Upload
others
View
17
Download
0
Embed Size (px)
Citation preview
1
Oral colonization by Entamoeba gingivalis and Trichomonas tenax: PCR-1
based study in health, gingivitis, and periodontitis 2
Running title: Oral parasites as risk factors for periodontal disease 3
4
Authors 5
Alaa’ Yaseena, Azmi Mahafzaha,b, Deema Dababsehc, Duaa Tayemc, Ahmad A. Hamdanc,d, 6
Esraa Al-Fraihata,b, Yazan Hassonac,d, Gülşen Özkaya Şahine,f, Julien Santi-Roccag and Malik 7
Sallama,b,e,# 8
Affiliations 9
aDepartment of Pathology, Microbiology and Forensic Medicine, School of Medicine, the 10
University of Jordan, Amman, Jordan. Postal code: 11942. 11
bDepartment of Clinical Laboratories and Forensic Medicine, Jordan University Hospital, 12
Amman, Jordan. Postal code: 11942. 13
cSchool of Dentistry, the University of Jordan, Amman, Jordan. 14
dDepartment of Oral and Maxillofacial Surgery, Oral Medicine and Periodontology, Jordan 15
University Hospital, Amman, Jordan. 16
eDepartment of Translational Medicine, Faculty of Medicine, Lund University, Malmö, 17
Sweden. Postal code: 22100. 18
fDepartment of Clinical Microbiology, Laboratory Medicine, Skåne University Hospital, Lund, 19
Sweden. 20
gScience and Healthcare for Oral Welfare, Toulouse, France. 21
22
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice.
2
#Corresponding author (to whom requests for reprints should be made): 23
Malik Sallam, M.D., Ph.D. Department of Clinical Laboratories and Forensic Medicine, 24
Jordan University Hospital, Queen Rania Al-Abdullah Street-Aljubeiha/P.O. Box: 13046, 25
Postal code: 11942. Amman, Jordan. Tel: +962 79 184 5186. E-mail: [email protected], 26
ORCID ID: 0000-0002-0165-9670. 27
28
Running title length: 54 characters with spaces, (limit: 54 characters with spaces). 29
Abstract word count: 250 words, (limit: 250 words). 30
Importance word count: 112 words, (limit: 150 words). 31
Manuscript word count: 4832 words 32
33
34
35
36
37
38
39
40
41
42
43
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
3
ABSTRACT 44
The etiology of periodontitis needs further investigation, as is the place of gingivitis in its 45
pathophysiology. A few studies linked the oral colonization by parasites (Entamoeba gingivalis 46
and Trichomonas tenax) to the disease and its severity. The aim of this study was to estimate 47
the prevalence of these oral parasites among healthy individuals, gingivitis and periodontitis 48
patients in Jordan. The study was conducted by active enrolment of participants at Jordan 49
University Hospital. The participants answered a questionnaire that included items related to 50
possible risk factors for periodontal disease. Saliva and dental plaque samples were collected. 51
The detection of oral parasites was done using conventional PCR and microscopic examination 52
of wet mounts. The study population comprised a total of 237 individuals divided into three 53
groups: healthy (n=94), gingivitis (n=53), and periodontitis (n=90). PCR results revealed that 54
the overall prevalence of E. gingivalis was 71.7% compared to 12.2% for T. tenax. The 55
periodontal disease group had higher prevalence of E. gingivalis and T. tenax compared to the 56
healthy group (p<0.001). Increasing age was associated with higher prevalence of E. gingivalis 57
(p=0.008) and T. tenax (p=0.019), in the entire study population. The number of cases of 58
colonization detected by microscopic observation was lower for any of the oral parasites, as 59
compared to diagnosis by PCR (40.7% vs. 71.7%, p<0.001 for E. gingivalis and 4.3% vs. 60
12.2%, p=0.007 for T. tenax). The higher prevalence of oral parasites among patients with 61
periodontal disease might point to their potential contribution in the disease and its severity. 62
63
64
65
66
67
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
4
IMPORTANCE 68
Periodontal disease has a high prevalence globally, with adverse effects on the quality of life 69
for affected individuals. Despite the presence of several studies that investigated the role of 70
oral parasites in periodontal disease, reliable conclusions about this matter remained elusive 71
mainly due to utilization of microscopy in parasite detection. The current study provides new 72
insights into the epidemiology and prevalence of the two oral parasites (Entamoeba gingivalis 73
and Trichomonas tenax) in patients with various stages of periodontal disease in comparison 74
to healthy adults. In addition, we describe the potential role of oral colonization by parasites as 75
a risk factor for development of periodontal disease and its severity using a molecular-based 76
approach. 77
78
79
80
81
82
83
84
85
86
87
88
89
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
5
Introduction 90
In recent years, the role of microbiota in establishing and maintaining a healthy status among 91
humans has been demonstrated by molecular methods (1-3). The oral microbiota was no 92
exception, and its disruption has been shown to result in a various range of oral diseases 93
including gingivitis and periodontitis (4, 5). This disruption in oral microbiota is termed 94
dysbiosis, in contrast to eubiosis defined as the complex interactions of different resident 95
microbes that result in an equilibrium to maintain the healthy state of the ecologic niche, which 96
is the oral cavity in this case (4-7). 97
Periodontal disease represents a state of chronic inflammation in gingiva, bone and supporting 98
ligaments (8, 9). The physiologic healthy state of gingiva can be defined as the total absence 99
or minimal levels of clinical inflammation of the periodontium with normal support (no loss 100
affecting attachment or bone) (10, 11). The identification of plaque‐induced gingivitis relies on 101
the presence of bleeding on probing with an intact periodontium and/or visible inflammation 102
and this condition can be reversed back to a healthy state if managed properly (11, 12). 103
Periodontitis results in destruction of the periodontal ligament, cementum and alveolar bone. 104
Inflammation and microbiota of periodontitis can be cured but tissues are not healed back to 105
their initial volume, organization, and shape, thus necessitating continuous maintenance of 106
good oral hygiene (11, 13-15). 107
Despite the lack of accurate and recent estimates of its prevalence, periodontal disease is 108
considered among the most common conditions affecting all age groups with predilection for 109
the elderly (6, 16). As of 2010, the prevalence of periodontitis was 47% among adults aged 30 110
and above in the United States, while the global prevalence of severe periodontitis was 11%, 111
with higher estimates for gingivitis (17-19). In addition, periodontitis is considered an 112
important cause of teeth loss in older adults, which adversely affects the quality of life (20). 113
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
6
The underlying etiology and pathogenesis of periodontal disease has been linked to microbial 114
dysbiosis (21, 22). However, the exact specific roles of different microbes in the dental plaque 115
that lead to the development of periodontal disease remains an enigma (7, 23). In addition, the 116
initiating factors for microbial dysbiosis in the oral cavity remains unclear and the study of 117
these factors is a subject for ongoing research (5). 118
Several factors have been linked to an increased incidence of periodontal disease and these can 119
be divided into non-modifiable and modifiable factors (24). Examples of the former include 120
aging, genetic predisposition, and osteoporosis, whereas the later include smoking, diabetes 121
mellitus, psychological stress, alcohol consumption and poor oral hygiene (24-31). 122
The role of the parasitic fraction of the oral microbiome, namely: Entamoeba gingivalis and 123
Trichomonas tenax, is considered among the proposed models regarding the contributing 124
factors to the development of periodontal disease (32, 33). Several studies aimed to investigate 125
