Winklbauer, 1990; Winklbauer and Nagel, 1991). Thus, LEM
migration is a model for directional collective cell migration. Cells that are in
contact with the BCR extend lamelliform protrusions in the direction of migration,
toward the animal pole (Winklbauer and Selchow, 1992; Nagel et al, 2004).
Typically, models of LEM morphogenesis have required that the cells use the
BCR inner surface as a substrate for migration. Indeed explants of LEM tissue
can attach and migrate directionally in vitro on explanted BCR or on extracellular
matrix transferred from the inner layer of the BCR to a glass slide (Nakatsuji and
Johnson 1983a; Winklbauer, 1990; Winklbauer and Nagel, 1991; Winklbauer et
al. 1996). However, in vivo it appears that some locomotory protrusions attach to
adjacent mesoderm cells rather than the BCR (Figure 2.8C). Furthermore,
transmission electron micrographs of the mesoderm/ectoderm boundary do not
show protrusions crossing the separation gap (Figure 2.16A). Thus, intercellular
migration (the migration of cells over other cells) may play an important role in
this process. Thus, the model of LEM morphogenesis requires updating to take
these new observations into account.
Fibrillar fibronectin plays an important role in regulating LEM migration. At the
22
start of gastrulation, inner layer BCR cells assemble a layer of fibrillar fibronectin
on the inner surface of the BCR (Nakatsuji and Johnson, 1983b; Winklbauer and
Nagel, 1991; Winklbauer, 1998). This matrix is required for gastrulation in
urodeles and plays an important role in the regulation of cell migration in
amphibians like Xenopus (Boucaut et al. 1984a; Boucaut et al. 1984b; Darribere
et al. 1988; Nakatsuji and Johnson, 1983a; Nakatsuji and Johnson, 1982). Even
though fibronectin is known to have a role in cell-matrix adhesion in vitro (Schlie-
Wolter et al, 2013), the attachment of LEM cells to the BCR did not depend on
fibronectin, suggesting that cell-cell adhesion molecules such as cadherins may
regulate adhesion here (Winklbauer and Keller, 1996). Interactions between this
fibronectin matrix and LEM cells are required for the extension of lamelliform
protrusions (Winklbauer and Selchow, 1992). Thus, fibronectin may play a
signaling function that regulates the stability of cellular protrusions, which is
required for cell migration. Interestingly, the BCR has an innate polarity, which is
observed in extracellular matrix and associated molecules and can be measured
by cell behaviour in vitro (Nagel and Winklbauer, 1999). The BCR matrix and any
associated molecules can be transferred to a glass slide for in vitro studies
(Nakatsuji et al, 1983a). When explants of LEM cells are placed on this
“conditioned substrate”, the explants move toward the end of the slide that
corresponds to matrix from the animal pole (Nagel and Winklbauer, 1999; Nagel
et al, 2004). This indicates that there is a matrix associated guidance signal. Lf-
PDGF-A has been shown to be involved (see below). Thus, fibronectin and
23
PDGF-A together may function to stabilize lamelliform protrusions and provide
directional information, regulating the migration of LEM cells.
1.2: Platelet derived growth factor signaling in Xenopus gastrulation
PDGF molecules and their associated receptor tyrosine kinases belong to an
evolutionarily conserved family in vertebrates with diverse functions. PDGF and
PDGF receptors are proto-oncogenes and therefore, PDGF signaling is most
commonly studied for its role in cancer progression. In particular, improperly
regulated autocrine PDGF signaling has been implicated in tumour cell
proliferation, angiogenesis of tumours, epithelial to mesenchymal transition,
cancer metastasis and tumour resistance to drug therapies (Andrae et al. 2008;
Nister et al. 1988; Hermanson et al. 1992; Furuhashi et al. 2004; Jechlinger et al.
2003; Heuchel et al. 1999). However, like many of the genes that regulate cancer
processes, PDGF signaling is essential for a number of developmental processes
such as directional cell migration, programmed cell death, primordial germ cell
migration, neural crest morphogenesis and the organogenesis of several organs
(Andrae et al. 2008). During Xenopus development, PDGF signaling has been
found to regulate multiple processes (Ataliotis et al. 1995; Utoh et al. 2003; Van
Stry et al. 2004; Nagel et al. 2004; Van Stry et al. 2005; Andrae et al. 2008
Damm and Winklbauer, 2011). The diverse functions of PDGF signaling are
correlated with the large number of downstream signaling pathways that can be
24
activated by the receptors.
I have shown that long range PDGF-A signaling is an essential regulator of
prechordal mesoderm morphogenesis (see Chapter Three), thus in this section I
will discuss the structure of the PDGF ligands and receptors, the dynamics of
their interactions and the long and short range signaling functions of PDGF.
PDGF-A signaling plays multiple roles in the development of the prechordal
mesoderm; therefore in order to put the morphogenetic role played by signaling
into context, the other roles of PDGF signaling during early Xenopus
development will be discussed in detail.
1.2.1: Platelet derived growth factor ligands and receptors PDGF family ligands The PDGF family of ligands is made up of four members, PDGF-A, B, C and D,
encoded by four separate genes and divided into two subfamilies (Figure 1.3);
PDGF-A and B are type I ligands while PDGF-C and D are type II ligands. Type I
PDGFs are characterized by positively charged arginine and lysine residues in
their C-termini, (Figure 1.3; Raines and Ross, 1992; Kelly et al. 1993; Andersson
et al. 1994). Type II PDGFs have an N-terminal CUB domain, which is cleaved
after secretion (Figure 1.3; Li et al. 2000; Bergsten et al. 2001; Hoch and
Soriano, 2003). The PDGF ligands are closely related to members of the
Vascular Endothelial Growth Factor (VEGF) and Placental Growth Factor (PlGF)
25
families (Ferrara et al. 2003; Fredricksson et al. 2004a). Homologues of these
molecules are found in species throughout the vertebrate subphylum (Andrae et
al. 2008). Molecules that are similar to the vertebrate PDGF/VEGF family
members have also been identified in invertebrates like Drosophila and C.
elegans. In Drosophila, three homologues called PDGF/VEGF-like ligand 1-3
(Pvf1-3) interact with a PDGF/VEGF-like receptor (McDonald et al. 2003;
Ducheck et al. 2001). Four receptor homologues (VER1-4) and a single ligand
(Pvf1) have been identified in C. elegans (Popovici et al. 2002; Hoch and
Soriano, 2003; Tarsitano et al. 2006). The similarities of the invertebrate ligand
and receptor homologues to vertebrate VEGF ligands and receptors may suggest
that the modern VEGF/VEGFR and PDGF/PDGFR groups diverged from VEGF
and VEGFR like ancestral molecules (Andrae et al. 2008).
PDGF molecules have a conserved PDGF/VEGF core growth factor domain that
contains a set of eight conserved cysteine residues that are important for
receptor binding and ligand dimerization (Hoch and Soriano, 2003; Andrae et al.
2008; Fredricksson et al. 2004a), which occurs by the formation of disulfide
bridges between these conserved cysteine residues (Mercola et al. 1990). PDGF
ligands typically form homodimers, however heterodimers are possible and a
PDGF-AB heterodimer has been identified in human platelets (Stroobant and
Waterfield, 1984). Interestingly, the binding of PDGF-AB has been shown to
26
Figure 1.3: Platelet Derived Growth Factor Family Ligands
Schematic diagram of platelet derived growth factor (PDGF) family members.
The displayed amino acid (aa) lengths are taken from the Xenopus homologues
of the proteins (Xenbase). N, N-terminus; C, C-terminus.
27
Figure 1.3: Platelet Derived Growth Factor Family Ligands
28
activate different downstream signaling pathways from those activated by PDGF-
AA (Ekman et al. 1999).
PDGF family receptors PDGF receptors are receptor tyrosine kinases that are made up of five
extracellular immunoglobulin loops, a transmembrane domain and a split tyrosine
kinase domain (Figure 1.4; Andrae et al. 2008). These receptors can be semi-
promiscuous with respect to ligand binding. PDGFRα typically binds PDGF-AA,
PDGF-BB and PDGF-CC homodimers as well as PDGF-AB heterodimers
(Andrae et al. 2008). PDGFRβ is less promiscuous than PDGFRα and typically
binds PDGF-BB and DD homodimers (Andrae et al. 2008). Heterodimers of
PDGFRα and PDGFRβ are also possible when expression overlaps (Klinghoffer
et al. 2002). Heterodimerized receptors can bind all of the known PDGF ligand
dimers with varying affinities (Andrae et al. 2008).
29
Figure 1.4: PDGFRα and associated signaling pathways
Schematic diagram of a PDGFRα homodimer. Tyrosine residues that are
important in interactions with downstream signaling partners are indicated by
numbers representing their amino acid position (from the Xenopus homologue).
30
Figure 1.4: PDGFRα and associated signaling pathways
31
Extracellular localization of PDGF ligands The localization and activation of PDGF ligands in tissues depends on the ability
of the ligand to associate with the matrix surrounding the secreting cells and
proteolytic processing respectively. In mammals and Xenopus, PDGF-A
undergoes alternative splicing to produce long and short PDGF-A variants that
differ in their abilities to bind extracellular matrix (Figure 1.3; Raines and Ross,
1992; Andersson et al. 1994; Hoch and Soriano, 2003; Andrae et al. 2008). In
chick, alternative splicing generates three PDGF-A isoforms, one of which has
matrix binding potential (Horiuchi et al. 2001). PDGF-A long isoforms have a C-
terminal cell retention motif made up of positively charged amino acids that has
been shown to interact with extracellular matrix molecules like fibronectin and
HSPGs (Raines and Ross, 1992; Andersson et al. 1994; Smith et al. 2009). Long
PDGF-A isoforms do not undergo proteolytic processing of their C-termini and
can remain associated with extracellular matrix in order to perform short range
signaling functions (Nagel et al. 2004, Smith et al. 2009; Damm and Winklbauer,
2011). Short PDGF-A isoforms are soluble molecules that can act at a distance
from their source (Damm and Winklbauer, 2011; Raines and Ross, 1992). PDGF-
B contains a retention motif similar to the one found in long PDGF-A isoforms,
however it undergoes extracellular processing by proteases to free it from
extracellular matrix. The processing enzymes involved here have not been
identified, although thrombin type proteases are candidate molecules (Kelly et al.
1993). PDGF-C and PDGF-D contain N-terminal CUB domains that require
32
proteolytic processing in order for the ligand to become active. Tissue
plasminogen activator has been described as a potential activator of PDGF-C
(Fredriksson et al. 2004b).
1.2.2: Platelet derived growth factor ligands and receptors are expressed in adjacent tissue layers during development
The expression pattern of PDGF ligands and receptors are important in
determining the type of signaling that occurs. During development, paracrine
signaling is apparently the most common form of PDGF signaling since the
expression of PDGF ligands and receptors does not frequently overlap (Damm
and Winklbauer, 2011; Liu et al. 2002ab; Hoch and Soriano, 2002; Ataliotis et al.
1995; Ho et al. 1994; Orr-Urtreger and Lonai, 1992).
A common feature of PDGF ligand and receptor expression during development
is the complimentary expression of ligand and receptor in different but adjacent
cell layers. During mouse development, PDGF-A expression is largely found to
be restricted to epithelial layers such as the primitive ectoderm, surface
ectoderm, myotome, and the olfactory epithelium, among others (Orr-Urtreger
and Lonai, 1992). PDGF-B and PDGF-C are also expressed in cell layers
overlying mesenchymal cell populations (Hoch and Soriano et al. 2003; Aase et
al. 2002). Similarly, in chick embryos PDGF-A is expressed in the overlying
epiblast (Yang et al. 2008). The expression of PDGF receptors appears to be
33
largely localized to the mesenchymal cells underlying these cell layers (Orr-
Urtreger and Lonai, 1992, Hoch and Soriano, 2003; Yang et al. 2008). However,
during early zebrafish development, PDGF-A and PDGFRα expression appears
to be ubiquitous (Liu et al. 2002a; Liu et al. 2002b). This observation is based on
detection of PDGF-A/Rα RNA in cells and therefore, a more restricted localization
of protein function cannot be excluded. However, at later stages of zebrafish
development the characteristic PDGF/PDGFR expression pattern is observed.
PDGF-A expression is found in overlying ectoderm with PDGFRα expression
localized to the mesenchymal cranial neural crest cells (Liu et al. 2002a; Liu et al.
2002b).
In Xenopus, similar patterns of expression are observed during early and later
development. During gastrulation, PDGF-A expression is found localized to the
inner layer cells of the overlying ectoderm while PDGFRα expression is restricted
to the underlying mesenchymal like mesoderm cells (Ataliotis et al. 1995). During
later stages of Xenopus development, PDGF-A expression is found in the
neuroectoderm, otic vesicle and pharyngeal endoderm while,
PDGFRα expression is found primarily in the cephalic neural crest as they
migrate into the visceral arches (Ho et al. 1994). Effectively, PDGF-A is
expressed along the migratory route of the cephalic neural crest cells, which is
strongly suggestive of a role for PDGF-A in regulating movement in these cells.
The expression of PDGF and PDGFRα in adjacent cell layers allows for
34
communication between the overlying layers and deeper mesenchymal cells.
During development, this expression pattern permits PDGF signaling to regulate
chemotaxis, cell fate specification, cell survival and other cellular functions of
these mesenchymal populations.
1.2.3: Signaling downstream of platelet derived growth factor receptors
PDGFRα and PDGFRβ are receptor tyrosine kinases that activate a similar
complement of downstream signaling pathways. Binding of PDGF homo/hetero
dimers triggers receptor dimerization (Hoch and Soriano 2003). Typically,
homodimerization occurs because expression of the two receptors rarely
overlaps, however heterodimerization can occur, for example, in mouse postnatal
neurons (Vignais et al. 1995; Hoch and Soriano, 2003). PDGF receptors contain
five extracellular immunoglobulin loops, the outer three of which are important for
interactions with PDGF ligands (Figure 1.4; Heidaran et al. 1990; Yu et al. 1994).
PDGF ligands likely play a role in keeping receptors together during dimerization,
however the receptors themselves have been shown to physically interact
through their fourth immunoglobulin loops (Omura et al. 1997). This may suggest
that ligand independent signaling can occur due to stochastic receptor
interactions. Upon ligand binding and receptor dimerization, autophosphorylation
occurs resulting in the phosphorylation of key tyrosine residues in the kinase
domain of the receptor. These phosphorylated tyrosine residues are Src
35
homology 2 (SH-2) docking sites for downstream signaling effectors (Figure 1.4).
PDGF associated signaling pathways PDGFRα and PDGFRβ activate downstream signaling pathways that are
common to a number of growth factor signaling pathways such as Src, PI3K,
PLCγ, as well as indirect links to the Ras-MAPK pathway through activation of
Shc and Grb2 (Heldin et al. 1998). These downstream effectors belong to
signaling pathways that typically function to regulate developmental processes
like cell migration and cell differentiation (Andrae et al. 2008). During gastrulation,
cell migration is a key process and the regulation of this process in this context
by PDGF signaling is of interest. PI3K is an enzyme that phosphorylates
phosphoinositides on the inner surface of the cell membrane, converting
phosphoinositol (4,5)-bisphosphate (PIP2) into phosphoinositol (3,4,5)-
triphosphate (PIP3) (Burgering and Coffer, 1995). PIP3 is a docking site for
pleckstrin homology domain (PH-domain) containing effectors at the cell surface.
The formation of a PIP3 intracellular gradient at the leading edge of migratory
cells has been described as an important consequence of chemotactic gradient
detection (Sasaki et al. 2000; Funamoto et al. 2002). Some of the effectors that
interact with PIP3 include members of the Ras superfamily of small-GTPases
including the RhoGTPases and their associated exchange factors (RasGEFs)
(Hawkins et al. 1995; Fukata et al. 2003). These molecules are known regulators
of the actin cytoskeleton. In this case, activation of GEFs at the leading edge of
36
the cell through PIP3 interaction can result in the polarized activation of
RhoGTPase family members resulting in modulation of the actin cytoskeleton,
which is important for the cell to form locomotory protrusions (Fukata et al. 2003;
Stephens et al. 2008).
PLCγ function downstream of PDGF signaling has also been described as an
important regulator of directional cell migration. In this case, PLCγ is activated
downstream of the PDGF receptor resulting in the hydrolysis of PIP2, producing
diacyl glycerol (DAG) and inositol triphosphate (IP3), both of which are important
second messenger signaling molecules (Bornfeldt et al. 1995). High levels of IP3
in the cell can result in an increase in cytosolic calcium levels due to release from
cellular stores (Berridge, 1993). This increase in cytosolic calcium level and
decreased levels of PIP2, as a result of PLCγ hydrolysis, is hypothesized to
trigger actin filament disassembly through binding of capping proteins to the
barbed ends of actin filaments (Stossel, 1993; Bornfeldt et al. 1995). This
remodeling of actin filaments is conducive to the formation of new locomotory
protrusions at the leading edge of cells (Bornfeldt et al. 1995).
Regulation of PDGF signaling by receptor mediated endocytosis In addition to triggering PDGF receptor dimerization and autophosphorylation,
ligand binding is thought to trigger receptor mediated endocytosis of the receptor
ligand complex in some cell types (Kawada et al. 2009). PDGF-
37
B/Rβ based chemotaxis in fibroblasts has been shown to involve interactions
between PDGFRβ and a ternary protein complex made up of ELMO adaptor
proteins, DOCK4 (Rac1 GEF) and Grb2 (Kawada et al. 2009). PDGFRβ contains
an SH-2 docking site for Grb2, thus following PDGF ligand binding and receptor
autophosphorylation, a ternary complex containing Grb2 interacts with Dynamin
and binds to PDGFRβ. The receptor/ligand complex is subsequently endocytosed
and signaling results in modulation of the cortical actin cytoskeleton, leading to
directional migration of the cells (Kawada et al. 2009). Internalized
PDGFRβ receptors are recycled to the plasma membrane in a Rab4 dependent
process (Kawada et al. 2009). Thus, internalization of the receptor/ligand
complex is required for directional migration in some cell types. It is not known if
receptor mediated endocytosis is required for PDGF-A/ PDGFRα signaling.
1.2.4: Platelet derived growth factor signaling during Xenopus gastrulation
During Xenopus development, PDGF signaling is known to regulate processes
such as directional cell migration of the leading edge mesendoderm, prevention
of apoptosis in mesoderm cells and the epithelial to mesenchymal transition that
occurs during larval skin morphogenesis (Ataliotis et al. 1995; Nagel et al. 2004;
Van Stry et al. 2004; Van Stry et al. 2005; Utoh et al. 2003). In these cases,
signaling through PDGFRα by PDGF-A homodimers is involved. Although,
PDGF-B and PDGFRβ have been cloned in Xenopus, expression of PDGF-B has
38
not been detected during gastrulation (Mercola et al. 1988). Thus, no role in early
development has been identified for PDGF-B/ PDGFRβ signaling.
PDGF-A signaling is required for gastrulation in Xenopus Inhibition of PDGF-A signaling with dominant negative PDGF-A ligands and a
dominant negative PDGFRα construct results in severe embryonic phenotypes
(Ataliotis et al. 1995). During gastrulation, blastopore closure was significantly
delayed, although epiboly movements continued (Ataliotis et al. 1995; Nagel et
al. 2004; Damm and Winklbauer, 2011). Disruption of PDGF-A signaling did not
prevent convergent extension in activin induced animal caps, although at larval
stages, the anterior/posterior axis of the embryo was significantly truncated
(Ataliotis et al. 1995). Thus, PDGF-A signaling may not be involved in the
regulation of CM convergent extension, but may be important in regulating
morphogenesis in more anterior tissues, such as the PCM or the LEM.
Additionally, larval head development was severely disrupted. In many cases,
larval heads were smaller than normal, showing abnormally developed structures
and in some cases, heads were completely absent (Ataliotis et al. 1995). This
may suggest potential defects in the morphogenetic movements of the PCM and
cranial neural crest cells given the involvement of these cells in head
development (Bothe et al. 2000). Interestingly, PDGF-A and PDGFRα are
expressed along the migratory routes of both of these cell populations (Ho et al.
1994; Ataliotis et al. 1995; Damm and Winklbauer, 2011). Nervous system
development was also severely disrupted, with many larval stage embryos
39
having an open back or “spina bifida” phenotype (Ataliotis et al. 1995). The
expression of the PCM marker, Gsc and the CM marker, XBra, was unaffected,
which indicates that mesoderm cell fates were not disrupted by inhibition of
PDGF-A signaling (Damm and Winklbauer, 2011; Ataliotis et al. 1995). Thus, it is
likely that many of the observed defects are due to disruption of morphogenetic
movements in the embryo.
PDGF-A signaling in mesoderm migration Single mesoderm cells, when seeded on fibronectin extend lamelliform
protrusions as they spread on the substrate (Winklbauer and Selchow, 1992). It
has been shown that aggregates of Activin induced Xenopus mesoderm can
spread on fibronectin by producing lamelliform protrusions around the periphery
of the aggregate, similar to the way single mesoderm cells spread (Symes and
Mercola, 1996). Aggregate spreading requires the inclusion of PDGF-A in the
culture medium, otherwise the cells in the aggregates remain tightly associated
(Symes and Mercola, 1996). Furthermore, aggregate spreading requires PI3K
signaling downstream of PDFGRα. When Wortmannin, a specific PI3K inhibitor is
added to the culture medium, aggregates fail to spread, even in the presence of
PDGF-A (Symes and Mercola, 1996). Thus, as in other systems, signaling
through PI3K downstream of PDGF-A is important for cell motility in Xenopus
mesoderm (Symes and Mercola, 1996; Fukata et al. 2003; Stephens et al. 2008)
The LEM migrates toward the animal pole of the embryo on the inner layer
40
surface of the BCR roof during gastrulation (Winklbauer and Nagel, et al. 2001;
Davidson et al. 2002; Nagel et al. 2004). This directional migration movement
depends on guidance cues that have been deposited in the BCR extracellular
matrix (Nagel and Winklbauer, 1999; Nagel et al. 2004). It has been shown that
the long, and likely the intermediate isoforms of PDGF-A, are important
regulators of this process (Nagel et al. 2004). LEM cells extend lamelliform
protrusions preferentially in the direction of the embryonic animal pole (Nagel and
Winklbauer, 1991; Nagel et al. 2004). When PDGF-A signaling is disrupted by
morpholino oligonucletoides or by expression of dominant negative constructs,
cells extend protrusions randomly (Nagel et al. 2004). The BCR extracellular
matrix and associated guidance cues can be transferred from the inner layer of
the BCR to a glass slide for in vitro studies (Nakatsuji and Johnson, 1983a; Nagel
and Winklbauer, 1999; Nagel et al. 2004). Aggregates of LEM typically migrate
toward the end of the glass slide that would correspond to the animal pole on the
BCR. This directional movement is disrupted in aggregates from embryos
expressing constructs encoding dominant negative PDGF-A or PDGFRα or
injected with PDGF-A morpholino oligonucleotides (Nagel et al. 2004).
Additionally, consistent with a role for PI3K signaling downstream of PDGF-A in
Xenopus mesoderm migration, Wortmannin treatments were also found to inhibit
directional migration of aggregates (Nagel et al. 2004). The overexpression of
PDGF-A constructs in the embryo or in aggregates of LEM, results in a similar
disruption of directional migration (Nagel et al. 2004). This suggests that PDGF-A
41
signaling plays an instructive role in the regulation of directional migration of the
LEM on the inner layer of the BCR. This also suggests that a gradient of PDGF-A
may be present within the BCR extracellular matrix. The cell retention motif found
in the long and intermediate PDGF-A isoforms could be interacting with HSPGs
or fibronectin in the extracellular matrix (Andersson et al. 1994; Smith et al.
2009). This gradient could be formed by modulation of PDGF-A expression
between different zones of the BCR. PDGF-A molecules would be deposited in
the BCR extracellular matrix in a graded fashion. Indeed, in situ hybridization for
PDGF-A may provide evidence for this polarization, with increasing expression
towards the animal pole (Ataliotis et al. 1995; See Chapter Three, Figure 3.2).
There appears to be a counter-gradient of PDGFRα expression in mesoderm
tissue, with decreasing expression moving toward the vegetal pole (Ataliotis et al.
1995; See Chapter Three, Figure 3.2). Increased receptor expression in more
posterior cells may increase sensitivity for reduced levels of PDGF-A expression
in that region of the embryo. Thus, PDGF signaling plays an important role in the
regulation of cell movements during gastrulation.
Anti-apoptotic effects of PDGF-A signaling The effect of inhibiting PDGF-A signaling during gastrulation in Xenopus causes
non-subtle, dramatic phenotypes (Ataliotis et al. 1995). PDGF-A has obvious
effects on cell movements, however some of the observed phenotypes could be
due to the loss of key cell populations in addition to defects in cell movement.
42
Subsets of cells in the Xenopus gastrula undergo cell death at the early gastrula
transition (Howe et al. 1995). These cells die through Caspase3/7 activation
downstream of the mitochondrial apoptotic pathway (Thornberry and Lazebnik,
1998). PDGF-A signaling appears to be involved in ensuring cell survival in the
prechordal mesoderm population by preventing these cells from undergoing
apoptosis (Van Stry et al. 2004; Van Stry et al. 2005). When PDGF-A signaling is
inhibited by expression of a dominant negative form of PDGFRα, TUNEL-positive
PCM cells with increased Caspase 3 activity were found in the blastocoel (Van
Stry et al. 2004). Apoptosis could be rescued by expression of Caspase 3
inhibitors in these cells, however this did not rescue the dramatic embryonic
phenotypes caused by PDGFRα knockdown (Van Stry et al. 2004). PDGF
receptors that contain tyrosine residue docking sites for PI3K and PLCγ only were
sufficient to rescue apoptosis in PCM cells with defective PDGF signaling (Van
Stry et al. 2005). This shows that the anti-apoptotic effect of PDGF-A signaling
requires signaling by PDGFRα through the PLCγ and PI3K signaling pathways
(Van Stry et al. 2005). Thus, while the anti-apoptotic effects of PDGFRα signaling
may be important in gastrulation, the regulation of cell movements by PDGF-A
signaling is critical. Interestingly, the pathways regulating cell migration and the
anti-apoptotic effects of PDGF signaling appear to overlap. This could suggest a
mechanism where cells that fail to migrate normally because of defective
signaling through the PI3K or PLCγ pathways, undergo programmed cell death to
ensure that they do not accumulate in incorrect locations in the embryo.
43
1.3: Molecular gradient formation: mechanisms and kinetics. During embryonic development, gradients of signaling molecules are formed in
embryonic tissues. Morphogen gradients are an example of a molecular gradient.
Different cell fates are specified by different concentrations of molecules along
the gradient and in this way, morphogen gradients play an essential role in the
patterning of embryonic tissues. Chemoattractant gradients are another type of
molecular gradient. In this case, the gradient of molecules provides directional
information so that cells can polarize or migrate in the direction of the source of
the molecules. The morphogen gradients responsible for patterning the
anterior/posterior axis of the Drosophila wing imaginal disc have been subject to
extensive study (Baker et al. 2007). These studies have contributed to the
development of several theories about how gradients form and spread through
tissues.
My work has identified that the short isoform of PDGF-A functions as a long
range signaling molecule and that it forms a molecular gradient that is
responsible for orienting and directing the movements of prechordal mesoderm
cells during gastrulation in Xenopus (See Chapter Three). The mechanism
responsible for forming this type of growth factor gradient is not clear, however
the observations suggest that a mechanism involving the diffusion of molecules
through extracellular spaces fits better than others as potential spreading
44
mechanisms (See Chapter Four). Thus, the theoretical models for gradient
formation and the techniques used to distinguish between the models in different
systems will be reviewed in this section.
1.3.1: Mechanisms of molecular gradient formation The patterning of the wing imaginal disc in Drosophila larvae involves several
gradient forming molecules from different molecular families (Baker et al. 2007).
The different properties of these molecules require different mechanisms of
gradient formation and as such the wing imaginal disc has served as an excellent
system for developing models of mechanisms regulating gradient formation.
Since the molecules involved in patterning the wing imaginal disc are conserved
in vertebrates, it is possible that the gradient forming mechanisms are conserved
as well. Regardless of the mechanism involved in the spreading of the molecules,
gradients in tissues form because there is a source of transmittable molecules
that are capable of moving through a tissue (see below). These molecules must
also have a sink, usually uniform degradation, which is required to shape the
gradient (Wolpert, 1969). Without a sink, molecules would continue to move into
the tissue until it becomes saturated, that is, the concentration of molecules at
positions distant from the source would be the same as the concentration at
positions close to the source. This can be seen experimentally when following the
movement of a secreted-GFP constructs, which lack a sink in tissues. In this
case, secreted-GFP continues to move into the tissue until a uniform
45
concentration is reached (Entchev et al. 2000; Yu et al. 2009).
The mechanisms proposed to regulate gradient formation in the Drosophila wing
imaginal disc include planar transcytosis, the “bucket brigade” mechanism,
morphogen transport by argosomes, morphogen transport by cytonemes, free
and restricted diffusion of molecules, and gradient shaping by extracellular
proteoglycans (Kerszberg and Wolpert, 1998; Entchev et al. 2000; Greco et al.
2001; Panakova et al. 2005; Ramirez-Weber and Kornberg, 1999; Hsiung et al.
2005; Kicheva et al. 2007; Zhou et al. 2012; Yan and Lin, 2009). Each of these
models will be discussed in detail below.
Planar transcytosis Planar transcytosis involves the spreading of transmittable molecules though
cells rather than through extracellular spaces in order to spread through a tissue.
During planar transcytosis, transmittable molecules are endocytosed by cells
closer to the molecule source, these molecules move through the cytoplasm of
the cell before being secreted through a recycling pathway (Yan and Lin, 2009).
The re-secreted molecules are then subsequently endocytosed by the next layer
of cells and the cycle repeats. Thus, planar transcytosis relies on subsequent
cycles of endocytosis and re-secretion in order to spread the molecules through
the tissue (Yan and Lin, 2009). Decapentaplegic (Dpp) is a signaling molecule
that belongs to the highly conserved transforming growth factor β (TGFβ)
superfamily of signaling molecules. It is produced in the anterior/posterior
46
compartment boundary of the Drosophila wing imaginal disc and plays an
essential role in determining cell fates along the anterior/posterior axis of the disc
(Basler and Struhl, 1994; Lecuit et al. 1996; Nellen et al. 1996; Baker et al. 2007).
An initial study of Dpp morphogen gradient formation used Dpp molecules tagged
with green fluorescent protein (GFP) (Dpp-GFP) for visualization of the
molecules. Dpp-GFP is typically found intracellularly in wild-type wing imaginal
disc cells (Entchev et al. 2000; Kicheva, et al. 2007; Zhou et al. 2012).
Interestingly, it was observed that mutant shibire clones (shibire mutants have a
mutation in the Drosophila homologue of Dynamin) did not permit the spreading
of Dpp through the clone (Entchev et al. 2000). This result suggested that Dpp
gradient formation required Dynamin function, likely for endocytosis. The
intracellular distribution of Dpp-GFP in wild-type cells, together with the shibire
mutant data, would be consistent with a transcytosis mechanism (Entchev et al.
2000). Kinetics of the Dpp morphogen gradient have been determined using
fluorescence recovery after photobleaching (FRAP) techniques. The diffusion
coefficient derived from this data was three orders of magnitude lower than what
would have been expected for the free diffusion of the Dpp-GFP molecule in
water, but was thought to be consistent with a facilitated transport mechanism
(Kicheva et al. 2007). This was further supporting data for the planar transcytosis
hypothesis. However, more recent data that was gathered using a method called
Fluorescence Correlation Spectroscopy (FCS) (see below) derived diffusion
coefficients that were more in line with what would be expected for free diffusion
47
of Dpp-GFP (Zhou et al. 2012). Therefore, the diffusion coefficient derived with
the FRAP method may have been an artefact of assumptions made by the
investigators and the techniques used (Zhou et al. 2012). Furthermore, it has
been suggested that the lack of endocytosis in shibire mutant clones could
prevent removal of receptors from the cell surface (Yan and Lin, 2009; Kicheva et
al. 2012). This lack of receptor removal would result in an accumulation of
receptors at the cell surface that could then function as an extracellular sink for
Dpp by binding Dpp molecules. This would prevent the molecules from moving
deeper into the tissue. Thus, a role for planar transcytosis has not been
definitively identified.
The “Bucket-Brigade” mechanism Signaling by TGFβ family molecules such as Activin, BMPs and TGFβs involves
the binding of the ligand molecule to type II TGFβ receptors with high affinity,
which triggers heterodimerization of the receptor with a type I TGFβ receptor
(Kerszberg and Wolpert, 1998). Heterodimerization, results in
autophosphorylation of the receptors and in a lower affinity interaction with the
bound ligand (Kerszberg and Wolpert, 1998). These observations were used to
design a theoretical model of molecular spreading in tissues (Kerszberg and
Wolpert, 1998). In this model, after binding of the ligand with high affinity to a
receptor monomer, the dimerization of the receptors is triggered. Receptor
heterodimers have a lower affinity for the ligand, thus the ligand is released,
however the receptor dimers persist and continue to signal. The free ligand
48
molecule will move to a new receptor monomer preferentially because of the high
affinity interaction between ligand and receptor. Cycles of ligand binding, receptor
heterodimerization and ligand release continue along the surface of the same cell
until close apposition of cells allows a free ligand to be passed to a receptor
monomer on an adjacent cell. Thus, in this model ligands are passed around the
cell and to adjacent cells, allowing for signaling and movement of the ligand
through the tissue. Computer simulations of this model have been successful in
forming a molecular gradient, however a role for this model in vivo has not been
identified and thus, remains a theoretical possibility for molecular spreading
(Kerzsberg and Wolpert, 1998).
Molecular transport by cytonemes Not all molecules have the capability to move freely in a tissue. Structural motifs
and post-translational modifications of proteins can be responsible for retaining a
secreted molecule in the vicinity of the secreting cell. PDGF-A long isoforms for
example, include a positively charged region in the C-terminus that interacts with
the negatively charged sulfate groups of heparin sulfate proteoglycans (HSPGs)
(Andersson et al. 1994; Andrae et al. 2008). This interaction restricts the
molecule to the region near the secreted cells (Andersson et al. 1994; see
Chapter Three). Furthermore, the signaling molecule, hedgehog (Hh), undergoes
post-translational modifications that result in the addition of cholesterol and a
palmitoylation group to its C and N-termini respectively (Porter et al. 1996;
Pepinsky et al. 1998). This post-translational lipid modification of the protein
49
results in retention of the Hh near the surface of the secreting cells. Thus, these
types of molecules are not likely to be transmitted well through the extracellular
space because they would likely become associated with the surfaces of cells
before a gradient could spread a significant distance.
The cells of the Drosophila wing imaginal disc are known to extend thin but long
filopodia like processes called cytonemes (Ramirez-Weber and Kornberg, 1999).
Similar structures have been observed in cultured mammalian cells when
induced with Fgf4 (Ramirez-Weber and Kornberg, 1999). Thus, these structures
are not unique to invertebrates. Interestingly, cells at varying distances from the
wing disc anterior/posterior compartment boundary extend these cytonemes in
the direction of the compartment boundary and apparently make physical contact
with the cells in the boundary region (Ramirez-Weber and Kornberg, 1999).
Thus, it has been hypothesized that cytonemes facilitate long range signaling
between the compartment boundary cells and cells located at varying distances
from the compartment boundary (Ramirez-Weber and Kornberg, 1999; Hsiung et
al. 2005). Signaling molecules produced by cells at the compartment boundary
could travel the distance to distant cells along cytonemes without the need to
travel through the extracellular space. Therefore the formation of an extracellular
gradient would not be required. Instead, the signaling molecule could travel along
the cytonemes, intracellularly, degrading over time, forming an intracellular
gradient (Ramirez-Weber and Kornberg, 1999). Dpp signaling, which is important
for determining cell fates along the anterior/posterior axis of the wing imaginal
50
disc is known to form a gradient (Kicheva et al. 2007, Zhou et al. 2012).
However, interestingly, the receptor for Dpp signaling, Thickveins (Tkv), has been
observed as puncta that are motile along the length of the cytonemes (Hsiung et
al. 2005). Thus, if Dpp is associated with the Tkv puncta, it is possible that
cytonemes could play a role in the distribution of Dpp to locations distant from the
source at the compartment boundary (Hsiung et al. 2005). However, an
alternative possibility that has not been ruled out, suggests that Dpp signaling
could play an important role in regulating cytoneme formation or function (Hsiung
et al. 2005). Thus, signal spreading though cytonemes is a potential alternative
mechanism for transport of molecules like the long isoforms of PDGF-A in
vertebrates or lipid modified molecules such as Hh, which would be stopped by
extracellular interactions with cells and extracellular matrix.
Spreading of membrane associated molecules by argosomes and lipoproteins Cytonemes provide an intracellular solution for the problem of the spreading of
lipid modified molecules and other molecules that become associated with the
cell membrane after secretion. Another potential mechanism for the spreading of
these molecules involves exosomes. In the Drosophila wing imaginal disc,
exosome-like structures have been termed argosomes and are membrane
exovesicles that are produced from the baso-lateral membrane of epithelial cells
(Greco et al. 2001). When argosomes are produced, the membrane and
associated molecules at that location on the cell surface, including any bound
signaling molecules, are formed into exosome like structures. The argosomes
51
would be released into the extracellular space when the endosome fuses with the
cell plasma membrane and subsequently interact with and are endocytosed by
receiving cells (Greco et al. 2001). Wingless (Wg) and Hedgehog (Hh) lipid
modified molecules that are typically retained at the cell surface could be
transported by argosomes to locations distant from their source. Indeed,
argosome like structures are produced from cells expressing high levels of Wg
(Greco et al. 2001). Interestingly, Wg containing argosomes like structures were
found to move at a similar rate to that of Wg spreading in the wing imaginal disc
(Greco et al. 2001). Argosomes/exosomes could also play a role in the transport
of membrane associated growth factor molecules like cell retention motif
containing isoforms of PDGF-A or membrane associated variants of FGF ligands.
Exosome-like structures are not exclusive to invertebrates. Fibroblasts can
produce exosomes and interestingly, Wnt11, a vertebrate homolog of Wg-like
molecules, has been found to associate with these exosomes through which
intercellular communication between fibroblasts and surrounding breast cancer
cells occurs (Luga et al. 2012). Together, these observations suggest a potential
role for extracellular vesicles in the transport of signaling molecules.
Although argosomes/exosomes are potential candidate structures for the
spreading of membrane tethered proteins, the model describing the spreading of
the Wg and Hh signaling molecules has been updated to involve a different type
of structure. Lipoprotein particles have been shown to be important in the
52
formation of Wg and Hh morphogen gradients (Panakova et al. 2005).
Lipoprotein particles are secreted structures made up of a core of neutral lipids
surrounded by polar phospholipids; cholesterol and large apolipoproteins are
embedded in these phospholipids (Yan and Lin, 2009; Panakova et al. 2005).