parasitic oral colonization among healthy individuals and those with periodontal disease with 126
remarkably variable results (34-41). Such variability can be related to adoption of different 127
approaches for parasite detection, the existence of previously unknown genetic variants of oral 128
parasites, in addition to limitations of small sample sizes, and possible bias in selection of study 129
subjects among others as reviewed recently (42, 43). 130
Thus, the objective of the current study was to examine potential differences of the two 131
reference methods for oral parasite detection (microscopy vs. PCR), which might help to 132
explain the differences observed between studies. In addition, we aimed to investigate the 133
prevalence of both parasites in health and periodontal disease, to check for possible regional 134
specificities in Jordan. Also, we aimed to better define the place of gingivitis in the 135
physiopathology of periodontal disease using parasite colonization. Finally, we aimed to 136
identify the variables that might be associated with increased likelihood of harboring these 137
parasites in health and disease. 138
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
7
Results 139
Study population 140
The total number of study participants who were eligible to be included in the final analysis 141
was 237, distributed as follows: healthy group (n=94, 39.7%), gingivitis group (n=53, 22.4%) 142
and periodontitis group (n=90, 38.0%, Table 1). Significant differences among the three study 143
groups were found for the following factors: the median age of the healthy group was younger 144
compared to the two other groups combined (24 vs. 44 years, p<0.001, Mann-Whitney U test 145
[M-W]). The periodontitis group had an older median age compared to the two other groups 146
(p<0.001, Kruskall-Wallis test [K-W], Table 1). The percentage of smokers in the healthy 147
group was lower in comparison to the disease group with ex-smokers excluded (31.9% vs. 148
50.3%, p=0.004, χ2 test). The monthly income was the lowest among the periodontitis group 149
and the highest among the healthy group (p<0.001, K-W). In addition, the periodontitis group 150
had the lowest overall level of dental care (p<0.001, K-W) and the highest body mass index 151
(BMI) levels (p=0.003, K-W, Table 1). 152
The prevalence of oral parasites in the study population 153
To estimate the overall prevalence of E. gingivalis and T. tenax, the conventional PCR results 154
were available from the 237 individuals of the three groups for final analysis. The overall 155
prevalence of E. gingivalis among the entire study population was 71.7% (95% confidence 156
interval [CI]: 65.7% to 77.1%), while the overall prevalence for T. tenax was 12.2% (95% CI: 157
8.6% to 17.1%). 158
Concurrent detection of the two oral parasites (dual colonization) was detected in 26 study 159
subjects yielding a prevalence of 11.0% (95% CI: 7.6% to 15.6%). Among the 29 study subjects 160
with T. tenax colonization, E. gingivalis was also present in 26 individuals (89.7%). 161
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
8
Divided by the study groups, the prevalence of E. gingivalis was the highest among the 162
periodontitis group (n=80, 88.9%) compared to gingivitis (n=45, 84.9%) and healthy group 163
(n=45, 47.9%). The difference was statistically significant upon comparing the healthy group 164
to gingivitis and periodontitis groups (p<0.001 for both comparisons, χ2 test). However, the 165
difference was not significant upon comparing the gingivitis group with the periodontitis group 166
(p=0.603, χ2 test). For T. tenax, the prevalence increased starting from 3.2% in the heathy 167
group, to 5.7% in the gingivitis group and ending in 25.6% in the periodontitis group. The 168
difference was not significant by comparing the healthy and gingivitis groups (p=0.668, χ2 test), 169
but significant results were noticed upon comparing the periodontitis group to healthy and 170
gingivitis groups (p<0.001 and 0.003 respectively for the two comparisons, χ2 test). 171
Factors associated with higher prevalence of oral parasites in the whole study 172
population 173
The entire study population comprised 122 males and 115 females. T. tenax was detected more 174
frequently among males compared to females (16.4% vs. 7.8%, p=0.044, χ2 test). In addition, 175
E. gingivalis and dual colonization showed the following gender prevalence, that lacked 176
statistical significance (74.6% vs. 68.7%; 14.8% vs. 7.0%, p=0.314; p=0.055, χ2 test). 177
For both oral parasites E. gingivalis and T. tenax, higher prevalence of colonization was found 178
among the study subjects with the lowest income (p<0.001 for E. gingivalis, p=0.010 for T. 179
tenax, χ2 test). No previous history of dental care was associated with higher prevalence of E. 180
gingivalis (p<0.001, χ2 test), whereas higher levels of colonization by T. tenax was associated 181
with Non-Jordanian nationality (p=0.010, χ2 test) and higher BMI (p=0.012, χ2 test). 182
The bleeding index levels were higher among study subjects positive for E. gingivalis and T. 183
tenax (mean: 0.53 vs. 0.20, and 0.73 vs. 0.39, respectively p<0.001, M-W). For the plaque 184
index, significant difference was only found among individuals positive for E. gingivalis 185
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
9
(mean: 0.79 vs. 0.55, p<0.001, M-W). The following factors did not give significant differences 186
in colonization by either of the two oral parasites: smoking, smoking exposure through pack-187
year evaluation, history of diabetes, family history of gum disease, alcohol use and 188
osteoporosis. 189
Factors associated with higher prevalence of oral parasites in each study group 190
The analysis of the variables associated with higher prevalence of colonization by oral parasites 191
divided by the three groups revealed the following significant results: In the healthy group, E. 192
gingivalis was detected in 100.0% of the individuals with uncontrolled diabetes compared to 193
75.0% among those with controlled diabetes and 42.5% among those without history of 194
diabetes (p=0.012, χ2 test). In the periodontitis group, all study subjects with non-Jordanian 195
nationality were positive for T. tenax (n=4) compared to 22.1% among Jordanians (p<0.001, 196
χ2 test) and individuals with BMIs higher than 25 had a prevalence of E. gingivalis of 93.4% 197
compared to 78.6% among individuals with BMIs less than 25 (p=0.039, χ2 test) and a similar 198
pattern was observed for T. tenax with 10.7% among individuals with BMIs less than 25 vs. 199
32.8% among individuals with BMIs higher than 25 (p=0.027, χ2 test). 200
Association of oral parasites with periodontal disease severity 201
Data on the type of periodontal disease (localized vs. generalized) was available from 130 study 202
subjects. The localized type comprised 18 individuals as opposed to 112 individuals with 203
generalized periodontal disease. T. tenax was only detected among individuals with generalized 204
periodontal disease compared to its total absence among those with localized periodontal 205
disease (19.6% vs 0.0%. p=0.039, χ2 test) and no dual colonization was detected either in the 206
localized group compared to generalized group (p=0.051, χ2 test). Despite the higher 207
prevalence of both oral parasites in individuals with advanced stage and grade of disease, no 208
statistical significance was detected. 209
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
10
210
Comparing the accuracy of microscopic examination to molecular detection for oral 211
parasites 212
To assess the sensitivity of microscopic examination of wet mounts in the evaluation of 213
colonization by oral parasites to molecular detection using conventional PCR, we compared 214
the rate of positivity for each method. Microscopic examination detected E. gingivalis in 94 215
out of 231 (40.7%) specimens analyzed using this method compared to positivity rate of 71.7% 216
using PCR (p<0.001, χ2 test) and missing a total of 76 cases. For T. tenax, microscopic 217
examination detected only 10 out of 231 (4.3%) specimens compared to 12.2% using PCR 218
(p=0.002, χ2 test) and missing a total of 19 cases. Stratified by the study group, the largest 219
proportion of missed cases of E. gingivalis was noticed among healthy group (73.3%) 220
compared to gingivitis group (40.5%) and periodontitis group (26.0%, p<0.001, linear-by-221
linear test for association [LBL]). For T. tenax, all cases were missed in the healthy and 222
gingivitis groups, while the missing rate was 56.5% in the periodontitis group (p=0.066, LBL). 223
Risk factors for periodontal disease in the study population 224
The majority of risk factors for periodontal disease that were previously reported in various 225
studies were tested in this work (e.g. dental care level, smoking, DM, etc.). To analyse the 226
patterns associated with higher likelihood of having periodontal disease as a whole and per 227
disease state (gingivitis and periodontitis), we conducted multinomial logistic regression 228
analysis using variables that were classified into dichotomous outcomes as follows: For age 229
(more than 38 years vs. less than or equal to 38 years, [38 years was the median age for the 230
whole population]), gender (male vs. female), nationality (Jordanian vs. non-Jordanian), BMI 231
(more than or equal to 25 vs. less than 25), monthly income (less than 500 JD vs. more than or 232
equal to 500 JD), dental care (no dental care vs. any form of dental care), smoking (smoker vs. 233
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
11
non-smoker, [ex-smokers were excluded]), DM (controlled or non-controlled DM vs. non-234
diabetic), family history (present vs. absent), subjective evaluation of stress (more stressed if 235
the score is 0-4 vs. less stressed if the score is more than 5), alcohol use (consumer vs. non-236
consumer, [ex-consumers were excluded]), osteoporosis (present vs. absent), E. gingivalis by 237
PCR (positive vs. negative) and T. tenax by PCR (positive vs. negative). 238
For the health vs. disease groups, the most significant risk factors for development of 239
periodontal disease in the current study was colonization by E. gingivalis (p<0.001, odds ratio 240
[OR]=5.8). Other significant risk factors included monthly income that is less than 500 JD, 241
lack of dental care and higher levels of stress evaluated using the questionnaire (Tables 2, 3 242
and 4). In gingivitis compared to healthy individuals, significant risk factors included lack of 243
dental care, colonization by E. gingivalis and low monthly income, while for periodontitis vs. 244
healthy individuals, colonization by each oral parasite was an independent risk factor for the 245
disease (p=0.007, OR=5.2 for E. gingivalis and p=0.009, OR=10.1 for T. tenax, Tables 2, 3 and 246
4). 247
248
249
250
251
252
253
254
255
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
12
Discussion 256
Gingivitis and periodontitis are inflammatory conditions that can also be viewed as infectious 257
diseases (44). In the oral microbiome, the role of the bacterial fraction in periodontitis has been 258
studied extensively with accumulating evidence pointing to its contribution to the etiology of 259
the disease (45). However, the minority fraction of protozoa was not studied to a similar level 260
compared to its bacterial counterpart (32, 43, 46, 47). Thus, more studies are warranted to 261
evaluate the potential role of the human oral “protozoome” in health and disease. 262
In the current study, we investigated the prevalence and risk factors for oral colonization by 263
the currently known human oral parasites, E. gingivalis and T. tenax, for the first time in Jordan. 264
The importance of this work is related to the following aspects: First, periodontal disease 265
(gingivitis and periodontitis) has a high prevalence among individuals of different age groups, 266
which poses significant risks to public health, including various infections and potential tooth 267
loss (6, 16, 20). Second, some key elements regarding the etiology and pathophysiology of 268
periodontal disease have not been disentangled yet, hence more research is needed to decipher 269
these unresolved elements (5, 7, 23). Third, despite the uncertainties regarding the specific 270
roles of different microorganisms in periodontal disease, the accumulating evidence points to 271
conspicuous differences in the oral microbiome between health and disease and the role of oral 272
parasites in both states is yet to be clearly delineated (43). Fourth, a few studies on the 273
epidemiology of oral parasites originated from the Middle East and North Africa (MENA) 274
region, including studies from Egypt, Iran, Iraq and Saudi Arabia, without relying on molecular 275
detection for estimating the burden of these oral parasites in the countries of the region (35, 37-276
39, 48, 49). Thus, we aimed to build on the previous work that had the same objective, while 277
attempting to avoid some limitations of the previously published reports. For example, in this 278
study, each sample was based on a mixture of saliva and dental plaques as opposed to relying 279
on one of them solely for parasite detection. The advantage of this sampling approach is related 280
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
13
to improving the sensitivity of detection as oral parasites can be found in either one of these 281
sites (50). Also, we relied on contemporaneous use of the two reference methods currently 282
applied for oral parasite detection (34, 43). In addition, we tried to improve the sensitivity of 283
molecular detection in this study through using silica column-based DNA extraction method, 284
which can help to remove PCR inhibitors and we adopted sensitive PCR protocols that were 285
previously validated (34, 51, 52). 286
The main result of the study was the finding of a profoundly higher prevalence of E. gingivalis 287
(87.4%) among individuals with periodontal disease, compared to those in the healthy group 288
(47.9%) using the PCR method. For T. tenax, the estimates were much lower and significant 289
differences were found moving from 3.2% in the healthy group to 18.2% among individuals 290
with periodontal disease. To assess reproducibility of these results, a limited number of studies 291
were found (34, 36, 43, 53, 54). The comparisons were further complicated by the reliance of 292
a majority of the previous studies on microscopic detection methods (examination of wet 293
mounts or permanent stained smears) (35, 37-41). In the current study, a significant number of 294
colonization cases by the two oral parasites was missed upon using the microscopic approach. 295
One possible explanation for this discrepancy is the subjectivity of the microscopic approach 296
which depends on the skills and experience of the examiner, number of the fields examined, 297
method of microscopy used (light vs. phase-contrast), use of staining, nature of mounting 298
media, and the lag time between sampling and examination (particularly for wet mount 299
examination which depends on the viability of oral parasites, since motility is one of the 300
decisive defining features for diagnosis) (34). 301
Despite the variability in results of the previously published reports, two recurring patterns 302
were observed and were in line with our results. First, the observation of an increase in the 303
prevalence of both oral parasites moving from health to gingivitis and reaching the highest 304
levels in periodontitis (43). Second, the generally higher prevalence of E. gingivalis in 305
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
14
comparison to T. tenax in both health and disease. Interestingly, a significant association 306
between the presence of T. tenax and periodontal disease severity was also found which was 307