Lipoprotein particles are known to transport lipid molecules like cholesterol and
as such may be involved in the transport of lipid modified signaling molecules
(Yan and Lin, 2009). Lipophorin is a Drosophila apolipoprotein and it has been
found to interact with Wg and Hh in biochemical analyses and it also co-localizes
with both proteins in wing imaginal disc cells (Panakova et al. 2005). Knockdown
of lipophorin resulted in a significant restriction in the range of Hh and Wg
signaling activity, effectively restricting the signaling to near the source of the
molecules (Panakova et al. 2005). Thus lipoprotein particles are required for the
formation of Hh and Wg morphogen gradients. Lipoproteins are also found in
vertebrate embryos (Farese et al. 1996; Willnow et al. 2007), thus this method of
transport for lipid modified signaling molecules could be ubiquitous during
development.
Heparin sulfate proteoglycan (HSPG) interactions Secreted proteins often contain domains that interact with the negatively charged
sulfate groups found on HSPGs. HSPGs are members of a highly conserved
extracellular protein family in which a core protein is associated with a heparin
sulfate glycosaminoglycan side-chain. The family can be divided into two cell
associated types, the syndecans and glypicans and a diffusible type, the
53
perlecans (Bernfield et al. 1999). Interactions between glipicans, syndecans and
extracellular signaling proteins have the potential to significantly affect the shape
of a molecular gradient. In vertebrates, the cell retention motif containing
isoforms of PDGF-A are thought to bind to cell surface HSPGs (Andersson et al.
1994) and this interaction likely restricts the signaling role of these isoforms to
near the secreting cells (see Chapter Four). Furthermore, the Drosophila
glypicans, Dally and Dally-like (Dlp), play a major role in the shaping of Wg, Hh
and Dpp gradients in the Drosophila wing imaginal disc. Mutations in genes that
are involved in the biosynthesis or regulation of HSPGs, often results in inhibited
Wg, Hh and Dpp signaling and a lack of extracellular accumulation for these
molecules (Lin, 2004). Thus, a major function of HSPGs in gradient formation
could be to encourage the accumulation of Wg extracellularly where signaling is
required, particularly at locations distant from the source where the concentration
of the molecule would be lower. HSPG’s may also be involved in enhancing the
stability of these extracellular signaling molecules (Lin and Perrimon, 2000).
HSPGs could also function as co-receptors and indeed Dally has been implicated
in such a function in Wg signaling (Baeg et al. 2001).
An interesting possibility that was proposed to explain why Dpp does not cross
cell clones lacking Dally is that HSPGs could function to facilitate the transport of
signaling molecules through the extracellular space. In this model, the side
chains of HSPGs would bind to signaling molecules like Dpp and those
54
molecules would subsequently be handed to the next side chain, then the next
and so an, effectively passing the molecule along the gradient (Belenkaya et al.
2004) This is similar to the hypothetical bucket brigade mechanism (Kerszberg
and Wolpert, 1998). Thus, the exact role of HSPGs in molecular gradient
formation is not well understood. However HSPGs may play roles in restriction of
movement, facilitation of movement and stabilization extracellular signaling
molecules, which results in the modulation of the shape of molecular gradients.
Gradient formation by free diffusion Over four decades ago, it was shown theoretically, that simple diffusion of
molecules, over the distances and timescales required when patterning a tissue,
could form a molecular gradient (Crick, 1970). Since then, diffusion of molecules
through extracellular spaces has been described as a mechanism of molecular
gradient formation in several systems, including the formation of the Dpp gradient
in the Drosophila wing imaginal disc, the Fgf8 gradient in the Zebrafish embryo
and the Activin gradient in the early Xenopus embryo (McDowell et al. 1997;
McDowell et al. 2001; Gregor et al. 2007; Kicheva et al. 2007; Hagemann et al.
2009; Yu et al. 2009; Zhou et al. 2012). As discussed above, Dpp gradient
formation has been subject to several hypothetical models of gradient formation.
Recently however, kinetic data gathered using fluorescence correlation
spectroscopy (FCS), has led to a revision of the model (Zhou et al. 2012). FCS is
a single molecule resolution technique that works by measuring the fluctuations
in fluorescent signals over very short time scales within a small half cubic
55
micrometer volume (Ries et al. 2009; Zhou et al. 2012; Kicheva et al. 2012).
Autocorrelation analysis then allows for determination of diffusion coefficients as
well as providing information about whether molecules move independently or as
aggregates/molecular complexes (Kicheva et al. 2012). Data gathered by FCS
currently supports a model of rapid extracellular diffusion of Dpp molecules,
rather than facilitated transport mechanisms like planar transcytosis, cytoneme
transport or restricted diffusion (Zhou et al. 2012). Diffusion of individual
molecules happens very rapidly (diffusion coefficient of GFP in water is 87µm2/s,
Swaminathan et al. 1997). The majority of Dpp molecules (65%) were found to
have a diffusion coefficient of 21 µm2/s, a rate that is consistent with free diffusion
of these molecules (Zhou et al. 2012). The remaining 35% of extracellular
molecules had a significantly lower diffusion coefficient of 0.03 µm2/s, suggesting
that these molecules are associated with extracellular HSPGs or receptors (Zhou
et al. 2012). Thus, the rapid transport via free diffusion of the majority of Dpp
molecules dominates the spreading process because transport of the Dpp
molecule happens very rapidly compared with binding to HSPGs and receptor
mediated endocytosis (Zhou et al. 2012). As a result of this rapid spreading
process, few molecules need to be motile in the extracellular space because they
are rapidly replaced as they get degraded or become associated with immobile
structures (Zhou et al. 2012). Spreading by diffusion is coupled with intracellular
degradation of Dpp after internalization through receptor mediated endocytosis
(Kicheva et al. 2007; Zhou et al. 2012). Thus, while Dpp interacts with potentially
56
immobilizing structures such as extracellular HSPG molecules (Belenkaya et al.
2004; Akiyama et al. 2008; Fujise et al. 2003), the interactions with these
structures is considered to be a downstream event, that is, these events occur
slowly and after the molecules have already diffused through the tissue (Zhou et
al. 2012). Thus, while interactions with receptors, co-receptors, and HSPGs at
the cell surface serves to stabilize the gradient through degradation, stabilization
of receptor/ligand interactions, or by concentrating molecules at specific locations
for signaling purposes, the transport rate of Dpp is not affected by these
interactions because diffusion of molecules is several orders of magnitude faster
(Zhou et al. 2012). The interactions with receptors and HSPGs are however,
essential to the formation of a stable gradient. Secreted forms of GFP fail to form
gradients because without stable substrates to bind to, the molecules diffuse out
of the tissue so rapidly that it is not possible to form a stable gradient (Zhou et al.
2012).
Rapid intercellular diffusion of molecules can form gradients in vertebrates as
well. Similar to Dpp gradient formation, Fgf8 in the zebrafish neuroectoderm
spreads by free diffusion of molecules (Scholpp and Brand, 2004; Yu et al. 2009).
Using FCS techniques, it was determined that Fgf8 moves through extracellular
spaces rapidly by free non-directional diffusion (diffusion coefficient of 53µm2/s)
(Yu et al. 2009). A small percentage (~9%) of extracellular Fgf8 was found to
move at a significantly reduced transport rate (Yu et al. 2009). This was due in
57
part to interactions with HSPG molecules as treatment with heparinase, an
enzyme that degrades HSPGs, resulted in a decrease in the amount of Fgf8 with
the reduced transport rate (Yu et al. 2009). Interestingly, this treatment also
resulted in an expansion of the expression domains of genes downstream of the
FGF signaling pathway, indicating that the range of Fgf molecule influences can
be regulated by interactions with HSPGs (Yu et al. 2009). Additionally, the Activin
gradient, which is important in the specification of mesoderm during Xenopus
development (Asashima et al. 1990), is thought to be formed by free diffusion
through the extracellular space (McDowell et al. 1997; Hagemann et al. 2009).
XBra is a downstream target of Activin/TGFβ signaling and is upregulated at a
distance from the Activin source (McDowell et al. 1997). Interestingly, the Activin
signal is capable of moving through the extracellular spaces of groups of cells
that lack the receptor required for Activin signaling, ruling out a relay mechanism
for signal spreading (McDowell et al. 1997). The range of the gradient can be
modulated by the number of receptors on the surfaces of responding cells
(Hagemann et al. 2009), similar to what is observed in Fgf8 gradient formation in
Zebrafish (Scholpp and Brand, 2004). Higher numbers of receptors results in a
reduced range of the gradient, likely because there are more available receptors
close to the Activin source to bind and capture Activin molecules, reducing the
available pool of freely diffusing molecules. Interestingly, even though
internalized Activin is found in lysosomes, inhibition of endocytosis does not
significantly affect the signaling rage of the gradient (Hagemann et al. 2009).
58
Although the reason for this is unknown, it has been hypothesized to be an effect
of the available space for diffusion of Activin in the in vitro system used to study
the gradient (Hagemann et al. 2009).
1.3.2: Kinetics of gradient formation: tissue level versus molecular level.
To date, many of the studies of gradient formation have analyzed the kinetics
involved on the tissue level. That is, by analyzing the distribution of molecules
over the entire length of the gradient or by analyzing the range of activation of
signaling processes downstream of gradient forming signaling molecules
(Entchev et al. 2001; Gregor et al. 2007; Kicheva et al. 2007; Wartlick et al. 2011;
Yan et al. 2009; Schwank et al. 2011). These measurements are usually taken
over time periods measured in hours. Typically, tissue level kinetic parameters
are determined with analysis by fluorescence recovery after photobleaching
(FRAP). FRAP works by photobleaching an area of interest, extracellular spaces
for example, and then analyzing the kinetics of the recovery of the fluorescent
molecules back into the photobleached area (Lippincott-Schwartz et al. 2003;
Kicheva et al 2009; Zhou et al. 2012; Kicheva et al. 2012). The kinetic
parameters are derived from the resulting FRAP recovery curves. These
analyses can be used to derive diffusion coefficients and rates of degradation
(Kicheva et al. 2007; Kicheva et al. 2012). Tissue level studies can be particularly
useful for understanding how gradient formation is affected by mutations in
potential regulatory genes. For example, in the Drosophila wing imaginal disc, the
59
way that induced clones with mutations in genes encoding regulatory proteins
affects the movement of molecules around and through the clones can be readily
studied. This kind of study can provide valuable information about interactions
between cells, extracellular matrix and signaling molecules.
Kinetic parameters, such as the diffusion coefficient, that are derived from tissue
level studies can be significantly different from the same parameters derived from
measurements made on the molecular level. This is particularly the case when
molecules move through tissues by rapid free diffusion, as is the case for Dpp
and Fgf8 (Zhou et al. 2012; Kicheva et al. 2012; Yu et al. 2009; Kicheva et al.
2012). This is because analysis of diffusion through tissues has been shown to
be extremely rapid compared with the rates of receptor mediated endocytosis or
reversible binding from HSPGs (Zhou et al. 2012; Kicheva et al. 2012).
Therefore, the rate kinetics determined reflects the degradation of molecules,
rather than the transport (Zhou et al. 2012). Since the transport and
establishment of the gradient has already occurred before the concentration of
molecules has built up to a detectable level, the fluorescence being analyzed is
likely due to interactions with HSPGs and/or receptors rather than representing
the diffusible fraction of molecules (Zhou et al. 2012). Therefore, the diffusion
coefficient determined from tissue level experiments is an “effective” diffusion
coefficient that likely depends on several different interactions between the
molecule and various structures along the path of movement. The diffusion
60
coefficients derived from single molecule analysis is a property of the molecule in
question and depends only on the viscosity of the material through which the
molecule is diffusing (Zhou et al. 2012).
Single molecule analysis typically uses FCS and these analyses have revealed
that some gradients form by rapid diffusion of molecules; a conclusion that could
not be reliably made from the data obtained from tissue level analyses. Analysis
with FCS can also detect molecules moving at much slower rates. While the
fraction of molecules moving at a faster rate likely resperesents the transport
mechanism of the molecule (i.e. diffusion, transcytosis), the slower fraction of
molecules likely represents association with receptors and extracellular matrix
molecules (Zhou et al. 2012, Yu et al. 2009). It is unclear, however whether all of
the potential interactions of signaling molecules within their environment can be
sampled within the extremely small volume analyzed by FCS. Thus, combining
high resolution single molecule analysis with results from tissue level analyses
are necessary to understand both the underlying transport mechanism and the
types of interactions of molecules with the environmental factors that can affect
the overall rate of molecular gradient formation.
1.4: Outline and Objectives Prechordal mesoderm morphogenesis (Chapter Two) The Xenopus prechordal mesoderm (PCM) is an understudied region of the
Xenopus mesoderm, thus in order to develop an understanding of
61
morphogenesis in this region, my first objective was to analyze the polarity and
orientation of PCM cells during gastrulation. This was done using scanning
electron microscopy in order to get high resolution views of cells and cellular
processes. I found that the long axes of PCM cells were oriented perpendicular to
the overlying blastocoel roof and that cells extended lamelliform protrusions in
the direction of the blastocoel roof. Futhermore, I analyzed the orientation of cells
in mesoderm regions on the lateral and ventral sides of the embryo and found
that the orientation of these cells were strikingly similar to the corresponding
regions on the dorsal side of the embryo. In order to image live cell movements, I
developed an explant system that was instrumental in confirming that PCM cells
undergo radial intercalation by directional intercellular migration toward the BCR.
Platelet derived growth factor signaling (Chapter Three) PDGF-A signaling has been implicated in the directional migration of the leading
edge mesendoderm during Xenopus gastrulation (Nagel et al. 2004).
Furthermore, the expression patterns of ligand and receptor are such that PDGF-
A signaling could regulate directional migration of PCM cells. My next objective
was to determine whether PDGF-A signaling played a role in this system. I
showed that the BCR expresses three PDGF-A isoforms, one of which is
considered to be a diffusible molecule. Using a combination of scanning electron
microscopy and live cell imaging of explanted mesoderm and BCR tissue, I
showed that the diffusible PDGF-A isoform plays an instructive role in regulating
the directional migration of deep prechordal mesoderm cells. Thus, I was able to
62
propose a model in which the diffusible isoform of PDGF-A forms an extracellular
chemoattractant gradient within the PCM tissue that regulates the radial
intercalation of the PCM during gastrulation.
PDGF-A forms an extracellular gradient in PCM tissue (Chapter Four) My proposed model for the regulation of radial intercalation by PDGF-A signaling
required that a gradient of PDGF-A be established in the PCM. My final objective
was to attempt to visualize and derive kinetic parameters of the putative PDGF-A.
Using eGFP labeled PDGF-A constructs and explants of mesoderm and BCR
tissue, I confirmed that the diffusible short isoform of PDGF-A (sf-PDGF-A)
formed a steady state gradient, while the long and intermediate cell associated
isoforms of PDGF-A remained localized to the mesoderm/ectoderm interface.
Furthermore, I was able to determine the decay length λ, degradataion rate 𝑘,
and the effective diffusion coefficient 𝐷!"" parameters for sf-PDGF-A. Based on
the value determined for 𝐷!"", I suggest that the sf-PDGF-A gradient forms by
diffusion of molecules through extracellular spaces. My work describes a model
for the molecular regulation of radial intercalation in a vertebrate system.
63
Chapter Two: The prechordal mesoderm undergoes intercellular migration and radial
intercalation during gastrulation
Sections of this chapter were published in Damm, E.W. and Winklbauer, R. (2011) PDGF-A controls mesoderm cell orientation and radial intercalation during Xenopus gastrulation. Development,
138: 565-575
64
2.1: Introduction Research in the field of mesoderm morphogenesis has resulted in a good
understanding of CM convergent extension and LEM directional migration in the
gastrulating Xenopus embryo. However, morphogenesis of the other regions of
mesoderm, ectoderm and endoderm and the importance of these movements in
gastrulation are not well understood.
Classically, the involuted dorsal mesoderm has been described as being
comprised of two domains, the posterior mesoderm (CM) and the head
mesoderm (including the LEM) (Keller et al. 1985; Winklbauer and Nagel, 1991).
The CM is well known for convergent extension movements (Keller et al. 2000;
Keller, 2004; Solnica-Krezel, 2005; Solnica-Krezel and Sepich; 2012), while the
head mesoderm has been thought to migrate as a whole in the direction of the
animal pole on the inner layer of the BCR, guided by direction determining cues
that are associated with the BCR extracellular matrix (Winklbauer and Nagel
1991; Nagel and Winklbauer, 1999; Davidson et al. 2002; Nagel et al. 2004).
However, more recent evidence, based on gene expression, has shown that
involuted mesoderm can be divided into three motility domains, the involuted part
of the XBra expressing CM, Gsc expressing PCM and the LEM (Smith et al.
1991, Wilkinson et al. 1990, Cho et al. 1991, Niehrs et al. 1994; Saint-Jeannet et
al. 1994, Damm and Winklbauer, 2011). Morphogenesis of the PCM region has
not been subjected to detailed investigation in Xenopus but has been a topic of
65
discussion in zebrafish studies (Solnica-Krezel et al. 1995; Blader and Strahle,
1998; Chan et al. 2001; Montero et al. 2004). Importantly, cells located in a
region of dorsal mesoderm that likely corresponds to the PCM region have been
described as being oriented with their long axis perpendicular to the BCR (Keller
and Schoenwolf, 1977). This orientation is perpendicular to the direction of
mesoderm movement and suggests that PCM cells may undergo movements
independent of the animally directed migration of the anterior mesoderm. Thus,
the contribution of PCM morphogenesis to gastrulation is unknown.
The opaque nature of the Xenopus embryo makes the imaging of cell
movements challenging. Therefore studies of morphogenesis in Xenopus have
relied heavily on imaging of explanted tissue. The disadvantage of explant
studies is the disruption of the endogenous organization of embryonic tissues. In
order to understand the contribution of different morphogenetic movements to the
gastrulation process, it is essential to combine data from explant experiments
with data obtained from studies using intact embryos in order to ensure that what
is observed in the explant represents the movement in vivo.
Scanning electron microscopy (SEM) of intact specimens provides high
resolution, high contrast and high depth of field images while preserving the
structure of the embryo. In 1977, Keller and Schoenwolf carried out a seminal
study of the gastrulating embryo using SEM. Although this study was primarily
66
qualitative, they gathered data about cell shapes and organizations in tissues as
well as information about the orientations of cellular protrusions. They found that
the dorsal mesoderm could be divided into two regions with different cell
orientations. These regions correspond to the motility zones of the CM, which
was undergoing convergent extension and the anterior (PCM and LEM)
mesoderm, which was undergoing animally directed cell migration (Keller and
Schoenwolf, 1977; Keller and Tibbetts, 1989; Winklbauer and Nagel, 1991).
Combining endogenous cell orientation data with in vitro data from live imaging of
explanted tissue has improved our understanding of CM and LEM movements
but has also raised questions about whether the movements observed in
explants are representative of the movements occurring in the embryo. In this
chapter, using a combination of whole embryo and in vitro analysis I describe the
morphogenesis of the PCM. I quantitatively show that PCM cells are highly
oriented toward the BCR and that over the course of gastrulation, these cells
undergo radial intercalation, migrating toward the BCR using the surfaces of
other cells as a substrate for migration in a process that is BCR dependent.
2.2: Results 2.2.1 The dorsal, lateral and ventral mesoderm can be subdivided into distinct cell groups based on gene expression and morphological evidence
67
Mesoderm is a non-homogenous tissue, which can be divided into distinct groups
of cells undergoing specific morphogenetic movements. In order to investigate
these movements, the dorsal, lateral and ventral mesoderm was divided into
regions according to the expression of known marker genes, visible
morphological boundaries and differences in cell morphology. The dorsal
mesoderm was divided into three regions (Figure 2.1). XBra marked the CM
(Figure 2.1A-C, D-F) (Wilkinson et al., 1990; Smith et al. 1991) and Gsc marked
the PCM (Figure 2.1A’-C’, D-F) (Cho et al., 1991; Niehrs et al. 1994, Niehrs et al.
1993). The third region, the LEM, was defined as the region between the anterior
boundary of Gsc expression and the leading edge of the mesoderm mantle
(Figure 2.1D-F). I used scanning electron microscopy to analyze morphological
characteristics of cells in each of the dorsal mesoderm sub-regions. In order to
determine the relative positions of XBra and Gsc expressing regions and LEM on
SEM micrographs, the average length and width of these regions were measured
from in situ hybridization experiments (Table 2.1). The average length of the LEM
was measured from the non-Gsc expressing region that was anterior to Gsc
expression on in situ images. Average width measurements from in situ images
were used to directly describe the width of the XBra and Gsc expressing regions
on SEM micrographs (Table 2.1; Figure 2.2A). The average width of the LEM
was assumed to be the same as the Gsc expressing region. Average length data
was used to determine the proportion of total mesoderm length occupied by XBra
or Gsc expression (Table 2.1; Figure 2.2A). These proportions determined the
68
Figure 2.1: The dorsal, lateral and ventral mesoderm are made up of sub-regions (A-C’) In situ hybridization showing expression of Xbrachyury (A-C) and
goosecoid (A’-C’) in mesoderm of early (NF stage 10), middle (NF stage 11) and
late (NF stage 12) gastrula stage embryos; dashed purple and yellow lines show
the boundary of expression of Xbrachyury and goosecoid respectively. (D-F) Low
magnification scanning electron micrographs of early (NF stage 10) (D), middle
(NF stage 11) (E) and late (NF stage 12) (F) gastrula stage embryos; dorsal and
ventral mesoderm regions are described by coloured areas on scanning electron
micrographs; white arrow indicates the dorsal blastopore lip. Crosshairs show
directions of embryonic axes. Ant., Anterior; Pos., Posterior; D, Dorsal; V,
Ventral.
69
Figure 2.1: The dorsal, lateral and ventral mesoderm are made up of sub-regions
70
relative positions of the mesoderm regions expressing these genes according to
the overall length of the curved mesoderm for each SEM image (Table 2.1;
Figure 2.2A). The areas of XBra expression, Gsc expression and the LEM
correlated well with areas of distinct cell orientation on scanning electron
micrographs of sagitally fractured embryos (Figure 2.2A). This correlation
suggests that cell orientation can be an indicator of different mesoderm regions
when marker gene expression data is unavailable.
XBra expression is not confined to the dorsal side but extends laterally to the
ventral side of the embryo (Figure 2.1A-C and Murai et al. 2007); therefore XBra
was used as a general marker for the lateral somitic mesoderm (posterior lateral
mesoderm) (Keller, 1976) and the presumptive pronephric mesoderm (ventro-
lateral posterior mesoderm) (Colas et al. 2008). Unlike the dorsal mesoderm,
specific gene expression markers for lateral and ventral anterior mesoderm and
LEM have not been identified. Cardiogenic marker genes such as Nkx 2.5 and
GATA-4, 5 and 6 (Walters et al. 2001) and the prospective blood island markers,
hepatocyte growth factor and C-met (Koibuchi et al. 2003) are expressed during
gastrulation in the anterior dorso-lateral mesoderm and anterior ventro-lateral
mesoderm respectively. However it is difficult to distinguish a boundary between
the expression of these markers and XBra expression. Thus, cell morphology
was used as an indicator to distinguish between anterior and posterior mesoderm
in these lateral and ventral regions (Figure 2.2B). Similar to the dorsal side, on
71
Figure 2.2: Mapping of dorsal, ventral and lateral mesoderm regions on scanning electron micrographs (A,B) Average length and width dimensions of dorsal XBra (A), ventral/lateral
XBra (B) and dorsal Gsc (A) expression domains were measured from in situ
hybridization images. Average lengths were determined (See Table 2.1), and the
percentage of total mesoderm length occupied by each domain was mapped
onto the SEM pictures. The widths of domains varied little, and average values
were used directly. The domains defined corresponded well to morphological
boundaries between ectoderm and mesoderm (Brachet’s cleft) on one side, and
large endoderm cells or the archenteron epithelium on the other. No
unambiguous markers or morphological boundaries are available to distinguish
between LEM and deep endoderm. Thus, the PCM-endoderm boundary was
extended anteriorly in parallel to the BCR, to describe the width of the LEM. (B)
The boundary between the involuted mesoderm and ventral/lateral LEM regions
is the transition between different cell morphologies (compare white arrowheads
and red arrowheads). Yellow arrowheads highlight endoderm cells. Average
lengths of these regions were determined and the percentage of total
ventral/lateral mesoderm occupied by each region was mapped on to SEMs.
Purple, chordamesoderm (XBra); yellow, pre-chordal mesoderm (Gsc); orange,
leading edge mesoderm; green, involuted lateral/ventral mesoderm; blue,
lateral/ventral LEM. EN, endoderm; BC, blastocoel.
72
Figure 2.2: Mapping of dorsal, ventral and lateral mesoderm regions on scanning electron micrographs
73
Table 2.1: The proportion of total mesoderm occupied by individual mesoderm subtypes. Lengths, widths and proportions of total mesoderm length for early, middle and
late gastrula stages. Blue text indicates that measurments were derived from
marker gene expression data. Asterisks and red text indicate that measurements
were derived from morphological evidence from scanning electron micrographs.
All length and width measurements are in micrometres.
Table 2.1: The proportion of total mesoderm occupied by individual mesoderm subtypes.
Stage Region of Interest Length
Width
Width (lower Gsc)
Width (BCR XBra)
Avg. proport. of length
Early Gastrula
(NF Stg. 10)
Chorda. (XBra) 281 +/- 15 146 +/- 8 - - 0.29 +/- 0.01 Prechordal (Gsc) 587 +/- 44 139 +/- 5 71 +/- 0.4 - 0.63 +/- 0.02
Dors. LEM 271 +/- 28 - - - 0.29 +/- 0.02 Avg. Mes. Length 945 +/- 39
Ventral (XBra) 377 +/- 9.5 195 +/- 5 - 81 +/- 1 0.56 +/- 0.03 *Vent. Anterior 110 +/- 9.3 101 +/- 1 - - 0.25 +/- 0.02
*Vent. LEM 103 +/- 26 - - - 0.24 +/- 0.05 Avg. Mes. Length 562 +/- 45
Mid Gastrula (NF Stg. 11)
Chorda. (XBra) 345 +/- 22 142 +/- 5 - - 0.26 +/- 0.02 Prechordal (Gsc) 520 +/- 32 106 +/- 5 - - 0.46 +/- 0.03
Dors. LEM 409 +/- 64 - - - 0.36 +/- 0.05 Avg. Mes. Length 1175 +/- 50
Ventral (XBra) 419 +/- 19 185 +/- 6 - - 0.41 +/- 0.03 *Vent. Anterior 235 +/- 10 87 +/- 2 - - 0.33 +/- 0.01
*Vent. LEM 177 +/- 11 - - - 0.26 +/- 0.01 Avg. Mes. Length 1016 +/- 43
*Lateral Anterior 304 +/- 23 66 +/- 2 - - 0.40 +/- 0.02 Avg. Mes. Length 752.6 +/- 45
Late Gastrula (NF Stg. 12)
Chorda. (XBra) 564 +/- 47 131 +/- 5 - - 0.33 +/- 0.03 Prechordal (Gsc) 507 +/- 28 50 +/- 9 - - 0.27 +/- 0.01
Dors. LEM 644 +/- 36 - - - 0.33 +/- 0.02 Avg. Mes. Length 1782 +/- 68
the lateral and ventral sides of the embryo, cell sizes vary between the LEM and
more posteriorly located mesoderm, with LEM cells being obviously larger
(Figure 2.2B). The transition from smaller to larger cell sizes was used to divide
the LEM from the anterior mesoderm (Figure 2.2B). Thus the lateral/ventral
anterior mesoderm was defined as the region between the anterior extent of
XBra expression and the posterior side of the cell size transition (Figure 2.1E,F).
The LEM was therefore the region between the anterior side of the cell size
transition and the leading edge of the mesoderm mantle (Figure 2.1E,F).
The same method used to determine the proportion of the dorsal mesoderm
length occupied by each mesoderm region was used to identify the regions of the
lateral and ventral mesoderm on SEM images. The average proportion of
lateral/ventral mesoderm occupied by XBra expressing posterior mesoderm was
determined from in situ hybridization images for XBra (Table 2.1; Figure 2.2B).
However, since specific gene expression markers for the lateral/ventral anterior
mesoderm were not available, the proportion of lateral/ventral mesoderm
occupied by anterior mesoderm was measured directly from SEM images (Table
2.1; Figure 2.2B). The transition between LEM and anterior mesoderm described
above and the anterior extent of XBra expression were used to mark the anterior
and posterior boundaries of the anterior mesoderm respectively. Furthermore, it
was assumed that the anterior mesoderm was bound by the mesoderm/ectoderm
boundary (Brachet’s cleft) on one side and large endoderm cells on the other
76
side (Figure 2.2B) and average width measurements were taken directly from
SEM images (Table 2.1). The lateral and ventral LEM made up the remaining
proportion of total mesoderm length (Table 2.1; Figure 2.2B). As with the dorsal
LEM, the width of this region was taken to be the same as that of anterior
mesoderm (PCM dorsally) since there are no known markers that specifically
label LEM, although this may be an underestimation of the width of the region.
Thus, during gastrulation, based on gene expression and morphological
differences, the dorsal, ventral and lateral (left/right) mesoderm can be divided
into XBra expressing posterior mesoderm, anterior mesoderm (Gsc expressing
dorsally) and LEM, which could each undergo specific morphogenetic
movements.
2.2.2: During gastrulation, PCM cells are unipolar and produce lamelliform protrusions In their 1977 paper, Keller and Schoenwolf carried out a detailed scanning
electron microscopy analysis of the dorsal mesoderm in which they qualitatively
described morphological details of non-involuted and involuted cells over the
course of gastrulation. Here, I expand on their original analysis through
quantification of cell morphology on a sub-region basis.
During the mid-gastrula stage, deep cells of the Gsc expressing PCM were
elongated perpendicular to the BCR, were unipolar, with a protrusion-bearing
77
front end pointing towards the BCR, and a rounded rear in sagittal and transverse
planes of fracture (Figure 2.3A-G). Protrusions were lamelliform or filiform, and
appeared attached to neighbouring cells (Figure 2.3A-F). In particular, filiform
protrusions were extended between cells as previously described for involuted
mesoderm (Figure 2.3F) (Keller and Schoenwolf, 1977). In some instances, cells
could be seen extending multiple protrusions into spaces around surrounding
cells (Figure 2.3D). The sites of protrusion attachment suggest that deep PCM
cells use neighbouring cells as a migration substrate. The preferential orientation
of the long axis of these cells may be due to regulation by an orientating cue.
Alternatively, the orientation of these cells could be passively determined by the
movements of the surrounding regions, such as the endoderm.
The long axis of PCM cells at the mid-gastrula stage is on average 2 times longer
than the short axis. Visually, it appears that PCM cells are preferentially
elongated in the dorsal/ventral axis (Figures 2.3, 2.4, 2.5) and therefore, the
direction of the axis elongation of these cells may be indicative of a cell
movement direction. Since it is unknown if there are changes in PCM mesoderm
cell shape over the course of gastrulation, I analyzed the length/width ratios of
these cells. Length/width ratios have been used as an indicator of cell polarity in
explanted tissue (Wallingford et al. 2000). However, these measurements are
typically done in two dimensions and therefore only provide information about cell
shape in the plane of the image being analyzed. Measurements done in this way
78
Figure 2.3: PCM cells extend lamelliform protrusions toward the BCR in sagittal and transverse planes (A-F) SEM micrographs of PCM cells from sagittaly fractured (A,C,E) and
transversely fractured (B,D,F) mid-gastrula stage (NF stage 11) embryos,
extending lamelliform protrusions both in (white arrowheads) and out of the plane
of the image (white arrows). Cells can extend multiple protrusions from a single
pole (D, asterisk) in the same or different planes (E, F, asterisk and white
arrowhead, same cell in E and F). (G) Schematic diagram showing the
orientation of fracture planes. (H) Percentage of cells extending protrusions in or
out of the plane of fracture or lacking protrusions measured from transversely
fractured and sagittaly fractured embryos. BCR, blastocoel roof; BC, blastocoel;
AC, archenteron.
79
Figure 2.3: PCM cells extend lamelliform protrusions toward the BCR in sagittal and transverse planes
80
are not necessarily reflective of actual cell shape or polarity. I measured the
length/width ratios of the PCM from SEM micrographs of sagittaly and
transversely fractured embryos (Figure 2.3G) before and during gastrulation and
integrated the data from both planes to get a picture of mesoderm cell shape and
orientation in the embryo.
Prior to the start of gastrulation (NF stage 9), cells in the dorsal marginal zone
(Figure 2.4A, red box), which gives rise to the three dorsal mesoderm regions at
later stages of gastrulation, had an average length/width ratio of 1.4 +/- 0.05 in
both the sagittal and transverse fracture planes (Figure 2.4A, 2.5A). However, by
the mid-gastrula stage (NF stage 11), the cell elongation increased significantly
(P-value < 0.0001). Average length/width ratios were 1.9 +/- 0.03 and 1.8 +/- 0.06
in the sagittal and transverse fracture planes respectively (Figure 2.4B, 2.5B).
Interestingly, the adjacent pharyngeal endoderm cells also became visibly
elongated by mid-gastrulation (compare Figure 2.4A and B). There was no
change in cell elongation between mid and late gastrula stages in either plane of
fracture (Figure 2.4B-D and Figure 2.5B-D). This indicates that cells are
elongated along the same axis in both fracture planes. Cells often become
elongated along an axis parallel to their direction of movement (Ridley, 2011),
thus I took the orientation of this long axis to be indicative of the orientation and
the direction of movement of the cell. For quantification purposes it was sufficient
to derive cell orientation from the sagittal plane alone since the length/width ratios
81
Figure 2.4: PCM cells become significantly elongated in the sagittal plane during gastrulation (A-C) Scanning electron micrographs of stage 9 (A), stage 11 (B) and stage 12
(C) sagittaly fractured embryos; red box in (A) shows the area of the DMZ where
measurements were taken; yellow lines show the length and width axes of PCM
cells along which length/width ratio measurements were taken. (D) Bar graph
comparing the average length/width ratios of PCM cells before and during
gastrulation, asterisk indicates a statistically significant result, P value < 0.0001.
Error bars show standard error of the mean. 9 (84 cells) stage 9, 10 (101 cells)
stage 11 and 7 (71 cells) stage 12 sagitally fractured embryos were used to
generate data. EN, endoderm; EC, ectoderm; BC, blastocoel; DMZ, dorsal
marginal zone; BCR, blastocoel roof.
82
Figure 2.4: PCM cells become significantly elongated in the sagittal plane during gastrulation
83
were the same in both planes of fracture. I also determined the positions of PCM
cell protrusions relative to anterior/posterior or lateral neighbours at the mid-
gastrula stage (Figure 2.3H). Cells extended and attached lamelliform protrusions
to neighbouring cells in both the sagittal and transverse fracture planes.
Approximately 50% of cells in both fracture planes extended and attached
protrusions within the plane of fracture (Figure 2.3H). Some cells extended
protrusions in the opposite plane from the one being imaged however, the
majority of remaining cells did not have visible protrusions (Figure 2.3H). These
cells are likely extending protrusions in the plane opposite to the one being
imaged, however these protrusions may be hidden. Some cells extended multiple
lamelliform protrusions from a single pole of the cell in two planes simultaneously
(Figure 2.3E,F). Altogether, PCM cells extend protrusions between neighbouring
cells in any antero-posterior or mediolateral plane.
2.2.3: LEM, PCM and involuted chordamesoderm cells are oriented toward the BCR
The orientation of cells can provide information about the direction of cell
movements in the embryo. At the start of gastrulation (stage 10), cells were
elongated but did not always extend lamelliform protrusions (Figure 2.6). Thus, to
quantify cell orientation, the angle of the cell long axis with respect to the
dorsal/ventral axis (lower PCM) or the BCR (upper PCM and LEM) was
measured from SEM images of sagittaly fractured embryos (Figure 2.3G).
84
The long axes of deep and more superficial (closer to the embryo surface) LEM
cells in the sagittal plane were predominantly oriented toward the BCR at angles
between 30o and 100o (avg. 71o +/- 3.2) with respect to the BCR (Figure 2.6A,E).
This highly oblique orientation is consistent with the reports of LEM spreading on
the inner BCR surface in the direction of the animal pole and is reflected in a
“shingle” like arrangement when viewed from the surface that is in contact with
the BCR (Figure 2.8A; Winklbauer and Nagel 1991; Davidson et al. 2002; Nagel
et al. 2004).
At the onset of gastrulation, goosecoid expression extends from just above the
embryo equator down to the bottle cell region of the blastopore lip (Figure 2.1A’).
Thus, the PCM can be subdivided into two regions, one that is adjacent to the
BCR (upper PCM) and one that is adjacent to the non-involuted CM (lower PCM),
where a separation boundary between Gsc and XBra expressing cells is
maintained (Figure 2.6G). The cell long axes of upper PCM cells were oriented at
angles between 0o and 100o (avg. 41o +/- 4.7) (Figure 2.6B,F), which is a broader
distribution of cell orientations when compared with the LEM (compare Figure
2.6A and B). At this stage of gastrulation, the lower PCM cells have not been
internalized to the level of the BCR. Thus, it is not possible to relate the
85
Figure 2.5: PCM cells become significantly elongated in the transverse plane during gastrulation (A-C) Scanning electron micrographs of stage 9 (A), stage 11 (B) and stage 12
(C) transversely fractured embryos; yellow lines show the length and width axes
of PCM cells along which length/width ratio measurements were taken. (D) Bar
graph comparing the average length/width ratios of PCM cells before and during
gastrulation, asterisk indicates a statistically significant result, P value < 0.0001.
Error bars show standard error of the mean. 7 (63 cells) stage 9, 10 (97 cells)
stage 11 and 6 (60 cells) stage 12 transversely fractured embryos were used to
generate the data. EN, endoderm; DMZ, dorsal marginal zone; BCR, blastocoel
roof.
86
Figure 2.5: PCM cells become significantly elongated in the transverse plane during gastrulation
87
orientation of these cells to the BCR; instead cell orientation was measured with
respect to the dorsal/ventral axis of the embryo. The orientation of lower PCM
cells was significantly different from cells of the upper PCM (P-value = 0.0007).
Upper PCM cells were oriented at angles between 40o and 90o (avg. 61o +/- 3.7)
with respect to the dorsal/ventral axis of the embryo (Figure 2.6C,G). Thus, the
BCR may produce a signal that can regulate the orientation of cells. The upper
PCM, which is adjacent to the BCR, may be influenced by such a signal. This
could explain the difference in orientation between the upper and lower PCM
regions.
When examined from sagitally fractured embryos, the chordamesoderm was
made up of a mixture of elongated and non-elongated cells. The long axes of the
elongated cells were oriented parallel to the animal/vegetal axis of the embryo,
predominantly at angles between 700 and 900 (avg. 80o +/- 3.3) with respect to
the BCR (Figure 2.6D,G). The orientation of the non-elongated cells could not be
determined from sagitally fractured embryos. These cells may be oriented into
the plane of the image and thus appear as non-elongated when viewed on end in
sagittal fractures (Figure 2.6G). Thus, non-involuted chordamesoderm cells
appear to be oriented in the animal/vegetal axis and the medial/lateral axes of the
embryo.
88
At the mid-gastrula stage (stage 11), LEM and PCM cells extend lamelliform
protrusions from the leading edge of the cell. To quantify cell orientation, I
measured the angles at which these protrusions were extended from the cell
body with respect to the BCR.
Cells of the dorsal LEM are heterogeneous in size. Individual cells appeared
either mesoderm like or endoderm like in size and morphology (Figure 2.7E).
Endoderm like cells tended to be larger and produced visibly smaller protrusions
with respect to the size of the cell body compared with mesoderm cells (Figure
2.7E). This mixture of morphologies suggests that this region is a mixture of
mesoderm and endoderm cells. LEM cells exhibited a distinct polarity with a
single protrusion-bearing pole. Like the PCM, LEM cells attached their
lamelliform protrusions to neighbouring cells (Figure 2.7E). The orientation of
LEM remained oblique with respect to the BCR, with most cells extending
protrusions at angles between 0 and 70 degrees (avg. 36o +/- 3.9) (Figure
2.7A,E).
Based on the location of Gsc expression, all PCM cells had been internalized
such that they were adjacent to the BCR by the mid-gastrula stage (Figure 2.1B’).
PCM cells were highly oriented toward the BCR (avg. 9o +/- 1.6 with respect to
the BCR) (Figure 2.7B,F). This orientation is perpendicular to the BCR and to the
animally directed movement of mesoderm. In contrast, the long axes of the large
89
Figure 2.6: The long axes of mesoderm cells are oriented parallel to the BCR at the start of gastrulation (A-D) Rose diagrams showing the percentage orientation of LEM (A) and upper
involuted PCM (B) cells with respect to the BCR and lower PCM (C) and
chordamesoderm (D) cells with respect to the dorsal/ventral axis. 0 degrees,
dorsal BCR or dorsal/ventral axis; 90 degrees, animal pole. (E-G) Scanning
electron micrographs of LEM (E), upper PCM (F) and lower PCM with
chordamesoderm (G), white arrowheads highlight cells with long axis orientations
that are parallel to the BCR (E,F) or dorsal/ventral axis (G), red arrowheads
highlight rounded cells that may be pointing into the plane of the image (G).
Orange, leading edge mesendoderm; yellow, prechordal mesoderm; purple,
chordamesoderm. LEM, leading edge mesendoderm; PCM, prechordal
mesoderm; Chorda, chordamesoderm; BC, blastocoel; BCR, blastocoel roof; EN,
endoderm. “n” is the number of cells scored per region from 10 embryos
analyzed. Crosshairs show directions of embryonic axes; An, animal pole; Ve,
vegtal pole; D, dorsal; V, ventral.
90
Figure 2.6: The long axes of mesoderm cells are oriented parallel to the BCR at the start of gastrulation
91
endodermal cells located deep to the PCM were oriented in parallel to the BCR
(avg. 78o +/- 1.7) (Figure 2.7C,F), similar to the orientation of lower PCM cells at
the start of gastrulation. Thus, apparently the lower PCM cells become oriented
toward the BCR as they are internalized and become positioned adjacent to the
BCR. These results support the idea that the BCR has an orienting influence on
PCM cells.
At the mid-gastrula stage the XBra expressing CM can be divided into involuted
and non-involuted sub-regions (Figure 2.1B, 2.6G). The non-involuted region is
located in the lower blastopore lip and involuted cells are located adjacent to the
BCR, posterior to the PCM (Figure 2.7G). The orientation of non-involuted CM
cells was not determined because few cells appeared elongated and many did
not have discernable protrusions. Like at the start of gastrulation, non-involuted
CM cells may have been oriented with the animal/vegetal and medial/lateral axes
of the embryo. Involuted CM often lacked clearly defined protrusions; therefore
the orientation of the cell long axis was measured. Like in the PCM, cells were
oriented perpendicular to the BCR (avg. 5o +/- 2.5 with respect to the BCR)
(Figure 2.7D,G). CM cells appear to behave in a similar way to PCM cells after
being internalized. As cells move into the embryo and become adjacent the BCR,
cells become oriented perpendicular to it. As suggested for the PCM,
chordamesoderm may also be under the influence of an orienting cue from the
BCR.
92
It has been shown that LEM cells adjacent to the BCR substrate extend
lamelliform protrusions preferentially toward the animal pole (Figure 2.8A and
Winklbauer and Nagel 1991; Nagel et al. 2004). In order to determine if the same
organization occurs in the PCM, the BCR was fractured away and the substrate
adjacent side of the mesoderm was imaged. Numerous protrusions were visible
but there was no obvious orientation and cells had a rounded morphology (Figure
2.8B). Furthermore, the protrusions appeared to be flat against neighbouring
mesoderm cells rather than pointing away from the surface of the embryo as if
they had been crossing Brachet’s cleft to form contacts with the BCR (Figure
2.8B). Thus, it appeared as though cells make contact with adjacent mesoderm
cells rather than the BCR. This observation suggests that unlike LEM cells, PCM
cells at the mesoderm/ectoderm interface may not use the BCR inner surface as
a migration substrate and thus, may use a different mechanism to spread in the
direction of the animal pole.
At the mid-gasrula stage, the XBra expressing blastopore lip is the site of
involution. Like PCM cells, non-involuted and involuted CM cells can extend
lamelliform and filiform protrusions (Figure 2.7G, 2.8C). When the dorsal
blastopore lip was fractured parallel to the embryo surface, medio-laterally
oriented bipolar cells extending protrusions from opposite poles of the cell were
visible (Figure 2.8C), which may be consistent with medio-lateral cell intercalation
(Keller and Tibbetts, 1989; Shih and Keller, 1992).
93
Figure 2.7: Internalized PCM and chordamesoderm cells are oriented toward the BCR (A-D) Rose diagrams showing the percentage orientation of LEM (A) PCM (B)
endoderm (C) and involuted chordamesoderm (D) cells with respect to the BCR.
0 degrees, dorsal BCR; 90 degrees, animal pole. Blue rose diagrams use the
angle at which protrusions are extended from the cell body with respect to the
BCR as a measure of orientation. Red rose diagrams use the orientation of the
cell long axis with respect to the BCR. (E-G) Scanning electron micrographs of
LEM (E), PCM and endoderm (F) and chordamesoderm (G), red arrowheads in
(E) highlight cells that are orientated parallel to the BCR; red arrowheads in (G)
indicate random orientation of cells; White arrowheads highlight cells oriented
perpendicular to the BCR (F,G). Red line in (G) is the boundary between non-
involuted and involuted chordamesoderm. LEM, leading edge mesendoderm;
PCM, prechordal mesoderm; Chorda, chordamesoderm; AC, archenteron; BC,
blastocoel; BCR, blastocoel roof; EN, endoderm. Orange, leading edge
mesendoderm; yellow, prechordal mesoderm; purple, chordamesoderm; blue,
endoderm. “n” is the number of cells scored per region from 10 embryos
analyzed.
94
Figure 2.7: Internalized PCM and chordamesoderm cells are oriented toward the BCR
95
Convergent extension movements are thought to start just prior to the mid-
gastrula stage (Keller et al. 1985; Keller and Danilchik, 1988). It is therefore
unclear how non-involuted medio-laterally oriented superficial cells cooperate
with the deeper non-involuted CM cells and radially oriented involuted CM cells to
narrow and elongate the anterior/posterior axis of the embryo. Internalized CM
cells were oriented like PCM cells, with a long axis orientation perpendicular to
the BCR (Figure 2.7D,G). When viewed from the side previously in contact with
the BCR inner layer, cells resembled the more anterior PCM cells and a strong
medio-lateral orientation was not visibly obvious (Figure 2.8D). The contribution
of involuted chordamesoderm cells to medial-lateral intercalation based
convergent extension is unknown and difficult to visualize given the long axis
orientation of the cells.
There was no change in orientation of LEM or PCM cells by late gastrulation
(compare Figures 2.7A-B, E-F; 2.9A-B, F-G), although the PCM had apparently
thinned to a single cell layer that was in contact with the BCR (Figure 2.9A-B, F-
G). Post-involution chordamesoderm cells were still oriented perpendicular to the
BCR, but cells had become strongly protrusive (Figure 2.9C,D). Unlike the PCM
however, where protrusions are always oriented toward the BCR, I observed that
59% of CM cells extended their lamelliform protrusions toward the BCR while
16% extended lamelliform protrusions toward the archenteron (Figure 2.9C, E).
96
Figure 2.8: LEM, PCM and CM exhibit distinct cell morphologies when viewed from the BCR apposed surface (A-C) Scanning electron micrographs of the surface of the mesoderm that is
normally apposed to the inner layer of the BCR. Mid-gastrula leading edge
mesendoderm (LEM) (A), white arrowheads point at oriented cells. Mid-gastrula
prechordal mesoderm (PCM) (B), white arrowheads point to cells with rounded
morphology. Pre-involution chordamesoderm (C), white arrowheads point at
protrusions on opposite poles of bipolar cells. Post-involution chordamesoderm
located anterior to the pre-involution chordamesoderm, white arrowheads point at
protrusions on opposite poles of bipolar cells, red arrow heads highlight cells with
rounded morphology, similar to PCM cells (D); the crosshairs show the directions
of embryonic axes. Lat., lateral; Chorda, chordamesoderm.
97
Figure 2.8: LEM, PCM and CM exhibit distinct cell morphologies when viewed from the BCR apposed surface
98
PCM cells were never found to extend protrusions toward the archenteron,
therefore different signals may regulate cell body orientation and the direction of
protrusion extension. Thus, chordamesoderm cells may not respond to the same
protrusion orienting cue as the PCM. Interestingly, the long axis of non-involuted
CM cells became oriented radially by late gastrulation (Figure 2.9D, H).
2.2.4: PCM cells undergo radial intercalation as they migrate toward the mesoderm/ectoderm boundary
The PCM dramatically thinned from what was a multi-layered tissue during mid-
gastrulation to a single layer of cells by the end of gastrulation (Figure 2.9G).
Comparison of PCM thickness over the course of gastrulation showed a
significant change in region thickness resulting in an average thinning of 89 µm
over 4.5 hours (P-value < 0.0001) (Figure 2.10A,D). In contrast, there was no
change in the thickness of post-involution chordamesoderm from mid-gastrulation
to late gastrulation (Figure 2.10A).
To determine whether the change in PCM thickness is due to rearrangement or
flattening of cells, we measured the layer index, i.e. tissue thickness in terms of
cell layers (Keller, 1980; Figure 2.10B). The average layer index changed
significantly over the course of gastrulation. It was reduced from 3.1 +/- 0.09
(upper PCM) at the start of gastrulation to 1.5 +/- 0.08 by the late gastrula stage
99
Figure 2.9: PCM thins to a single cell layer by the late gastrula stage (A-D) Rose diagrams showing the percentage orientation of LEM (A) PCM (B)
chordamesoderm (C) and non-involuted chordamesoderm (D). 0 degrees, dorsal
BCR/outer embryonic epithlium; 90 degrees, animal pole. Blue rose diagrams
use the angle at which protrusions are extended from the cell body with respect
to the BCR as a measure of orientation. Red rose diagrams use the orientation of
the cell long axis with respect to the outer embryonic epithelium. (E) High
magnification scanning electron micrograph of bi-directionally oriented involuted
chordamesoderm cells. White arrowhead, cell oriented toward BCR; red
arrowhead, cell oriented toward the archenteron epithelium (F-H) Scanning
electron micrographs of LEM (F), PCM (G) and chordamesoderm (H), white
arrowheads highlight cells that are orientated perpendicular to the BCR (F-H).
Red arrowheads highlight cells oriented parallel to the BCR (F). LEM, leading
edge mesendoderm; PCM, prechordal mesoderm; Chorda, chordamesoderm;
AC, archenteron; BC, blastocoel; BCR, blastocoel roof; EN, endoderm. Orange,
leading edge mesendoderm; yellow, prechordal mesoderm; purple,
chordamesoderm. “n” is the number of cells scored per region from 10 embryos
analyzed.
100
Figure 2.9: PCM thins to a single cell layer by the late gastrula stage
101
(P-value < 0.001) (Figure 2.10C, D-G). There was no change in the layer index of
the post-involution CM (Figure 2.10C, H-I). Occasionally, cells undergo cell
division during gastrulation. If the plane of cell division were parallel to the long
axis of the cell, the resultant daughter cells could increase the number of cell
rows between the BCR and the endoderm, increasing the layer index.
Regardless of cell divisions, the PCM thins to a single cell layer by the end of
gastrulation (Figure 2.10C, D-G) suggesting that all PCM cells, including cells
that appear as a result of cell divisions, undergo radial intercalation. Furthermore,
It is unlikely that cell divisions are responsible for keeping the post-involution CM
multilayered over gastrulation because it has been shown that CM cells are
arrested in the G2 phase during gastrulation (Cooke, 1979). Thus, together with
the presence of oriented protrusions, these results suggest that the PCM
undergoes radial intercalation. Significant insertion of deeper cells into the
superficial layer of the PCM has indeed been observed (Winklbauer and
Schurfeld, 1999). The CM also likely undergoes radial intercalation during the
formation of the notochord (Keller et al. 1989), however these movements may
not be prominent until after the start of neurulation, when convergent extension
occurs most strongly (Wilson and Keller, 1991; Keller et al. 1985).
2.2.5: Intercellular migration drives PCM radial intercalation
PCM cells attach their BCR oriented protrusions to surrounding PCM cells,
suggesting that cells use each other as a substrate for migration. The PCM thins
102
significantly from an average thickness of 139 +/- 5.1µm during early gastrulation
(NF stage 10+) to 106 +/- 4.6µm during mid-gastrulation (NF stage 11) (P-value =
0.0035) corresponding to an average rate of thinning of 0.3 µm/min (Figure
2.9A,D). The rate of thinning increases at mid-gastrulation, significantly thinning
the PCM to 50 +/- 8.8 µm (P-value < 0.0001) by the late gastrula stage (NF stage
12) at an average rate of 0.6 µm/min (Figure 2.10A,D). Thus, the overall average
rate of thinning of the PCM is 0.45 µm/min (Figure 2.10D). While cell shape
changes such as the flattening of cells can result in thinning of a tissue, it is likely
that it contributes little to the thinning of this region considering that a single,
superficial layer of cells is flattened against the BCR throughout gastrulation
(Figure 2.10D,F). Thus, the average rate of PCM thinning corresponds to the
average radial intercalation rate. Since radial intercalation is occurring by
intercellular migration, the rate of radial intercalation corresponds to the relative
rate of intercellular movement in the PCM.
The opacity of the Xenopus embryo prevents direct observation of cell
movements, therefore in order to analyze live PCM morphogenesis, dorsal
mesoderm and endoderm, including the PCM, was explanted and combined with
BCR (Figure 2.11A). These slice explants preserve the endogenous tissue
arrangement. Based on the SEM study, I expected that PCM cell movement
would be directed towards the BCR. This was indeed observed (Figure 2.11B-C).
Although only cells at the explant surface can be filmed, which may move more
103
2.10: PCM undergoes radially directed cell rearrangements
(A) Bar graph comparison of changes in Chordamesoderm (XBra) and PCM
region thickness over gastrulation. The PCM thins significantly between stages
10 and 11 (p-value < 0.0001, n = 10) and again between stages 11 and 12 (p-
value < 0.0001, n = 10 embryos/stage) (B) the layer index is a measure of cell re-
arrangement and is calculated as the shortest number of transitions (indicated by
numbers) from cell to cell between the BCR and the endoderm (direction
indicated by red arrows). (C) Comparison of layer index changes in
chordamesoderm (XBra) and PCM over gastrulation. PCM layer index changes
significantly from stage 10 to 11 (p-value = 0.0018, n = 10) and again from stage
11 to 12 (p-value < 0.0001, n = 10) (D) Change in region thickness and layer
index over the 4.25 hour period of gastrulation analyzed. (E-I) High magnification
scanning electron micrographs of PCM (D-F) at stages 10 (D), 11 (E) and 12 (F)
with the span of mesoderm regions indicated with the layer index. Error bars
represent standard error of the mean, asterisks indicated statistically significant
results. PCM, prechordal mesoderm; XBra, chordamesoderm; BCR, blastocoel
roof; AC, archenteron; EN/Endo, endoderm.
104
Figure 2.10: PCM undergoes radially directed cell rearrangements
105
easily between deeper cells and the coverslip than between lateral cells in this
artificial situation, instances of radial intercalation were nevertheless observed
(Figure 2.1B-B’), consistent with the active directional migration of individual cells
on each other’s surface.
To further analyze the directional intercellular migration of PCM cells, I developed
a different explant system (Figure 2.12A). The former posterior side of the PCM
region of a mesoderm explant was brought into contact with explanted BCR. This
array recapitulates the in vivo apposition of mesoderm and ectoderm while re-
directing cell movements from radially to posteriorly. After 30 minutes, when
explants had adjusted in response to the mechanical effects of the assembly of
the explants, cell movements were followed.
Similar to in vivo, PCM cells extended large lamelliform protrusions toward the
BCR explant (see Figure 2.12A,B). Cells were observed to exchange neighbors
while they moved towards the BCR, again reinforcing evidence of active
directional migration of individual cells on the cells deeper in the explant (Figure
2.12B-E). Occasionally, cells from deep in the explant appeared at the surface
where they joined the cohort of cells migrating toward the ectoderm explant
(Figure 2.12B-E).
It is unknown if PCM cells in contact with the BCR in vivo (i.e. the superficial layer
106
Figure 2.11: PCM radial intercalation in vitro
(A) Explant system. (1.) Slice of mesoderm and adjacent endoderm is combined
with (2.) explanted BCR under a coverslip and (3.) filmed to track mesoderm cell
movements. Blue, endoderm; green, ectoderm; orange, mesoderm; red arrow
show direction of cell intercalation; A, anterior; P, posterior; D, dorsal; V, ventral.
(B-B’) Frames from timelapse recording. (B) Cell cluster at 0 min. (B’) Same
cluster after 30min, cells have intercalated at the mesoderm/BCR boundary
(white dotted line). (C) Cell movement tracks from explants during intercalation
movements.
107
Figure 2.11: PCM radial intercalation in vitro
108
of PCM cells) use it as a substrate for migration like LEM cells (Winklbauer and
Nagel, 1991; Nagel et al. 2004). In vitro, if PCM cells were to migrate over the
BCR explant, it may appear as though they are migrating toward it. To determine
if mesoderm/BCR separation is maintained in explants, BCR-mesoderm explants
were fractured and analyzed by SEM. Although the BCR-mesoderm boundary
was not perfectly straight in fractures, PCM cells maintained a separation
boundary between the BCR and did not migrate over it (Figure 2.13C). Thus, the
observed movement of PCM cells is toward the BCR explant and not across its
surface.
Cell velocity was measured during consecutive 30-minute intervals (Figure
2.12F-H). Directional movement of mesoderm cells within a five-cell diameter
zone (zone R1) adjacent to the BCR was apparent 30 minutes after assembly of
the explants (Figure 2.12F). Directional movement continued over the next hour
(Figure 2.12F), at an average velocity of 0.8 +/- 0.03 µm/min, which is in the
same range as the rate of intercellular migration in vivo (0.45 µm/min +/- 0.05).
Cells located further from the BCR (zones R2 and R3; Figure 2.12G,H) were
motile but never moved directionally (Figure 2.12G,H). This observation suggests
that the influence of the BCR has a finite distance of approximately five cell
lengths into the mesoderm explant, which corresponds to a distance of
approximately 200 µm (PCM cell length approx. 40 µm; Selchow and Winklbauer,
1997). Directional migration of cells was dependent on the BCR. Explants of
109
mesoderm alone did not show any directional movement and cells moved
randomly (Figure 2.13D). Furthermore, the directional movement response to the
BCR appeared to be unique to mesoderm cells. When explants of endoderm, in
place of mesoderm, were combined with BCR explants, the endoderm cells
moved randomly over the 90 minute period (Figure 2.13E). These results strongly
suggest that a directional determinant, that mesoderm cells are sensitive to, is
released by the BCR. This determinant may form a chemotactic gradient in the
mesoderm tissue that guides cells to the mesoderm/BCR boundary where radial
intercalation occurs.
2.2.6: Anterior lateral and ventral mesoderm cells are oriented toward the BCR I extended the cell orientation analysis to the lateral and ventral mesoderm at the
mid-gastrula stage. Lateral and ventral LEM, anterior mesoderm and non-
involuted XBra expressing cells were similar in shape to their dorsal counterparts
in sagittally fractured embryos (Figure 2.14; 2.15). Like dorsal LEM and PCM,
ventral and lateral LEM and anterior mesoderm cells extended lamelliform
protrusions (Figure 2.14D-F; 2.15D-F). Smaller protrusions were present on XBra
expressing cells (Figure 2.14F; 2.15F). The orientation of lateral and ventral LEM
cells was similar to dorsal LEM. Cells were oriented highly obliquely and
extended protrusions at angles between 0o and 110o (avg. ventral: 63o +/- 4.6,
110
Figure 2.12: PCM cells migrate directionally in vitro
(A) Explant system. (1., 2.) Mesoderm and endoderm or ectoderm are explanted,
combined and left to relax for 15 minutes. BCR or endoderm is placed at the
posterior, PCM-containing end of mesoderm explant, to force cells to reorient by
90 degrees (from radially to posteriorly). Explant combinations (3.) are filmed,
and cell velocities measured. R1-R3, regions each five cell diameters wide. Blue,
endoderm; green, ecotoderm; orange, mesoderm; red arrow, redirected cell
movement; A, anterior; P, posterior; D, dorsal; V, ventral. (B-E) Frames from
timelapse recording of a BCR-mesoderm explant. (B) Selected cells at 0 min; (C)
at 30 min, cells close to the BCR (green, light blue, purple and red) are moving
toward the BCR; position where a cell will emerge from below is marked by
turquoise arrowhead; (D) at 60 min, the light blue cell has made contact with the
BCR, the purple cell has divided, the turquoise cell has emerged; (E) at 90 min,
the blue and green cells contact the BCR, the green cell has divided. The dark
blue cell has remained at a constant distance from the BCR. (F-H) Velocity plots
showing average velocities of 50 individual cells collected from five separate
BCR-mesoderm explants. Positive y-axis is toward the BCR. (F) Cells in R1
migrate directionally. (G,H) Cells in R2 and R3 show random migration.
111
Figure 2.12: PCM cells migrate directionally in vitro
112
avg. lateral: 51o +/- 3.8) with respect to the BCR (Figure 2.14A,D; 2.15A,D). The
oblique orientation of LEM cells all around the embryo could be due to
mechanical influence by the free margin ahead of the LEM. Alternatively, LEM
cells may not receive the same concentration of orienting cues from the BCR or
may not be able to respond as strongly to these signals, potentially resulting in
the oblique orientation of these cells.
The orientation of anterior mesoderm on the ventral and lateral sides of the
embryo was strikingly similar to the PCM on the dorsal side. Cells were strongly
oriented toward the BCR, predominantly extending protrusions at angles between
0o and 20o (avg. ventral: 11o +/- 1.5, avg. lateral: 11o +/- 1.4) with respect to the
BCR (Figure 2.14B,E; 2.15B,E). Thus, involuted mesoderm all around the
embryo may undergo radial intercalation as the cells migrate toward the
mesoderm/ectoderm boundary.
The long axes of cells in the ventral and lateral XBra expressing regions (non-
involuted at mid-gastrulation) were oriented perpendicular to the animal/vegetal
axis of the embryo when viewed in sagittaly fractured embryos (avg. ventral: 34o
+/- 4, avg. lateral: 20o +/- 2) (Figure 2.14C,F; 2.15C,F). The orientation of these
cells is different from the non-involuted XBra cells on the dorsal side of the
embryo, which appeared largely random at the mid-gastrula stage (Figure 2.7G).
113
Figure 2.13: Directional migration of PCM cells in vitro is BCR dependent
(A,B) Confocal microscopy images of a mesoderm explant expressing a
membrane bound RFP construct, white arrowheads show BCR oriented
protrusions on the surface of the explant (A), protrusions are not visible beneath
the surface, white arrowheads (B). (C) Scanning electron micrograph of a
mesoderm-BCR combined explant, red dotted line highlights the mesoderm-
ectoderm boundary; green, ectoderm explant; orange, mesoderm explant. (D,E)
Velocity plots showing average velocities of 50 individual cells collected from 5 of
the following explant combinations: (D) Mesoderm alone, no BCR explant and (E)
endoderm combined with a BCR explant.
114
Figure 2.13: Directional migration of PCM cells in vitro is BCR dependent
115
Figure 2.14: Involuted lateral mesoderm and LEM orientation is similar to their dorsal counterparts
(A-C) Rose diagrams showing the percentage orientation of lateral LEM (A),
involuted lateral mesoderm (B) and XBra expressing lateral mesoderm (C). Blue
rose diagrams use the angle at which protrusions are extended from the cell
body with respect to the BCR as a measure of orientation. Red rose diagrams
use the orientation of the cell long axis with outer embryonic epithelium. (D-F)
Scanning electron micrographs of LEM (D), lateral involuted mesoderm (E) and
lateral XBra expressing mesoderm (F), red arrowheads highlight cells that are
orientated parallel (D) to the BCR; white arrowheads highlight cells that are
oriented perpendicular to the BCR (E) or outer embryonic epithelium (F) Blue,
lateral leading edge mesendoderm; green, involuted lateral mesoderm; purple,
lateral XBra expressing mesoderm; BCR, blastocoel roof; EN, endoderm; BC,
blatocoel. “n” is the number of cells scored per region from 10 embryos analyzed.
116
Figure 2.14: Involuted lateral mesoderm and LEM orientation is similar to their dorsal counterparts
117
Figure 2.15: Involuted ventral mesoderm and LEM orientation is similar to their dorsal counterparts
(A-C) Rose diagrams showing the percentage orientation of ventral LEM (A),
involuted ventral mesoderm (B) and XBra expressing ventral mesoderm (C) at
the mid gastrula stage (NF stage 11). Blue rose diagrams use the angle at which
protrusions are extended from the cell body with respect to the BCR as a
measure of orientation. Red rose diagrams use the orientation of the cell long
axis with outer embryonic epithelium. 0 degrees, lateral BCR/outer embryonic
epithelium; 90 degrees, animal pole. (D-F) Scanning electron micrographs of
LEM (D), ventral involuted mesoderm (E) and ventral XBra expressing mesoderm
(F), red arrowheads highlight cells that are orientated parallel (D) to the BCR;
white arrowheads highlight cells that are oriented perpendicular to the BCR (E) or
outer embryonic epithelium (F) Blue, ventral leading edge mesendoderm; green,
involuted ventral mesoderm; purple, ventral XBra expressing mesoderm; BCR,
blastocoel roof; EN, endoderm; BC, blatocoel. “n” is the number of cells scored
per region from 10 embryos analyzed.
118
Figure 2.15: Involuted ventral mesoderm and LEM orientation is similar to their dorsal counterparts
119
This difference may be related to the convergent extension movements on the
dorsal side of the embryo.
2.3: Discussion
In this chapter I analyzed cell morphology and orientation in different mesoderm
regions in order to develop a view of the movements in each region. In analyzing
the PCM, I found that these cells, which are oriented perpendicular to the BCR,
undergo radial intercalation as the cells migrate over the surfaces of
neighbouring cells, toward the mesoderm/BCR interface. Furthermore, I showed
that this movement was mesoderm specific and dependent on the BCR.
2.3.1 Complementing in vitro explant studies with intact embryo studies Studies of cell movements during Xenopus gastrulation have made heavy use of
tissue explants. While these experiments have been highly informative, questions
have been raised about how accurately the in vitro observations translate over to
what happens in an intact embryo.
Our understanding of Xenopus CM morphogenesis has been derived from
studies of explanted tissue (Keller et al. 1985; Keller and Danichik, 1988; Keller
and Tibbetts, 1989; Wilson and Keller; 1991). In explants bipolar CM cells are
oriented in a medial to lateral direction and converge and intercalate at the
120
explant midline, resulting in elongation of the tissue (Keller and Tibbetts, 1989;
Keller et al. 1989). My SEM analysis of CM in the mid-gastrula stage embryo has
identified a layer of non-involuted cells beneath the supra-blastoporal endoderm
that are arranged in a medial-lateral orientation (Figure 2.8C). Prior to the start of
gastrulation, the CM is located in the equatorial region of the embryo. Since the
embryo is spherical, the radius decreases at lines of latitude that are closer to the
blastopore. Thus, as the mass of CM cells rotates vegetally during involution, the
cells must constrict toward the midline in order for the region to move into the
embryo through the blastopore. Therefore, it is not clear if the oriented cells seen
in the embryo are driving tissue elongation or if their orientation is a consequence
of the constriction required for the region to move into the embryo through the
blastopore. At the mid-gastrula stage there is relatively little CM remaining to be
internalized. Therefore, it seems unlikely that these medio-laterally oriented cells
could drive the extension of the anterior/posterior axis through the later gastrula
stages. Further complexity is added when considering that involuted CM cells are
apparently organized perpendicular to the BCR (Figure 2.6G) and that superficial
involuted CM cells are not strongly medio-laterally oriented beneath the BCR
substrate (Figure 2.8D). This organization is not consistent with the dominance of
medio-lateral intercalation that has been observed in explants. Thus, the
apparent medial to lateral orientation of cells in explants has not been directly
observed in an intact embryo and may suggest that elongation occurs through a
different mechanism in vivo; radially directed movements which have also been
121
observed in explants (Wilson and Keller, 1991), may dominate in the embryo.
Further in vivo analysis must be done to address these questions.
Combining data from in vitro studies of LEM cell migration with studies of intact
embryos has also been problematic. LEM cells are thought to migrate on the
inner surface of the blastocoel roof (BCR) with PDGF signalling directing cells
toward the animal pole (Winklbauer and Nagel, 1991; Nagel et al. 2004). This is
thought to be important in the spreading of mesoderm over the inner BCR and in
the animally directed translocation of the mesoderm as a whole (Winklbauer and
Nagel, 1991; Davidson et al. 2002). Our understanding of this process comes
from analyzing the behaviour of explanted mesoderm on extracellular matrix
(ECM) and associated PDGF guidance cues that were transferred from the BCR
to a glass slide. LEM explants migrate on this substrate toward what would have
been the animal pole in an intact embryo. However, when transmission electron
micrographs are taken of whole embryo sections, there appears to be no contact
between LEM cells and the BCR (Figure 2.16A). It is therefore unclear if these
cells migrate on this surface in the embryo. Furthermore, my SEM analysis of this
region has shown that the leading edge is apparently over taken by a mass of
endoderm cells, which can be identified by their different orientation and cell size
(Figure 2.16B), well before the end of gastrulation. Therefore, the significance of
this process in animally directed movement and spreading of mesoderm needs
further clarification by studies with intact embryos.
122
In my study of PCM morphogenesis, I have primarily made use of SEM to
analyze cell orientation and morphology over the course of gastrulation. This
approach allowed me to design explant systems, which maintain the in vivo cell
relationships between endoderm, mesoderm and BCR. By basing the design of
my explant systems on what I observed in whole embryos, the observations have
been transferrable to the in vivo situation.
2.3.2 Mesoderm regions undergo region specific morphogenetic movements Convergent extension movements of the chordamesoderm have been
extensively studied with less emphasis being given to the movements occurring
in other regions of the embryo. This has led to an idea that convergent extension
is a driving force of anterior/posterior axis elongation (Keller 2004; Solnica-Krezel
and Sepich, 2012). This is likely due to the dramatic shape change that occurs
when explanted chordamesoderm is cultured over the course of gastrulation.
This is misleading and detracts from the significance of movements in other
regions of mesoderm. Gastrulation is a system of movements, which is highly co-
ordinated; it is unlikely that any one of these movements could be deleted without
seriously disrupting the development of the embryo. In some cases disruption of
a movement may result in a less dramatic phenotype in later stage embryos,
123
Figure 2.16: Electron microscropy of the LEM
(A) Transmission electron micrograph of Brachet’s cleft indicated by white
arrowheads. The LEM are the cells on the left and the BCR are the cells on the
right. (B) Scanning electon micrograph of the LEM of a stage 12 embryo, red
arrowheads highlight cells that are oriented toward the BCR in the LEM and the
adjacent endoderm. White arrow indicates endoderm mass which has overtaken
the LEM. EN, endoderm; LEM, leading edge mesendoderm.
124
Figure 2.16: Electron microscropy of the LEM
125
however to use a superficial observation like the external appearance of an
embryo, as criteria to determine the significance of a gastrulation movement
would be irresponsible. What may seem like a subtle effect in such a superficial
analysis could have a dramatic effect on the adult organism. To improve the
understanding of gastrulation as a system, I investigated the morphogenesis of
the under studied prechordal mesoderm and analyzed the orientations of cells in
lateral and ventral mesoderm regions.
Others and myself have shown through analysis of gene expression patterns and
differences in cell morphology that the dorsal mesoderm can be divided into at
least three types of mesoderm, XBra expressing CM, Gsc expressing PCM and
LEM (Smith et al. 1991, Wilkinson et al. 1991, Cho et al. 1991, Niehrs et al. 1994;
Saint-Jeannet et al. 1994, Damm and Winklbauer, 2004). The CM and PCM
regions can be further subdivided into involuted and non-involuted regions
(Figure 2.6G; 2.7G). I have shown that at the start of gastrulation non-involuted
CM cells are randomly oriented, non-involuted PCM is oriented parallel to the
animal/vegetal axis of the embryo and involuted PCM cells are oriented
perpendicular to the BCR (Figure 2.6B-D,G). LEM cells are oriented obliquely
with respect to the BCR throughout gastrulation (Figure 2.6A; 2.7A; 2.9A). At
later stages of gastrulation, post-involution CM cells are elongated, oriented
perpendicular to the BCR and extend protrusions toward and away from the BCR
while involuted PCM cells are oriented perpendicular to the BCR and extend
126
protrusions toward the BCR. The PCM ultimately ends up thinning to a single
layer of cells by the end of gastrulation (Figure 2.9G; 2.10C,G). Therefore, these
sub-regions can be defined as independent motility domains because region
specific cell orientations are suggestive of distinct cell movements occurring in
each region. Furthermore, explants of CM, PCM and LEM show autonomy in
their movements suggesting that morphogenesis of these regions is independent
each other (Figure 2.11; Keller et al. 1985; Keller and Tibbetts, 1989; Wilson and
Keller, 1991; Winklbauer and Nagel, 1991; Nagel, et al. 2004; Damm and
Winklbauer, 2011). Depending on the stage of the gastrula, there can be up to
four distinct movement domains (in the early gastrula; LEM, upper PCM, lower
PCM, CM) within the dorsal mesoderm undergoing region specific movements
simultaneously.
The lateral and ventral mesoderm can also be divided into three regions, XBra
expressing posterior mesoderm, anterior mesoderm and LEM. Cell orientations in
the anterior mesoderm and LEM are similar to those found in the PCM and dorsal
LEM respectively (Figure 2.14A-B; 2.15A-B). Unlike on the dorsal side of the
embryo, the non-involuted XBra expressing region was not randomly oriented but
was oriented roughly perpendicular to the animal/vegetal axis of the embryo
(Figure 2.14C,F; 2.15C,F). Movements of lateral and ventral mesoderm have
also been largely neglected in favour of the more dramatic movements of the
127
dorsal mesoderm. Further analysis of lateral and ventral mesoderm
morphogenesis will be required for a systematic understanding of gastrulation.
It is the sum of movements on the dorsal, lateral and ventral sides of the embryo
that results in the correct positioning of cells at the end of gastrulation.
Intercalation and directional migration of the dorsal PCM and LEM occurs
autonomously in explants of these tissues that have been isolated from the other
mesoderm regions. Thus, it is unlikely that convergent extension of the CM could
act as a driving force to ensure the correct positioning of cells in the PCM, dorsal
LEM or the lateral and ventral mesoderm. Therefore to understand gastrulation,
cell movements must be analyzed on a regional basis.
2.3.3 Intercellular migration and radial intercalation
Anterior mesoderm cells extend large lamelliform protrusions in the absence of
any external cues (Keller and Schoenwolf, 1977; Winklbauer and Nagel, 1991;
Damm and Winklbauer, 2011) and attach these protrusions to neighbouring cells.
This suggests that cells use the surfaces of their neighbours as points of
attachment while they squeeze between adjacent cells. Medial-lateral
intercalation in chordamesoderm explants may also be dependent on intercellular
migration since it is a BCR substrate independent and autonomous process
(Keller et al. 1984; Keller and Tibbetts, 1989; Wilson and Keller, 1991). Thus,
intercellular migration may play a role in several gastrulation movements. The
128
cell-cell adhesion molecules involved in intercellular migration have not been
characterized. However, cell-cell adhesion molecules like EP/C-cadherin and
XB/U-cadherin are candidate molecules as they are the only classical cadherin
molecules known to be expressed in mesoderm tissue during gastrulation (Muller
et al. 1994; Kuhl and Wedlich, 1996).
The long axes and lamelliform protrusions of PCM cells are strongly oriented
toward the BCR (Figure 2.7B,F). Over the course of gastrulation these cells
migrate toward the BCR and intercalate at the mesoderm/BCR interface in an
instance of radial intercalation. PCM cells are elongated and unipolar, thus the
orientation and protrusive activity of the cells suggests unidirectional radial
intercalation, in the direction of the BCR. The thinning of the PCM is significant.
The region starts out as being 3 to 4 cell layers thick at the start of gastrulation
and ends up as a monolayer by the end of gastrulation (Figure 2.9C; 2.10F). Cell
shapes do not change dramatically over the course of gastrulation and therefore
intercalation of cells would result in an expansion of the area of PCM that is in
contact with the BCR.
Radial intercalation has been observed elsewhere during gastrulation. Although
medio-lateral intercalation is the primary movement observed in CM explants,
radial intercalation is observed during the early phase of convergent extension
when cells from deeper in open-faced CM explants appear at the surface (Wilson
129
and Keller, 1991; Shih and Keller, 1992; Wallingford et al. 2000; Keller, 2002).
This in vitro observation may fit with my intact embryo observation of radially
oriented cells in the post-involution chordamesoderm (Figure 2.7G). Additionally,
radial intercalation has been reported in ectoderm during epiboly (Keller, 1980;
Marsden and DeSimone, 2001) at the anterior periphery of the LEM (Davidson et
al, 2001) and in the morphogenesis of the SM (Wilson and Keller, 1991; Yin et al.