manifested in its total absence in localized disease. This result should be interpreted with 308
extreme caution taking into account the limited number of individuals with localized disease 309
that were included in the study (n=12). However, Marty et al hinted to the potential existence 310
of an association between oral colonization by T. tenax and severity of periodontal disease, 311
thus, our observation might not appear as an unforeseen result (33, 47). Since the current 312
consensus is the belief that the role of microbial communities rather than single microbes are 313
implicated in the development of periodontal disease, it appears that the significant differences 314
observed in this study among different groups and for the two oral parasites is genuine and the 315
potential pathogenic roles of these oral parasites should be dissected continuously similar to 316
recent work by Bao et al (21, 55). 317
In the few studies that used the same molecular approach (conventional PCR), for identification 318
of oral parasites, a couple reported a prevalence of E. gingivalis that was consistent with our 319
results (34, 54, 56). Bonner et al reported a slightly lower prevalence of 33.3% for E. gingivalis 320
among healthy individuals whereas Garcia et al results were close at 48.6%. In the two other 321
remaining studies, E. gingivalis was not detected at all among healthy individuals, however, 322
these two studies suffered from two shortcomings. First, they used different sets of primers that 323
might resulted in missing some cases particularly those with possible low parasite loads. 324
Second, the two studies included smaller sample sizes (12 and 20 samples) (36, 53). For 325
periodontitis, results were available from three studies only, and the prevalence of E. gingivalis 326
ranged from 26.9% to 80.6% (34, 36, 54). Three studies that used PCR for the detection of T. 327
tenax, reported higher prevalence among individuals with periodontitis (39, 47, 57, 58). 328
However, the reported prevalence in these studies varied considerably (26.9% vs. 40.0% and 329
70.0%), which might be related to the differences in the study populations. Another explanation 330
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
15
might be the presence of regional specificities in this type of colonization since we found a 331
statistically significant higher prevalence of T. tenax among the study subjects of non-Jordanian 332
countries of origin (all where from other MENA countries). 333
Analysis of different individual variables for possible association with increased likelihood of 334
harbouring the oral parasites was futile to say the least. Patterns in the whole population 335
differed when analysis was done by stratification into the three individual groups, and also no 336
specific patterns were consistently found in other studies (37, 58, 59). However, an interesting 337
observation that can be seen in this study is that colonization by oral parasites per se appeared 338
to be an independent risk factor for periodontal disease. Indirect indicators of a lower socio-339
economic status (low income and absence of previous dental care) appeared to have the most 340
obvious association with higher prevalence of oral parasites besides the increasing age 341
irrespective of the individual group (which might be related to an increased likelihood of 342
exposure). The known risk factors for periodontitis were not necessarily associated with higher 343
prevalence of oral parasites, which makes us inclined to propose that the presence of oral 344
parasites may not merely be a marker of the disease and might rather play a larger role that has 345
not been appreciated yet. 346
Limitations of the current work were inevitable and included difficulty in matching different 347
groups (health and disease), particularly for age and income levels, which precluded 348
conducting the study in a case-control type. The application of quantitative PCR could have 349
resolved association between the parasite load and periodontal disease, especially for E. 350
gingivalis, and this should be considered in any future work trying to link oral parasites in 351
health and disease, especially with availability of an experimentally validated protocol for such 352
an aim (60). Also, the strain variability particularly for E. gingivalis was not covered 353
completely in this work since we did not use the ST2 primers aimed at the detection of the 354
second currently known variant of E. gingivalis and this clear limitation should be considered 355
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
16
by assessing the prevalence of the other strain in the future studies (42, 54, 56). For the negative 356
samples we did not rule out inhibition of PCR completely, which can make our results an 357
underestimation of the true prevalence. 358
To conclude, the higher prevalence of human oral parasites in periodontal disease compared to 359
healthy individuals appears to be more than a mere marker for the disease and might also be 360
associated with disease severity and potential for progression. Thus, the dogmatic view of these 361
oral parasites as commensals needs to be re-evaluated and their role cannot be neglected in 362
light of the results of this study that supplement the recent articles that pointed to similar links. 363
It is recommended to conduct future studies with the same molecular approach since the sole 364
use of microscopy can lead to significant underestimation of the true prevalence of these oral 365
parasites. Future studies are needed to assess the molecular epidemiology of these oral parasites 366
and to test whether variations in strains that do exist, have a significant contribution in health 367
and disease (61). Regional specificity for T. tenax appeared to be existent in Jordanian 368
population and other studies in different geographic locations with different living standards 369
might reveal if such specificity is genuine, or if it is only a spurious correlation involving an 370
underlying factor. 371
372
373
374
375
376
377
378
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
17
Materials and Methods 379
Study design 380
The project was a prospective study with active enrolment of potential participants that took 381
place during July 2019 to December 2019 at Jordan University Hospital (JUH). We sought to 382
recruit study subjects from the following three categories: (1) Individuals with healthy gums 383
(will be referred to as “healthy group” in the rest of manuscript), (2) Individuals with gingivitis 384
(in this work, the term “gingivitis” will be applied to plaque‐induced gingivitis, rather than 385
non‐dental‐biofilm induced forms of gingivitis) and (3) individuals with periodontitis. The 386
individuals with gingivitis and those with periodontitis (the disease group) were recruited from 387
Periodontics Outpatient Clinics at JUH whereas healthy controls were recruited by active 388
approach of the JUH staff that included dentists, laboratory technicians, nurses and students at 389
the University of Jordan. 390
Study participants 391
Each healthy individual was included in the study if the following criteria were met altogether: 392
(1) Healthy gingiva on periodontal examination, (2) Bleeding index of less than 10%, and (3) 393
No previous history of periodontal diseases. The criteria for the individuals with gingivitis and 394
periodontitis were: (1) Diagnosis of the gum disease for the first time, and (2) No previous 395
history of exposure to any kind of periodontal therapy (scaling or root planing). The presence 396
of one of the following criteria resulted in non-inclusion of the potential participant in the study: 397
(1) Pregnant woman, (2) Previous history of periodontal treatment, (3) Non‐dental‐biofilm 398
induced forms of gingivitis, (4) Presence of dental implants, and (5) Orthodontics treatment. 399
Paper-based questionnaire on possible risk factors for periodontal disease 400