2008). Radial intercalation of the PCM and the axial mesoderm (somitic and
chordamesoderm) can contribute significantly to elongation of the
anterior/posterior axis of the embryo. In the zebrafish SM, radial interaction
results in an anisotropic elongation of the tissue (Yin et al. 2008). This is because
intercalating cells preferentially insert between anterior/posterior neighbours
rather than lateral neighbours. This results in an extension in the
anterior/posterior direction. The molecular regulation of this process is not well
understood but may involve members of the non-canonical Wnt signalling
pathway (Yin et al. 2008). Furthermore, radial intercalation and anisotropic
spreading of the SM has been observed in Xenopus as well (Wilson and Keller,
1991). Thus, if this polarized anisotropic radial intercalation process is occurring
in SM, CM and PCM, it could have a significant effect on the elongation of the
anterior/posterior axis of the embryo.
I found that the orientation of lateral and ventral involuted mesoderm cells is also
consistent with unidirectional radial intercalation. In a pervious study, ventral
130
mesoderm cells were labelled with a vital dye prior to involution (Ibrahim and
Winklbauer, 2001). When the BCR was fractured away following involution,
labelled and unlabelled cells were in contact with the BCR, which suggests that
unlabelled cells from deeper in the explant had arrived at the mesoderm/BCR
boundary by radial intercalation.
Unidirectional radial intercalation in the PCM and corresponding lateral and
ventral mesoderm domains is associated with strong tissue spreading in a zone
which has to expand most as the mesoderm moves animally within the spherical
geometry of the gastrula (Keller and Tibbetts, 1989; Winklbauer and Schurfeld,
1999; Ibrahim and Winklbauer, 2001). The expansion of the PCM almost
certainly contributes to elongation of the anterior/posterior axis of the embryo,
however the extent of this contribution is not known. Theoretically the extent of
spreading could be determined by measuring the change in area of mesoderm
occupied by labelled PCM cells over the course of gastrulation. Dorsally, I have
shown that this spreading is dependant on the BCR, but does not require direct
contact with its fibronectin matrix (Winklbauer and Schurfeld, 1999). Furthermore,
this movement is tissue autonomous and therefore does not depend on the
movements occurring in the CM or the LEM. My results suggest that spreading
may be due to a long distance attraction of mesoderm cells by the BCR, leading
to radial intercalation.
131
2.4: Materials and Methods
2.4.1: Embryos and microinjections Xenopus laevis embryos were fertilized in vitro in 1/10X Modified Barth’s Solution
(MBS). Fertilized embryos were de-jellied with 2% cysteine solution diluted in
1/10X MBS at pH of 8.0. Embryos were left to develop to the required stages in
1/10X MBS in and incubator at 15o Celsius. Developing embryos were staged
with The Normal Table of Xenopus Development by Nieuwkoop and Faber, 1967.
For confocal microscopy experiments, embryos were injected with 150 pg per
blastomere of mRNA encoding a cell membrane bound RFP molecule in the
equatorial region of the two dorsal blastomeres at the four cell stage in 4% Ficoll
solution (Sigma) using pulled glass needles and a Nanoject II microinjector
(Fisher). Injected emrbyos were kept in 4% Ficoll solution for one hour following
injection to prevent the loss of cytoplasm while the blastomeres healed around
the injection site. Embryos were transferred to 1/10X Modified Barth’s solution
(MBS) and left to develop at 15°C until the required stage.
2.4.2: In-Situ Hybridization and In-Situ Probe Synthesis The in situ hybridization protocol and solutions were adapted from Harland, 1991.
Embryos were fixed for 1 hour in MEMFA and were then sagitally fractured.
Embryos were fixed for an additional hour in MEMFA. Samples were treated with
Proteinase K (Sigma) for 10 minutes followed by two washes with
132
triethanolamine and three washes with triethanolamine/acetic anhydride mixture.
Embryos were re-fixed in 4% formaldehyde for 30 minutes followed by washes
with PBS-Tween. Embryos were immersed in hybridization buffer and subjected
to a pre-hybridization period of 4 hours at 60o Celsius before adding the RNA in
situ probe. After addition of probe, embryos were incubated overnight at 60o
Celsius. Embryos were washed in 2X SSC buffer followed by washes in 0.2X
SSC. Embryos were washed in maleic acid buffer and blocked with 2% BMB
blocking buffer plus 20% Gibco Lamb Serum (Life Technologies) in maleic acid
buffer for one hour at room temperature. Subsequently, samples were incubated
in 2% BMB blocking buffer, 20% Gibco Lamb Serum and a 1/2000 dilution of the
anti-digoxygenin antibody in maleic acid buffer for 4 hours at room temperature.
Samples were washed overnight in maleic acid buffer. Samples were washed
with alkaline phosphatase buffer before the addition of BM Purple (Roche).
Embryos were incubated in BM Purple at room temperature for 2.
Plasmids (DB30 for XBra, pBluescript for Gsc) were linearized with BgIII for XBra
(M. Sargent Lab) and EcoRI for Gsc (H. Steinbeisser Lab). Anti-sense mRNA
probes for XBra and Gsc were generated by in vitro transcription using a
mMessage mMachine T7 RNA polymerase kit (Life Technologies) according to
the kit protocol. The kit supplied nucleotide triphosphates (NTPs) were
substituted with digoxigenin-labeled NTPs (Roche).
2.4.3: Scanning Electron Microscopy
133
Embryos were fixed in 2.5% glutaraldehyde/0.1M sodium cacodylate solution, pH
7.4, overnight at 4° Celsius before being fractured with a scalpel as required for
the experiment being performed. Embryos were post-fixed in 1% osmium
tetraoxide (SPI or Cedarlane) diluted in 0.1M sodium cacodylate solution (Sigma)
for 1 hour at 4° Celsius before being treated with ethanol/0.1M cacodylate
solution dehydration series. Embryos were treated with 50% ethanol diluted in
0.1M cacodylate solution for 20 minutes, followed by two treatments of 100%
ethanol for 20 minutes each. Embryos were then treated with 50%
hexamethyldisilizane (Sigma) diluted in 100% ethanol for 30 minutes, followed by
two treatments of 100% hexamethydisilizane for 30 minutes each. Specimens
were dried overnight, mounted on SEM stubs (SPI) with carbon tape (SPI) and
sputter coated with gold-palladium. Samples were imaged using a Hitachi S2500
scanning electron microscope.
2.4.4: Transmission Electron Microscopy The protocol used for the preparation of samples for transmission electron
microscopy is adapted from Kurth et al. 2010. Embryos were fixed in 2.5%
glutaraldehyde/0.1M sodium cacodylate solution, pH 7.4 overnight at 4o Celsius.
For orientation purposes, samples were embedded in 3% low melting
temperature agarose and postfixed in 1% osmium tetraoxide solution for 4 hours
at 4o Celsius. Samples were subsequently subjected to washes in 1X PBS and
water. Samples were dehydrated with an ethanol dehydration series, 30, 50, 70
134
90 and 96, 100 and 100% ethanol for 30 minutes each. Samples were infiltrated
with Spurr’s resin in solutions of 1:2, 1:1 and 2:1 Spurr’s to 100% ethanol for 1.5
hours each and then in pure Spurr’s resin for 2 hours and again overnight.
Samples were oriented in moulds and baked overnight at 65o Celsius. Semi-thin
sections were stained with toluidine blue and ultra-thin sections were stained with
lead citrate and uranyl acetate. Samples were imaged with a Hitachi H7000
transmission electron microscope.
2.4.5: Confocal Microscopy Explants were filmed with a Zeiss LSM510 laser scanning confocal system.
mbRFP was visualized by excitation with a 543nm helium/neon laser at 100%
intensity. The following confocal settings were used, pinhole size: 701µm,
detector gain: 940, amplitude offset: -1.22, amplitude gain: 1. The microscope
system was controlled by Zeiss LSM5 software.
2.4.6: Explants For slice explants, slices of dorsal mesoderm and attached endoderm were
combined with inner ectoderm from the animal BCR and secured under a
coverslip for filming (Figure 2.11A). For mesoderm-BCR or mesoderm-endoderm
combined explants, PCM, inner cells from the animal region of the BCR, or
endoderm from the vegetal cell mass were dissected, combined and secured
under a strip of coverslip, with the mesoderm side originally in contact with the
BCR facing down, and the BCR explant positioned opposite to what would have
135
been the anterior side of the mesoderm in vivo (Figure 2.12A). Explants were
cultured in 1X MBS on 1% BSA treated glass bottom dishes (Mak Tek) during
filming. Explants were filmed for 90 minutes using a Zeiss Axiovert 200M inverted
microscope. Timelapses were analyzed with the Zeiss Axiovision 4.8 software
suite. For explants filmed with the confocal microscope, mesoderm expressing
the mbRFP construct was combined with a BCR explant from an un-injected
embryo and cultured as above.
2.4.7: Statistical Analysis Statistical analysis was performed using GraphPad inStat 3. The Mann-Whitney
statistical test at the 95% confidence level was used for all statistical calculations.
136
Chapter Three: PDGF-A controls prechordal mesoderm cell orientation and radial intercalation
during gastrulation
A version of this chapter was published as Damm, E.W. and Winklbauer, R. (2011) PDGF-A controls mesoderm cell orientation and radial intercalation during Xenopus gastrulation. Development,
138: 565-575
137
3.1: Introduction Radial intercalation is a basic morphogenetic process, which plays an essential
role in the large-scale rearrangement of germ layers during gastrulation. The
upper half of the amphibian blastula consists of prospective ectoderm, while the
mesoderm forms a narrow ring below the equator. During gastrulation, these
regions expand to eventually cover the endodermal core of the embryo (See
Figure 1.1). Since there is no embryonic growth during gastrulation, expansion
occurs by a respective thinning of these two germ layers, brought about mainly
by an interdigitation of cells in the radial direction, i.e. by radial intercalation
(Keller et al. 2003).
In the Xenopus embryo, radial intercalation has been observed in all regions of
the mesoderm (Keller and Tibbetts, 1989; Wilson and Keller, 1991; Keller, 2002;
Winklbauer and Schurfeld, 1999; Ibrahim and Winklbauer, 2001; Damm and
Winklbauer, 2011). In the CM and the SM, it cooperates with mediolateral cell
intercalation to promote convergent extension (Keller and Tibbetts, 1989; Wilson
and Keller, 1991; Keller, 2002; Yin et al, 2008). In the PCM, radial intercalation
results in thinning and spreading of the region (See Chapeter Two; Damm and
Winklbauer; 2011) Despite its ubiquity, however, radial intercalation is not well
understood at the cellular level, and its molecular control is virtually unknown. In
the Xenopus mesoderm, radial intercalation is an active process (See Chapter
Two; Wilson and Keller, 1991; Winklbauer and Schurfeld, 1999; Ibrahim and
138
Winklbauer, 2001; Damm and Winklbauer, 2011), but the molecular cues
regulating cell movements have not been determined.
Here, I show that radial intercalation in the prechordal mesoderm (PCM), i.e. in
the region where thinning of the mesoderm layer is greatest (See Figure 2.9G;
2.10C), is driven by an attraction of its cells to the blastocoel roof (BCR) by
PDGF-A. I show that the three PDGF-A isoforms generated by alternative
splicing are expressed in the BCR. The long and intermediate sized variants (lf-
PDGF-A, int-PDGF-A respectively) associate with cell surface and extracellular
components such as heparin sulfate proteoglycans and fibronectin (Smith et al.
2009; Andersson et al. 1994; Raines and Ross, 1992) and regulate the animally
directed migration of the dorsal LEM on the BCR inner surface (Nagel and
Winklbauer; 1999; Nagel et al. 2004). Thus far, no function has been identified for
the short, diffusible isoform (sf-PDGF-A) (Figure 3.1A-B) (Andrae et al. 2008;
Mercola et al. 1988; Raines and Ross, 1992). I also confirm that PDGFR-α, the
cognate receptor for PDGF-A is expressed in the mesoderm (Figure 3.3A-D).
Thus, showing the complementary expression of ligand in the ectoderm and
receptor in the mesoderm that is typical of PDGF/PDGFR-α expression in
vertebrate gastrulae (Ataliotis et al. 1995; Orr-Urtreger and Lonai, 1992; Yang et
al. 2008).
139
My data shows that sf-PDGF-A acts as a long-range signal to orient and attract
the cells of the multilayered PCM toward the BCR, leading to radial intercalation.
This establishes a dual role for PDGF-A in Xenopus gastrulation, based on
differential splicing, where the long and intermediate sized isoforms regulate
directional mesoderm migration across the BCR surface (Nagel et al. 2004) and
the short form regulates radial intercalation of PCM cells. Furthermore, for the
first time I provide insight into the molecular basis of a radial intercalation
movement in a vertebrate embryo.
3.2: Results 3.2.1: Expression of PDGF-A isoforms is restricted to the inner cell layer of the blastocoel roof PDGF-A is a known chemoattractant and experiments have shown that it
provides directional information to migrating leading edge mesendoderm cells
(Nagel et al. 2004). To determine if PDGF-A could play a role in regulating
intercalation movements of PCM cells, I investigated the expression patterns of
PDGF-A isoforms and PDGFR-α during gastrulation.
Ataliotis et al. 1995 showed that during gastrulation, PDGFR-α expression is
confined to dorsal and ventral involuted mesoderm cells with PDGF-A expression
140
Figure 3.1: The structure of Xenopus PDGF-A isoforms (A) Clustal comparison of amino acid sequences of the three Xenopus PDGF-A
isoforms. Asterisks indicate 100% amino acid identity match between the three
isoforms. Light blue, N-terminal leader sequence; green, pro-peptide domain;
orange, conserved PDGF growth factor domain; dark blue, hydrophobic amino
acid domain; red, positively charged cell retention motif; brown, short isoform C-
terminus. (B) Schematic diagrams of the three Xenopus PDGF-A isoforms.
141
Figure 3.1: The structure of Xenopus PDGF-A isoforms
142
in the overlying ectoderm. I confirmed these results with in situ hybridization
experiments on mid and late gastrula stage embryos using RNA anti-sense
probes targeting PDGF-A and PDGFR-α. As previously reported, PDGF-A
expression is confined to the inner layer of cells of the BCR while expression of
PDGFR-α is confined to involuted XBra expressing posterior mesoderm and
anterior mesoderm (PCM dorsally) on the dorsal and ventral sides of the embryo
(Figure 3.2A-D). It has previously been suggested that PDGF-A may form a
molecular gradient along the inner layer of the BCR (Nagel et al. 2004, Ataliotis
et al. 1995). This gradient would provide a mechanism for providing directional
guidance to migrating LEM cells (Nagel et al. 2004). PDGF-A expression in the
ectoderm appears to taper in an animal to vegetal direction (Figure 3.2A-B). This
expression pattern is consistent with the idea of a PDGF-A expression gradient in
the BCR (Nagel et al. 2004).
The long and short PDGF-A isoforms are nearly identical over their lengths but
differ in amino acid sequence at their C-termini. The long isoform contains a short
stretch of hydrophobic amino acids upstream of a positively charged domain
(Figure 3.1A-B). The function of the hydrophobic domain remains unknown,
however the hydrophobicity of the domain may contribute to cell retention
through interactions with cell membrane phospholipids. The function of the
positively charged domain in cell/matrix retention has been well described
(Raines and Ross, 1992; Kelly et al. 1993; Andersson et al. 1994). The short
143
Figure 3.2: Expression of PDGF-A and PDGFRα in the Xenopus gastrula
(A-D) In situ hybridization showing the expression domains of PDGF-A (A,B) and
PDGFRα (C,D) at mid (A,C) and late (B,D) gastrula stages. Boundaries of
expression domains are indicated by white arrowheads. (E) Diagram of the long
PDGF-A isoform with PCR primer pair locations indicated; red, cell retention
motif. (F) RT-PCR detection of PDGF-A isoforms and PDGFR-α in BCR,
prechordal mesoderm (PCM) and endoderm (Endo.). Red arrow, 241 b.p. lf-
PDGF-A product; purple arrow, 225 b.p. int-PDGF-A product; blue arrow, 113
b.p. sf-PDGF-A product. RT-PCR results were combined from multiple
experiments. XBra, Xbrachyury; Gsc, goosecoid; ODC, ornithine decarboxylase;
-RT, reverse transcriptase not used in cDNA preparation.
144
Figure 3.2: Expression of PDGF-A and PDGFRα in the Xenopus gastrula
145
isoform lacks both of these domains and has a unique C-terminal sequence
(Figure 3.1A-B). Sequence similarity between PDGF isoforms of different species
is strikingly high, particularly in the core PDGF domain and the C-terminus,
highlighting the functional significance of these regions (Figure 3.3A-B). The long
isoform sequences of mammals and chick lack the hydrophobic domain found in
Xenopus, however Anolis carolinensis (Anole lizard) contains a stretch of amino
acids between the PDGF domain and the positively charged retention motif
(Figure 3.3A). Although the sequence of this region differs in residue identity
when compared with Xenopus, the region in both species is made up of
hydrophobic amino acids, which may suggest functional similarity (Figure 3.3A).
The short isoform C-terminus is identical in Xenopus and mammals, but the
sequences of the chick short (sf-PDGF-A2) and intermediate (sf-PDGF-A1)
isoforms differ (Figure 3.3B).
Since sf-PDGF-A is not retained at the cell surface and may penetrate deep into
tissues (Raines and Ross, 1992), I hypothesized that this isoform could control
deep PCM cell movements. The anti-sense RNA probes used for in situ
hybridization experiments were unable to distinguish between the different
PDGF-A isoforms. To determine which splice isoforms are expressed in the BCR,
I designed PCR primers flanking the putative spliced-out exon of the short
isoform mRNA (Figure 3.2E). The long isoform amplicon should be distingishable
from the short isoform by its larger size (Figure 3.2E,F).
146
RNA from BCR was processed for RT-PCR. Two bands corresponding to
fragments of 240 b.p. (base pairs) (expected for long isoform) and 110 b.p. (short
isoform) were observed (Figure 3.2F). Unexpectedly, a third band was found at
225 b.p. (Figure 3.2F). The 110 b.p. band appeared brightest (Figure 3.2F),
suggesting that the short isoform may be more abundant than the 240 b.p. and
225 b.p. species individually. Expression of sf-PDGF-A in BCR cells is consistent
with a putative role for this isoform in regulating deep PCM cell movements.
Typically, two splice isoforms of PDGF-A have been identified in model systems
(see above). In chick however, a third intermediate sized isoform was found
(Figure 3.2B) (Horiuchi et al. 2001). I hypothesized that the 225 b.p. band could
correspond to an intermediate sized isoform similar to that discovered in chick.
DNA sequencing analysis of the unknown band showed a PDGF-A isoform (int-
PDGF-A), which corresponded to the longer isoform identified in mammalian
systems, containing a cell retention motif but lacking the hydrophobic domain
(Figure 3.2A). The int-PDGF-A cell retention motif sequence was identical to that
of lf-PDGF-A (Figure 3.1A). Despite the lack of a hydrophobic domain in int-
PDGF-A, the sequence similarity between the long and intermediate form C-
termini and their co-expression may suggest a level of functional redundancy
between these isoforms in Xenopus.
147
Figure 3.3: PDGF-A isoforms are highly conserved between species
(A,B) Clustal alignments of Xenopus lf-PDGF-A/int-PDGF-A (A) and sf-PDGF-A
(B) with the corresponding PDGF-A isoforms in human (Homo sapiens), mouse
(Mus musculus), chicken (Gallus gallus), and the Anole lizard (Anolis carolinesis).
Orange, conserved PDGF growth factor domain; purple, hydrophobic domain;
red, positively charged cell retention motif. Asterisks indicate full amino acid
conservation between species; : indicates amino acid subsitituion between
species with an amino acid of highly similar properties; . indicates amino acid
substitution between species with an amino acid of weakly similar properties.
148
Figure 3.3: PDGF-A isoforms are highly conserved between species
149
I confirmed (Ataliotis et al., 1995) the lack of PDGF-A expression in mesoderm
and endoderm, and the presence of PDGFR-α RNA in mesoderm (Figure 3.2F).
Unexpectedly, endoderm cells also expressed PDGFR-α (Figure 3.2F).
Expression of the receptor, which had not been detected by in situ hybridization,
could explain previous findings, which showed that vegetal cells migrate
directionally on BCR matrix, similar to leading edge mesendoderm (Winklbauer
and Nagel, 1991, Nagel et al. 2004).
3.2.2: Inhibition of PDGF signalling interferes with PCM radial intercalation, but not with CM cell orientation The expression of sf-PDGF-A in the BCR and PDGFR-α in the mesoderm makes
PDGF signalling a candidate for orienting PCM cell movements. To test this
notion, I treated stage 11 embryos with the cell-permeable PDGFR-α inhibitor,
AG1296, until DMSO treated controls reached stage 12. Although the PCM
became thinner in treated embryos, it actually consisted of two layers of cells
oriented in parallel to the BCR (Figure 3.4A,I) reflected in a layer index of 2.0 +/-
0.7 (Figure 3.4B). The average thickness of the region was 47.7 µm +/- 3.2
(Figure 3.4A). At the same developmental stage, DMSO treated control embryos
had formed a single cell layer with a layer index 1.3 +/- 0.5 (Figure 3.4B-C,F) and
an average thickness of 32.3 µm +/- 2.6 (Figure 3.4A). In the AG1296 treated
LEM, cells appeared more obliquely oriented compared to controls (Figure
3.4G,J). LEM cells are normally obliquely oriented with respect to the BCR, thus
150
Figure 3.4: PDGF-A inhibition disrupts PCM radial intercalation
(A) PCM thins significantly (p-value < 0.0001, n = 10 embryos/stage) between
stages 11 and 12; thinning is reduced upon AG1296 treatment (p-value < 0.0001,
n = 10 embryos). (B) Change in layer index of PCM over time and following
AG1296 treatment at stage 11. (C) PCM layer index is significantly higher at
stage 12 following AG1296 treatment (p value = 0.0013, n = 13 embryos) or at
stage 11 in PDGF-A MO injected embryos (p value < 0.0001, n = 12 embryos);
chordamesoderm is unaffected (p value = 0.0886, n = 13 embryos). (A-C) Error
bars represent standard error of the mean, asterisks indicate statistically
significant results. (D) Rose diagrams show the orientation of chordamesoderm
cells, BCR = 0 degrees, n = number of cells. No significant difference between
controls and AG1296 treated embryos (p value = 0.9842). (E-J) Scanning
electron micrographs of sagitally fractured stage 12 embryos treated with DMSO
(E-G) or 10 μM AG1296 (H-J) two hours prior to fixation, coloured dashed lines
indicate region boundaries. (F) Red arrowheads, PCM cells in a single layer in
DMSO controls. (I) Red arrowheads, superficial PCM cells in contact with the
BCR; red arrows, second layer of cells in AG1296 treated embryos. (G) Red
arrowheads, LEM cells oriented perpendicular to the BCR in controls, and (J)
obliquely oriented LEM cells in AG1296 treated embryos. BCR, blastocoel roof;
EN, endoderm; AC, archenteron; BC, blastocoel.
151
Figure 3.4: PDGF-A inhibition disrupts PCM radial intercalation
152
the increase in obliqueness when PDGF signalling is inhibited may suggest that
the normal orientation of these cells is due to reduced PDGF signalling in this
region. These results confirmed that the increased thickness of the PCM in
embryos with disrupted PDGF-A signalling is primarily due to defects in radially
oriented cell rearrangement rather than changes in cell shape/size or orientation.
The post-involution CM appeared unaffected by PDGF-A inhibition. As in
controls, cells from AG1296 treated embryos were elongated perpendicular to the
BCR (Figure 3.4D,E,H), and extended protrusions either toward or away from the
BCR (Figure 3.4D,E,H). Furthermore, the layer indices of AG1296 and DMSO
treated embryos were similar (Figure 3.4B), suggesting that PDGFR-α inhibition
did not affect movements in this region even though PDGFRα is expressed in the
CM. The results suggest that PDGF-A signalling is required to orient PCM cells
toward the BCR and to prompt radial intercalation, but that radial orientation of
the chordamesoderm is regulated by a different mechanism.
3.2.3: sf-PDGF-A is an instructive cue required for radial orientation of PCM cells To further analyze the role of PDGF-A in radial intercalation, I made use of an
ATG morpholino oligonucleotide (PDGF-A MO) that had previously been shown
to inhibit PDGF-A signalling (Nagel et al. 2004). Following PDGF-A knockdown,
embryo phenotypes resembled those previously described (Ataliotis et al. 1995;
Nagel et al. 2004). Mesoderm patterning was not affected. Both Gsc and XBra
153
Figure 3.5: PDGF-A knockdown by morpholino oligonucleotides disrupts the orientation of PCM cells
(A,C) Scanning electron micrographs of sagittaly fractured embryos injected with
PDGF-A morpholino. White arrowheads highlight cells oriented parallel to the
BCR in prechordal mesoderm (A) and leading edge mesendoderm (C). (B,D)
Rose diagrams showing the percentage orientation of prechordal mesoderm cells
(B) and leading edge mesendoderm cells (D) with respect to the BCR of embryos
injected with the PDGF-A morpholino. 0 degrees, dorsal BCR; 90 degrees,
animal pole. “n” is number of cells scored from 14 embryos analyzed. (E,F) In situ
hybridization of Xbrachyury (E) and goosecoid (F) expression patterns in
embryos injected with PDGF-A morpholino. (G) Scanning electron micrograph of
the dorsal blastopore lip region of an NF stage 11 gastrula injected with PDGF-A
morpholino, red dotted line outlines the region that has failed to involute, white
arrow points at the dorsal blastopore lip. BCR, blastocoel roof; EN, endoderm;
BC, blastocoel; XBra, Xbrachyury; Gsc, goosecoid. Orange, leading edge
mesendoderm; yellow, prechordal mesoderm.
154
Figure 3.5: PDGF-A knockdown by morpholino oligonucleotides disrupts the orientation of PCM cells
155
were still expressed although the positions of the expression domains were
slightly altered (Figure 3.5E-F). The change in expression pattern position is in
agreement with a failure of mesoderm involution and archenteron elongation
(Figure 3.5G) (Nagel et al. 2009). These results show that while specification of
mesodermal regions is not affected by an inhibition of PDGF-A signalling, normal
morphogenetic movements are disrupted.
In morpholino injected embryos, PCM, ventral involuted mesoderm, dorsal LEM
and ventral LEM cells were elongated and extended protrusions from a single
pole (Figure 3.5A,C; 3.6A,C). However, PCM cells were no longer oriented strictly
toward the BCR, but at angles between 0 and 90 degrees, i.e. between the
original orientation and that of the adjacent endodermal cells (Figure 3.5A-B;
3.6A-B). As a result, the PCM layer index of PDGF-A MO injected embryos was
increased compared to controls (Figure 3.4B), which is consistent with an
inhibition of radial intercalation. Similar to chordamesoderm in AG2196 treated
embryos, the ventral XBra expressing mesoderm was unaffected by PDGF-A
inhibition (Figure 3.6E,F). Dorsal and lateral LEM cells from morphant embryos
were also more obliquely oriented with respect to controls (compare Figures 3.5D
and 2.8A; 3.6D and 2.16A). When embryos were injected with mRNA encoding a
dominant negative PDGF-A construct, dnPDGF-A 1308 (Mercola et al. 1990)
(Figure 3.7A,C-D), or a dominant negative version of PDGFRα, PDGFR-37
(Ataliotis et al. 1995) (Figure 3.7B,E-F), the effects on PCM and dorsal LEM cell
orientation were similar to PDGF-A morphant embryos. From these results I
156
Figure 3.6: PDGF-A knockdown by morpholino oligonucleotides disrupts the orientation of involuted ventral mesoderm cells
(A,C,E) Scanning electron micrographs of the ventral leading edge
mesendoderm (A), involuted ventral mesoderm (C) and ventral XBra expressing
mesoderm (E) of a sagitally fractured mid-gastrula stage (NF stage 11) embryo
injected with PDGF-A MO, white arrowheads highlight cells oriented parallel to
the BCR (A,C) or outer embryonic epithelium (E). (B,D,F) Rose diagrams
showing the percentage orientation of ventral leading edge mesendoderm (B),
ventral involuted mesoderm (D) and ventral XBra expressing mesoderm (F), Blue
rose diagrams use the angle at which protrusions are extended from the cell
body with respect to the ventral BCR as a measure of orientation. Red rose
diagrams use the orientation of the cell long axis with respect to the ventral
external embryonic epithelium. 0 degrees, ventral BCR or ventral external
embryonic epithelium; 90 degrees, animal pole. “n” is number of cells scored
from 9 embryos analyzed. Blue, ventral leading edge mesendoderm; green,
involuted ventral mesoderm; purple, XBra expressing ventral mesoderm. BCR,
blastocoel roof; EN, endoderm; BC, blastocoel.
157
Figure 3.6: PDGF-A knockdown by morpholino oligonucleotides disrupts the orientation of involuted ventral mesoderm cells
158
propose that during gastrulation, the mesoderm can be divided into PDGF-A
sensitive (PCM and anterior ventral mesoderm, LEM, non-XBra expressing) and
insensitive zones (XBra expressing zones, including CM) with respect to its role
in regulating cell orientation. PDGF-A signalling is important in determining the
radial orientation of cells in involuted mesoderm all around the embryo and may
influence the dorsal, lateral and ventral LEM, while the orientation of cells in XBra
expressing mesoderm is independent of PDGF-A signalling.
When morpholino resistant mRNA encoding sf-PDGF-A was co-injected with
PDGF-A MO, cell orientation (Figure 3.8A,B) and the layer index of the PCM
were significantly rescued (Figure 3.4B). However, unlike sf-PDGF-A, co-injection
of PDGF-A MO and mRNA encoding morpholino resistant lf-PDGF-A or int-
PDGF-A failed to rescue PCM cell orientation (Figure 3.8C-F). These results
suggest that sf-PDGF-A can influence the orientation of deep PCM cells, possibly
because it is capable of signalling at a distance from its source while the cell-
retention motif containing isoforms may not be able to signal to deeper cells.
Furthermore, as seen from the locations of XBra and Gsc expression cells, sf-
PDGF-A was unable to rescue involution and archenteron elongation (Figure
3.8G-H). This suggests that the orientation of PCM cells and involution are
independent processes.
159
Figure 3.7: PDGF signaling knockdown by dominant negative ligand or receptor disrupts PCM cell orientation
(A,B) Scanning electron micrographs of a sagittaly fractured embryos with
disrupted PDGF signaling due to expression of dnPDGFRα-37 (A) or dnPDGF-A
1308 (B), white arrowheads highlight cells oriented parallel to the BCR. (C-F)
Rose diagrams showing percentage orientation of prechordal mesoderm (C,E)
and leading edge mesendoderm cells (D,F) with respect to the BCR in embryos
expressing dnPDGFRα-37 (C,D) or dnPDGF-A 1308 (E,F). “n” is number of cells
scored from 9 (dnPDGFRα-37) and 13 (dnPDGF-A 1308) embryos analyzed.
BCR, blastocoel roof; EN, endoderm, BC, blastocoel.
160
Figure 3.7: PDGF signaling knockdown by dominant negative ligand or receptor disrupts PCM cell orientation
161
The overexpression of sf-PDGF-A, lf-PDGF-A or int-PDGF-A in the BCR had no
effect on the orientation of PCM cells (Figure 3.9A-C,E,G,I). However,
overexpression of sf-PDGF-A in the BCR caused deep LEM cells to become
more strongly oriented toward the BCR (compare Figures 3.9A,F and 2.8A,E).
LEM cells were unaffected by overexpression of lf-PDGF-A (Figure 3.9B,H) and
int-PDGF-A (Figure 3.9C,J) These results suggest that although lf-PDGF-A and
likely int-PDGF-A are sensed by cells directly in contact with the BCR or its
matrix (Nagel et al. 2004), only the sf-PDGF-A signal is relayed to cells deeper in
the embryo. This is because interactions between the cell retention motif and the
cell surface could anchor these molecules close to the source (Raines and Ross,
1992; Kelly et al. 1993; Andersson et al. 1994). Therefore, it is not surprising that
neither of these molecules are able to function as a directional determinants for
PCM cells.
I hypothesized that if PDGF-A acts as an instructive guidance molecule,
overexpression of sf-PDGF-A in PCM cells should interfere with the ability of cells
to detect an endogenous sf-PDGF-A gradient. Under these circumstances, cells
would be detecting the PDGF-A signal from surrounding cells as well as the
BCR, abolishing any putative gradient. Indeed, in embryos expressing a sf-
PDGF-A construct in the PCM, which is not resistant to the PDGF-A morpholino,
cell orientation was similar to that in PDGF-A morphant embryos (Figure
3.10A,C). LEM cell orientation was unaffected (Figure 3.10B,D). This loss of
162
Figure 3.8: sf-PDGF-A is required for radial orientation of PCM cells
(A,C,E) Scanning electron micrographs of sagittaly fractured mid-gastrula stage
(NF stage 11) embryos co-injected with PDGF-A morpholino and morpholino
resistant variants of sf-PDGF-A (A), or lf-PDGF-A (C) or int-PDGF-A RNA, white
arrowheads highlight cells oriented perpendicular to the BCR, red arrowheads
highlight cells oriented parallel to the BCR. (B,D,F) Rose diagrams show the
percentage orientation of prechordal mesoderm cells from embryos co-injected
with PDGF-A morpholino and morpholino resistant variants of sf-PDGF-A (B) or
lf-PDGF-A (D) or int-PDGF-A (F) RNA, rose diagrams use the angle at which
protrusions are extended from the cell body with respect to the dorsal BCR as a
measure of orientation. 0 degrees, dorsal BCR; 90 degrees, animal pole. “n” is
number of cells scored from 9 embryos (sf-PDGF-A), 12 embryos (lf-PDGF-A)
and 10 embryos (int-PDGF-A) analyzed. (G,H) In situ hybridization showing the
expression of Xbrachyury (G) and goosecoid (H) in embryos co-injected with
PDGF-A morpholino and sf-PDGF-A RNA, white arrowhead indicates dorsal
blastopore lip. Yellow, prechordal mesoderm. BCR, blastocoel roof; EN,
endoderm; XBra, Xbrachyury; Gsc, goosecoid.
163
Figure 3.8: sf-PDGF-A is required for radial orientation of PCM cells
164
orientation was rescued by co-injection with PDGF-A MO (Figure 3.11A-D). This
is consistent with the short isoform of PDGF-A providing an instructive long-range
guidance cue, emitted by the BCR.
3.2.4: sf-PDGF-A is required for directional intercellular mesoderm migration in an explant system Results from the above experiments support the hypothesis that PDGF-A is an
important regulator of PCM morphogenesis. To visualize the effect of knocking
down PDGF-A on cell movements in the embryo, slice explants (Figure 3.12B)
from embryos injected with PDGF-A MO in the BCR were made. The movements
of PCM cells were erratic and unlike un-injected control explants (see Figure
2.11C), cells did not intercalate at the mesoderm/ectoderm boundary. These
results showed that PDGF-A is important in regulating the movements of cells in
embryo slices which preserve the original organization of tissues in the embryo.
In order to analyze the effect of PDGF-A knockdown on directional migration, I
made use of the explant system I developed for observing live PCM migration
(see Figure 2.12A). This system allowed me to test whether PDGF-A is
responsible for re-orienting cell movements because the BCR explant is placed
on the opposite side from the endogenous direction of cell movement. BCR inner
layer cells injected with PDGF-A MO were placed in contact with un-injected
mesoderm explants; cell tracks were followed and velocity measurements taken.
Mesoderm cells were motile, but not moving directionally (Figure 3.13A,B-B’’),
165
Figure 3.9: Overexpression of PDGF-A constructs in the BCR does not affect PCM cell orientation
(A-C) Scanning electron micrographs of sagittaly fractured mid gastrula (NF
stage 11) stage embryos over-expressing sf-PDGF-A (A), lf-PDGF-A (B) or int-
PDGF-A (C) in the BCR, (A-C) red arrowheads highlight cells that are oriented
parallel to the BCR, white arrowheads highlight cells oriented perpendicular to
the BCR. (D-I) Rose diagrams showing the percentage orientation of prechordal
mesoderm cells (D,F,H) and leading edge mesendoderm cells (E,G,I) with
respect to the BCR. Rose diagrams use the angle at which protrusions are
extended from the cell body with respect to the dorsal BCR as a measure of
orientation, 0 degrees, dorsal BCR; 90 degrees, animal pole. “n” is number of
cells scored from 11 embryos (sf-PDGF-A), 5 embryos (lf-PDGF-A) and 13
embryos (int-PDGF-A) analyzed. Orange, leading edge mesendoderm; yellow,
prechordal mesoderm, BCR, blastocoel roof; BC, blastocoel; EN, endoderm.
166
Figure 3.9: Overexpression of PDGF-A constructs in the BCR does not affect PCM cell orientation
167
until at 90 minutes some cells acquired directionality (Figure 3.13A,B-B’’). This
recovery may be due to an incomplete knockdown of PDGF-A as is typical for
morpholino knockdown. Co-injection of morpholino resistant sf-PDGF-A rescued
the effect of the PDGF-A MO (Figure 3.13C,D-D’’). From these results, I conclude
that PDGF-A determines the direction of PCM cell movement, although cells are
able to migrate randomly in absence of PDGF-A signalling (see Figure 2.14D).
3.2.5: An instructive role for sf-PDGF-A signaling in directional migration To see whether PDGF-A determines the direction of migration instructively, I
carried out gain-of-function experiments. The in vitro migration assay was
modified by combining mesoderm with endoderm in place of BCR (Figure 2.13A).
Since PDGF-A is not normally expressed in endoderm, mesoderm cells moved
randomly (Figure 3.14A,B-B’’). Migration was also random when lf-PDGF-A or
int-PDGF-A was expressed in the endoderm, confirming that these isoforms have
no long-range function (Figure 3.14D-E). However, when endoderm expressing
sf-PDGF-A was combined with mesoderm, cells moved directionally (Figure
3.14C). This argues that the sf-PDGF-A behaves as a long range signal which
instructively determines the orientation of PCM cells, and that a localized source
of sf-PDGF-A is sufficient to act as a directional cue.
168
Figure 3.10: Over-expression of sf-PDGF-A in the marginal zone disrupts PCM cell orientation
(A,B) Scanning electron micrographs of prechordal mesoderm (A) and leading
edge mesendoderm (B) of sagittaly fractured mid-gastrula stage (NF stage 11)
embryos expressing sf-PDGF-A in the dorsal marginal zone, white arrowheads
highlight cells oriented parallel to the BCR, (C,D) Rose diagrams show the
percentage orientation of prechordal mesoderm cells (C) and leading edge
mesendoderm cells (D) from embryos expressing sf-PDGF-A marginal, rose
diagrams use the angle at which protrusions are extended from the cell body with
respect to the dorsal BCR as a measure of orientation. 0 degrees, dorsal BCR;
90 degrees, animal pole. “n” is number of cells scored from 8 embryos analyzed.
Orange, leading edge mesendoderm; Yellow, prechordal mesoderm; purple,
chordamesoderm. BCR, blastocoel roof; EN, endoderm; BC, blastocoel.
169
Figure 3.10: Over-expression of sf-PDGF-A in the marginal zone disrupts PCM cell orientation
170
Figure 3.11: The effect of over-expression of sf-PDGF-A in the marginal zone can be rescued
(A,B) Scanning electron micrographs of prechordal mesoderm from sagittaly
fractured mid-gastrula stage (NF stage 11) embryos expressing sf-PDGF-A in the
dorsal marginal zone (A) or embryos co-injected with PDGF-A morpholino and sf-
PDGF-A RNA in the marginal zone (B), red arrowheads highlight cells oriented
parallel to the BCR (A), white arrowheads highlight cells oriented perpendicular to
the BCR (B). (C,D) Rose diagrams show the percentage orientation of prechordal
mesoderm cells from embryos expressing sf-PDGF-A in the marginal zone (C) or
after rescue by co-injection with PDGF-A morpholino (D), rose diagrams use the
angle at which protrusions are extended from the cell body with respect to the
dorsal BCR as a measure of orientation. 0 degrees, dorsal BCR; 90 degrees,
animal pole. “n” is number of cells scored from 8 embryos analyzed. Yellow,
prechordal mesoderm; purple, chordamesoderm. BCR, blastocoel roof; EN,
endoderm; BC, blastocoel.
171
Figure 3.11: The effect of over-expression of sf-PDGF-A in the marginal zone can be rescued
172
Figure 3.12: PDGF-A MO inhibits PCM radial intercalation in vitro
(A) Explant system. (1.) Slice of mesoderm and adjacent endoderm is combined
with (2.) explanted control or PDGF-A MO injected BCR under a coverslip and
(3.) filmed to track mesoderm cell movements. Blue, endoderm; green, ectoderm;
orange, mesoderm; red arrow shows direction of cell intercalation; A, anterior; P,
posterior; D, dorsal; V, ventral. (B-B’) Frames from timelapse recording. (B) Cell
cluster at 0 min. (B’) Same cluster after 30min, cells have intercalated at the
mesoderm/BCR boundary (white dotted line). (C-D) Cell tracks from explants
combined with uninjected BCR (C) or BCR injected with 60ng PDGF-A MO (D).
173
Figure 3.12: PDGF-A MO inhibits PCM radial intercalation in vitro
174
Figure 3.13: sf-PDGF-A is required for directional migration of deep PCM cells
(A,C) Velocity plots, average velocities of 50 individual cells collected from five of
each of the following combinations (A) BCR injected with 60 ng PDGF-A
MO/uninjected mesoderm, (C) BCR co-injected with 800 pg of morpholino
resistant sf-PDGF-A mRNA and 60 ng PDGF-A morpholino/uninjected
mesoderm. Positive x-axis toward BCR. (B-B’’; D-D’’) Tracks of individual cells in
mesodermal explant of (A) and (C) respectively.
175
Figure 3.13: sf-PDGF-A is required for directional migration of deep PCM cells
176
Figure 3.14: sf-PDGF-A is an instructive cue for PCM directional migration
(A, C-E) Velocity plots, velocities of 50 individual PCM cells from 5 of each of the
following explant combinations: (A) uninjected endoderm/mesoderm, (C)
endoderm injected with 400 pg sf-PDGF RNA/uninjected mesoderm, (D)
endoderm injected with 400 pg intPDGF-A RNA/uninjected mesoderm and (E)
endoderm injected with 400 pg lfPDGF-A RNA/uninjected mesoderm. Positive x-
axis is toward the endoderm. (B-B’’) Tracks of PCM cells from uninjected
endoderm/uninjected mesoderm combination.
177
Figure 3.14: sf-PDGF-A is an instructive cue for PCM directional migration
178
3.3: Discussion By analyzing cell rearrangement in the prechordal mesoderm of the Xenopus
gastrula, I have identified a mechanism for radial intercalation that depends on
long-range PDGF-A signalling. Furthermore, I have identified different functions,
long-range and contact-dependent signalling, for short and long/intermediate
splice variants of PDGF-A, respectively.
3.3.1: A mechanism for radial cell intercalation in the PCM In the PCM of the Xenopus gastrula, a sf-PDGF-A-mediated long range signal
reorients the protrusions of unipolar cells from an orientation parallel to the BCR
to one that is perpendicular to the BCR. The oriented protrusions are in contact
with the cell bodies of adjacent cells. This suggests that cells use the surface of
their neighbours and wedge between each other in an instance of intercellular
migration, leading to radial intercalation and the observed gradual thinning of the
PCM. The ability of the cells to migrate across adjacent cells towards a sf-PDGF-
A source can be directly demonstrated in vitro.
The PCM is separated from the ectodermal BCR by Brachet’s cleft, a tissue
boundary maintained by cycles of attachment and repulsion between ectoderm
and mesoderm cells (Wacker et al. 2000; Rohani et al. 2011). The resulting
dynamic adhesion between germ layers ensures that while the most superficial
PCM cells can contact the BCR, they cannot penetrate into it despite being
attracted by sf-PDGF-A. Lateral mobility at the BCR/mesoderm interface is
179
essential for cells to efficiently wedge between each other and to intercalate at
the boundary. The sf-PDGF-A signal potentially reaches about 5 cell lengths
deep, but is only recognized by the PCM cells and not by adjacent endodermal
cells. Therefore, given sufficient time, all PCM cells, and only these, will
eventually arrive at the BCR to form a single layer. In summary, PCM thinning
consists of a chemotactic reorientation of unipolar cells by an exogenous tissue,
and intercellular migration, leading to a re-arrangement of the multi-layered tissue
and the formation of a monolayer adjacent to the ectoderm.
During gastrulation in Drosophila, radial intercalation of deep mesoderm cells
depends on signaling by the FGF receptor Heartless and its ligands Pyramus and
Thisbe, which are all required for normal protrusion formation and intercalation
(McMahon et al. 2010; McMahon et al. 2008; Klingeisen et al. 2009; Murray and
Saint, 2007). Dorsal migration of the more superficial mesoderm cells on the
ecotoderm is not affected in heartless mutants (McMahon et al. 2010; Murray and
Saint, 2007). In our system, different isoforms of PDGF-A regulate both the
intercalation of deep mesodermal cells and the directional migration of the more
superficial LEM cells on the BCR (see above and Nagel et al. 2004).
3.3.2: Distinct roles for long and short PDGF-A splice isoforms in cell orientation: contact-dependent and long-range signaling Presence or absence of the positively charged cell retention motif determines
PDGF-A behaviour, i.e. whether the molecule remains bound to the cell surface
180
or extracellular matrix, or is able to diffuse over larger distances (Andersson et al.
1994; Raines and Ross et al. 1992). In this way, PDGF-A molecules suited either
for long-range or for contact-dependent signaling are generated by differential
splicing (Andrae et al. 2008; Mercola et al. 1988). In Xenopus, previous (Nagel et
al. 2004) and my current results indicate that the long/intermediate and short
isoforms indeed serve distinct functions in cell orientation. The sf-PDGF-A
controls orientation and attracts PCM cells to the BCR over a distance of several
cell lengths. The lf-PDGF-A and int-PDGF-A, on the other hand, associate with
the extracellular matrix of the BCR by binding to proteoglycans or fibronectin
(Smith et al. 2009; Nagel et al. 2004), restricting long range movement of the
molecules. With PDGFR-α being expressed in adjacent mesoderm tissue, this
creates a contact-dependent PDGF signaling mechanism where only mesoderm
cells directly in contact with the BCR receive the signal. Consistent with this, the
lf-PDGF-A (and likely int-PDGF-A given sequence similarity) has been linked to
substrate-dependent guidance cues that direct the migration of the leading edge
mesendoderm on the BCR surface (Nagel et al. 2004). An interesting question
will be how matrix-bound and diffusible PDGF signals are integrated as they
simultaneously impact cells directly at the ectoderm-mesoderm boundary.
As reviewed in Chapter One, a number of signaling pathways are activated
downstream of PDGFRα, some of which are known to be involved in the
regulation of directional cell migration (Heldin et al. 1998; Ronnstrand and Heldin,
181
2001; Hoch and Soriano, 2003). Interestingly, it has been shown that PDGF-AB
heterodimers and PDGF-AA homodimers activate distinct pathways downstream
of PDGFRα (Ekman et al. 1999). This shows that activation of receptors is not an
all or nothing event and that the activation of individual downstream signaling
pathways can be ligand dependent. Thus, it is possible that homodimers of sf-
PDGF-A, lf-PDGF-A and int-PDGF-A could activate distinct downstream signaling
pathways. Thus, the long range signaling mechanism regulating PCM radial
intercalation and the short range contact dependent signaling mechanism
regulating LEM directional migration could function through distinct signaling
pathways. Cells that are in contact with the BCR receive lf/int-PDGF-A and sf-
PDGF-A signals, thus if signalling downstream of these ligands involves different
signalling pathways, this could explain how LEM cells are able respond to the
short range contact based signal even though they are still exposed to long range
sf-PDGF-A signal.
The downstream signalling pathways involved in short and long range PDGF-A
signalling should be investigated and this could be studied using the approach
used by Van Stry et al. 2005. This approach used a panel of mutant
PDGFRα molecules where single key tyrosine residues or combinations of these
residues were mutated to phenyalanine. These receptors were defective for
individual or groups of signaling pathways. Furthermore, these receptors were
designed so that they could be chemically activated when needed, independently
182
of the endogenous PDGF-A ligand, which allows for the effect of the receptors on
gastrulation processes to be studied without affecting earlier stages of
development. Over-activation of PDGF signaling in the PCM or the LEM disrupts
cell orientation in these regions (see Section 3.2.3, Damm and Winklbauer, 2011;
Nagel et al. 2004), thus it would be expected that the activation of receptors that
contain intact tyrosine residues for the required signaling pathway(s) would result
in an overexpression phenotype. Focus could be directed to mutant receptors
that when expressed, fail to result in an overexpression phenotype. This effect
would indicate that the missing pathway(s) are required for cells to respond to the
PDGF-A directional signal. Thus, by running through the panel of mutant
receptors that contain different complements of functional signaling pathways
and screening embryos for the PDGF signaling overexpression phenotype, the
required signaling pathways regulating PCM radial intercalation and LEM
directional migration could be identified.
Based on the behaviour of cells in mesoderm explants, the orienting signal from
the BCR spreads about 5 cell layers deep into the mesoderm. Since the
mesoderm does not express PDGF, a relay mechanism involving signal
propagation by PDGF-stimulated PDGF release is excluded. Furthermore, since
lf-PDGF-A and int-PDGF-A are ineffective in BCR rescue experiments and in
endoderm gain-of-function assays, it is unlikely that a PDGF-A induced relay
mechanism is functioning as the orienting cue. Instead, sf-PDGF-A may
183
effectively diffuse into the mesoderm and form a classical chemoattractant
gradient. Unfortunately, the initial speading of the signal could not be determined
from the migratory response in explants, since irregular movements due to
explant relaxation after explantation were superimposed over directed migration.
After 30 minutes, approximately 5 cell rows were moving directionally,
corresponding to a signal range of about 200 µm. The boundary of this oriented
region advanced little during the next hours. This would be consistent with a
steady state gradient being formed in about an hour, but also with a continuously
expanding gradient whose spreading velocity decreases exponentially.
Compared to these length and time scales, the migration velocity of cells towards
the source, about 20 µm/hour, is small, and will probably not affect the gradient
significantly. (For more on PDGF-A gradients, refer to Chapter Four)
Roles for PDGF-A and PDGFR-α have been identified during early development
of zebrafish, chick and mouse (Yang et al. 2008; Orr-Urtreger and Lonai, 1992;
Soriano, 1997; Montero et al. 2003), but it is not known which isoforms of PDGF-
A are involved, and whether boundary effects or long-range signals are
employed. Also, PDGF-A has functions other than cell orientation in the embryo.
It prevents apoptosis in the mesoderm of Xenopus (Van Stry et al. 2004; Van
Stry et al. 2005), and regulates N-cadherin expression in the chick (Yang et al.
2008). In zebrafish, PDGF-A is part of a signaling pathway involving PI3K and
184
PKB, which stimulates the formation of PCM cell protrusions during gastrulation
(Montero et al. 2003).
3.3.3: Patterns of cell orientation and radial intercalation in Xenopus gastrulation
Both in PCM and LEM, orientation is influenced by sf-PDGF-A. If signalling is
diminished, PCM cells assume an orientation characteristic of the LEM, and
conversely, when sf-PDGF-A is overexpressed, LEM cells become radially
oriented, similar to the PCM. A lower sensitivity towards the PDGF signal in the
LEM, consistent with the reduced expression of PDGFR-α in this region (Figure
3.2A,B and Ataliotis et al. 1995), could explain the difference between regions. In
the LEM, the matrix-bound lf-PDGF-A orients the lamellipodia of the cells in
contact with the BCR substratum, towards the animal pole (Figure 2.9A; Nagel et
al. 2004).
Several observations suggest that the dorsal pattern of cell orientation continues
laterally and ventrally. Bidirectional orientation extends laterally into the SM,
which takes part in convergent extension. Unidirectional radial orientation and,
anterior to it at the leading edge of the mesoderm mantle, oblique orientation is
seen in lateral and ventral mesoderm (Figure 2.13 and 2.14, Ibrahim and
Winklbauer, 2001). We propose that the whole mesoderm can be subdivided into
a PDGF-insensitive region, characterized by the expression of XBra and a
185
PDGF-sensitive, unidirectional population located anteriorly to the insensitive
region. The former would comprise the converging and extending mesoderm,
and the latter both the leading edge mesendoderm with its oblique orientation,
and an intermediate region where cells point towards the BCR.
The endodermal vegetal cell mass is not responsive to the sf-PDGF-A long-range
signal. However, cells express PDGFR-α, and endodermal explants migrate
directionally on BCR-conditioned substratum (Figure Winklbauer and Nagel,
1991), consistent with an ability to recognize lf-PDGF-A. Vegetal cells are animal-
vegetally elongated, i.e. in parallel and not perpendicular to the BCR, fitting to the
vegetal rotation movement in which these cells are engaged (Winklbauer and
Schurfeld, 1999). In the absence of a sf-PDGF-A signal, PCM cells take on a
similar orientation. This suggests that in mesoderm and vegetal endoderm, the
basic cell orientation is along the animal/vegetal axis, however the molecular
regulators of this orientation have not been identified. Thus, as mesoderm cells
respond to PDGF-A, they are reoriented towards the BCR, but they fall back into
the animal/vegetal orientation if PDGF-A is not detected.
3.4: Materials and Methods 3.4.1: Embryos and microinjections See Chapter 2, Section 2.4.1.
186
3.4.2: Explants See Chapter 2, Section 2.4.6
3.4.3: Scanning Electron Microscopy See Chapter 2, Section 2.4.3
3.4.4: mRNA Isolation/RT-PCR PCM, endoderm and animal caps were dissected at stages 11 and 12. RNA was
purified using TriZol extraction (Life Technologies) and cDNA was synthesized
according to the protocol for the Superscript III reverse transcriptase (Life
Technologies). The following primers were used for PCR reactions: PDGF-A
(long/short form) FWD 5’-GGAATGCACGTGTACAGCAA-3’ and REV 5’-
CGGGAATGTAACATGGCGTA-3’; PDGFR-α FWD 5’-CTCGCAAATGCCACTACAGA-3’ and
REV 5’-CCACAAGGTGTCATTGTTGC-3’; ODC FWD 5’-GTCAATGATGGAGTGTATGGATC-3’
and REV 5’-TCCATTCCGCTCTCCTGAGCAC-3’; Gsc FWD 5’-TGTGGAGCAGTTCAAGCTCT-
3’ and REV 5’-ATCTGGGTACTTGGTTTCTT-3’; XBra FWD 5’-GGATCGTTATCACCTCTG-
3’ and REV 5’-GTGTAGTCTGTAGCAGCA-3’. PCR reactions were assembled
according to the protocol for the Platinum Taq Polymerase (Life Technologies).
Reactions for PDGF-A/PDGFR-α and ODC were run for 30 and 23 cycles
respectively at an annealing temperature of 60°C, reactions for Gsc and XBra for
25 cycles at an annealing temperature of 55°C.
3.4.5: Constructs, Morpholinos and mRNA Synthesis
187
RNA was synthesized using mMessage mMachine in vitro transcription kits (Life
Technologies). Plasmids containing lfPDGF-A (pGHE2), sfPDGF-A (pCS2+),
PDGFR-α (pGHE2), PDGFR-37 (pGHE2) and dnPDGF-A 1308 (pGEM) were
prepared for transcription as in Nagel et al. (2004). PDGF-A morpholino (5’
AGAATCCAAGCCCAGATCCTCATTG - 3’) was used as described (Nagel et al. 2004).
Morpholino resistant variants of sf/lf-PDGF-A were generated using the
QuickChange II site directed mutagenesis kit (Stratagene). Five bases (A, G, C,
T, T) within the morpholino hybridization region were changed to (C, A, T, C, A)
respectively. The sense and antisense primers used were (5’-
GCAGCAGGACGCAATGCGAATTTGGGCCTGGATACTGCTGCTAAGCGTCG-3’) and (5’
AGACGCTTAGCAGCAGTATCCAGGCCCAAATTCGCATTGCGTCCTGCTGC-3’) respectively. The
amino acid composition of the PDGF-A protein was preserved.
3.4.6: In-Situ Hybridization and In-Situ Probe Synthesis See Chapter 2, Section 2.4.2.
3.4.7: Statistical Analysis Statistical analysis was performed using GraphPad inStat 3. The Mann-Whitney
statistical test at the 95% confidence level was used for all statistical calculations.
188
Chapter Four: The short splice isoform of PDGF-A forms a chemoattractant gradient by diffusion of
molecules through the extracellular space
189
4.1: Introduction Chemoattractant and morphogen gradients play essential roles in development.
The wing imaginal discs of Drosophila larvae are patterned by a gradient of
Decapentaplegic, a TGF-β factor that spreads from the compartment boundary
separating the anterior and posterior halves of the disc (Basler and Struhl, 1994;
Entchev et al. 2000; Teleman and Cohen, 2000; Kicheva et al. 2007; Zhou et al.
2012). In Xenopus and zebrafish early development, a hypothesized gradient of
bone morphogenetic proteins (BMPs) produced on the future ventral side of the
embryo is thought to pattern the dorsal/ventral axis of the embryo (Suzuki et al.
1994; Dosch et al. 1997; Kishimoto et al. 1997; Dick et al. 2000; Plouchinec and
DeRobertis, 2011). A chemoattractant gradient of SDF1-α instructively regulates
the directional migration of primordial germ cells during early Zebrafish
development (Doitsidou et al. 2002; Boldajipour et al. 2008). Thus, signalling
molecules from several families have been hypothesized to form gradients. While
experimental evidence has suggested roles for morphogen or chemoattractant
gradients in many systems, the existence of many of these gradients remains
hypothetical, as they have not been directly observed. Several recent studies
have used fluorescently tagged proteins in order to visualize gradients and to
study the kinetics of gradient formation (Kicheva et al. 2007; Yu et al. 2009; Zhou
et al. 2012).
190
In principle, in order for a stable gradient to form there must be a localized source
of molecules and a sink for the molecules. The sink is usually in the form of
protein degradation, either by extracellular degradation or intracellular
degradation after receptor mediated endocytosis (Kruse et al. 2004; Kitcheva et
al. 2007; Boldajipour 2008; Yu et al. 2009; Zhou et al. 2012). Alternatively,
binding and inactivation of molecules by extracellular receptors or extracellular
antagonists could also function as a sink (Piccolo et al. 1996; Blitz et al. 2000;
Little et al. 2006; Umulis et al. 2009). In order to form a gradient, molecules must
spread from the source through the tissue. The mechanism of spreading seems
to be dependent on the molecule involved. Hypothetically, simple free diffusion of
molecules through cells with a localized sink that is distant from the source can
form a linear gradient (Crick, 1970). Alternatively, free diffusion of molecules
through extracellular spaces with a uniform sink in the tissue and a constant rate
of degradation forms a gradient described by an exponential decay function
(Wartlick et al. 2009). The Dpp morphogen gradient in the Drosophila wing disc
and the Fgf-8 morphogen gradient in the Zebrafish embryo are examples of
gradients that form by free diffusion (Zhou et al. 2012, Yu et al. 2009). Other
potential mechanisms of spreading include the “bucket brigade”, in which
molecules are passed from receptor to receptor on the cell surface, and
transcytosis where molecules internalized by endocytosis are subsequently
secreted and passed on to the next cell (Kerzberg and Wolpert 1998, Strigini,
2005).
191
PDGFs have been described as both chemoattractants and morphogens (Andrae
et al. 2008). These observations imply that PDGF molecules form a
concentration gradient in tissues. The PCM of the Xenopus embryo undergoes
radial intercalation over the course of gastrulation (see Chapter Two; Damm and
Winklbauer, 2011). Radial intercalation of these cells requires directional
intercellular migration that is instructively regulated by sf-PDGF-A, which is
produced by the overlying BCR (see Chapter Three; Ataliotis et al. 1995; Damm
and Winklbauer, 2011). In vitro observations using explants suggests that the
influence of sf-PDGF-A is stable to a range of approximately 200 µm (see
Chapter Three; Damm and Winklbauer, 2011). Furthermore, sf-PDGF-A dimers
are similar in size to Dpp and Fgf dimers, which form concentration gradients in
tissues (Zhou et al. 2012). Thus, it is possible that sf-PDGF-A, which lacks the C-
terminal cell retention motif domain, could form a chemoattractant gradient in
PCM tissue (Figure 3.1; Raines and Ross 1992; Kelly et al. 1993; Andersson et
al. 1994; Damm and Winklbauer, 2011).
In this chapter, using PDGF-A-eGFP fusion constructs, I show that sf-PDGF-A
forms a gradient in PCM tissue and that these molecules spread through the
tissue by moving through intercellular spaces. Furthermore, I show that lf-PDGF-
A and int-PDGF-A, which contain a C-terminal cell retention motif, do not form a
192
gradient and remain restricted at the mesoderm/BCR boundary. Lastly, my
results suggest that sf-PDGF-A spreads through the tissue by diffusion.
4.2: Results 4.2.1: Short and long PDGF-A isoforms have different extracellular localizations Several reports have shown that GFP tagged proteins can be used to visualize
concentration gradients of molecules (Kicheva et al. 2007; Yu et al. 2009; Zhou
et al. 2012). Morpholino resistant variants of sf-PDGF-A, lf-PDGF-A and int-
PDGF-A were tagged with eGFP downstream of the N-terminal pro-peptide
cleavage site (Figure 4.1A). Since eGFP is a relatively large molecule and I was
concerned that fusing it with PDGF-A may lead to a non-functional protein, sf-
PDGF-A and lf-PDGF-A constructs were generated with three short Myc epitope
tags downstream of the pro-peptide cleavage site as a contingency (Figure 4.1A).
Because tagging proteins with fluorophores can disrupt protein function, I tested
the ability of the sf-PDGF-A-eGFP to rescue the PDGF-A morphant phenotype.
When a morpholino targeting PDGF-A is injected into BCR cells, PCM cells fail to
orient their protrusions toward the BCR and instead orient their protrusions
between 0o and 90o with respect to the BCR (Figure 4.2A, C), an effect that is
fully rescued by co-expressing sf-PDGF-A with the PDGF-A morpholino (see
chapter three, Figure 3.8A, B). Similar to sf-PDGF-A, the sf-PDGF-A-eGFP
193
construct was able to rescue the PDGF-A morphant phenotype (P-value <
0.0001) showing that fusion with eGFP did not disrupt function (Figure 4.2B, D).
The Xenopus embryo is opaque during early development; therefore it is not
possible to see the expression of tagged constructs inside the embryo. I made
use of the explant system designed to film intercellular migration of PCM cells
(see chapter two, Figure 2.13A; 4.1B). Since directional migration of PCM cells
can be measured in this explant, and I have shown that sf-PDGF-A instructively
regulates this migration, any putative PDGF-A gradient must be formed in vitro in
this tissue as well as in vivo. Therefore, this explant is a suitable system to study
PDGF-A gradients. Ectoderm (BCR) was injected with sf-PDGF-A-eGFP, lf-
PDGF-A-eGFP or int-PDGF-A-eGFP mRNA and combined with the posterior end
of a mesoderm explant isolated from an un-injected embryo (Figure 4.1B).
Assembled explants were observed with a laser scanning confocal microscope.
PDGF-A is normally expressed by ectoderm cells, therefore I analyzed the
localization of the PDGF-A-eGFP constructs in the ectoderm of
ectoderm/mesoderm explant combinations. In whole embryos, the ectoderm has
large triangular/rectangular intercellular gaps and narrower gaps between parallel
membranes of tightly associated cells (Figure 4.3A,B). Similar gaps are observed
in explanted ectoderm tissue. These gaps open and close as cells break and
194
Figure 4.1: Visualizing PDGF molecules (A) Schematic diagrams of PDGF-A-eGFP and PDGF-A-myc constructs showing
the location of the eGFP and Myc tags downstream of the pro-peptide domain.
Light blue, leader sequence; orange, PDGF growth factor domain; red, C-terminal
retention motif; light green, propeptide domain; purple, hydrophobic domain;
brown, short form specific C-terminus; green; eGFP tag; blue, 3XMyc tag. (B)
Explant system. (1.) Mesoderm and ectoderm (expressing PDGF-A-eGFP
constructs) are explanted and (2.) combined with the BCR placed at the
posterior, PCM-containing end of mesoderm explant. Explant combinations (3.)
are filmed immediately with a laser scanning confocal system and cell velocities
measured.
195
Figure 4.1: Visualizing PDGF molecules
196
re-form contacts over time (Figure 4.3D-L; 4.4A-I). Sf-PDGF-A-eGFP was
detected intracellularly and in existing and newly formed large extracellular gaps
(Figure 4.3E-F, H-I, K-L). Some sf-PDGF-A-eGFP was also co-localized with the
adjacent membranes between cells, which suggests that the molecules could be
accumulating in spaces between cell membranes (Figure 4.3B, F, I;
mbRFP/eGFP co-localization between cells). These observations are consistent
with sf-PDGF-A being secreted but not remaining associated with the cell
surface. Interestingly, int-PDGF-A-eGFP, which contains the C-terminal cell
retention motif, was found to co-localize with the exposed cell membrane of the
large extracellular gaps and with the membranes of adjacent cells (Figure 4.4B-
E, E-F, H-I) and was not found within intercellular gaps. For unknown reasons, lf-
PDGF-A-eGFP failed to show any fluorescent signal. Therefore, I analyzed the
localization of lf-PDGF-A-myc in ectoderm. As with int-PDGF-A-eGFP, lf-PDGF-
A-myc was found to co-localize with the cell membrane (Figure 4.5A-C), however
membrane localization appeared to be stronger. Lf-PDGF-A-myc was observed
in fixed tissue compared with the live imaging of int-PDGF-A-eGFP. The
increased localization of lf-PDGF-A-myc at the membrane could be a fixation
artefact if the accumulation of lf-PDGF-A extracellularly is a highly dynamic
process. Alternatively, the difference in membrane localization could be an
artefact caused by the fusion of the molecules with the eGFP or Myc tags.
Finally, this observation could be the result of real differences in behaviour
between the long and intermediate PDGF isoforms. Regardless of the cause,
197
Figure 4.2: sf-PDGF-A-eGFP can rescue the PDGF-A morphant phenotype (A-B) Scanning electron micrographs of sagittaly fractured mid-gastrula stage
(NF stage 11) embryos injected with PDGF-A morpholino (A) or co-injection of
PDGF-A morpholino and morpholino resistant sf-PDGF-A-eGFP (B); white
arrowheads in (A) highlight cells oriented parallel to the BCR; white arrowheads
in (B) highlight cells oriented perpendicular to the BCR. (C,D) Rose diagrams
showing the percentage orientation of prechordal mesoderm cells from embryos
injected with PDGF-A morpholino (C) or co-injected with PDGF-A morpholino and
morpholino resistant sf-PDGF-A-eGFP (D); 0 degrees, dorsal BCR; 90 degrees,
animal pole. “n” is number of cells scored from 10 embryos analyzed for each
condition. BCR, blastocoel roof; EN, endoderm.
198
Figure 4.2: sf-PDGF-A-eGFP can rescue the PDGF-A morphant phenotype
199
both the intermediate and long PDGF isoforms were membrane localized, which
was expected since the C-terminal cell retention sequence has been shown to be
important for keeping PDGF-A at the surface of the secreting cell (Raines and
Ross, 1992). However, I was unable to determine if, as expected, the tagged
proteins were indeed associated with the extracellular or intracellular side of the
cell membrane.
4.2.2: sf-PDGF-A is found distant from its source, in intercellular spaces between PCM cells
BCR expressing sf-PDGF-A-eGFP was combined with uninjected mesoderm
(Figure 4.1B) and immediately imaged with the confocal microscope. Unlike
ectoderm, mesoderm in the intact embryo has more intercellular spaces due to
sites of cell-cell contact being small, as seen with TEM (Figure 4.3C). In the
embryo, these gaps are potential sites of PDGF-A accumulation. In explants, the
large gaps between mesoderm cells could function similarly. Immediately after
the mesoderm and BCR explants were combined, sf-PDGF-A-eGFP was clearly
visible in the ectoderm, however mesoderm explants were completely clear of
GFP signal (Figure 4.6A-D). When explants were imaged over an hour later, sf-
PDGF-A-eGFP was found in the mesoderm intercellular spaces (Figure 4.6E-H).
Interestingly, there was no sf-PDGF-A-eGFP seen intracellularly in the
mesoderm explant (Figure 4.6E-H). Receptor mediated endocytosis of PDGF-A
has been shown to be important in the regulation of chemotaxis (Kawada et al.
200
2009; Avrov et al. 2003), thus in order to determine if intracellular sf-PDGF-A-
eGFP might be visible in the mesoderm explant below the surface level filmed in
timelapses, Z-stack images of the explants were generated (Figure 4.7). It was
possible to image explants to a depth of approximately 11 µm. PCM mesoderm
cells range from 15-25 µm in height (Selchow and Winklbauer, 1997), thus the
deepest plane imaged should be approximately halfway through the height of the
cells. Sf-PDGF-A-eGFP was only found extracellularly at all levels of the z-stack
(Figure 4.7A-D). This unexpected result argues against a role for receptor-
mediated endocytosis in this system. Together, these results suggested that sf-
PDGF-A-eGFP molecules had travelled from their source in the BCR explant to
deep in the mesoderm explant through intercellular spaces.
Close examination of mesoderm intercellular spaces revealed that sf-PDGF-A-
eGFP appeared to be punctate (Figure 4.3H,K; 4.8A). Interestingly, when images
of mesoderm intercellular spaces were analyzed, fluorescent structures ranging
in length from 0.5 µm to greater than 1 µm could be seen interspersed by dark
areas (Figure 4.8B,C). Furthermore, eGFP signal of these structures was
obviously more intense in extracellular gaps that were closer to the BCR explant
(PDGF-A source) (Figure 4.8B,C). These observations suggest that extracellular
matrix macromolecules could be creating channels or pores in the extracellular
gaps. Sf-PDGF-A-eGFP could travel as individual dimers or small aggregates
through these channels as it moves through the mesoderm tissue. The decrease
201
Figure 4.3: sf-PDGF-A-eGFP is localized to ectoderm intercellular spaces
(A-C) Transmission electron micrographs of large ectoderm intercellular spaces,
black arrowhead in (A), close ectoderm cell contacts, between black arrowheads
in (B) and large gaps between mesoderm cells, between white arrowheads and
indicated by asterisk in (C). (D-L) Confocal optical sections of the ectoderm piece
of ectoderm/mesoderm explant combinations, ectoderm expressed membrane
bound RFP (D,G,J) to label cells and sf-PDGF-A-eGFP (E,H,K); Merge images
(F,I,L); white arrowheads indicates accumulation of eGFP signal in the
intercellular spaces at t = 0 (D), t = 3 minutes (E) and t = 6 minutes (F). Scale bar
in merge images (F,I,L) = 50µm.
202
Figure 4.3: sf-PDGF-A-eGFP is localized to ectoderm intercellular spaces
203
Figure 4.4: int-PDGF-A-eGFP is localized to ectoderm cell membranes
(A-I) Confocal optical sections of an ectoderm explant expressing membrane
bound RFP (A,D,G) to visualize the cells and int-PDGF-A-eGFP (B,E,H), white
arrow heads show the absence of eGFP signal in intercellular spaces at t = 0 (A-
C), t = 3 minutes (D-F) and t = 6 minutes (G-I). Localization of int-PDGF-A-eGFP
at the cell membrane can be seen in Merge images (C,F,I). Scale bar in merge
images (C,F,I) = 50µm.
204
Figure 4.4: int-PDGF-A-eGFP is localized to ectoderm cell membranes
205
in average fluorescence intensity of these structures at increasing distances from
the BCR explant (Figure 4.8B,C) supports the idea that these structures could
represent channels but not large aggregates. Fluorescence intensity is an
indicator of eGFP concentration and the concentration of sf-PDGF-A-eGFP
moving through channels is expected to decrease with increasing distance from
the sf-PDGF-A-eGFP source (BCR explant). It is unlikely that there would be a
decrease in the fluorescence intensity of individual structures with increasing
distance from the BCR explant if these structures represented aggregates of sf-
PDGF-eGFP molecules. Dense extracellular matrix has indeed been observed in
the intercellular gaps of the gastrula (Johnson, 1977ab). The path followed by sf-
PDGF-A-eGFP molecules as they move through the extracellular spaces could
be increased as a result of having to move through channels or around
obstacles, which would reduce the effective rate and range of sf-PDGF-A
spreading in mesoderm tissue.
In order to determine if PDGF-A isoforms containing the C-terminal retention
motif move into the mesoderm like sf-PDGF-A molecules, ectoderm expressing
int-PDGF-A-eGFP was combined with mesoderm. When the explant combination
was imaged immediately after being combined, int-PDGF-A-eGFP was strongly
visible in the ectoderm explant, however no GFP signal was present in
mesoderm intercellular spaces (Figure 4.9A-D). When analyzed later, unlike with
sf-PDGF-A-eGFP, there was still no GFP signal present in the mesoderm explant
206
Figure 4.5: lf-PDGF-A-myc localization is similar to that of int-PDGF-A-eGFP (A-C) Confocal optical section of an ectoderm explant expressing membrane
bound RFP to visualize the cells and lf-PDGF-A-myc. Sections stained with anti-
myc antibody and FITC conjugated secondary antibody. (A) mbRFP, (B) lf-
PDGF-A-myc, (C) merge image, white arrow heads (B,C) show the localization of
lf-PDGF-A-myc at cell membranes. Scale bar in merge image (C) = 50µm.
207
Figure 4.5: lf-PDGF-A-myc localization is similar to that of int-PDGF-A-eGFP
208
Figure 4.6: sf-PDGF-A-eGFP forms a visible gradient in mesoderm tissue
(A-H) Confocal optical sections of ectoderm/mesoderm explant combinations,
ectoderm expressed membrane bound RFP (A,E) to label cells and sf-PDGF-A-
eGFP (B,F); DIC channel (C,G); Merge images (D,H); (A-D) Images taken
immediately after explant assembly; (E-H) images taken after 120 minutes, white
arrowheads (F,H) indicates accumulation of eGFP signal in the intercellular
spaces with visually decreasing fluorescence intensity moving away from the
ectoderm explant/mesoderm interface. Scale bar in merge images (D,H) = 50µm.
209
Figure 4.6: sf-PDGF-A-eGFP forms a visible gradient in mesoderm tissue
210
(Figure 4.9E-H). Instead, int-PDGF-A-eGFP signal was strongly present at the
mesoderm-ectoderm boundary, co-localizing with the labelled ectoderm cell
membrane (Figure 4.9H). These results fit with explant and whole embryo
observations that suggest that sf-PDGF-A functions as a long range molecule
while PDGF-A isoforms containing the C-terminal cell retention motif appear to
have short range functions only (see Chapter Three, Damm and Winklbauer,
2011).
4.2.3: sf-PDGF-A forms an extracellular gradient that fits a single exponential decay function
Several lines of indirect evidence have suggested that sf-PDGF-A is forming a
concentration gradient in the mesoderm tissue (see Chapter Three; Figure 4.6).
The presence of sf-PDGF-A-eGFP in mesoderm explants at a distance from the
BCR source is in support of this hypothesis. The spreading of molecules from a
localized source in a non-directional fashion with linear degradation is described
by equation (A1) (see section 4.5). Once a steady state has been reached, this
can be characterized by the exponential decay function:
(1)
𝐶 𝑥 = 𝐶!𝑒!!!
where 𝐶! is the concentration at the source boundary, 𝑥 (µm) is the distance from
the source boundary, and λ (µm) is the decay length, the distance from the
211
Figure 4.7: sf-PDGF-A-eGFP is only observed in intercellular gaps
(A-D) Confocal optical sections of an ectoderm/mesoderm explant combination z-
stack, ectoderm expressed membrane bound RFP to label cells and sf-PDGF-A-
eGFP; z. position of 0 is the surface of the explant (A); white arrowheads
highlight intercellular spaces that show eGFP signal at increasing depth in the
explants (B,C,D). Scale bar in merge images (A-D) = 50µm.
212
Figure 4.7: sf-PDGF-A-eGFP is only observed in intercellular gaps
213
source where the concentration of the molecule has decayed to a factor of 1 𝑒 of
the concentration at the source 𝐶!. Equation (1) shows that 𝐶(𝑥) depends on the
distance from the source, the decay length 𝜆 and the concentration at the source
boundary 𝐶! . Thus, the shape of the exponential function representing a
molecular gradient is determined by 𝜆 and 𝐶! . These parameters in turn are
determined by the degradation rate 𝑘 (s-1) and the diffusion coefficient 𝐷 (µm2s-1)
in the source (ectoderm) and receiving (mesoderm) tissues. In the mesoderm, 𝜆,
𝑘 and 𝐷 are related by:
(2)
𝜆 =𝐷𝑘
(Equations (1) and (2) are adapted from Kicheva et al. 2007)
For the purposes of this study, a relative 𝐶! in arbitrary fluorescence units can be
determined from the average fluorescence intensity of eGFP labelled constructs
at the source boundary. This is possible because the Beer-Lambert law shows
that fluorescence intensity and concentration are proportionally related
(Lakowicz, 2006) providing that saturation of the pixels in the image has not
occurred.