Data from the study participants were collected using a paper-based questionnaire that 401
comprised 17 different items (Supplementary File 1). The study participants’ data included: 402
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
18
age, gender, body mass index (BMI), monthly income, and dental care level, history of 403
smoking, alcohol consumption, diabetes mellitus, family history of gum disease and 404
medications history. In addition, nine questions were used to assess the stress-related factors, 405
with each positive response given a single point yielding a stress score that ranged from nil to 406
nine. 407
Ethical considerations 408
This study was approved by the School of Medicine and the School of Graduate Studies, 409
University of Jordan. Ethical approval was obtained from the Institutional Review Board (IRB) 410
at JUH (Ref. No. 239/2019). A written and signed informed consent was obtained from all 411
individuals who agreed to participate in the study following full explanation of the study 412
objectives and the procedure of obtaining the samples. In addition, the work was conducted 413
according to the principles of good clinical practice that have their origin in the declaration of 414
Helsinki and all individual data were treated with confidentiality. 415
Classification of study subjects into healthy, gingivitis or periodontitis groups 416
The diagnosis of gingivitis and periodontitis was based on diagnostic guidelines that were set 417
by the 2018 new classification scheme for periodontal and peri-implant diseases and conditions 418
(11). The details are provided in (Supplementary File 2). 419
Specimen collection and microscopic examination 420
Salivary and dental plaque specimens were obtained from each study subject. Supra-gingival 421
plaque was removed then the sample was taken from the deepest periodontal pocket. Dental 422
plaque samples were collected using the UNC periodontal probe (15 mm). For participants 423
with furcation involvement, the sample was taken using Nabers probe from the furcation. For 424
each participant, the salivary and dental plaque specimens were mixed together in a sterile tube. 425
A single drop of the mixture was used for immediate wet mount examination using wide-field 426
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
19
light microscopy, while the tubes were stored at −20ºC for DNA extraction and amplification. 427
For wet mount examination, the entire cover slip was inspected with 10× objective through a 428
zigzag path to ensure scanning the sample entirely and the suspicious objects (based mainly 429
the criteria defined by Bonner et al.) were examined at 40× objective (34). 430
DNA extraction and amplification 431
DNA purification was done using QIAamp DNA Mini Kit (QIAGEN) according to 432
manufacturer’s instructions. Briefly, the saliva/dental plaque specimens were brought to room 433
temperature and mixed well, followed by adding 20 μL of proteinase k to a total of 200 μL of 434
the specimen. If the specimen volume was less than 200 μL, we added a proper volume of 435
phosphate buffered saline to reach a final volume of 200 μL. This was followed by adding 200 436
μL of buffer AL to the sample/proteinase k and vortexing for until a homogenous solution was 437
formed. The mixture was then incubated at 56 °C for ten minutes. After that, 200 μL absolute 438
ethanol was added to the lysed sample a mixed by vortexing for 15 seconds followed by its 439
transfer into QIAamp Mini spin column. This was followed by centrifugation at 6000 × g for 440
one minute. Washing steps followed using buffers AW1 and AW2 and DNA elution was done 441
using 200 μL of buffer AE and centrifugation at 6000 × g for one minute. 442
For the detection of oral parasites, two sets of PCR primers were used. For E. gingivalis, we 443
used the same set of primers utilized by Bonner et al. with minor modification of the reverse 444
primer as follows: forward primer (5′-AGGAATGAACGGAACGTACA-3′) and reverse 445
primer (5′-CCATTTCCTTCTTCTATTGTTTMAC-3′) with a product size of 203 bases(34). 446
For T. tenax, we used the same set of primers utilized by Kikuta et al. as follows: PT3 forward 447
primer (5′-AGTTCCATCGATGCCATTC-3′) and PT7 reverse primer (5′-448
GCATCTAAGGACTTAGACG -3′) with product size of 776 bases (52). The PCR mix 449
comprised 5 μL of the DNA eluate, 5 μL of 5×FIREPol Master Mix (Solis BioDyne), 1 μL of 450
each primer and 13 μL of DNase/RNase free water. The steps of PCR were as follows: Initial 451
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
20
denaturation for 3.5 minutes at 94°C, 40 cycles of 1 minute at 94°C for denaturation, 1 minute 452
at 60°C for primer annealing, 1 minute at 72°C for elongation, a final elongation step for 5 453
minutes at 72°C (34, 52, 62). 454
A volume of 6 µL of the final product was assessed using for 2% agarose gel electrophoresis 455
for evaluation of the DNA product sizes. Proper positive and negative extraction and PCR 456
controls were used to ensure the quality of DNA extraction and PCR and to rule out 457
contamination. Positive controls were taken from periodontitis patients who were positive for 458
E. gingivalis and T. tenax by microscopy and that yielded the correct band sizes, while the 459
negative control was nuclease-free water. The housekeeping gene actin beta (ACTB) with 460
accession number (NG_007992.1) was used to assess PCR inhibition of the sample and to 461
ensure the efficiency of the DNA extraction procedure with the following primers: forward 5’ 462
GTCCTGTGGCATCCACGAAA 3’ and reverse 5’ AGTGAGGACCCTGGATGTGAC 3’ 463
and PCR product size of 265 bases. 464
Statistical analysis 465
Data generated from the study were cleaned using Microsoft Excel and uploaded to IBM SPSS 466
Statistics 22.0 for Windows. Chi-squared test (χ2 test), Mann-Whitney (M-W), Kruskall-Wallis 467
(K-W) and linear-by-linear test for association (LBL) tests were used when appropriate and the 468
statistical significance was considered for p<0.050. To analyse the patterns associated with 469
higher likelihood of having periodontal disease as a whole and per disease state (gingivitis and 470
periodontitis), we conducted multinomial logistic regression analysis using variables that were 471
classified into dichotomous outcomes. Confidence intervals of percentages (95% CI) were 472
calculated using modified Wald method through GraphPad calculator available freely online 473
through the following link: https://www.graphpad.com/quickcalcs/ConfInterval1.cfm 474
475
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
21
Acknowledgments 476
We would like to thank all the individuals who agreed to participate in the study. In addition, 477
we would like to thank the Staff of the Department of Dentistry and the Department of Clinical 478
Laboratories and Forensic Medicine at JUH for their help and support. Special thanks to Dr. 479
Omar Alkaradsheh, Dr. Nicola Barghout, Dr. Mais Al-Ashqar and Dr. Belal Al-Azab for 480
facilitating sample collection and laboratory work. 481
Competing interests 482
We declare that we have no competing interests nor conflicts of interests. 483
Funding 484
This study was supported by funding from the Deanship of Academic Research at the 485
University of Jordan with ref. No. (126/2019/19) granted on 30th January 2019. The Deanship 486
of Academic Research at the University of Jordan as the funding body, had no role in study 487
design, data collection and analysis, decision to publish, or preparation of the manuscript. 488
Author Contributions 489
Conceptualization: AY, AM, GÖŞ, JSR and MS 490
Funding acquisition: AM 491
Supervision: AM, JSR and MS 492
Data collection: AY, DD and DT 493
Sample collection: AY, DD and DT 494
Laboratory work: AY 495
Data analysis and interpretation: All authors 496
Statistical analysis: MS 497
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
22
Prepared tables: MS 498
Writing - original draft: MS 499