214
After ectoderm expressing sf-PDGF-A-eGFP and uninjected mesoderm are
combined, a gradient of sf-PDGF-A-eGFP can be seen extending from the
ectoderm explant into the mesoderm explant in confocal images (Figure 4.6). To
determine if the sf-PDGF-A-eGFP distribution is an exponential concentration
gradient, mRNA encoding sf-PDGF-A-eGFP was injected at a concentration of
400pg/blastomere. This concentration of sf-PDGF-A mRNA was used previously
to rescue PDGF-A morphant embryos and thus can mimic endogenous sf-PDGF-
A concentrations (See Chapter Three; Figure 4.2B). Ectoderm expressing sf-
PDGF-A-eGFP was then combined with mesoderm from an uninjected embryo
and z-stack images of the explants were captured after 2 hours. These images
were divided into 13 stripes parallel to the mesoderm-BCR boundary that were
20µm in width, the first of which corresponded to the first 20µm of mesoderm
adjacent to the mesoderm/ectoderm boundary. The average GFP fluorescence
intensity of the intercellular spaces was determined in each stripe and the relative
average 𝐶! was determined by measuring the fluorescence intensity at the
source boundary (i.e. in Brachet’s Cleft) (Figure 4.10A).
Although the general trend was a decay in GFP intensity with increasing distance
from the mesoderm-BCR boundary (Figure 4.10B), fluctuation in fluorescence
intensity occurred from region to region, sometimes increasing slightly when
moving to regions further away from the BCR before dropping back down in
regions even further from the BCR (Figure 4.10B). Similar fluctuations were
215
Figure 4.8: sf-PDGF-A-eGFP in intercellular spaces
(A) High magnification (1000X), high resolution (1024x1024) image of a
mesoderm-BCR explant showing two intercellular gaps in the mesoderm explant,
(B-C) Digitally magnified images of the intercellular gaps from (A). (B) is the gap
furthest from the BCR explant, (C) is the gap closer to the BCR explant, white
arrowheads highlight sf-PDGF-A-eGFP signal, white lines trace the length of
individual eGFP structures.
216
Figure 4.8: sf-PDGF-A-eGFP in intercellular spaces
217
Figure 4.9: int-PDGF-A-eGFP remains localized to the mesoderm/ectoderm boundary (A-H) Confocal optical sections of ectoderm/mesoderm explant combinations,
ectoderm expressed membrane bound RFP (A,E) to label cells and int-PDGF-A-
eGFP (B,F); DIC channel (C,G); Merge images (D,H); (A-D) Images taken
immediately after explant assembly; (E-H) images taken after 120 minutes, white
arrowheads (F,H) indicates accumulation of eGFP signal at the
mesoderm/ectoderm boundary. Scale bar in merge images (D,H) = 50µm.
218
Figure 4.9: int-PDGF-A-eGFP remains localized to the mesoderm/ectoderm boundary
219
observed when Dpp-GFP fluorescence intensity was measured in the Drosophila
wing imaginal disc (Kicheva et al. 2007). When averaged over all explants,
however, the sf-PDGF-A-eGFP distribution in mesoderm tissue fit a single
exponential function very well (R2 = 0.95, Figure 4.10B-D). The average decay
length λ was determined from the exponential function plot (Figure 4.10C). Thus,
the average decay length λ was 80 +/- 12 µm. In explants, approximately 4 to 5
rows of PCM cells migrate directionally toward a sf-PDGF-A source (see Chapter
Two, Figure 2.14F, G, H). PCM cells are approximately 40 to 50 µm in length
(Selchow and Winklbauer, 1997). Thus, cells are able to respond to the gradient
up to an approximate distance of 2λ−2.5λ (160-200 µm). This suggests that
mesoderm cells can read the PDGF-A signal to levels of approximately 20% of
the concentration at the mesoderm-ectoderm interface.
In order to ensure that pixels were not saturated in the sf-PDGF-A-eGFP source
where the concentration is highest, which would affect the measurements of
relative average 𝐶! value and thus the shape of the gradient, sf-PDGF-A-eGFP
was also expressed at a high dose (approximately 2.5X higher than the dose
used to rescue PDGF-A morphant embryos). BCR explanted from embryos
injected with 1ng/blastomere of mRNA encoding sf-PDGF-A-eGFP was used.
High concentration explants were imaged under the same conditions and with the
same microscope settings as the lower concentration explants. The average
intracellular fluorescence intensity of the sf-PDGF-A-eGFP source cells in the
220
Figure 4.10: The sf-PDGF-A gradient fits a single exponentional function
(A) Explanation of the method used to measure average fluorescence intensity in
extracellular gaps and at the source boundary, red boxes indicate examples of
areas where measurements were made from maximum projection z-stack
images, red line represents the approximately 14 pixel distance over which
fluorescence intensity was measured. (B-D) Average eGFP intensity measured
from 20µm wide mesoderm regions to a distance of 260µm from the ectoderm
explant. Measurements were made from confocal maximum intensity projections
of individual mesoderm/ectoderm explant combinations. Ectoderm was co-
injected with 600pg of membrane bound RFP RNA and 1.6ng of sf-PDGF-A-
eGFP RNA (coloured lines, 6 in total) (B), black trace (B,C) is the average GFP
intensity in each 20µm wide mesoderm region of the 6 explants measured, red
line is the curve of best fit for the black trace. The distance from the source
corresponding to the average decay length (λ) is indicated by the red dotted line
(B,C). Error bars show standard error of the mean. (D) Linear regression analysis
of average fluorescent intensity data from the black trace in (B,C), trace is nearly
linear (R2 = 0.95).
221
Figure 4.10: The sf-PDGF-A gradient fits a single exponentional function
222
Figure 4.11: There is no change in average decay length (λ) by increasing sf-PDGF-A expression (A) Bar graph comparison of fluorescence intensity at the mesoderm-BCR
boundary and inside ectoderm cells for low and high mRNA conditions. (B,C)
Average eGFP intensity measured from 20µm wide mesoderm regions to a
distance of 260µm from the ectoderm explant. Measurements were made from
confocal maximum intensity projections of individual mesoderm/ectoderm explant
combinations. Ectoderm was co-injected with 600pg of membrane bound RFP
RNA and 4ng of sf-PDGF-A-eGFP RNA (coloured lines, 6 in total) (B), black trace
(B,C) is the average GFP intensity from each mesoderm region of the 6 explants
measured, red line is the curve of best fit for the black trace. The distance from
the source corresponding to the average decay length (λ) is indicated by the red
dotted line (B,C). Error bars show standard error of the mean. (D) Linear
regression analysis of average fluorescent intensity data from the black trace in
(B,C), best fit is close to linear (R2 = 0.84). (E) Comparison of decay lengths of
explants expressing low and high concentration of sf-PDGF-A-eGFP. Error bars
show standard error of the mean. Asterisks indicate statistically significant
results.
223
Figure 4.11: There is no change in average decay length (λ) by increasing sf-PDGF-A expression
224
ectoderm was significantly higher (P-value = 0.03) in ectoderm injected with 4ng
sf-PDGF-A-eGFP mRNA compared with lower concentrations of mRNA (Figure
4.11A), although this increase was not proportional to the mRNA dose. The lack
of a proportional increase could be the result of several possibilities. For
example, it is unknown how much of the injected mRNA is actually translated;
very high concentrations of mRNA could overpower the available protein
translation machinery of the cells resulting in a lower than expected protein
concentration. Additionally, translational and post-translational regulation of sf-
PDGF-A-eGFP mRNA and protein could affect protein levels. Fluorescence
intensities were measured using the Zeiss Axiovison 4 microscopy software
package. This software allows pixel intensities to vary between one and 255 for
an 8 bit image. Even with the increased fluorescence intensity, both the average
intracellular (in ectoderm cells) and source boundary (mesoderm-BCR interface)
sf-PDGF-A-eGFP intensities were below the 255 intensity level in the very high
mRNA concentration explants (Figure 4.11A). This result suggests that saturation
of pixels in the image was not an issue and should not affect the shape of the
gradient.
For unknown reasons, fluctuations in GFP intensity were more severe between
regions in mesoderm explants at high concentration of sf-PDGF-A-eGFP,
compared with ectoderm expressing a lower concentration (compare Figures
4.10B and 4.11B). However, similar to the lower concentration situation, on
225
average the data fit a single exponential function reasonably well (R2 = 0.84,
Figure 4.11B-D). The decay length value was determined to be λ = 111 +/- 19
µm, which is not significantly different from the lower sf-PDGF-A-eGFP mRNA
concentration experiment (P-value = 0.329) (Figure 4.12E). Thus, the higher
source concentration of sf-PDGF-A-eGFP did not increase the decay length (λ)
(Figure 4.11D). This result shows that the relationship described in equation (1) is
valid in this system.
The C-terminal cell retention motif found in the longer PDGF-A isoforms
apparently restricts the PDGF-A-eGFP signal to the mesoderm/ectoderm
boundary (Figure 4.9E-H). In order to quantitatively analyze the dynamics of
PDGF-A isoforms that contain a C-terminal retention motif, 400pg/blastomere of
int-PDGF-A-eGFP mRNA was injected into embryos. Immediately after
combining the mesoderm and ectoderm explants, GFP signal was clearly visible
in ectoderm cells however, no GFP signal appeared in the mesoderm
intercellular spaces over the two hours of filming (Figure 4.12A,B). Thus, PDGF-
A isoforms containing the C-terminal cell retention do not form a gradient and
their signalling functions must be restricted to the region surrounding the
secreting cells.
The relationships described in equations (1) and (2) only describe a gradient at
steady state; therefore equations (1) and (2) can only be applied to spreading of
226
PDGF-A after the gradient reaches a steady state. The sf-PDGF-A-eGFP signal
continued to spread until approximately one hour after the mesoderm and BCR
explants were combined (Figure 4.13A-D). After that time point, the maximum
distance from the BCR where a GFP signal was visible did not change (Figure
4.13D). This suggests that a steady state gradient was established in about an
hour. To quantify this observation, the GFP fluorescence intensity was measured
in intercellular gaps in a region corresponding to the average decay length λ
(approximately 80µm from the mesoderm/BCR interface). Once a steady state
gradient is established, the GFP fluorescence intensity at this position should
stop increasing and become constant, although some fluctuations in intensity
may be expected. The time point at which GFP fluorescence intensity began to
increase at λ was explant specific, beginning between 20 and 40 minutes after
the start of filming. Fluorescence intensity continued to increase for
approximately another 40 minutes before levelling off in the vicinity of the 70
minute mark (Figure 4.13E). The initial 0 to 40 minute delay in the appearance of
fluorescence in the mesoderm explant is likely due to the time required for the
mesoderm and ectoderm explants to heal and form the mesoderm-ecotoderm
interface (approx. 30 minutes, see Chapter Two). These results indicate that the
sf-PDGF-A-eGFP gradient could reach a steady state within approximately 50
minutes of the first appearance of GFP signal at λ. Interestingly, cells in
mesoderm explants begin moving toward the BCR explant between 30 and 60
227
Figure 4.12: int-PDGF-A-eGFP does not form a gradient (A,B) Average eGFP intensity in mesoderm regions measured from confocal
maximum intensity projections of individual mesoderm/ectoderm explant
combinations with ectoderm injected with 1.6ng of int-PDGF-A-eGFP RNA
(coloured lines, 6 in total) (A); black trace (A,B) plots the average eGFP intensity
in each mesoderm region of the 6 explants measured. Error bars show the
standard error of the mean.
228
Figure 4.12: int-PDGF-A-eGFP does not form a gradient
229
minutes after the assembly of the explants (see Chapter Two, Figure 2.13F, G,
H), thus mesoderm cell movements correlate with the timeline for the formation of
sf-PDGF-A steady state gradient in mesoderm tissue.
The spaces between mesoderm cells are filled with an extracellular matrix
material that includes glycosaminoglycans (Johnson, 1977ab). Since PDGF-A is
found in intercellular spaces, it must be contained within this material.
Interestingly, as cells in mesoderm explants migrated toward the BCR explant, sf-
PDGF-A-eGFP containing extracellular matrix could be seen moving relative to
the cells (Figure 4.14A-D). This is presumably due to forces exerted on the matrix
by the migrating cells. In some cases, gaps fused to make a new gap combining
the PDGF-A containing material from the original gaps (Figure 4.14D). These
observations may explain the fluctuations seen in the GFP intensity
measurements. As described above, measurements are made in stripes
spanning 20 µm in width. If cell movements push material into and out of
measurement zones, it could appear as fluctuations in intensity measurements.
The contribution of these convection processes on the spreading of sf-PDGF-A-
eGFP through mesoderm tissue remains to be analyzed in detail.
230
Figure 4.13: sf-PDGF-A-eGFP forms a steady state gradient
(A-D) Confocal optical sections from a mesoderm/ectoderm combination
timelapse. (A) Start of timelapse recording, (B) t = 20 minutes, white box and
arrowhead show visually detectable GFP signal at a position corresponding to
the average decay length (λ). Red measurements show the range of the visible
gradient after 70 minutes (C) and 110 minutes (D). White arrow in (C,D) indicates
a sf-PDGF-A-eGFP filled gap at a position corresponding to the average decay
length (λ). Scale bars correspond to 50µm. (E) Plot of the change in average
eGFP fluorescence intensity over the course of the timelapse at position λ as
measured from confocal maximum projections for 5 mesoderm/ectoderm
combinations (coloured lines). Black trace (E) plots the average eGFP intensity in
each mesoderm region from the 5 explants measured over the course of the
timelapse. Red trace (E) plots the average eGFP intensity in ectoderm explant
(PDGF-A-eGFP source) from the 5 explants measured over the course of the
timelapse. Error bars show the standard error of the mean.
231
Figure 4.13: sf-PDGF-A-eGFP forms a steady state gradient
232
Figure 4.14: sf-PDGF-A-eGFP in extracellular spaces moves relative to the cells as they migrate (A-D) Confocal optical sections of ectoderm/mesoderm explant combinations,
ectoderm expressed membrane bound RFP to label cells and sf-PDGF-A-eGFP;
white arrowheads follow the merging of two intercellular gaps over six minutes
(A-D). Scale bars = 50µm.
233
Figure 4.14: sf-PDGF-A-eGFP in extracellular spaces moves relative to cells as cells migrate
234
4.2.4: The effective diffusion coefficient 𝑫𝒆𝒇𝒇 is consistent with formation of a sf-PDFG-A-eGFP gradient by diffusion through extracellular spaces
The decay length λ, degradation rate 𝑘 and the diffusion coefficient 𝐷 kinetic
parameters provide information about the mechanism of spreading of molecules
in a tissue. The diffusion coefficient 𝐷, which describes the rate of molecule
spreading in a fluid medium as a result of random diffusion, is a property that is
characteristic of the diffusing molecule in a specific medium. However, the
diffusion of a molecule through a tissue is subject to interactions with extracellular
matrix molecules, binding proteins, receptors and factors that can increase the
diffusion path length for the molecule. These interactions can be strongly
reflected in diffusion coefficients determined for molecules when using
techniques like FRAP because they operate over long distance and time scales
(Kitcheva et al. 2012). However, these interactions can also be reflected, to a
lesser degree, in diffusion coefficients determined using techniques that operate
over very short length and time scales, such as FCS (see Chapter 1, section
1.3.1). Thus, diffusion coefficients of molecules in tissues determined using these
techniques are referred to as effective diffusion coefficients 𝐷!"! , as they pertain
to the overall rate of gradient formation. The magnitude of the effective diffusion
coefficient 𝐷!"" of a molecule can be indicative of the mechanism of spreading
for that molecule when compared to the diffusion coefficient 𝐷 of that molecule in
water. For example, very low effective diffusion coefficients (0.1 – 0.5 µm2s-1) are
235
suggestive of active transport mechanisms involving endocytosis or the transport
of molecules along a cell membrane while higher effective diffusion coefficients
(on the order of magnitude of 20 to 86 µm2s-1) could suggest free extracellular
diffusion of molecules (Kicheva et al. 2012; Kicheva et al. 2007; Yu et al. 2009).
In order to determine how sf-PDGF-A-eGFP is transported in mesoderm tissue,
these parameters were calculated. λ, 𝑘 and 𝐷!"" are related by equation (2).
Thus, if two of these parameters are known, the third can be calculated. The
average decay length λ was determined above (Figure 4.10B). In order to
calculate the degradation rate 𝑘, I used the method that was used to analyze the
kinetics of the Dpp gradient of the Drosophila wing imaginal disc (Kicheva et al.
2007; Zhou et al. 2012). The curve generated by measuring the increase in GFP
fluorescence intensity over time at λ in mesoderm-BCR explant combinations
(Figure 4.13E) is analogous to recovery curves generated by FRAP experiments.
In most of the systems where this technique is used, the molecules of interest
have already spread through the area to be analyzed. Therefore, in order to
derive transport rate information about the molecules of interest, an area of pre-
defined size must be photobleached in order to generate a recovery curve. The
degradation rate can then be determined by fitting the experimentally generated
recovery curve to a theoretical recovery curve generated by a mathematical
model of the experimental situation. The mesoderm-BCR explant system that I
have used provides the unique opportunity to observe a molecular gradient as it
forms. The formation of the gradient in mesoderm tissue will occur with the same
236
kinetics as if the molecules were moving into a photobleached area of
mesoderm. Thus, the method used to derive the degradation rate 𝑘 from FRAP
experiments can be adapted to determine this parameter for sf-PDGF-A-eGFP
from explant experiments without the need for photobleaching. The calculations
and the method used to determine the degradation rate 𝑘 and the effective
diffusion coefficient 𝐷!"" of sf-PDGF-A-eGFP are described in detail in Section
4.5.
The formation of the sf-PDGF-A-eGFP gradient can be modelled as one-
dimensional non-directional transport of molecules with uniform linear
degradation. This is represented by the de-dimensionalized time dependent
solution of the model represented by equation (A1) in Section 4.5:
(4)
𝐶(𝑋, 𝜏) =12𝐶!𝑒
!! 2− Erfc −𝑋 − 2𝜏2 𝜏
− 𝑒!!Erfc𝑋 + 2𝜏2 𝜏
where 𝐶(𝑋, 𝜏) is the concentration of sf-PDGF-A-eGFP at the relative
dimensionless position 𝑋 = !! for the corresponding dimensionless time 𝜏 = 𝑘𝑡.
With 𝐶! = !!!
and at 𝑥 = 𝜆 i.e. 𝑋 = 1, equation (4) can be further simplified to (see
Section 4.5 for the full explanation of the simplification):
(5)
𝐶′ =12𝑒 1− 𝑒! + Erf
1− 2𝜏2 𝜏
+ 𝑒!Erf1+ 2𝜏2 𝜏
237
In order to calculate 𝑘, a theoretical fluorescence “recovery” curve was generated
by plotting the theoretical 𝐶!!! (𝜏) values over the corresponding τ values. 𝐶!!! (𝜏)
was calculated from equation (5) for τ ranging from 0.1 to 10 (see Table A1). The
theoretical recovery curve is shown in Figure A1A, Section 4.5.
The experimental recovery curve (see Figure 4.13E) is fitted to the theoretical
curve by determining the experimental τ, 𝜏!! , that corresponds to the
experimental 𝐶!!!(𝜏) , the values of which were determined by dividing the
average fluorescence intensity at λ at times between 30 and 80 minutes after
mesoderm-BCR explant assembly by 𝐶! (see Table A4, Section 4.5). The
corresponding values for 𝜏!! were determined from the theoretical recovery curve
and are presented in Table A4. The relationship between 𝜏!!, time 𝑡 (s-1) and the
degradation constant 𝑘 (s-1) is by definition:
𝜏 = 𝑘𝑡
Thus, in order to determine a value for the degradation constant 𝑘, the 𝜏!! values
were plotted over the corresponding values for 𝑡 (see Table A4). The resulting
curve (Figure A1B) correlated well with a linear function (R2 = 0.97). The
degradation constant 𝑘 was determined by calculating the slope of this curve:
𝑘 = 1.07×10!! s-1
Since the degradation constant 𝑘 is related to the diffusion coefficient 𝐷 through
equation (2) and the average decay length λ = 80 µm, the effective diffusion
coefficient 𝐷!"" for sf-PDGF-A-eGFP can be calculated as:
238
𝐷!"" = (80!) 1.07×10!! = 6.8 µm2s-1
Dpp in the Drosophila wing imaginal disc and Fgf8 in the Zebrafish gastrula have
diffusion coefficients of 21 µm2s-1 and 53 µm2s-1 respectively (Zhou et al. 2012;
Yu et al. 2009). Both of these gradients are formed by free diffusion of molecules
through extracellular spaces. Thus, since the effective diffusion coefficient 𝐷!"" of
sf-PDGF-A-eGFP is on the same order of magnitude as the diffusion coefficients
of Dpp and Fgf8, the sf-PDGF-A gradient may form by a similar extracellular
diffusion mechanism (see section 4.3.3 of the Discussion).
4.3: Discussion In this chapter, I show that sf-PDGF-A is found in intercellular spaces in the
ectoderm and mesoderm and forms a concentration gradient in mesoderm.
Furthermore, I have determined the decay length λ, degradation rate and the
effective diffusion coefficient for the gradient and these parameters are consistent
with formation of the sf-PDGF-A gradient by diffusion of molecules through
intercellular spaces. Interestingly the gradient forms over a range that coincides
with the number of cell rows that migrate directionally toward the BCR in vitro. I
have also confirmed that PDGF-A isoforms containing the C-terminal cell
retention motif do not form a gradient in mesoderm tissue but rather, remain
associated with the ectoderm cell surface and do not cross the
mesoderm/ectoderm boundary.
239
4.3.1: The cell retention motif determines whether a PDGF-A isoform can form a concentration gradient
In Xenopus, PDGF-A exists as three isoforms. These isoforms differ in their C-
termini where the long and intermediate sized isoforms contain a stretch of
positively charged amino acids known to retain PDGF molecules at the cell
surface (Raines and Ross, 1992; Kelly et al. 1993; Andersson et al, 1994). The
short isoform is lacking this domain. I have shown here that sf-PDGF-A can form
a concentration gradient in mesoderm tissues and thus can act as a long range
signalling molecule. Previously, I had shown that sf-PDGF-A plays an instructive
role in regulating the directional migration and radial intercalation of PCM cells
during gastrulation (see Chapter Three). Therefore, sf-PDGF-A apparently
regulates this process by providing directional information through a
concentration gradient that extends from the BCR source through several
mesoderm cell layers. In contrast, neither int-PDGF-A nor lf-PDGF-A have been
found to regulate PCM cell radial intercalation (see Chapter Three).
The leading edge mesendoderm migrates toward the animal pole of the embryo
during gastrulation, directed by short range contact based PDGF-A signalling
(Winklbauer and Nagel, 1991; Nagel et al. 2004). In this case, lf-PDGF-A is
thought to instructively regulate this process and a gradient of matrix associated
PDGF-A on the BCR has been suggested because LEM explants continue to
migrate directionally in vitro on extracellular matrix transferred from the inner
240
BCR (Winklbauer and Nagel, 1991; Nagel and Winklbauer, 1999; Nagel et al.
2004). Here, I have shown directly for the first time, that PDGF-A isoforms
containing the C-terminal retention motif (int-PDGF-A-eGFP) remain associated
with and are restricted to the BCR/mesoderm interface. Thus, PDGF-A isoforms
that contain the C-terminal retention motif are not capable of long range
signalling but may require direct contact between the BCR and the adjacent
migrating cells to initiate signalling. Although a cell-associated gradient of int-
PDGF-A-eGFP increasing in a vegetal to animal direction cannot be seen on the
BCR because of uniform over-expression of int-PDGF-A-eGFP mRNA in
ectoderm cells, the accumulation of int-PDGF-A at the mesoderm-ectoderm
boundary is consistent with a role in regulating LEM directional migration.
4.3.2: The sf-PDGF-A gradient likely forms by diffusion of molecules through intercellular spaces Several models have been proposed to explain the formation of concentration
gradients in tissues. The presence of sf-PDGF-A-eGFP in intercellular spaces
indicates that PDGF-A molecules travel through these spaces when forming the
gradient. This makes sense since the gaps between cells are the largest spaces
for molecules to move into without obstruction. In contrast, no GFP signal was
found intracellularly (Figure 4.7A-D). This is unlike Dpp in the Drosophila wing
imaginal disc or Fgf8 in the zebrafish embryo where in both cases, vesicles
containing labelled molecules were found intracellularly (Kitcheva et al. 2007; Yu
et al. 2009; Zhou et al. 2012). The lack of intracellular GFP signal argues against
241
the idea that the cells themselves traffic PDGF-A. Thus a transcytosis
mechanism, which relies on the endocytosis of molecules and subsequent
secretion of those molecules in order for the signal to be passed on to the next
row of cells, is not likely being employed here.
Another potential mechanism involves the “handing” of molecules from a receptor
on one cell to a receptor on an adjacent cell. This is an active transport
mechanism that has been modelled to describe the formation of TGF-β family
ligand gradients (Kerszberg and Wolpert, 1998). It is unlikely that this “bucket-
brigade” mechanism plays a role in PDGF-A gradient formation because, as it is
modelled, the mechanism depends on two different receptors with low and high
affinities for the ligand molecule (Kerszberg and Wolpert, 1998). PDGF-A binds
strongly to PDGFR-α homodimers and PDGFR-α is the only known receptor to
bind PDGF-A (Andrae et al. 2008). Futhermore, the “bucket brigade” mechanism
depends on continuous receptor binding and therefore ligand molecules would be
strongly associated with cell membranes. In mesoderm explants, GFP signal
does not outline cells, showing that sf-PDGF-A-eGFP is not heavily localized with
the cell membranes. Thus, although binding of sf-PDGF-A to PDGFRα must be
occurring to activate the downstream signalling pathways that regulate directional
cell migration, it is unlikely that there is enough ligand/receptor binding occurring
to spread the amount of sf-PDGF-A-eGFP seen in the mesoderm intercellular
spaces.
242
It was previously hypothesized that diffusion of molecules through cells can occur
quickly enough to form concentration gradients over distances of approximately
one millimetre (Crick, 1970). Recent studies have implicated the free diffusion of
protein molecules through intercellular spaces as a mechanism for the formation
of gradients of Dpp in the Drosophila wing imaginal disc and Fgf8 in the
Zebrafish embryo (Zhou et al. 2012, Yu et al. 2009). Transport of GFP molecules
in water and in the extracellular space of zebrafish gastrulae occurs by free
diffusion and the effective diffusion coefficients determined for these processes
using FCS analysis are 95 µm2s-1 and 87 µm2s-1 respectively (Petrasek et al.
2008, Yu et al. 2009). Dpp and Fgf8 gradients are also thought to form by free
diffusion because the effective diffusion coefficients as measured by FCS (21
µm2s-1 and 53 µm2s-1 respectively) of these two molecules fall into the same
order of magnitude as the diffusion coefficient of freely diffusing GFP molecules.
Furthermore, the effective diffusion coefficients of these molecules reveal that
transport occurs too rapidly to involve the endocytosis and re-secretion
processes involved in a transcytosis mechanism (Zhou et al. 2012; Yu et al.
2009). Interestingly, in both of the above cases, FCS recorded a subset of Dpp
and Fgf8 molecules with significantly lower effective diffusion coefficients. This
likely reflects reversible and non-reversible interactions between Dpp or Fgf8
molecules and receptors or extracellular matrix molecules (Zhou et al. 2012 and
Yu et al. 2009). Indeed, it was shown that reducing the amount of HSPGs in
extracellular spaces reduced the percentage of Fgf8 molecules with the lower
243
effective diffusion coefficient (Yu et al. 2009). However, since the large majority
of molecules exhibit the higher transport rate (>60% for Dpp and >90% for Fgf8;
Zhou et al. 2012, Yu et al. 2009), gradient formation is dominated by the rapidly
diffusing molecules.
FCS analyzes transport of molecules over relatively small length scales (500
nm3) and time scales (milliseconds), thus the transport rate information derived
from these experiments approximates the transport rate of individual molecules
well, since interactions between the molecule being transported and other factors
are more limited in the smaller volume than over longer length scales (Kicheva et
al. 2012). Tissue level analysis techniques, such as FRAP, however operate over
much larger length (tens to hundreds of micrometres) and time scales (minutes to
hours) and thus reversible and non-reversible binding events between the
transported molecule and other factors and extracellular degradation will be
reflected in kinetic information from these experiments (Kicheva et al. 2012).
Thus, effective diffusion coefficients derived from these experiments can reflect
the overall kinetics of gradient formation, rather than the transport of individual
molecules. The effective diffusion coefficient for the sf-PDGF-A-eGFP gradient (7
µm2s-1) was determined using a tissue level technique. I propose that sf-PDGF-A
is likely transported through mesoderm extracellular spaces by diffusion based
on the following evidence: The effective diffusion coefficient of sf-PDGF-A-eGFP
is on the same order of magnitude as that for both Dpp and Fgf8. This effective
244
diffusion coefficient is 70X faster than rates expected for a mechanism involving
endocytosis, such as trancytosis (Kicheva et al. 2009). The exclusive localization
of sf-PDGF-A-eGFP in extracellular spaces also argues against the involvement
of mesoderm cells in the trafficking of sf-PDGF-A. Furthermore, if a “bucket
brigade” type mechanism were involved here, the diffusion coefficient would be
expected to reflect the rate of lateral movement of PDGF receptors in the cell
membrane. These rates have not been determined for PDGF receptors, however
the rates for the smaller sized FGF receptors are known (𝐷 = 0.51 µm2s1 for
zebrafish Fgfr1; Ries et al. 2009). It can be expected that the diffusion coefficient
for PDGFRα in membranes would be similar or smaller. The diffusion coefficient
for the lateral mobility of a receptor tyrosine kinase in a cell membrane is at least
14X slower than the effective diffusion coefficient determined for sf-PDGF-A-
eGFP. Thus, it is likely that the sf-PDGF-A gradient forms by extracellular
diffusion. This question will be further addressed in the future by conducting an
FCS analysis using sf-PDGF-A-eGFP.
4.3.3: Potential factors influencing the effective diffusion coefficient
The effective diffusion coefficient of sf-PDGF-A-eGFP is significantly lower than
the diffusion coefficient of GFP diffusing in water (compare 7 µm2s-1 to 95 µm2s1)
(Petrasek and Schwille, 2008), therefore if sf-PDGF-A-eGFP is moving through
extracellular spaces by diffusion, free movement of the molecules is being
245
hindered. Movement of molecules through the extracellular space can be
influenced by several factors, including the size of PDGF-A dimers, reversible
and non-reversible binding to cell surface receptors, extracellular matrix
molecules or binding proteins, and extracellular degradation. The potential effects
of these factors on the effective diffusion coefficient of sf-PDGF-A-eGFP will be
discussed below.
Diffusion coefficients are inversely proportional to the radius of the molecules
being transported (Crick, 1970). This is assuming that the diffusing molecules
form a sphere or behave as if they are spherical. Thus, large aggregates of sf-
PDGF-A-eGFP would affect the effective diffusion coefficient. For example, a
1000 fold increase in the molecular weight of sf-PDGF-A-eGFP because of
aggregation would result in a 10 fold decrease in the effective diffusion
coefficient. It is not known how many sf-PDGF-A molecules could be found in a
putative aggregate, however the formation of very large aggregates could
dramatically reduce the diffusion coefficient compared with that of non-
aggregated sf-PDGF-A dimers. It is possible that aggregation could be an
artefact caused by tagging of sf-PDGF-A with a GFP molecule, however I
consider this possibility to be unlikely. There is no indication in the FCS
determined kinetic parameters of either Dpp or Fgf8 that fusing these molecules
to GFP resulted in aggregation (Zhou et al. 2012; Yu et al. 2009). However, the
246
endogenous formation of aggregates could be a biological mechanism used to
reduce the reach of PDGF-A gradient.
Alternatively, the structure of the extracellular matrix within intercellular gaps
could also explain the effective diffusion coefficient 𝐷!"" and the sub-localization
of sf-PDGF-A-eGFP in these gaps. The spaces between cells in the Xenopus
gastrula are known to be filled with an extracellular matrix that is composed of
proteoglycans (Johnson, 1977ab). Sf-PDGF-A molecules may need to navigate
through pores or channels between extracellular matrix macromolecule
structures as they diffuse through the extracellular spaces. This idea is supported
by the presence of sf-PDGF-A-eGFP containing structures within mesoderm
extracellular gaps (see Figure 4.8). The diffusion of molecules through narrower
irregularly shaped channels rather than straight through a wide extracellular gap
will result in an increase in diffusion path length and a reduction of the effective
diffusion coefficient compared with a non-porous medium like water. Tortuosity
(𝑇) is the increase in the diffusion path length due to geometry that results in a
1𝑇! fold decrease in the diffusion coefficient (Rusakov and Kullman, 1998).
Thus, tortuosity is related to the diffusion coefficient by the expression 𝐷!"" =
𝐷!"##(𝑇!!), where 𝐷!"" is the effective diffusion coefficient of molecules in the
extracellular space, 𝐷!"## is the diffusion coefficient in a non-porous medium like
water and 𝑇 is the tortuosity. The tortuosity factor of mesoderm extracellular gaps
is not known, however this factor has been determined for brain tissue based on
247
experimental evidence and is approximately equal to 2.2 (Rusakov and Kullman,
1998). If this factor were applicable in mesoderm extracellular gaps, the effective
diffusion coefficient could be reduced by as much as 5 fold due to tortuosity.
Tortuosity factors may explain why FCS measurements typically result in higher
diffusion coefficients than tissue level analyses such as FRAP. Since FCS
measurements are made over very small length scales, the effect of interactions
between the diffusing molecules and extracellular macromolecules may not be
measured, resulting in an effective diffusion coefficient 𝐷!"" that can be closer to
the diffusion coefficient 𝐷 of the molecule in water. Hypothetically, if tortuosity
reduces the effective diffusion coefficient for sf-PDGF-A-eGFP 5 fold, reducing or
eliminating the tortuosity factor could result in an effective diffusion coefficient
that is as high as 𝐷 = 35 µm2s-1. This would place the sf-PDGF-A-eGFP diffusion
coefficient between the FCS determined diffusion coefficients of Dpp and Fgf8
(Zhou et al. 2012; Yu et al. 2009). Thus, tortuosity could be a major factor
influencing the effective diffusion coefficient determined from the FRAP-like
analysis carried out above.
Free diffusion may be a primary mechanism of growth factor spreading, however
these molecules are also subject to binding interactions with extracellular matrix
components and cell surface receptors as gradients form (Yan and Lin, 2009).
Similar to tortuosity, these interactions affect the rate of gradient formation by
modulating the effective diffusion coefficient of the molecule (Rusakov and
248
Kullman, 1998). PDGF-A molecules are known interactants of heparin sulphate
proteoglycans (HSPGs) (Andersson et al. 1994, Smith et al. 2009). Specifically,
the longer isoforms (lf-PDGF-A and int-PDGF-A in Xenopus) that contain the C-
terminal cell retention motif may be anchored to cells through interactions with
HSPGs (Andersson et al. 1994; Smith et al. 2009). The effect of HSPG
interactions on the movement of sf-PDGF-A is unknown, however the effective
diffusion coefficient of diffusible molecules such as Fgf8 can be modulated by
interactions with HSPGs (Yu et al. 2009). Therefore, in addition to aggregation
and tortuosity, HSPGs can reduce the overall rate of gradient formation by
modulating the effective diffusion coefficient of molecules.
4.3.4: The regulation of molecule degradation during gradient formation
In order for a gradient to reach a steady state, the signalling molecules forming
the gradient must be subjected to degradation. Without degradation of molecules
over the path of signal spreading, molecules would continue to spread from the
source through the tissue until it becomes saturated, provided that the rate of
production at the source remains constant. This is observed when a secreted
GFP molecule, which lacks a sink, diffuses through tissues (Entchev et al. 2000).
Thus, having a sink for signalling molecules is important for the formation of a
stable gradient. Dynamin dependent receptor mediated endocytosis is a
commonly described sink and has been shown to play an important role in the
249
formation of several signalling gradients such as Fgf, Dpp, SDF-1α (Zhou et al.
2012; Yu et al. 2009; Kicheva et al. 2007; Piddini et al. 2005; Boldajipour et al.
2008). Modulation of Dynamin activities in mutants or by using soluble inhibitors
and dominant negative constructs were shown to change the kinetics of the
gradient, including increases in the decay length λ (Kitcheva et al. 2007;
Boldajipour et al 2008; Yu et al. 2009). This shows that in those cases, receptor
mediated endocytosis plays a role in the degradation of the signal and has an
essential role in shaping the gradient. Interestingly, an orphan non-signalling
chemokine receptor was identified as a sink-generating molecule for SDF-
1α signalling in zebrafish primordial germ cell migration (Boldajipour et al. 2008).
Rather than CXCR4, the signalling receptor for SDF-1α undergoing ligand
induced endocytosis CXCR7, binds to SDF-1α and undergoes receptor mediated
endocytosis (Boldajipour et al. 2008). Thus, non-signalling receptors can bind to
ligands to facilitate degradation.
It is known that PDGF-A ligand binding to PDGFR-α can trigger internalization of
the ligand-receptor complex (Avrov et al. 2003; Kawada et al. 2009). This
receptor mediated endocytosis process is important for the regulation of
directional migration of some cell types (Kawada et al. 2009). Surprisingly,
although vesicles containing labelled molecules have been seen in Xenopus cells
previously (Hagemann et al. 2009), there were no visible sf-PDGF-A-eGFP in the
cells of mesoderm explants (Figure 4.7A-D). Thus, directional migration of
250
mesoderm may not require internalization of the receptor-ligand complex for
signalling. The lack of intracellular GFP signal argues against the possibility that
a receptor other than PDGFR-α is involved in internalizing sf-PDGF-A for
degradation. However, a role for endocytosis in shaping the sf-PDGF-A-eGFP
gradient cannot be excluded and will be tested for by using cell-permeable
Dynamin inhibitors or dominant negative Dynamin constructs in the future. Thus,
the lack of intracellular sf-PDGF-A-eGFP suggests that degradation of the ligand
for the purpose of forming the concentration gradient may depend on an
alternative mechanism, such as degradation by extracellular proteases or ligand
sequestration by inhibiting molecules.
The degradation of sf-PDGF-A by proteases found in the intercellular gaps could
function as a sink and would be important in shaping the gradient. Some growth
factors are known to be degraded in the extracellular space, however it is
unknown if extracellular proteases interact with PDGF-A. Metalloproteinases are
metal ion dependent enzymes found in the extracellular spaces with known
functions in extracellular matrix remodelling, ectodomain shedding and cleavage
of growth factor molecules (Edwards et al. 2008). In particular, A Disintegrin and
Metalloproteanase (ADAMs) family members are known for their role in cleaving
growth factors, including several that interact with receptor tyrosine kinases such
as, ephrins, epidermal growth factor (EGF) and insulin-like growth factor (IGF)
(White et al. 2003; Edwards et al. 2008; Weber et al. 2012). In most cases, the
251
ADAMs play an important role in activating the growth factors by removing them
from the surface of the secreting cell and allowing them to become soluble
(Prenzel et al. 1999; Loechel et al. 2000; White et al. 2003). Many ADAM family
members are transmembrane proteins. However, some members of the ADAM
family are soluble proteins suggesting that they may act at a distance from their
source (Edwards et al. 2008). Homologues for the transmembrane ADAMS;
ADAM13, ADAM19 and ADAM 41 have been identified in Xenopus (Neuner et al.
2009; Wei et al. 2010; Xu et al. 2012; Cousin et al. 2012). However, none of the
soluble ADAMs have been identified. Given the known interactions of ADAMs
with growth factors, it is possible that sf-PDGF-A interacts with a soluble ADAM
family member and is inactivated or degraded. It is also possible that soluble or
transmembrane proteases cleave the ectodomain of PDGFRα after binding of
PDGF-A in order to modulate signalling and degradation, similar to ectodomain
shedding. However, proteases would be expected to cleave specific recognition
sites in the PDGF molecule and may not cleave the GFP molecules that are used
experimentally to make the gradient visible. Thus, proteolytic degradation would
potentially release the fused GFP molecules. The released GFP would be
expected to behave like a secreted GFP molecule and diffuse through the tissue.
Thus, a gradient would not be visible. Since a gradient is observed, if
extracaellular degradation is involved in shaping the sf-PDGF-A-eGFP gradient, it
is not clear how the GFP molecule is being removed.
252
BMPs are members of the TGFβ superfamily of signalling moleculed and are well
known for their involvement in determining ventral cell fates during the dorsal-
ventral patterning of vertebrate embryos (Suzuki et al. 1994; Furthauer et al.
1997; Khoka et al. 2005; Dosch et al. 1997; Stickney et al. 2007). It is
hypothesized that BMPs form a ventral to dorsal morphogen gradient, which is
antagonized by factors such as the soluble protein, Chordin, produced by cells on
the dorsal side of the embryo (Blitz et al. 2000; Hama and Weinstein, 2001;
Piccolo et al. 1996; Umulis et al. 2009). In this case, BMP inhibiting molecules
like Chordin help to shape the BMP gradient by binding to BMP morphogen
molecules and preventing their interaction with cell surface receptors or causing
their degradation, thus functioning as a sink (Umulis et al. 2009). An example of
an inhibitor molecule for PDGF-B is alpha-2-macroglobin (α2M) (Bonner, 2004;
Bonner, 1994). When PDGF-B interacts with an active form α2M, it ends up being
degraded though the LRP receptor (Bonner, 2004). Although, extracellular
inhibitors have not been identified for PDGF-A, it is possible that this type of
molecule could bind to PDGF-A molecules in the intercellular spaces and
inactivate them or prevent receptor binding. In this way, these inhibitors could
shape the gradient as a sink. However, proteolytic degradation after interaction
between PDGF-A and extracellular inhibitors could involve endocytosis, as in the
PDGF-B/α2M example or extracellular degradation and evidence of these
processes here is lacking. Thus the removal of sf-PDGF-A from our system is not
understood. Analysing the shape of the sf-PDGF-A gradient after disrupting
253
endocytosis or the function of extracellular proteases may reveal roles for these
molecules. Additionally, a potential role for the adjacent pharyngeal endoderm
cells in the degradation of sf-PDGF-A will be investigated in the future.
4.4: Materials and Methods 4.4.1: Embryos and Microinjections See Chapter Two, section 2.4.1.
4.4.2: eGFP and Myc tagged constructs The method used to generate eGFP fusion constructs was adapted from
Marjoram and Wright, 2011: PCR was used to add AscI sites to the 5’ and 3’
ends of the eGFP taken from a membrane bound eGFP construct (gift from C.
Heisenberg); primers: FWD 5’-GGCGCGCCGGGGGGGGTGAGCAAGGGC-3’; REV 5’-
GGCGCGCCCCCCTTGTACAGCTC-3’. PCR was also used to add an AscI site and
additional sequence encoding glycine residues upstream of the pro-peptide
cleavage site to lf-PDGF-A (pGHE2), sf-PDGFA (pCS2+) (gifts from K. Symes)
and int-PDGF-A (pCS2+), PCR primers: FWD 5’- GGCGCGCCGCAGTGCCAGCC-3’;
REV 5’-GGCGCGCCCTCCTCAATGCT-3’. The primers used to amplify AscI
containing PDGF-A constructs also added EcoRI and BamHI restriction sites to
the 5’ and 3’ ends of the PDGF-A construct respectively, primers: FWD 5’-
TTGGGAGATTTGTCTGTAGAAAGG-3’ and REV 5’-TGATATCTGATGCCCTCCTCTG-3’.
AscI containing PDGF-A constructs were cloned into pGEM-EasyT using the
254
pGEM-T Easy TA cloning kit (Promega). AscI-PDGF-A constructs and the AscI-
eGFP PCR product were digested with AscI (NEB). The digested eGFP molecule
was ligated into the digested PDGF-A constructs using a Quick Ligation Kit
(NEB). Ligated constructs were double digested with EcoRI/BamHI and the free
insert was ligated into pCS2+ using the Quick Ligation Kit (NEB).
lf-PDGF-A-myc and sf-PDGF-A-myc constructs were generated by PCR in a two
reaction process in which two Myc tags (2X Myc) were added downstream of the
pro-peptide cleavage site. lf-PDGF-A (pGHE2) and sfPDGFA (pCS2+) plasmids
were used as templates for the initial PCR reaction. Two species were generated
in separate reactions, one containing the 5’ half and added 2X Myc sequence
and one containing the complementary 3’ half and added 2X Myc sequence of
the PDGF-A constructs, PCR Primers:
FWD 5’-GAACAAAAACTTATTTCTGAAGAAGATCTGGAACAAAAACTTATTTCTGAAGA
AGATCTGGTTGAAGAAGCAGTCCCTGCTATC-3’,
REV 5’-CAGATCTTCTTCAGAAATAAGTTTTTGTTCCAGATCTTCTTCAGAAAT
AAGTTTTTGTTCACTTCTTTTTCTGCGACTGGG-3’
5’ and 3’ end primers were also added to amplify the two Myc containing halves
of the PDGF-A constructs, PCR Primers for the 5’ half FWD 5’-
GGATCCCCGTTACTGACTCC-3’, REV 5’-ATCTTCAGAAATAAGTTTTGTT-3’ and for
the 3’ half FWD 5’-GAACAAAACTTATTTCTGAAGAT-3’, REV 5’-
ATCCGAGTCCCAGATGATCC-3’. For the second reaction the species generated in
255
the first reaction were combined with 5’ and 3’ end primers for the PDGF-A
reaction (see above, the primers used were identical to the primers used to
amplify the AscI containing PDGF-A constructs). The 2X Myc sequence of the 5’
and 3’ species from reaction one are complimentary, thus the PCR reaction
produces a complete PDGF-A molecule containing the 2X Myc sequence. The 5’
and 3’ end primers then amplify the full sized PDGF-A molecule. This reaction
generates unwanted products, therefore these were separated from the full
length PDGF-A molecules using gel electrophoresis and the full length molecules
were purified using a Gel Purification kit (Qiagen). Full length PDGF-A molecules
were cloned into pCS2+ using the Quick Ligation kit (NEB).
4.4.3: mRNA Synthesis See Chapter 3, Section 3.4.5.
4.4.4: Explants For mesoderm-ectoderm combined explants, PCM explants from uninjected
embryos were combined with inner layer BCR explants expressing
600pg/embryo of mbRFP in addition to one of the following: 1.6ng/embryo or
4ng/embryo of sf-PDGF-A-eGFP or int-PDGF-A-eGFP or 1.6ng/embryo of lf-
PDGF-A-myc depending on the experiment. Combined explants were secured
under a strip of coverslip, with the mesoderm side that was originally in contact
with the BCR facing down, and the BCR explant positioned opposite to what
would have been the anterior side of the mesoderm in vivo (Figure 4.1). Explants
256
were cultured in 1X MBS on 1% BSA treated glass bottom dishes during filming
(Mak Tek).
4.4.5. Scanning Electron Microscopy See Chapter 2, Section 2.4.3.
4.4.6: Transmission Electron Microscopy See Chapter 2, Section 2.4.4.
4.4.7: Antibody Staining Embryos expressing membrane bound RFP and lf-PDGF-A-myc constructs were
fixed in 4% formaldehyde for one hour after which animal caps were dissected.
Animal caps were washed in 1X PBS three times for 10 minutes each before
blocking with 1% BSA solution for 1 hour. A 1:10 concentration of c-myc antibody
(9E10 from Hybridoma bank) was diluted in 1% BSA solution and applied to the
animal caps for 1 hour. Animal caps were subsequently washed with 1X PBS five
times for 10 minutes each. A FITC conjugated goat anti-mouse secondary
antibody was applied for 1 hour at a concentration of 1:100 diluted in 1% BSA
solution. Subsequently animal caps were washed with 1X PBS five times for 10
minutes each. Animal caps were secured under a coverslip in SlowFade Gold
solution (Invitrogen) before being imaged with the confocal microscope.
4.4.8: Confocal Microscopy Confocal images and Z-stacks of explants were obtained using a Zeiss LSM510
laser scanning confocal system. The following settings were kept constant for all
257
experiments involving the eGFP tagged constructs. eGFP was visualized by
excitation with a 488nm argon laser at 25% output, 30% excitation setting,
pinhole size: 701µm, detector gain: 956, Amplitude offset: -0.66, Amplitude gain:
-1. mbRFP was visualized by excitation with a 543nm helium/neon laser at the
100% excitation setting. The following confocal settings were used, pinhole size:
701µm, detector gain: 940, amplitude offset: -1.22, amplitude gain: 1. Images
were taken at a resolution of 512x512 unless otherwise stated with a scan speed
of 7.8 seconds, a 4.48µs pixel time and a line averaging of 4. All z-stacks were
made up of 8 optical sections with a stack thickness of approximately 20 µm.
The microscope system was controlled by Zeiss LSM5 software.
4.4.9: Image Processing ImageJ was used to process z-stack optical sections into maximum projection
images using the built in z-project function.
258
4.5: Appendix The formation of the sf-PDGF-A-eGFP gradient can be modeled as a process in
which transport of sf-PDGF-A occurs in a non-directional fashion with linear
degradation along the length of the gradient. The formation of the sf-PDGF-A
gradient in mesoderm-BCR explants can be modeled in one dimension; the
transport of molecules from a localized source (BCR explant) over a large
distance (approx. 200 µm) into the receiving tissue (mesoderm tissue). ImageJ
software was used to generate maximum projection images of the 8 optical
sections of mesoderm-ectoderm explant z-stacks, allowing explants to be treated
as a two-dimensional plane. Furthermore, because the only source of influx of
molecules into the mesoderm is the BCR explant and there is no influx of
molecules from the lateral sides, the formation of the gradient can be modeled in
one dimension. This type of simplification was used to model the formation of the
Dpp gradient in the Drosophila wing imaginal disc (Kicheva et al. 2009; Zhou et
al. 2012). The model used to describe this Dpp gradient was:
(A1, after Zhou et al. 2012)
𝛿𝛿𝑡 𝑐(𝑥, 𝑡) = 𝐷
𝛿!
𝛿𝑥! 𝑐(𝑥, 𝑡)− 𝑘𝑐(𝑥, 𝑡)
where 𝐷 (µm2s-1) is the diffusion coefficient and 𝑘 (s-1) is the degradation rate.
Both of these parameters are constants. The steady state solution for equation
A1 is:
259
(A2, after Kicheva et al. 2007 and Zhou et al. 2012)
𝐶 𝑥 = 𝐶!𝑒!!!
where 𝐶 𝑥 is the concentration of molecules at distance 𝑥 (µm) from the source
boundary, 𝐶! is the concentration of molecules at the source boundary and λ
(µm) is the decay length, the distance from the source where the concentration of
the molecule has decayed to a factor of 1 𝑒 of the concentration at the source 𝐶!.
Equation (A1) makes predictions about the rate of movement and degradation of
molecules during the formation of a gradient. FRAP analysis can approximate the
rate of degradation and the diffusion coefficient for these molecules by comparing
experimentally derived rate data to the predicted rate data according to equation
(A1). The mesoderm-BCR explant system provides for the unique ability to
observe a gradient as it forms. The influx of fluorescent molecules into a defined
area of the receiving tissue is analogous to the recovery of fluorescent molecules
into an area that was photobleached during a FRAP experiment. Thus, the
methodology used to derive transport rate parameters from FRAP experiments
can be applied to the formation of the sf-PDGF-A gradient in mesoderm-BCR
explants. The sections below describe in detail, the derivation of the degradation
rate and the calculation of the effective diffusion coefficient for the formation of a
sf-PDGF-A-eGFP gradient in mesoderm-BCR explants according to the
methodology used to analyze the kinetics of the Dpp gradient in the Drosophila
wing imaginal disc (Kicheva et al. 2007; Zhou et al. 2012).
260
A1: Generation of a theoretical “recovery” curve:
The simplified de-dimentionalized time dependent solution to (A1) is shown
below:
(A3, after Zhou et al. 2012)
𝑐(𝑋, 𝜏) =12𝐶!𝑒
!! 2− Erfc −𝑋 − 2𝜏2 𝜏
− 𝑒!!Erfc𝑋 + 2𝜏2 𝜏
where dimensionless position 𝑋 = !! and dimensionless time 𝜏 = 𝑘𝑡. Both sides
of equation (A3) are divided by 𝐶! to give the dimensionless concentration 𝐶!.
𝐶! =𝑐(𝑋, 𝜏)𝐶!
=
12𝐶!𝑒
!! 2− Erfc −𝑋 − 2𝜏2 𝜏
− 𝑒!!Erfc 𝑋 + 2𝜏2 𝑡
𝐶!
Since my measurements are made at 𝑥 = 𝜆 = 80, then 𝑋 = 1 and because
Erfc(𝑥) = 1− Erf(𝑥), equation (A3) becomes:
(A4)
𝐶′ =12𝑒 2− 1− Erf −
1− 2𝜏2 𝜏
− 𝑒! 1− Erf1+ 2𝜏2 𝜏
which can be re-organized to:
(A5)
𝐶′ =12𝑒 1− 𝑒! + Erf
1− 2𝜏2 𝜏
+ 𝑒!Erf1+ 2𝜏2 𝜏
𝑓1 𝑓2
261
For τ values ranging between 0 and 10, the 𝑓1 and 𝑓2 error function values were
calculated and are presented in Table A1:
Sample calculation for τ = 0.5:
𝑓2 =1+ 2(0.5)2 0.5
= 1.414
Table A1: The calculated 𝒇1 and 𝒇2 values for the range of t values
τ 𝒇1 𝒇2
0 ∞ ∞
0.1 1.265 1.897
0.2 0.670 1.565
0.4 0.158 1.423
0.5 0 1.414
0.6 -0.129 1.420
1 -0.50 1.50
2 -1.061 1.768
4 -1.751 2.250
6 -2.245 2.654
8 -2.652 3.01
10 -3.00 3.320
262
𝑓1 and 𝑓2 values from Table A4.1 were used to calculate the error function
approximations using the following equation (Abramowitz and Stegun, 1964):
Erf 𝑓 ≈ 1− 1
1+ 𝑎!𝑓 + 𝑎!𝑓! + 𝑎!𝑓! + 𝑎!𝑓! !
where 𝑎! = 0.2784,𝑎! = 0.2304,𝑎! = 0.00097,𝑎! = 0.0781
Table A2 lists the error function approximations Erf 𝑓1 and Erf 𝑓2 for each
value of τ.
Table A2: Error function approximation values for 𝒇1 and 𝒇2 for the indicated value of t
τ 𝐄𝐫𝐟(𝒇1) 𝐄𝐫𝐟(𝒇2)
0 1 1
0.1 0.926 0.992
0.2 0.656 0.973
0.4 0.176 0.956
0.5 0 0.954
0.6 0.144 0.955
1 0.520 0.966
2 0.866 0.987
4 0.986 0.998
6 0.998 0.999
8 0.999 0.999
10 0.999 0.999
263
Theoretical recovery curves are plotted as the ratio !(!,!)!!
= 𝐶!!! (𝜏) over τ, which is
calculated by substituting Erf(𝑓1) and Erf(𝑓2) values into equation A4.
Sample Calculation: for τ = 10
𝐶!!! (10) =12𝑒 1− 𝑒! + 0.999+ 𝑒!0.999 = 0.368
Table A3 lists 𝐶!!! (𝜏) values for each value of τ and is used to generate the
theoretical fluorescence recovery curve (Figure A1A).
Table A3: Calculated 𝑪𝒕𝒉! 𝝉 values for the indicated value of τ
τ 𝑪𝒕𝒉! (𝝉)
0 0
0.1 0.0029
0.2 0.0268
0.4 0.0919
0.5 0.1123
0.6 0.1503
1 0.2339
2 0.3261
4 0.3628
6 0.3670
8 0.3676
10 0.3678
264
Figure A1: Calculation of the degradation constant for sf-PDGF-A-eGFP
(A) Theoretical recovery curve for sf-PDGF-A-eGFP. (B) Plot of τ over time (𝑡);
the red line is the linear line of best fit; the R2 value indicates that the black curve
closely approximates a linear function.
265
Figure A1: Calculation of the degradation constant for sf-PDGF-A-eGFP
266
A2: Fitting experimental data for sf-PDGF-A-eGFP to theoretical recovery curves: The theoretical recovery curve is shown in Figure A1. In order to determine the
degradation rate 𝑘 for the sf-PDGF-A-eGFP gradient the experimentally derived
data must be fitted to the theoretical curve. Since the experimental
measurements were made at λ, the concentration 𝐶!, should be equal to !!𝐶!
when the gradient reaches a steady state. The experimental recovery curve is
presented in Figure 4.13E. This curve shows that the fluorescence intensity at
λ begins to level off at an average intensity of 73 +/- 1.7 arbitrary intensity units
approximately 70 minutes after the mesoderm and BCR (PDGF-A source)
explants were assembled and filming was started. 𝐶! can be calculated from the
average 𝐶! as follows:
𝐶! = 𝐶!!!
!!, thus 𝐶! = 73 !
!
!!= 198
A 𝐶! value of 198 arbitrary intensity units is in the range of the experimentally
derived average source boundary concentration of 178 +/- 9.8 (see Figure
4.10B).
The experimental data is fitted to the theoretical recovery curve by calculating the
ratio 𝐶!"! (𝜏) =!!!!
and then determining the corresponding value of 𝜏, τex from the
theoretical curve. The time required for fluorescence intensity to increase at
267
position λ after assembly of the mesoderm-BCR explants is explant specific and
varies between 20 and 40 minutes. I have previously observed that the time
required for mesoderm-BCR explants to heal varies from explant to explant,
however generally it takes approximately 30 minutes for mesoderm-BCR
explants to heal after being combined (See Chapter Two; Damm and Winklbauer,
2011). Thus, the time it takes for fluorescence intensity to begin to increase at
λ could be a result of the time required for the mesoderm-BCR interface to form.
For the purposes of calculating the kinetic parameters 𝑘 and 𝐷, the onset of
molecule movement into the area of λ (t = 0 seconds) was taken to be 30
minutes after mesoderm-BCR explants were combined. The theoretical recovery
curve levels off at 𝐶!!! (𝜏) = 0.3679 as the gradient reaches a steady state;
experimentally the gradient levels off at approximately this value after 50
minutes. The 𝐶!"! (𝜏) values determined from experiments and the values for τex,
for the 50 minute period are presented in Table A4.
Table A4: 𝑪𝒆𝒙! 𝝉 and 𝒕 values with the corresponding values 𝝉𝒆𝒙 for experimentally derived 𝑪𝝀.
τex 𝒕 (s) 𝑪𝒆𝒙! (𝝉)
0 0 0
0.45 600 0.1174
0.98 1200 0.2285
1.5 1800 0.2576
2.3 2400 0.3422
268
3.3 3000 0.3560
A3: Determining the degradation rate and the effective diffusion coefficient The relationship between τ and time (t seconds) is:
𝜏 = 𝑘𝑡
where the slope 𝑘 of the function is the degradation constant. The diffusion
coefficient 𝐷 and 𝑘 are related through the equation:
(A7)
𝐷 = 𝜆!𝑘
Thus, if the degradation constant 𝑘 and the decay length 𝜆 are known, the
diffusion coefficient 𝐷 can be calculated. In order to determine 𝑘 for the sf-PDGF-
A-eGFP gradient, τex was plotted over time 𝑡 to produce the linear curve
presented in Figure A1B. Regression analysis showed that the values for τex
over 𝑡 from Table A4 closely approximate a linear function (R2=0.97), as
expected from the relationship between τ and 𝑡. The degradation constant 𝑘 for
the sf-PDGF-A-eGFP gradient is the slope of the linear curve:
𝑘 = 1.07×10!! s-1
Using equation (A7), 𝑘 = 1.07×10!! s-1 and 𝜆 = 80 µm, the effective diffusion
coefficient (𝐷!"") for the sf-PDGF-A-eGFP gradient can be calculated:
𝐷!"" = (80!) 1.07×10!! = 6.8 µm2s-1
269
Chapter Five: Final Model and References
270
5.1: Prechordal mesoderm morphogenesis: the cellular basis and the molecular regulation
My work has lead to an understanding of the morphogenetic movements that
occur in the PCM of gastrulating Xenopus embryos. Based on the results of my
work I propose a model of PCM morphogenesis in the following summary (Figure
5.1): After the start of gastrulation, the PCM consists of multi-layered upper and
lower regions with distinct cell orientations. The upper PCM is internalized during
the early stages of gastrulation and is positioned adjacent to the inner layer of the
overlying BCR. The long axes of these cells are perpendicular with respect to the
BCR and this orientation is BCR dependent. The lower PCM region is located in
the dorsal blastopore lip, adjacent to the XBra expressing CM. At this stage, the
long axes of lower PCM cells are oriented parallel to the adjacent CM region. As
gastrulation proceeds, the lower PCM undergoes involution and becomes
internalized to the level of the BCR, likely as a result of a combination of animally
directed intercellular movements within the lower PCM and vegetally directed
epiboly movements of the BCR. Thus, all PCM cells become oriented with their
long axes perpendicular to the BCR by the middle of gastrulation (Figure 5.1A).
My work has shown that the inner layer cells of the BCR produce three PDGF-A
isoforms, sf-PDGF-A, int-PDGF-A and lf-PDGF-A. The cognate receptor for
PDGF-A, PDGFRα, is expressed in the PCM. Thus, this mutually exclusive
expression pattern suggests that the ectoderm signals to the PCM through
271
PDGF. The int-PDGF-A and lf-PDGF-A isoforms interact with extracellular matrix
molecules and thus remain localized to the vicinity of the secreting cells, with an
accumulation in Brachet’s cleft (Figure 5.1A,B). These isoforms regulate the
animally directed migration of the LEM through a short range contact based
mechanism (Nagel et al. 2004). The sf-PDGF-A isoform participates in long
range signaling. I have shown that sf-PDGF-A appears to form a steady state
extracellular gradient in approximately one hour, by the diffusion of sf-PDGF-A
molecules through PCM intercellular spaces (Figure 5.1A,B; See Chapter Four).
Furthermore, I have shown that in response to the long range sf-PDGF-A signal,
PCM cells orient locomotory protrusions toward the BCR and undergo radial
intercalation as they migrate toward the mesoderm/ectoderm boundary. By late
gastrulation, radial intercalation of the PCM converts a multi-layered region into a
monolayer (Figure 5.1B), resulting in an expansion of the area of PCM that is in
contact with the BCR, while contributing to the extension of the anterior/posterior
axis of the embryo.
272
Figure 5.1: A model for the cellular basis of prechordal mesoderm morphogenesis (A-B) Schematic diagrams of the change in cell organization of the PCM over the
course of gastrulation. (A) By the middle of gastrulation the PCM is multi-layered
and cells extend locomotory protrusions toward the ectoderm; PDGF-A isoforms
are produced and secreted by ectoderm cells; sf-PDGF-A forms a concentration
gradient in the PCM by diffusing through intercellular spaces. This gradient
instructively orients PDGFRa expressing PCM cells toward the ectoderm, lf-
PDGF-A and int-PDGF-A remain associated with the surfaces of the secreting
cells. (B) By late gastrulation, the PCM has undergone radial intercalation to thin
to a single layer of cells in contact with the ectoderm. The black arrow in (A)
indicates the direction of PCM cell movement; green wedges show the direction
of the sf-PDGF-A concentration gradient.
273
Figure 5.1: A model for the cellular basis of prechordal mesoderm morphogenesis
274
5.2: References Abramowitz M,. Stegun, I. A. (1965). Handbook of Mathematic Functions: with
Formulas, Graphs and Mathematical Tables. ISBN: 0486612724
Akiyama, T., Kamimura, K., Firkus, C., Takeo, S., Shimmi, O. and Nakato, H.
(2008). Dally Regulates Dpp Morphogen Gradient Formation by Stabilizing Dpp
on the Cell Surface. Dev. Biol. 313, 408-419.
Andersson, M., Ostman, A., Westermark, B. and Heldin, C. H. (1994).
Characterization of the Retention Motif in the C-Terminal Part of the Long Splice
Form of Platelet-Derived Growth Factor A-Chain. The Journal of Biological
Chemistry 269, 926-930.
Andrae, J., Gallini, R. and Betsholtz, C. (2008). Role of Platelet-Derived Growth
Factors in Physiology and Medicine. Genes & Development 22, 1276-1312.
Asashima, M., Nakano, H., Uchiyama, H., Davids, M., Plessow, S., Loppnow-
Blinde, B., Hoppe, P., Dau, H. and Tiedemann, H. (1990). The Vegetalizing
Factor Belongs to a Family of Mesoderm-Inducing Proteins Related to Erythroid
Differentiation Factor. Naturwissenschaften 77, 389-391.
Ataliotis, P., Symes, K., Chou, M. M., Ho, L. and Mercola, M. (1995). PDGF
Signalling is Required for Gastrulation of Xenopus Laevis. Development 121,
3099-3110.
275
Avrov, K. and Kazlauskas, A. (2003). The Role of c-Src in Platelet-Derived
Growth Factor Alpha Receptor Internalization. Exp. Cell Res. 291, 426-434.
Baeg, G. H., Lin, X., Khare, N., Baumgartner, S. and Perrimon, N. (2001).
Heparan Sulfate Proteoglycans are Critical for the Organization of the
Extracellular Distribution of Wingless. Development 128, 87-94.
Baker, N. E. (2007). Patterning Signals and Proliferation in Drosophila Imaginal
Discs. Current Opinion in Genetics {\&} Development 17, 287-293.
Basler, K. and Struhl, G. (1994). Compartment Boundaries and the Control of
Drosophila Limb Pattern by Hedgehog Protein. Nature 368, 208-214.
Bauer, D. V., Huang, S. and Moody, S. A. (1994). The Cleavage Stage Origin of
Spemann's Organizer: Analysis of the Movements of Blastomere Clones before
and during Gastrulation in Xenopus. Development 120, 1179-1189.
Belenkaya, T. Y., Han, C., Yan, D., Opoka, R. J., Khodoun, M., Liu, H. and Lin, X.
(2004). Drosophila Dpp Morphogen Movement is Independent of Dynamin-
Mediated Endocytosis but Regulated by the Glypican Members of Heparan
Sulfate Proteoglycans. Cell 119, 231-244.
Bergsten, E., Uutela, M., Li, X., Pietras, K., Ostman, A., Heldin, C. H., Alitalo, K.
and Eriksson, U. (2001). PDGF-D is a Specific, Protease-Activated Ligand for the
PDGF Beta-Receptor. Nat. Cell Biol. 3, 512-516.
Bernfield, M., Gotte, M., Park, P. W., Reizes, O., Fitzgerald, M. L., Lincecum, J.
276
and Zako, M. (1999). Functions of Cell Surface Heparan Sulfate Proteoglycans.
Annu. Rev. Biochem. 68, 729-777.
Berridge, M. J. (1993). Cell Signalling. A Tale of Two Messengers. Nature 365,
388-389.
Bertet, C., Sulak, L. and Lecuit, T. (2004). Myosin-Dependent Junction
Remodelling Controls Planar Cell Intercalation and Axis Elongation. Nature 429,
667-671.
Blader, P. and Strahle, U. (1998). Ethanol Impairs Migration of the Prechordal
Plate in the Zebrafish Embryo. Dev. Biol. 201, 185-201.
Blankenship, J. T., Backovic, S. T., Sanny, J. S. P., Weitz, O. and Zallen, J. A.
(2006). Multicellular Rosette Formation Links Planar Cell Polarity to Tissue
Morphogenesis. Developmental Cell 11, 459-470.
Blitz, I. (2000). Is Chordin a Long-Range- Or Short-Range-Acting Factor? Roles
for BMP1-Related Metalloproteases in Chordin and BMP4 Autofeedback Loop
Regulation. Dev. Biol. 223, 120-138.
Boldajipour, B., Mahabaleshwar, H., Kardash, E., Reichmanfried, M., Blaser, H.,
Minina, S., Wilson, D., Xu, Q. and Raz, E. (2008). Control of Chemokine-Guided
Cell Migration by Ligand Sequestration. Cell 132, 463-473.
Bonner, J. C. (1994). Regulation of Platelet-Derived Growth Factor (PDGF) and
Alveolar Macrophage-Derived PDGF by Alpha 2-Macroglobulin. Ann. N. Y. Acad.
277
Sci. 737, 324-338.
Bonner, J. C. (2004). Regulation of PDGF and its Receptors in Fibrotic Diseases.
Cytokine & Growth Factor Reviews 15, 255-273.
Bornfeldt, K. E., Raines, E. W., Graves, L. M., Skinner, M. P., Krebs, E. G. and
Ross, R. (1995). Platelet-Derived Growth Factor. Distinct Signal Transduction
Pathways Associated with Migration Versus Proliferation. Ann. N. Y. Acad. Sci.
766, 416-430.
Bothe, I. and Dietrich, S. (2006). The Molecular Setup of the Avian Head
Mesoderm and its Implication for Craniofacial Myogenesis. Developmental
Dynamics 235, 2845-2860.
Boucaut, J. C., Darribere, T., Boulekbache, H. and Thiery, J. P. (1984a).
Prevention of Gastrulation but Not Neurulation by Antibodies to Fibronectin in
Amphibian Embryos. Nature 307, 364-367.
Boucaut, J. C., Darribere, T., Poole, T. J., Aoyama, H., Yamada, K. M. and
Thiery, J. P. (1984b). Biologically Active Synthetic Peptides as Probes of
Embryonic Development: A Competitive Peptide Inhibitor of Fibronectin Function
Inhibits Gastrulation in Amphibian Embryos and Neural Crest Cell Migration in
Avian Embryos. J. Cell Biol. 99, 1822-1830.
Branford, W. W. and Yost, H. J. (2002). Lefty-Dependent Inhibition of Nodal- and
Wnt-Responsive Organizer Gene Expression is Essential for Normal
278
Gastrulation. Current Biology 12, 2136-2141.
Burgering, B. M. and Coffer, P. J. (1995). Protein Kinase B (c-Akt) in
Phosphatidylinositol-3-OH Kinase Signal Transduction. Nature 376, 599-602.
Chalmers, A. D. and Slack, J. M. (2000). The Xenopus Tadpole Gut: Fate Maps
and Morphogenetic Movements. Development 127, 381-392.
Chan, J., Mably, J. D., Serluca, F. C., Chen, J. N., Goldstein, N. B., Thomas, M.
C., Cleary, J. A., Brennan, C., Fishman, M. C. and Roberts, T. M. (2001).
Morphogenesis of Prechordal Plate and Notochord Requires Intact Eph/ephrin B
Signaling. Dev. Biol. 234, 470-482.
Cho, K. W., Blumberg, B., Steinbeisser, H. and Robertis, E. M. D. (1991).
Molecular Nature of Spemann's Organizer: The Role of the Xenopus Homeobox
Gene Goosecoid. Cell 67, 1111-1120.
Colas, A., Cartry, J., Buisson, I., Umbhauer, M., Smith, J. C. and Riou, J. C.
(2008). Mix.1/2-Dependent Control of FGF Availability during Gastrulation is
Essential for Pronephros Development in Xenopus. Dev. Biol. 320, 351-365.
Cooke, J. (1979). Cell Number in Relation to Primary Pattern Formation in the
Embryo of Xenopus Laevis. II. Sequential Cell Recruitment, and Control of the
Cell Cycle, during Mesoderm Formation. J. Embryol. Exp. Morphol. 53, 269-289.
Cousin, H., Abbruzzese, G., McCusker, C. and Alfandari, D. (2012). ADAM13
Function is Required in the 3 Dimensional Context of the Embryo during Cranial
279
Neural Crest Cell Migration in Xenopus Laevis. Dev. Biol. 368, 335-344.
Crick, F. (1970). Diffusion in Embryogenesis. Nature 225, 420-422.
Dale, L. and Slack, J. M. (1987). Fate Map for the 32-Cell Stage of Xenopus
Laevis. Development 99, 527-551.
Damm, E. W. and Winklbauer, R. (2011). PDGF-A Controls Mesoderm Cell
Orientation and Radial Intercalation during Xenopus Gastrulation. Development
138, 565-575.
Darribere, T., Yamada, K. M., Johnson, K. E. and Boucaut, J. C. (1988). The
140-kDa Fibronectin Receptor Complex is Required for Mesodermal Cell
Adhesion during Gastrulation in the Amphibian Pleurodeles Waltlii. Dev. Biol.
126, 182-194.
Davidson, L. A., Hoffstrom, B. G., Keller, R. and DeSimone, D. W. (2002).
Mesendoderm Extension and Mantle Closure in Xenopus Laevis Gastrulation:
Combined Roles for Integrin α5β1, Fibronectin, and Tissue Geometry. Dev. Biol.
242, 109-129.
Dick, A., Hild, M., Bauer, H., Imai, Y., Maifeld, H., Schier, A. F., Talbot, W. S.,
Bouwmeester, T. and Hammerschmidt, M. (2000). Essential Role of Bmp7
(Snailhouse) and its Prodomain in Dorsoventral Patterning of the Zebrafish
Embryo. Development 127, 343-354.
Djiane, A., Riou, J., Umbhauer, M., Boucaut, J. and Shi, D. (2000). Role of
280
Frizzled 7 in the Regulation of Convergent Extension Movements during
Gastrulation in Xenopus Laevis. Development 127, 3091-3100.
Doitsidou, M., Reichman-Fried, M., Stebler, J., Koprunner, M., Dorries, J., Meyer,
D., Esguerra, C. V., Leung, T. and Raz, E. (2002). Guidance of Primordial Germ
Cell Migration by the Chemokine SDF-1. Cell 111, 647-659.
Dosch, R., Gawantka, V., Delius, H., Blumenstock, C. and Niehrs, C. (1997).
Bmp-4 Acts as a Morphogen in Dorsoventral Mesoderm Patterning in Xenopus.
Development 124, 2325-2334.
Dougan, S. T., Warga, R. M., Kane, D. A., Schier, A. F. and Talbot, W. S. (2003).
The Role of the Zebrafish Nodal-Related Genes Squint and Cyclops in Patterning
of Mesendoderm. Development 130, 1837-1851.
Duchek, P., Somogyi, K., Jekely, G., Beccari, S. and Rorth, P. (2001). Guidance
of Cell Migration by the Drosophila PDGF/VEGF Receptor. Cell 107, 17-26.
Edwards, D. R., Handsley, M. M. and Pennington, C. J. (2008). The ADAM
Metalloproteinases. Mol. Aspects Med. 29, 258-289.
Ekman, S., Thuresson, E. R., Heldin, C. H. and Ronnstrand, L. (1999). Increased
Mitogenicity of an Alphabeta Heterodimeric PDGF Receptor Complex Correlates
with Lack of RasGAP Binding. Oncogene 18, 2481-2488.
Entchev, E. V., Schwabedissen, A. and Gonzalez-Gaitan, M. (2000). Gradient
Formation of the TGF-Beta Homolog Dpp. Cell 103, 981-991.
281
Farese, R. V., Cases, S., Ruland, S. L., Kayden, H. J., Wong, J. S., Young, S. G.
and Hamilton, R. L. (1996). A Novel Function for Apolipoprotein B: Lipoprotein
Synthesis in the Yolk Sac is Critical for Maternal-Fetal Lipid Transport in Mice. J.
Lipid Res. 37, 347-360.
Ferrara, N., Gerber, H. and LeCouter, J. (2003). The Biology of VEGF and its
Receptors. Nat. Med. 9, 669-676.
Fredriksson, L., Li, H. and Eriksson, U. (2004a). The PDGF Family: Four Gene
Products Form Five Dimeric Isoforms. Cytokine & Growth Factor Reviews 15,
197-204.
Fredriksson, L., Li, H., Fieber, C., Li, X. and Eriksson, U. (2004b). Tissue
Plasminogen Activator is a Potent Activator of PDGF-CC. EMBO J. 23, 3793-
3802.
Fujise, M., Takeo, S., Kamimura, K., Matsuo, T., Aigaki, T., Izumi, S. and Nakato,
H. (2003). Dally Regulates Dpp Morphogen Gradient Formation in the Drosophila
Wing. Development 130, 1515-1522.
Fukata, M., Nakagawa, M. and Kaibuchi, K. (2003). Roles of Rho-Family
GTPases in Cell Polarisation and Directional Migration. Curr. Opin. Cell Biol. 15,
590-597.
Funamoto, S., Meili, R., Lee, S., Parry, L. and Firtel, R. A. (2002). Spatial and
Temporal Regulation of 3-Phosphoinositides by PI 3-Kinase and PTEN Mediates
282
Chemotaxis. Cell 109, 611-623.
Furthauer, M., Thisse, C. and Thisse, B. (1997). A Role for FGF-8 in the
Dorsoventral Patterning of the Zebrafish Gastrula. Development 124, 4253-4264.
Furuhashi, M., Sjoblom, T., Abramsson, A., Ellingsen, J., Micke, P., Li, H.,
Bergsten-Folestad, E., Eriksson, U., Heuchel, R., Betsholtz, C. et al. (2004).
Platelet-Derived Growth Factor Production by B16 Melanoma Cells Leads to
Increased Pericyte Abundance in Tumors and an Associated Increase in Tumor
Growth Rate. Cancer Res. 64, 2725-2733.
Gong, Y., Mo, C. and Fraser, S. E. (2004). Planar Cell Polarity Signalling
Controls Cell Division Orientation during Zebrafish Gastrulation. Nature 430, 689-
693.
Greco, V., Hannus, M. and Eaton, S. (2001). Argosomes: A Potential Vehicle for
the Spread of Morphogens through Epithelia. Cell 106, 633-645.
Gregor, T., Wieschaus, E. F., McGregor, A. P., Bialek, W. and Tank, D. W.
(2007). Stability and Nuclear Dynamics of the Bicoid Morphogen Gradient. Cell
130, 141-152.
Gubb, D. and Garcia-Bellido, A. (1982). A Genetic Analysis of the Determination
of Cuticular Polarity during Development in Drosophila Melanogaster. J. Embryol.