Writing - review & editing: All authors 500
501
502
503
504
505
506
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
23
References 507
1. Cho I, Blaser MJ. 2012. The human microbiome: at the interface of health and disease. 508
Nat Rev Genet 13:260-70. doi:10.1038/nrg3182. 509
2. Tsuji H, Matsuda K, Nomoto K. 2018. Counting the Countless: Bacterial Quantification 510
by Targeting rRNA Molecules to Explore the Human Gut Microbiota in Health and 511
Disease. Front Microbiol 9:1417. doi:10.3389/fmicb.2018.01417. 512
3. Siqueira JF, Jr., Rocas IN. 2017. The Oral Microbiota in Health and Disease: An 513
Overview of Molecular Findings. Methods Mol Biol 1537:127-138. doi:10.1007/978-514
1-4939-6685-1_7. 515
4. Lourenco TG, Heller D, Silva-Boghossian CM, Cotton SL, Paster BJ, Colombo AP. 516
2014. Microbial signature profiles of periodontally healthy and diseased patients. J Clin 517
Periodontol 41:1027-36. doi:10.1111/jcpe.12302. 518
5. Lamont RJ, Koo H, Hajishengallis G. 2018. The oral microbiota: dynamic communities 519
and host interactions. Nat Rev Microbiol 16:745-759. doi:10.1038/s41579-018-0089-520
x. 521
6. Kinane DF, Stathopoulou PG, Papapanou PN. 2017. Periodontal diseases. Nat Rev Dis 522
Primers 3:17038. doi:10.1038/nrdp.2017.38. 523
7. Darveau RP. 2010. Periodontitis: a polymicrobial disruption of host homeostasis. Nat 524
Rev Microbiol 8:481-90. doi:10.1038/nrmicro2337. 525
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
24
8. Di Benedetto A, Gigante I, Colucci S, Grano M. 2013. Periodontal disease: linking the 526
primary inflammation to bone loss. Clin Dev Immunol 2013:503754. 527
doi:10.1155/2013/503754. 528
9. Kononen E, Gursoy M, Gursoy UK. 2019. Periodontitis: A Multifaceted Disease of 529
Tooth-Supporting Tissues. J Clin Med 8. doi:10.3390/jcm8081135. 530
10. Lang NP, Bartold PM. 2018. Periodontal health. J Periodontol 89 Suppl 1:S9-S16. 531
doi:10.1002/JPER.16-0517. 532
11. Caton JG, Armitage G, Berglundh T, Chapple ILC, Jepsen S, Kornman KS, Mealey 533
BL, Papapanou PN, Sanz M, Tonetti MS. 2018. A new classification scheme for 534
periodontal and peri-implant diseases and conditions - Introduction and key changes 535
from the 1999 classification. J Periodontol 89 Suppl 1:S1-S8. doi:10.1002/JPER.18-536
0157. 537
12. Trombelli L, Farina R, Silva CO, Tatakis DN. 2018. Plaque-induced gingivitis: Case 538
definition and diagnostic considerations. J Periodontol 89 Suppl 1:S46-S73. 539
doi:10.1002/JPER.17-0576. 540
13. American Academy of P. 2011. Comprehensive periodontal therapy: a statement by the 541
American Academy of Periodontology *. J Periodontol 82:943-9. 542
doi:10.1902/jop.2011.117001. 543
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
25
14. Lertpimonchai A, Rattanasiri S, Arj-Ong Vallibhakara S, Attia J, Thakkinstian A. 2017. 544
The association between oral hygiene and periodontitis: a systematic review and meta-545
analysis. Int Dent J 67:332-343. doi:10.1111/idj.12317. 546
15. Zimmermann H, Zimmermann N, Hagenfeld D, Veile A, Kim TS, Becher H. 2015. Is 547
frequency of tooth brushing a risk factor for periodontitis? A systematic review and 548
meta-analysis. Community Dent Oral Epidemiol 43:116-27. doi:10.1111/cdoe.12126. 549
16. Tonetti MS, Jepsen S, Jin L, Otomo-Corgel J. 2017. Impact of the global burden of 550
periodontal diseases on health, nutrition and wellbeing of mankind: A call for global 551
action. J Clin Periodontol 44:456-462. doi:10.1111/jcpe.12732. 552
17. Jin LJ, Lamster IB, Greenspan JS, Pitts NB, Scully C, Warnakulasuriya S. 2016. Global 553
burden of oral diseases: emerging concepts, management and interplay with systemic 554
health. Oral Dis 22:609-19. doi:10.1111/odi.12428. 555
18. Eke PI, Dye BA, Wei L, Thornton-Evans GO, Genco RJ, Cdc Periodontal Disease 556
Surveillance workgroup: James Beck GDRP. 2012. Prevalence of periodontitis in 557
adults in the United States: 2009 and 2010. J Dent Res 91:914-20. 558
doi:10.1177/0022034512457373. 559
19. Nazir MA. 2017. Prevalence of periodontal disease, its association with systemic 560
diseases and prevention. Int J Health Sci (Qassim) 11:72-80. 561
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
26
20. Griffin SO, Jones JA, Brunson D, Griffin PM, Bailey WD. 2012. Burden of oral disease 562
among older adults and implications for public health priorities. Am J Public Health 563
102:411-8. doi:10.2105/AJPH.2011.300362. 564
21. Mira A, Simon-Soro A, Curtis MA. 2017. Role of microbial communities in the 565
pathogenesis of periodontal diseases and caries. J Clin Periodontol 44 Suppl 18:S23-566
S38. doi:10.1111/jcpe.12671. 567
22. Sudhakara P, Gupta A, Bhardwaj A, Wilson A. 2018. Oral Dysbiotic Communities and 568
Their Implications in Systemic Diseases. Dent J (Basel) 6. doi:10.3390/dj6020010. 569
23. Hajishengallis G. 2015. Periodontitis: from microbial immune subversion to systemic 570
inflammation. Nat Rev Immunol 15:30-44. doi:10.1038/nri3785. 571
24. Van Dyke TE, Sheilesh D. 2005. Risk factors for periodontitis. J Int Acad Periodontol 572
7:3-7. 573
25. Masumoto R, Kitagaki J, Fujihara C, Matsumoto M, Miyauchi S, Asano Y, Imai A, 574
Kobayashi K, Nakaya A, Yamashita M, Yamada S, Kitamura M, Murakami S. 2019. 575
Identification of genetic risk factors of aggressive periodontitis using genomewide 576
association studies in association with those of chronic periodontitis. J Periodontal Res 577
54:199-206. doi:10.1111/jre.12620. 578
26. Reynolds MA. 2014. Modifiable risk factors in periodontitis: at the intersection of aging 579
and disease. Periodontol 2000 64:7-19. doi:10.1111/prd.12047. 580
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
27
27. Wang CJ, McCauley LK. 2016. Osteoporosis and Periodontitis. Curr Osteoporos Rep 581
14:284-291. doi:10.1007/s11914-016-0330-3. 582
28. Liu F, Wen YF, Zhou Y, Lei G, Guo QY, Dang YH. 2018. A meta-analysis of emotional 583
disorders as possible risk factors for chronic periodontitis. Medicine (Baltimore) 584
97:e11434. doi:10.1097/MD.0000000000011434. 585
29. Koo HS, Hong SM. 2018. Prevalence and Risk Factors for Periodontitis Among 586
Patients with Metabolic Syndrome. Metab Syndr Relat Disord 16:375-381. 587
doi:10.1089/met.2018.0003. 588
30. Hong M, Kim HY, Seok H, Yeo CD, Kim YS, Song JY, Lee YB, Lee DH, Lee JI, Lee 589
TK, Ahn HS, Ko YH, Jeong SC, Chae HS, Sohn TS. 2016. Prevalence and risk factors 590
of periodontitis among adults with or without diabetes mellitus. Korean J Intern Med 591
31:910-9. doi:10.3904/kjim.2016.031. 592
31. Borojevic T. 2012. Smoking and periodontal disease. Mater Sociomed 24:274-6. 593
doi:10.5455/msm.2012.24.274-276. 594
32. Bonner M, Fresno M, Girones N, Guillen N, Santi-Rocca J. 2018. Reassessing the Role 595
of Entamoeba gingivalis in Periodontitis. Front Cell Infect Microbiol 8:379. 596
doi:10.3389/fcimb.2018.00379. 597
33. Marty M, Lemaitre M, Kemoun P, Morrier JJ, Monsarrat P. 2017. Trichomonas tenax 598
and periodontal diseases: a concise review. Parasitology 144:1417-1425. 599
doi:10.1017/S0031182017000701. 600
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
28
34. Bonner M, Amard V, Bar-Pinatel C, Charpentier F, Chatard JM, Desmuyck Y, Ihler S, 601
Rochet JP, Roux de La Tribouille V, Saladin L, Verdy M, Girones N, Fresno M, Santi-602
Rocca J. 2014. Detection of the amoeba Entamoeba gingivalis in periodontal pockets. 603
Parasite 21:30. doi:10.1051/parasite/2014029. 604
35. Ghabanchi J, Zibaei M, Afkar MD, Sarbazie AH. 2010. Prevalence of oral Entamoeba 605
gingivalis and Trichomonas tenax in patients with periodontal disease and healthy 606
population in Shiraz, southern Iran. Indian J Dent Res 21:89-91. doi:10.4103/0970-607
9290.62821. 608
36. Trim RD, Skinner MA, Farone MB, Dubois JD, Newsome AL. 2011. Use of PCR to 609
detect Entamoeba gingivalis in diseased gingival pockets and demonstrate its absence 610
in healthy gingival sites. Parasitol Res 109:857-64. doi:10.1007/s00436-011-2312-9. 611
37. Ibrahim S, Abbas R. 2012. Evaluation of Entamoeba gingivalis and Trichomonas tenax 612
in patients with periodontitis and gingivitis and its correlation with some risk factors. 613
Journal of baghdad college of dentistry 24:158-162. 614
38. Hassan SS, Madkour GG, Henin RW, Gad SWF, El-Aal AAA. 2019. Is Entamoeba 615
Gingivalis a Risk Factor for Periodontal Diseases? A Case-Control Study. Perio J 3:18-616
28. 617
39. Athari A, Soghandi L, Haghighi A, Kazemi B. 2007. Prevalence of oral trichomoniasis 618
in patients with periodontitis and gingivitis using PCR and direct smear. Iranian Journal 619
of Public Health:33-37. 620
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
29
40. Al-hamiary AK, Kezar MY, Al-Khafaji YA. 2011. Prevalence of Oral Protozoa in 621
Periodontitis and Gingivitis Patients Whose Attended to Clinics Periodontics, Dentistry 622
College\Babylon Univ. IASJ 3:179-184. 623
41. Yazar S, Cetinkaya U, Hamamci B, Alkan A, Sisman Y, Esen C, Kolay M. 2016. 624
Investigation of Entamoeba gingivalis and Trichomonas tenax in Periodontitis or 625
Gingivitis Patients in Kayseri. Turkiye Parazitol Derg 40:17-21. 626
doi:10.5152/tpd.2016.4351. 627
42. Garcia G, Ramos F, Martinez-Hernandez F, Hernandez L, Yanez J, Gaytan P. 2018. A 628
new subtype of Entamoeba gingivalis: "E. gingivalis ST2, kamaktli variant". Parasitol 629
Res 117:1277-1284. doi:10.1007/s00436-018-5798-6. 630
43. Julien Santi-Rocca. 2020. The Protozoome of the Periodontal Sulcus: From Health to 631
Disease.,, p pp 113-131. In Nancy Guillen. (ed), Eukaryome Impact on Human Intestine 632
Homeostasis and Mucosal Immunology, doi:https://doi.org/10.1007/978-3-030-44826-633
4_9. Springer, Cham. 634
44. Cekici A, Kantarci A, Hasturk H, Van Dyke TE. 2014. Inflammatory and immune 635
pathways in the pathogenesis of periodontal disease. Periodontol 2000 64:57-80. 636
doi:10.1111/prd.12002. 637
45. Teles R, Teles F, Frias-Lopez J, Paster B, Haffajee A. 2013. Lessons learned and 638
unlearned in periodontal microbiology. Periodontol 2000 62:95-162. 639
doi:10.1111/prd.12010. 640
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
30
46. Deng ZL, Szafranski SP, Jarek M, Bhuju S, Wagner-Dobler I. 2017. Dysbiosis in 641
chronic periodontitis: Key microbial players and interactions with the human host. Sci 642
Rep 7:3703. doi:10.1038/s41598-017-03804-8. 643
47. Bisson C, Dridi SM, Machouart M. 2019. Assessment of the role of Trichomonas tenax 644
in the etiopathogenesis of human periodontitis: A systematic review. PLoS One 645
14:e0226266. doi:10.1371/journal.pone.0226266. 646
48. Ismail KA, Jastaniyyah MA, Al-Nemari NA, Al-Ghamdi HM, Al-Hamed RA. 2017. 647
Detection of Trichomonas tenax (T. tenax) in bad oral hygiene Saudi patients in Taif 648
city. International Educational Applied Scientific Research Journal 2. 649
49. el Hayawan IA, Bayoumy MM. 1992. The prevalence of Entamoeba gingivalis and 650
Trichomonas tenax in periodontal disease. J Egypt Soc Parasitol 22:101-5. 651
50. Rashidi Maybodi F, Haerian Ardakani A, Fattahi Bafghi A, Haerian Ardakani A, 652
Zafarbakhsh A. 2016. The Effect of Nonsurgical Periodontal Therapy on Trichomonas 653
Tenax and Entamoeba Gingivalis in Patients with Chronic Periodontitis. J Dent (Shiraz) 654
17:171-6. 655
51. Schrader C, Schielke A, Ellerbroek L, Johne R. 2012. PCR inhibitors - occurrence, 656
properties and removal. J Appl Microbiol 113:1014-26. doi:10.1111/j.1365-657
2672.2012.05384.x. 658
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
31
52. Kikuta N, Yamamoto A, Fukura K, Goto N. 1997. Specific and sensitive detection of 659
Trichomonas tenax by the polymerase chain reaction. Lett Appl Microbiol 24:193-7. 660
doi:10.1046/j.1472-765x.1997.00379.x. 661
53. Kikuta N, Yamamoto A, Goto N. 1996. Detection and identification of Entamoeba 662
gingivalis by specific amplification of rRNA gene. Can J Microbiol 42:1248-51. 663
doi:10.1139/m96-161. 664
54. Garcia G, Ramos F, Maldonado J, Fernandez A, Yanez J, Hernandez L, Gaytan P. 2018. 665
Prevalence of two Entamoeba gingivalis ST1 and ST2-kamaktli subtypes in the human 666
oral cavity under various conditions. Parasitol Res 117:2941-2948. 667
doi:10.1007/s00436-018-5990-8. 668
55. Bao X, Wiehe R, Dommisch H, Schaefer AS. 2020. Entamoeba gingivalis Causes Oral 669
Inflammation and Tissue Destruction. J Dent Res 670
doi:10.1177/0022034520901738:22034520901738. doi:10.1177/0022034520901738. 671
56. Dubar M, Zaffino ML, Remen T, Thilly N, Cunat L, Machouart MC, Bisson C. 2020. 672
Protozoans in subgingival biofilm: clinical and bacterial associated factors and impact 673
of scaling and root planing treatment. J Oral Microbiol 12:1693222. 674
doi:10.1080/20002297.2019.1693222. 675
57. Mehr AK, Zarandi A, Anush K. 2015. Prevalence of Oral Trichomonas tenax in 676
Periodontal Lesions of Down Syndrome in Tabriz, Iran. J Clin Diagn Res 9:ZC88-90. 677
doi:10.7860/JCDR/2015/14725.6238. 678
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
32
58. Bracamonte-Wolf C, Orrego PR, Munoz C, Herrera D, Bravo J, Gonzalez J, Varela H, 679
Catalan A, Araya JE. 2019. Observational cross-sectional study of Trichomonas tenax 680
in patients with periodontal disease attending a Chilean university dental clinic. BMC 681
Oral Health 19:207. doi:10.1186/s12903-019-0885-3. 682
59. Albuquerque Júnior RLCd, Melo CMd, Santana WAd, Ribeiro JL, Silva FA. 2011. 683
Incidence of Entamoeba gingivalis and Trichomonas tenax in samples of dental biofilm 684
and saliva from patients with periodontal disease. RGO Revista Gaúcha de Odontologia 685
(Online) 59:35-40. 686
60. Zaffino M, Dubar M, Debourgogne A, Bisson C, Machouart M. 2019. Development of 687
a new TaqMan PCR assay for the detection of both Entamoeba gingivalis genotypes. 688
Diagn Microbiol Infect Dis 95:114886. doi:10.1016/j.diagmicrobio.2019.114886. 689
61. Cembranelli SB, Souto FO, Ferreira-Paim K, Richinho TT, Nunes PL, Nascentes GA, 690
Ferreira TB, Correia D, Lages-Silva E. 2013. First evidence of genetic intraspecific 691
variability and occurrence of Entamoeba gingivalis in HIV(+)/AIDS. PLoS One 692
8:e82864. doi:10.1371/journal.pone.0082864. 693
62. Kucknoor AS, Mundodi V, Alderete J. 2009. Genetic identity and differential gene 694
expression between Trichomonas vaginalis and Trichomonas tenax. BMC Microbiol 695
9:58. doi:10.1186/1471-2180-9-58. 696
697
698
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
Table 1. Characteristics of the study population divided by the three study groups
Individual group Healthy Gingivitis Periodontitis P-value
6
Characteristic N5 (%) N (%) N (%)
94 (39.7) 53 (22.4) 90 (38.0)
Median age in years (SD1) 24 (13.5) 36 (14.5) 48 (10.9) <0.001
Gender
Male 40 (42.6) 29 (54.7) 53 (58.9) 0.075
Female 54 (57.4) 24 (45.3) 37 (41.1)
Nationality
Jordanian 88 (93.6) 48 (90.6) 86 (95.6) 0.498
Non-Jordanian 6 (6.4) 5 (9.4) 4 (4.4)
Alcohol consumption
Yes 5 (5.3) 1 (1.9) 2 (2.2) 0.921
No 89 (94.7) 52 (98.1) 88 (97.8)
Smoking
Non-smoker 63 (67.0) 26 (49.1) 42 (46.7)
0.012 Smoker 30 (31.9) 27 (50.9) 45 (50.0)
Ex-smoker 1 (1.1) 0 3 (3.3)
Income
Less than 500 JD2
15 (16.0) 29 (55.8) 70 (77.8)
<0.001 500-1000 JD 36 (38.3) 17 (32.7) 19 (21.1)
More than 1000 JD 43 (45.7) 6 (11.5) 1 (1.1)
Dental care level
None 23 (24.5) 37 (71.2) 71 (78.9)
<0.001 Annual inspection 6 (6.4) 4 (7.7) 3 (3.3)
Regular monitoring and 33 (35.1) 3 (5.8) 4 (4.4)
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
Irregular monitoring and 32 (34.0) 8 (15.4) 12 (13.3)
BMI3
Less than 20 9 (9.7) 6 (11.3) 6 (6.7)
0.003 20-25 41 (44.1) 21 (39.6) 22 (24.7)
25-30 25 (26.9) 17 (32.1) 29 (32.6)
More than 30 18 (19.4) 9 (17.0) 32 (36.0)
Osteoporosis
Yes 4 (4.3) 6 (11.5) 7 (8.1) 0.271
No 88 (95.7) 46 (88.5) 79 (91.9)
Diabetes4
No 80 (85.1) 50 (94.3) 76 (84.4)
0.194 Yes, latest HbA1c ≤ 7.0 12 (12.8) 2 (3.8) 9 (10.0)
Yes, latest HbA1c > 7.0 2 (2.1) 1 (1.9) 5 (5.6)
1SD: Standard deviation,
2JD: Jordanian Dinar,
3BMI: Body mass index,
4HbA1c:
Glycosylated hemoglobin levels to estimate glycemic control, 5N: Number,
6P-value:
Calculated using Kruskal Wallis test.