Exp. Morphol. 68, 37-57.
283
Hagemann, A. I., Xu, X., Nentwich, O., Hyvonen, M. and Smith, J. C. (2009).
Rab5-Mediated Endocytosis of Activin is Not Required for Gene Activation Or
Long-Range Signalling in Xenopus. Development 136, 2803-2813.
Hama, J. and Weinstein, D. C. (2001). Is Chordin a Morphogen? Bioessays 23,
121-124.
Harland, R. M. (1991). In Situ Hybridization: An Improved Whole-Mount Method
for Xenopus Embryos. Methods Cell Biol. 36, 685-695.
Hawkins, P. T., Eguinoa, A., Qiu, R. G., Stokoe, D., Cooke, F. T., Walters, R.,
Wennstrom, S., Claesson-Welsh, L., Evans, T. and Symons, M. (1995). PDGF
Stimulates an Increase in GTP-Rac Via Activation of Phosphoinositide 3-Kinase.
Current Biology 5, 393-403.
Heisenberg, C., Tada, M., Rauch, G. J., Saude, L., Concha, M. L., Geisler, R.,
Stemple, D. L., Smith, J. C. and Wilson, S. W. (2000). Silberblick/Wnt11 Mediates
Convergent Extension Movements during Zebrafish Gastrulation. Nature 405, 76-
81.
Heldin, C. H., Ostman, A. and Ronnstrand, L. (1998). Signal Transduction Via
Platelet-Derived Growth Factor Receptors. Biochim. Biophys. Acta 1378, F79-
113.
Hermanson, M., Funa, K., Hartman, M., Claesson-Welsh, L., Heldin, C. H.,
Westermark, B. and Nister, M. (1992). Platelet-Derived Growth Factor and its
284
Receptors in Human Glioma Tissue: Expression of Messenger RNA and Protein
Suggests the Presence of Autocrine and Paracrine Loops. Cancer Res. 52,
3213-3219.
Heuchel, R., Berg, A., Tallquist, M., Ahlen, K., Reed, R. K., Rubin, K., Claesson-
Welsh, L., Heldin, C. H. and Soriano, P. (1999). Platelet-Derived Growth Factor
Beta Receptor Regulates Interstitial Fluid Homeostasis through
Phosphatidylinositol-3' Kinase Signaling. Proc. Natl. Acad. Sci. U. S. A. 96,
11410-11415.
Hikasa, H., Shibata, M., Hiratani, I. and Taira, M. (2002). The Xenopus Receptor
Tyrosine Kinase Xror2 Modulates Morphogenetic Movements of the Axial
Mesoderm and Neuroectoderm Via Wnt Signaling. Development 129, 5227-5239.
Ho, L., Symes, K., Yordan, C., Gudas, L. J. and Mercola, M. (1994). Localization
of PDGF A and PDGFR Alpha mRNA in Xenopus Embryos Suggests Signalling
from Neural Ectoderm and Pharyngeal Endoderm to Neural Crest Cells. Mech.
Dev. 48, 165-174.
Hoch, R. V. and Soriano, P. (2003). Roles of PDGF in Animal Development.
Development 130, 4769-4784.
Horiuchi, H., Inoue, T., Furusawa, S. and Matsuda, H. (2001). Characterization
and Expression of Three Forms of cDNA Encoding Chicken Platelet-Derived
Growth Factor-A Chain. Gene 272, 181-190.
285
Howe, J. A., Howell, M., Hunt, T. and Newport, J. W. (1995). Identification of a
Developmental Timer Regulating the Stability of Embryonic Cyclin A and a New
Somatic A-Type Cyclin at Gastrulation. Genes & Development 9, 1164-1176.
Hsiung, F., Ramirez-Weber, F., Iwaki, D. D. and Kornberg, T. B. (2005).
Dependence of Drosophila Wing Imaginal Disc Cytonemes on Decapentaplegic.
Nature 437, 560-563.
Ibrahim, H. and Winklbauer, R. (2001). Mechanisms of Mesendoderm
Internalization in the Xenopus Gastrula: Lessons from the Ventral Side. Dev. Biol.
240, 108-122.
Jechlinger, M., Grunert, S., Tamir, I. H., Janda, E., Ludemann, S., Waerner, T.,
Seither, P., Weith, A., Beug, H. and Kraut, N. (2003). Expression Profiling of
Epithelial Plasticity in Tumor Progression. Oncogene 22, 7155-7169.
Johnson, K. E. (1977a). Extracellular Matrix Synthesis in Blastula and Gastrula
Stages of Normal and Hybrid Frog Embryos. I. Toluidine Blue and Lanthanum
Staining. J. Cell. Sci. 25, 313-322.
Johnson, K. E. (1977b). Extracellular Matrix Synthesis in Blastula and Gastrula
Stages of Normal and Hybrid Frog Embryos. III. Characterization of Galactose-
and Glucosamine-Labelled Materials. J. Cell. Sci. 25, 335-354.
Kuhl, M. and Wedlich, D. (1996). Xenopus Cadherins: Sorting Out Types and
Functions in Embryogenesis. Developmental Dynamics 207, 121-134.
286
Kawada, K., Upadhyay, G., Ferandon, S., Janarthanan, S., Hall, M., Vilardaga, J.
and Yajnik, V. (2009). Cell Migration is Regulated by PDGF Receptor
Endocytosis. Mol. Cell. Biol. 29, 4508-4518
Keller, R. E. (1975). Vital Dye Mapping of the Gastrula and Neurula of Xenopus
Laevis. I. Prospective Areas and Morphogenetic Movements of the Superficial
Layer. Dev. Biol. 42, 222-241.
Keller, R. E. (1976). Vital Dye Mapping of the Gastrula and Neurula of Xenopus
Laevis. II. Prospective Areas and Morphogenetic Movements of the Deep Layer.
Dev. Biol. 51, 118-137.
Keller, R. E. (1980). The Cellular Basis of Epiboly: An SEM Study of Deep-Cell
Rearrangement during Gastrulation in Xenopus Laevis. J. Embryol. Exp.
Morphol. 60, 201-234.
Keller, R. E. (2004). Developmental Biology: Heading Away from the Rump.
Nature 430, 305-306.
Keller, R. E., Danilchik, M., Gimlich, R. and Shih, J. (1985). The Function and
Mechanism of Convergent Extension during Gastrulation of Xenopus Laevis. J.
Embryol. Exp. Morphol. 89 Suppl, 185-209.
Keller, R. E., Davidson, L., Edlund, A., Elul, T., Ezin, M., Shook, D. and Skoglund,
P. (2000). Mechanisms of Convergence and Extension by Cell Intercalation.
Philosophical Transactions of the Royal Society of London Series, Biological
287
Sciences 355, 897-922.
Keller, R. (1991). Early Embryonic Development of Xenopus Laevis. Methods
Cell Biol. 36, 61-113.
Keller, R., Cooper, M. S., Danilchik, M., Tibbetts, P. and Wilson, P. A. (1989).
Cell Intercalation during Notochord Development in Xenopus Laevis. J. Exp.
Zool. 251, 134-154.
Keller, R. and Danilchik, M. (1988). Regional Expression, Pattern and Timing of
Convergence and Extension during Gastrulation of Xenopus Laevis.
Development 103, 193-209.
Keller, R. and Tibbetts, P. (1989). Mediolateral Cell Intercalation in the Dorsal,
Axial Mesoderm of Xenopus Laevis. Dev. Biol. 131, 539-549.
Keller, R. (2002). Shaping the Vertebrate Body Plan by Polarized Embryonic Cell
Movements. Science 298, 1950-1954.
Keller, R., Davidson, L. A. and Shook, D. R. (2003). How we are Shaped: The
Biomechanics of Gastrulation. Differentiation 71, 171-205.
Keller, R. and Schoenwolf, G. (1977). An SEM Study of Cellular Morphology,
Contact and Arrangement, as Related to Gastrulation in Xenopus Laevis. Roux's
Archives of Developmental Biology 182, 165-186.
288
Kelly, J. L., Sanchez, A., Brown, G. S., Chesterman, C. N. and Sleigh, M. J.
(1993). Accumulation of PDGF B and Cell-Binding Forms of PDGF A in the
Extracellular Matrix. J. Cell Biol. 121, 1153-1163.
Kerszberg, M. and Wolpert, L. (1998). Mechanisms for Positional Signalling by
Morphogen Transport: A Theoretical Study. J. Theor. Biol. 191, 103-114.
Khokha, M., Yeh, J., Grammer, T. and Harland, R. (2005). Depletion of Three
BMP Antagonists from Spemann's Organizer Leads to a Catastrophic Loss of
Dorsal Structures. Developmental Cell 8, 401-411.
Kicheva, A., Bollenbach, T., Wartlick, O., Julicher, F. and Gonzalez-Gaitan, M.
(2012). Investigating the Principles of Morphogen Gradient Formation: From
Tissues to Cells. Current Opinion in Genetics & Development.
10.1016/j.gde.2012.08.004.
Kicheva, A., Pantazis, P., Bollenbach, T., Kalaidzidis, Y., Bittig, T., Julicher, F.
and Gonzalez-Gaitan, M. (2007). Kinetics of Morphogen Gradient Formation.
Science 315, 521-525.
Kishimoto, Y., Lee, K. H., Zon, L., Hammerschmidt, M. and Schulte-Merker, S.
(1997). The Molecular Nature of Zebrafish Swirl: BMP2 Function is Essential
during Early Dorsoventral Patterning. Development 124, 4457-4466.
Klingseisen, A., Clark, I. B. N., Gryzik, T. and Muller, H. J. (2009). Differential and
Overlapping Functions of Two Closely Related Drosophila FGF8-Like Growth
289
Factors in Mesoderm Development. Development 136, 2393-2402.
Koibuchi, N., Kaneda, Y., Taniyama, Y., Matsumoto, K., Nakamura, T., Ogihara,
T. and Morishita, R. (2004). Essential Role of HGF (Hepatocyte Growth Factor) in
Blood Formation in Xenopus. Blood 103, 3320-3325.
Kruse, K., Pantazis, P., Bollenbach, T., J\ulicher, F. and Gonzalez-Gaitan, M.
(2004). Dpp Gradient Formation by Dynamin-Dependent Endocytosis: Receptor
Trafficking and the Diffusion Model. Development 131, 4843-4856.
Kurth, T., Berger, J., Wilsch-Brauninger, M., Kretschmar, S., Cerny, R., Schwarz,
H., Lofberg, J., Piendl, T. and Epperlein, H. H. (2010). Electron Microscopy of the
Amphibian Model Systems Xenopus Laevis and Ambystoma Mexicanum.
Methods Cell Biol. 96, 395-423.
Lane, M. C. and Smith, W. C. (1999). The Origins of Primitive Blood in Xenopus:
Implications for Axial Patterning. Development 126, 423-434.
Lakowicz, J. (2006). Principles of Fluorescence Spectroscopy 3rd Edition.
Springer. ISBN: 9780387463124
Lecuit, T., Brook, W. J., Ng, M., Calleja, M., Sun, H. and Cohen, S. M. (1996).
Two Distinct Mechanisms for Long-Range Patterning by Decapentaplegic in the
Drosophila Wing. Nature 381, 387-393.
Leptin, M. (2005). Gastrulation Movements: The Logic and the Nuts and Bolts.
Developmental Cell 8, 305-320.
290
Li, X., Ponten, A., Aase, K., Karlsson, L., Abramsson, A., Uutela, M., Backstrom,
G., Hellstrom, M., Bostrom, H., Li, H. et al. (2000). PDGF-C is a New Protease-
Activated Ligand for the PDGF Alpha-Receptor. Nat. Cell Biol. 2, 302-309.
Lin, X. and Perrimon, N. (2000). Role of Heparan Sulfate Proteoglycans in Cell-
Cell Signaling in Drosophila. Matrix Biology : Journal of the International Society
for Matrix Biology 19, 303-307.
Lin, X. (2004). Functions of Heparan Sulfate Proteoglycans in Cell Signaling
during Development. Development 131, 6009-6021.
Lippincott-Schwartz, J., Altan-Bonnet, N. and Patterson, G. H. (2003).
Photobleaching and Photoactivation: Following Protein Dynamics in Living Cells.
Nat. Cell Biol. Suppl, S7-14.
Little, S. C. and Mullins, M. C. (2006). Extracellular Modulation of BMP Activity in
Patterning the Dorsoventral Axis. Birth Defects Research Embryo Today:
Reviews 78, 224-242.
Liu, L., Chong, S., Balasubramaniyan, N. V., Korzh, V. and Ge, R. (2002a).
Platelet-Derived Growth Factor Receptor Alpha (PDGFR-α) Gene in Zebrafish
Embryonic Development. Mech. Dev. 116, 227-230.
Liu, L., Korzh, V., Balasubramaniyan, N. V., Ekker, M. and Ge, R. (2002b).
Platelet-Derived Growth Factor A (PDGF-A) Expression during Zebrafish
Embryonic Development. Dev. Genes Evol. 212, 298-301.
291
Loechel, F., Fox, J. W., Murphy, G., Albrechtsen, R. and Wewer, U. M. (2000).
ADAM 12-S Cleaves IGFBP-3 and IGFBP-5 and is Inhibited by TIMP-3.
Biochem. Biophys. Res. Commun. 278, 511-515.
Luga, V., Zhang, L., Viloria-Petit, A. M., Ogunjimi, A. A., Inanlou, M. R., Chiu, E.,
Buchanan, M., Hosein, A. N., Basik, M. and Wrana, J. L. (2012). Exosomes
Mediate Stromal Mobilization of Autocrine Wnt-PCP Signaling in Breast Cancer
Cell Migration. Cell 151, 1542-1556.
Luu, O., David, R., Ninomiya, H. and Winklbauer, R. (2011). Large-Scale
Mechanical Properties of Xenopus Embryonic Epithelium. Proc. Natl. Acad. Sci.
U. S. A. 108, 4000-4005
Marjoram, L., Wright, C. (2011). Rapid differential transport of Nodal and Lefty on
sulfated proteoglycan-rich extracellular matrix regulates left-right asymmetry in
Xenopus. Development 138, 475-485
Muller, H. A., Kuhl, M., Finnemann, S., Schneider, S., van der Poel, S. Z.,
Hausen, P. and Wedlich, D. (1994). Xenopus Cadherins: The Maternal Pool
Comprises Distinguishable Members of the Family. Mech. Dev. 47, 213-223.
Marsden, M. and DeSimone, D. W. (2001). Regulation of Cell Polarity, Radial
Intercalation and Epiboly in Xenopus: Novel Roles for Integrin and Fibronectin.
Development 128, 3635-3647.
McDonald, J. A., Pinheiro, E. M. and Montell, D. J. (2003). PVF1, a PDGF/VEGF
292
Homolog, is Sufficient to Guide Border Cells and Interacts Genetically with
Taiman. Development 130, 3469-3478.
McDowell, N., Zorn, A. M., Crease, D. J. and Gurdon, J. B. (1997). Activin has
Direct Long-Range Signalling Activity and can Form a Concentration Gradient by
Diffusion. Current Biology 7, 671-681.
McMahon, A., Supatto, W., Fraser, S. and Stathopoulos, A. (2008). Dynamic
Analyses of Drosophila Gastrulation Provide Insights into Collective Cell
Migration. Science 322, 1546-1550.
McMahon, A., Reeves, G. T., Supatto, W. and Stathopoulos, A. (2010).
Mesoderm Migration in Drosophila is a Multi-Step Process Requiring FGF
Signaling and Integrin Activity. Development 137, 2167-2175.
Mercola, M., Deininger, P. L., Shamah, S. M., Porter, J., Wang, C. Y. and Stiles,
C. D. (1990). Dominant-Negative Mutants of a Platelet-Derived Growth Factor
Gene. Genes & Development 4, 2333-2341.
Mercola, M., Melton, D. A. and Stiles, C. D. (1988). Platelet-Derived Growth
Factor A Chain is Maternally Encoded in Xenopus Embryos. Science 241, 1223-
1225.
Montero, J., Kilian, B., Chan, J., Bayliss, P. E. and Heisenberg, C. (2003).
Phosphoinositide 3-Kinase is Required for Process Outgrowth and Cell
Polarization of Gastrulating Mesendodermal Cells. Current Biology 13, 1279-
293
1289.
Moody, S. A. (1987a). Fates of the Blastomeres of the 16-Cell Stage Xenopus
Embryo. Dev. Biol. 119, 560-578.
Moody, S. A. (1987b). Fates of the Blastomeres of the 32-Cell-Stage Xenopus
Embryo. Dev. Biol. 122, 300-319.
Murray, M. J. and Saint, R. (2007). Photoactivatable GFP Resolves Drosophila
Mesoderm Migration Behaviour. Development 134, 3975-3983.
Myers, D. C., Sepich, D. S. and Solnica-Krezel, L. (2002). Convergence and
Extension in Vertebrate Gastrulae: Cell Movements According to Or in Search of
Identity? Trends in Genetics 18, 447-455.
Nagel, M., Tahinci, E., Symes, K. and Winklbauer, R. (2004). Guidance of
Mesoderm Cell Migration in the Xenopus Gastrula Requires PDGF Signaling.
Development 131, 2727-2736.
Nagel, M. and Winklbauer, R. (1999). Establishment of Substratum Polarity in the
Blastocoel Roof of the Xenopus Embryo. Development 126, 1975-1984.
Nakatsuji, N. and Johnson, K. E. (1982). Cell Locomotion in Vitro by Xenopus
Laevis Gastrula Mesodermal Cells. Cell Motil. 2, 149-161.
Nakatsuji, N. and Johnson, K. E. (1983). Comparative Study of Extracellular
Fibrils on the Ectodermal Layer in Gastrulae of Five Amphibian Species. J. Cell.
294
Sci. 59, 61-70.
Nellen, D., Burke, R., Struhl, G. and Basler, K. (1996). Direct and Long-Range
Action of a DPP Morphogen Gradient. Cell 85, 357-368.
Neuner, R., Cousin, H., McCusker, C., Coyne, M. and Alfandari, D. (2009).
Xenopus ADAM19 is Involved in Neural, Neural Crest and Muscle Development.
Mech. Dev. 126, 240-255.
Niehrs, C., Keller, R., Cho, K. W. and de Robertis, E. M. (1993). The Homeobox
Gene Goosecoid Controls Cell Migration in Xenopus Embryos. Cell 72, 491-503.
Niehrs, C., Steinbeisser, H. and de Robertis, E. M. (1994). Mesodermal
Patterning by a Gradient of the Vertebrate Homeobox Gene Goosecoid. Science
263, 817-820.
Nieukoop, P., Faber, J. (1967). Normal Table of Xenopus laevis (Daudin).
Amsterdam: North-Holland. ISBN: 0815318960
Ninomiya, H., Elinson, R. P. and Winklbauer, R. (2004). Antero-Posterior Tissue
Polarity Links Mesoderm Convergent Extension to Axial Patterning. Nature 430,
364-367.
Nister, M., Libermann, T. A., Betsholtz, C., Pettersson, M., Claesson-Welsh, L.,
Heldin, C. H., Schlessinger, J. and Westermark, B. (1988). Expression of
Messenger RNAs for Platelet-Derived Growth Factor and Transforming Growth
Factor-Alpha and their Receptors in Human Malignant Glioma Cell Lines. Cancer
295
Res. 48, 3910-3918.
Oishi, I., Suzuki, H., Onishi, N., Takada, R., Kani, S., Ohkawara, B., Koshida, I.,
Suzuki, K., Yamada, G., Schwabe, G. C. et al. (2003). The Receptor Tyrosine
Kinase Ror2 is Involved in Non-Canonical Wnt5a/JNK Signalling Pathway. Genes
to Cells 8, 645-654.
Omura, T., Heldin, C. H. and Ostman, A. (1997). Immunoglobulin-Like Domain 4-
Mediated Receptor-Receptor Interactions Contribute to Platelet-Derived Growth
Factor-Induced Receptor Dimerization. The Journal of Biological Chemistry 272,
12676-12682.
Orr-Urtreger, A. and Lonai, P. (1992). Platelet-Derived Growth Factor-A and its
Receptor are Expressed in Separate, but Adjacent Cell Layers of the Mouse
Embryo. Development 115, 1045-1058.
Panakova Daniela, Sprong, H., Marois, E., Thiele, C. and Eaton, S. (2005).
Lipoprotein Particles are Required for Hedgehog and Wingless Signalling. Nature
435, 58-65.
Papan, C., Boulat, B., Velan, S. S., Fraser, S. E. and Jacobs, R. E. (2007a).
Formation of the Dorsal Marginal Zone in Xenopus Laevis Analyzed by Time-
Lapse Microscopic Magnetic Resonance Imaging. Dev. Biol. 305, 161-171.
Papan, C., Boulat, B., Velan, S. S., Fraser, S. E. and Jacobs, R. E. (2007b). Two-
Dimensional and Three-Dimensional Time-Lapse Microscopic Magnetic
296
Resonance Imaging of Xenopus Gastrulation Movements using Intrinsic Tissue-
Specific Contrast. Developmental Dynamics 236, 494-501.
Pepinsky, R. B., Zeng, C., Wen, D., Rayhorn, P., Baker, D. P., Williams, K. P.,
Bixler, S. A., Ambrose, C. M., Garber, E. A., Miatkowski, K. et al. (1998).
Identification of a Palmitic Acid-Modified Form of Human Sonic Hedgehog. The
Journal of Biological Chemistry 273, 14037-14045.
Petrasek, Z. and Schwille, P. (2008). Precise Measurement of Diffusion
Coefficients using Scanning Fluorescence Correlation Spectroscopy. Biophys. J.
94, 1437-1448.
Piccolo, S., Sasai, Y., Lu, B. and Robertis, E. M. D. (1996). Dorsoventral
Patterning in Xenopus: Inhibition of Ventral Signals by Direct Binding of Chordin
to BMP-4. Cell 86, 589-598.
Piddini, E., Marshall, F., Dubois, L., Hirst, E. and Vincent, J. (2005). Arrow
(LRP6) and Frizzled2 Cooperate to Degrade Wingless in Drosophila Imaginal
Discs. Development 132, 5479-5489.
Plouhinec, J. and Robertis, E. M. D. (2007). Systems Biology of Embryonic
Morphogens. Molecular BioSystems 3, 454.
Popovici, C., Isnardon, D., Birnbaum, D. and Roubin, R. (2002). Caenorhabditis
Elegans Receptors Related to Mammalian Vascular Endothelial Growth Factor
297
Receptors are Expressed in Neural Cells. Neurosci. Lett. 329, 116-120.
Porter, J. A., Ekker, S. C., Park, W. J., von Kessler, D. P., Young, K. E., Chen, C.
H., Ma, Y., Woods, A. S., Cotter, R. J., Koonin, E. V. et al. (1996). Hedgehog
Patterning Activity: Role of a Lipophilic Modification Mediated by the Carboxy-
Terminal Autoprocessing Domain. Cell 86, 21-34.
Prenzel, N., Zwick, E., Daub, H., Leserer, M., Abraham, R., Wallasch, C. and
Ullrich, A. (1999). EGF Receptor Transactivation by G-Protein-Coupled
Receptors Requires Metalloproteinase Cleavage of proHB-EGF. Nature 402,
884-888.
Ronnstrand, L. and Heldin, C. H. (2001). Mechanisms of Platelet-Derived Growth
Factor-Induced Chemotaxis. International Journal of Cancer 91, 757-762.
Raines, E. W. and Ross, R. (1992). Compartmentalization of PDGF on
Extracellular Binding Sites Dependent on Exon-6-Encoded Sequences. J. Cell
Biol. 116, 533-543.
Ramirez-Weber, F. A. and Kornberg, T. B. (1999). Cytonemes: Cellular
Processes that Project to the Principal Signaling Center in Drosophila Imaginal
Discs. Cell 97, 599-607.
Ridley, A. J. (2011). Life at the Leading Edge. Cell 145, 1012-1022.
Ries, J., Yu, S. R., Burkhardt, M., Brand, M. and Schwille, P. (2009). Modular
Scanning FCS Quantifies Receptor-Ligand Interactions in Living Multicellular
298
Organisms. Nature Methods 6, 643-645.
Rohani, N., Canty, L., Luu, O., Fagotto, F. c. and Winklbauer, R. (2011).
EphrinB/EphB Signaling Controls Embryonic Germ Layer Separation by Contact-
Induced Cell Detachment. PLoS Biology 9, e1000597.
Rusakov, D. A. and Kullmann, D. M. (1998). Geometric and Viscous Components
of the Tortuosity of the Extracellular Space in the Brain. Proc. Natl. Acad. Sci. U.
S. A. 95, 8975-8980.
Saint-Jeannet, J. P., Karavanov, A. A. and Dawid, I. B. (1994). Expression of
Mesoderm Markers in Xenopus Laevis Keller Explants. Int. J. Dev. Biol. 38, 605-
611.
Sasaki, M., Kashima, M., Ito, T., Watanabe, A., Izumiyama, N., Sano, M.,
Kagaya, M., Shioya, T. and Miura, M. (2000). Differential Regulation of
Metalloproteinase Production, Proliferation and Chemotaxis of Human Lung
Fibroblasts by PDGF, Interleukin-1beta and TNF-Alpha. Mediators Inflamm. 9,
155-160.
Schambony, A. and Wedlich, D. (2007). Wnt-5A/Ror2 Regulate Expression of
XPAPC through an Alternative Noncanonical Signaling Pathway. Developmental
Cell 12, 779-792.
Schechtman, A. M. (1942). The mechanism of amphibian gastrulation. I.
Gastrulation-promoting interactions between various regions fo an anuran egg
299
(Hyla regilla), Univ. Calif. Publ. Zool. 51, 1-39.
Schlie-Wolter, S., Ngezahayo, A. and Chichkov, B. N. (2013). The Selective Role
of ECM Components on Cell Adhesion, Morphology, Proliferation and
Communication in Vitro. Exp. Cell Res. 319, 1553-1561.
Scholpp, S. and Brand, M. (2004). Endocytosis Controls Spreading and Effective
Signaling Range of Fgf8 Protein. Current Biology 14, 1834-1841.
Schwank, G., Dalessi, S., Yang, S., Yagi, R., de Lachapelle, A. M., Affolter, M.,
Bergmann, S. and Basler, K. (2011). Formation of the Long Range Dpp
Morphogen Gradient. PLoS Biology 9, e1001111.
Selchow, A. and Winklbauer, R. (1997). Structure and Cytoskeletal Organization
of Migratory Mesoderm Cells from the Xenopus Gastrula. Cell Motil. Cytoskeleton
36, 12-29.
Sepich, D. S., Myers, D. C., Short, R., Topczewski, J., Marlow, F. and Solnica-
Krezel, L. (2000). Role of the Zebrafish Trilobite Locus in Gastrulation
Movements of Convergence and Extension. Genesis 27, 159-173.
Shih, J. and Keller, R. (1992). Cell Motility Driving Mediolateral Intercalation in
Explants of Xenopus Laevis. Development 116, 901-914.
Smith, E., Mitsi, M., Nugent, M. and Symes, K. (2009). PDGF-A Interactions with
Fibronectin Reveal a Critical Role for Heparan Sulfate in Directed Cell Migration
during Xenopus Gastrulation. Proc. Natl. Acad. Sci. U. S. A. 106, 21683-21688
300
Smith, J. C., Price, B. M., Green, J. B., Weigel, D. and Herrmann, B. G. (1991).
Expression of a Xenopus Homolog of Brachyury (T) is an Immediate-Early
Response to Mesoderm Induction. Cell 67, 79-87.
Solnica-Krezel, L., Stemple, D. L. and Driever, W. (1995). Transparent Things:
Cell Fates and Cell Movements during Early Embryogenesis of Zebrafish.
Bioessays 17, 931-939.
Solnica-Krezel, L. and Sepich, D. S. (2012). Gastrulation: Making and Shaping
Germ Layers. Annu. Rev. Cell Dev. Biol. 10.1146/annurev-cellbio-092910-
154043
Solnica-Krezel, L. (2005). Conserved Patterns of Cell Movements during
Vertebrate Gastrulation. Current Biology 15, R213-28.
Soriano, P. (1997). The PDGF Alpha Receptor is Required for Neural Crest Cell
Development and for Normal Patterning of the Somites. Development 124, 2691-
2700.
Stephens, L., Milne, L. and Hawkins, P. (2008). Moving Towards a Better
Understanding of Chemotaxis. Current Biology 18, R485-94.
Stickney, H., Imai, Y., Draper, B., Moens, C. and Talbot, W. (2007). Zebrafish
bmp4 Functions during Late Gastrulation to Specify Ventroposterior Cell Fates.
Dev. Biol. 310, 71-84.
Stossel, T. P. (1993). On the Crawling of Animal Cells. Science 260, 1086-1094.
301
Strigini, M. (2005). Mechanisms of Morphogen Movement. J. Neurobiol. 64, 324-
333.
Stroobant, P. and Waterfield, M. D. (1984). Purification and Properties of Porcine
Platelet-Derived Growth Factor. EMBO J. 3, 2963-2967.
Suzuki, A., Thies, R. S., Yamaji, N., Song, J. J., Wozney, J. M., Murakami, K. and
Ueno, N. (1994). A Truncated Bone Morphogenetic Protein Receptor Affects
Dorsal-Ventral Patterning in the Early Xenopus Embryo. Proc. Natl. Acad. Sci. U.
S. A. 91, 10255-10259.
Swaminathan, R., Hoang, C. P. and Verkman, A. S. (1997). Photobleaching
Recovery and Anisotropy Decay of Green Fluorescent Protein GFP-S65T in
Solution and Cells: Cytoplasmic Viscosity Probed by Green Fluorescent Protein
Translational and Rotational Diffusion. Biophys. J. 72, 1900-1907.
Symes, K. and Mercola, M. (1996). Embryonic Mesoderm Cells Spread in
Response to Platelet-Derived Growth Factor and Signaling by
Phosphatidylinositol 3-Kinase. Proc. Natl. Acad. Sci. U. S. A. 93, 9641-9644.
Tada, M. and Smith, J. C. (2000). Xwnt11 is a Target of Xenopus Brachyury:
Regulation of Gastrulation Movements via Dishevelled, but not through the
Canonical Wnt Pathway. Development 127, 2227-2238.
Tada, M. and Kai, M. (2009). Noncanonical Wnt/PCP Signaling during Vertebrate
Gastrulation. Zebrafish 6, 29-40.
302
Teleman, A. A. and Cohen, S. M. (2000). Dpp Gradient Formation in the
Drosophila Wing Imaginal Disc. Cell 103, 971-980.
Thornberry, N. A. and Lazebnik, Y. (1998). Caspases: Enemies within. Science
281, 1312-1316.
Umulis, D., O'Connor, M. B. and Blair, S. S. (2009). The Extracellular Regulation
of Bone Morphogenetic Protein Signaling. Development 136, 3715-3728.
Unterseher, F., Hefele, J. A., Giehl, K., de Robertis, E. M., Wedlich, D. and
Schambony, A. (2004). Paraxial Protocadherin Coordinates Cell Polarity during
Convergent Extension Via Rho A and JNK. EMBO J. 23, 3259-3269.
Utoh, R., Shigenaga, S., Watanabe, Y. and Yoshizato, K. (2003). Platelet-
Derived Growth Factor Signaling as a Cue of the Epithelial-Mesenchymal
Interaction Required for Anuran Skin Metamorphosis. Developmental Dynamics
227, 157-169.
van Stry, M., Kazlauskas, A., Schreiber, S. L. and Symes, K. (2005). Distinct
Effectors of Platelet-Derived Growth Factor Receptor-Alpha Signaling are
Required for Cell Survival during Embryogenesis. Proc. Natl. Acad. Sci. U. S. A.
102, 8233-8238.
van Stry, M., McLaughlin, K. A., Ataliotis, P. and Symes, K. (2004). The
Mitochondrial-Apoptotic Pathway is Triggered in Xenopus Mesoderm Cells
Deprived of PDGF Receptor Signaling during Gastrulation. Dev. Biol. 268, 232-
303
242.
Vignais, L., Nait Oumesmar, B. and Baron-Van Evercooren, A. B. (1995). PDGF-
Alpha Receptor is Expressed by Mature Neurones of the Central Nervous
System. Neuroreport 6, 1993-1996.
Wacker, S., Grimm, K., Joos, T. and Winklbauer, R. (2000). Development and
Control of Tissue Separation at Gastrulation in Xenopus. Dev. Biol. 224, 428-439.
Wallingford, J. B. and Harland, R. M. (2001). Xenopus Dishevelled Signaling
Regulates both Neural and Mesodermal Convergent Extension: Parallel Forces
Elongating the Body Axis. Development 128, 2581-2592.
Wallingford, J. B., Rowning, B. A., Vogeli, K. M., Rothb\acher, U., Fraser, S. E.
and Harland, R. M. (2000). Dishevelled Controls Cell Polarity during Xenopus
Gastrulation. Nature 405, 81-85.
Walters, M. J., Wayman, G. A. and Christian, J. L. (2001). Bone Morphogenetic
Protein Function is Required for Terminal Differentiation of the Heart but Not for
Early Expression of Cardiac Marker Genes. Mech. Dev. 100, 263-273.
Wartlick, O., Kicheva, A. and Gonzalez-Gaitan, M. (2009). Morphogen Gradient
Formation. Cold Spring Harbor Perspectives in Biology 1, a001255.
Weber, S. and Saftig, P. (2012). Ectodomain Shedding and ADAMs in
Development. Development 139, 3693-3709.
304
Wei, S., Xu, G., Bridges, L. C., Williams, P., White, J. M. and DeSimone, D. W.
(2010). ADAM13 Induces Cranial Neural Crest by Cleaving Class B Ephrins and
Regulating Wnt Signaling. Developmental Cell 19, 345-352.
White, J. M. (2003). ADAMs: Modulators of Cell-Cell and Cell-Matrix Interactions.
Curr. Opin. Cell Biol. 15, 598-606.
Wilkinson, D. G., Bhatt, S. and Herrmann, B. G. (1990). Expression Pattern of the
Mouse T Gene and its Role in Mesoderm Formation. Nature 343, 657-659.
Willnow, T. E., Hammes, A. and Eaton, S. (2007). Lipoproteins and their
Receptors in Embryonic Development: More than Cholesterol Clearance.
Development 134, 3239-3249.
Wilson, P. A., Oster, G. and Keller, R. (1989). Cell Rearrangement and
Segmentation in Xenopus: Direct Observation of Cultured Explants. Development
105, 155-166.
Wilson, P. and Keller, R. (1991). Cell Rearrangement during Gastrulation of
Xenopus: Direct Observation of Cultured Explants. Development 112, 289-300.
Winklbauer, R. (1990). Mesodermal Cell Migration during Xenopus Gastrulation.
Dev. Biol. 142, 155-168.
Winklbauer, R. (1998). Conditions for Fibronectin Fibril Formation in the Early
Xenopus Embryo. Developmental Dynamics 212, 335-345.
305
Winklbauer, R. and Damm, E. W. (2011). Internalizing the Vegetal Cell Mass
before and during Amphibian Gastrulation: Vegetal Rotation and Related
Movements. Wiley Interdisciplinary Reviews: Developmental Biology 1, 301-306.
Winklbauer, R. and Keller, R. E. (1996). Fibronectin, Mesoderm Migration, and
Gastrulation in Xenopus. Dev. Biol. 177, 413-426.
Winklbauer, R. and Nagel, M. (1991). Directional Mesoderm Cell Migration in the
Xenopus Gastrula. Dev. Biol. 148, 573-589.
Winklbauer, R., Nagel, M., Selchow, A. and Wacker, S. (1996). Mesoderm
Migration in the Xenopus Gastrula. Int. J. Dev. Biol. 40, 305-311.
Winklbauer, R. and Schurfeld, M. (1999). Vegetal Rotation, a New Gastrulation
Movement Involved in the Internalization of the Mesoderm and Endoderm in
Xenopus. Development 126, 3703-3713.
Winklbauer, R. and Selchow, A. (1992). Motile Behavior and Protrusive Activity of
Migratory Mesoderm Cells from the Xenopus Gastrula. Dev. Biol. 150, 335-351.
Wolpert, L. (1969). Positional Information and the Spatial Pattern of Cellular
Differentiation. J. Theor. Biol. 25, 1-47.
Wong, L. L. and Adler, P. N. (1993). Tissue Polarity Genes of Drosophila
Regulate the Subcellular Location for Prehair Initiation in Pupal Wing Cells. J.
Cell Biol. 123, 209-221.
306
Xu, G., Wei, S., White, J. M. and DeSimone, D. W. (2012). Identification and
Characterization of ADAM41, a Novel ADAM Metalloproteinase in Xenopus. Int.
J. Dev. Biol. 56, 333-339.
Yamanaka, Y., Tamplin, O. J., Beckers, A., Gossler, A. and Rossant, J. (2007).
Live Imaging and Genetic Analysis of Mouse Notochord Formation Reveals
Regional Morphogenetic Mechanisms. Developmental Cell 13, 884-896.
Yamashita, S., Miyagi, C., Carmany-Rampey, A., Shimizu, T., Fujii, R., Schier, A.
F. and Hirano, T. (2002). Stat3 Controls Cell Movements during Zebrafish
Gastrulation. Developmental Cell 2, 363-375.
Yan, D. and Lin, X. (2009). Shaping Morphogen Gradients by Proteoglycans.
Cold Spring Harbor Perspectives in Biology, a002493.
Yang, X., Chrisman, H. and Weijer, C. (2008). PDGF Signalling Controls the
Migration of Mesoderm Cells during Chick Gastrulation by Regulating N-Cadherin
Expression. Development 135, 3521-3530.
Yin, C., Kiskowski, M., Pouille, P. A., Farge, E. and Solnica-Krezel, L. (2008).
Cooperation of Polarized Cell Intercalations Drives Convergence and Extension
of Presomitic Mesoderm during Zebrafish Gastrulation. J. Cell Biol. 180, 221-232.
Yu, J. C., Mahadevan, D., LaRochelle, W. J., Pierce, J. H. and Heidaran, M. A.
(1994). Structural Coincidence of Alpha PDGFR Epitopes Binding to Platelet-
Derived Growth Factor-AA and a Potent Neutralizing Monoclonal Antibody. The
307
Journal of Biological Chemistry 269, 10668-10674.
Yu, S. R., Burkhardt, M., Nowak, M., Ries, J., Petr\'asek, Z., Scholpp, S.,
Schwille, P. and Brand, M. (2009). Fgf8 Morphogen Gradient Forms by a Source-
Sink Mechanism with Freely Diffusing Molecules. Nature 461, 533-536.
Zhou, S., Lo, W., Suhalim, J. L., Digman, M. A., Gratton, E., Nie, Q. and Lander,
A. D. (2012). Free Extracellular Diffusion Creates the Dpp Morphogen Gradient of
the Drosophila Wing Disc. Current Biology 22, 668-675.
308