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
Table 2. Potential risk factors for periodontal disease upon comparing the healthy individuals
vs. those with periodontal disease (gingivitis or periodontitis)
Potential risk factors for periodontal disease
vs. healthy individuals
P value9
OR10
95% CI11
Entamoeba gingivalis by PCR (positive vs.
negative)1
<0.001 5.84 2.18-15.66
Monthly income (less than 500 JD vs. more
than or equal to 500 JD)2
<0.001 5.43 2.18-13.50
Dental care (no dental care vs. any form of
dental care)
0.001 4.45 1.89-10.50
Subjective evaluation of stress (more stressed
vs. less stressed)3
0.006 3.87 1.47-10.20
Trichomonas tenax by PCR (positive vs.
negative)
0.077 4.05 0.86-19.07
Age (more than 38 years vs. less than or equal to
38 years)4
0.180 2.01 0.73-5.54
Osteoporosis (present vs. absent) 0.466 1.90 0.34-10.63
Smoking (smoker vs. non-smoker)5
0.181 1.82 0.76-4.38
Gender (male vs. female) 0.461 1.40 0.57-3.47
Family history (present vs. absent) 0.656 1.25 0.48-3.26
Nationality (Jordanian vs. Non-Jordanian) 0.904 1.13 0.17-7.67
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
BMI (more than or equal to 25 vs. less than 25)6
0.754 0.86 0.35-2.16
Alcohol use (consumer vs. non-consumer)7 0.395 0.35 0.03-3.87
DM (controlled or non-controlled DM vs. non-
diabetic)8
0.053 0.26 0.07-1.02
1PCR: Conventional polymerase chain reaction,
2JD: Jordanian Dinar,
3Subjective evaluation
of stress: using a nine-item questionnaire, 4Age: The median age for the entire study
population was 38 years, 5Smoking: Ex-smokers were excluded from analysis (n=4),
6BMI:
Body mass index, 7Alcohol use: Ex-users of alcohol were excluded from analysis (n=3),
8DM: Diabetes mellitus. Significant results are shown in bold,
9P-value: Calculated using
multinomial logistic regression and likelihood ratio tests, 10
OR: Odds ratio, 11
CI: Confidence
interval.
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
Table 3. Risk factors for gingivitis and compared to healthy individuals in the current
study population
Potential risk factors for gingivitis vs. healthy
individuals
P value9
OR10
95% CI11
Dental care (no dental care vs. any form of
dental care)
0.001 5.78 2.13-15.70
Entamoeba gingivalis by PCR (positive vs.
negative)1
0.002 5.79 1.86-18.02
Monthly income (less than 500 JD vs. more
than or equal to 500 JD)2
0.010 3.87 1.39-10.84
DM (controlled or non-controlled DM vs. non-
diabetic)3
0.078 0.21 0.04-1.19
Subjective evaluation of stress (more stressed vs.
less stressed)4
0.115 2.38 0.81-6.97
Osteoporosis (present vs. absent) 0.129 4.17 0.66-26.36
Smoking (smoker vs. non-smoker)5
0.311 1.66 0.62-4.40
Gender (male vs. female) 0.425 1.51 0.55-4.11
Alcohol use (consumer vs. non-consumer)6
0.452 0.38 0.03-4.69
BMI (more than or equal to 25 vs. less than 25)7
0.528 0.73 0.27-1.97
Family history (present vs. absent) 0.744 0.83 0.27-2.55
Age (more than 38 years vs. less than or equal to
38 years)8
0.798 0.86 0.27-2.76
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
Trichomonas tenax by PCR (positive vs.
negative)
0.903 0.88 0.11-7.11
Nationality (Jordanian vs. Non-Jordanian) 0.934 1.09 0.16-7.60
1PCR: Conventional polymerase chain reaction,
2JD: Jordanian Dinar,
3DM: Diabetes
mellitus, 4
Subjective evaluation of stress: using a nine-item questionnaire, 5Smoking: Ex-
smokers were excluded from analysis (n=4), 6Alcohol use: Ex-users of alcohol were excluded
from analysis (n=3), 7BMI: Body mass index,
8Age: The median age for the entire study
population was 38 years. Significant results are shown in bold, 9P-value: Calculated using
multinomial logistic regression and likelihood ratio tests, 10
OR: Odds ratio, 11
CI: Confidence
interval.
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
Table 4. Risk factors for periodontitis and compared to healthy individuals in the
current study population.
Potential risk factors for periodontitis vs.
healthy individuals
P value1
OR2
95% CI3
Monthly income (less than 500 JD vs. more
than or equal to 500 JD)4
<0.001 7.70 2.65-22.33
Subjective evaluation of stress (more stressed
vs. less stressed)5
0.001 6.36 2.12-19.14
Entamoeba gingivalis by PCR (positive vs.
negative)6
0.007 5.21 1.58-17.25
Trichomonas tenax by PCR (positive vs.
negative)
0.009 10.09 1.77-57.53
Age (more than 38 years vs. less than or equal
to 38 years)7
0.011 4.43 1.40-14.05
Dental care (no dental care vs. any form of
dental care)
0.014 3.68 1.30-10.40
DM (controlled or non-controlled DM vs. non-
diabetic)8
0.102 0.28 0.06-1.29
Smoking (smoker vs. non-smoker)9 0.162 2.09 0.74-5.87
Family history (present vs. absent) 0.375 1.65 0.54-5.01
Alcohol use (consumer vs. non-consumer)10
0.416 0.17 0.01-12.59
Gender (male vs. female) 0.550 1.39 0.48-4.03
Nationality (Jordanian vs. Non-Jordanian) 0.718 1.56 0.14-17.30
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint
BMI (more than or equal to 25 vs. less than 25)11
0.917 1.06 0.37-3.06
Osteoporosis (present vs. absent) 0.973 0.97 0.13-7.07
1P-value: Calculated using multinomial logistic regression and likelihood ratio tests,
2OR:
Odds ratio, 3CI: Confidence interval,
4JD: Jordanian Dinar,
5Subjective evaluation of stress:
using a nine-item questionnaire, 6PCR: Conventional polymerase chain reaction,
7Age: The
median age for the entire study population was 38 years, 8DM: Diabetes mellitus,
9Smoking:
Ex-smokers were excluded from analysis (n=4), 10
Alcohol use: Ex-users of alcohol were
excluded from analysis (n=3), 11
BMI: Body mass index. Significant results are shown in
bold.
. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)
The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint