Oligomerization of the Response Regulator ComE fromStreptococcus mutans Is Affected by Phosphorylation

David C. I. Hung,a Jennifer S. Downey,a Jens Kreth,b Fengxia Qi,b Wenyuan Shi,c Dennis G. Cvitkovitch,d and Steven D. Goodmana

Division of Biomedical Science, Herman Ostrow School of Dentistry of University of Southern California, Los Angeles, California, USAa; Department of Microbiology andImmunology, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma, USAb; Department of Oral Biology and Medicine, UCLA School of Dentistry, LosAngeles, California, USAc; and Dental Research Institute, Faculty of Dentistry, University of Toronto, Toronto, Ontario, Canadad

We have previously characterized the interactions of the response regulator ComE from Streptococcus mutans and DNA bindingsites through DNase I footprinting and electrophoretic mobility shift assay analysis. Since response regulator functions are oftenaffected by their phosphorylation state, we investigated how phosphorylation affects the biochemical function of ComE. Unlikemany response regulators, we found that the phosphorylation state of ComE does not likely play a role in DNA binding affinitybut rather seems to induce the formation of an oligomeric form of the protein. The role of this oligomerization state for ComEfunction is discussed.

One of the ways for bacteria to monitor external conditions andadjust their structure, physiology, and behavior is through the

expression or repression of genes by a network of environmental sen-sors and response regulators collectively known as two-componentsignal transduction systems (TCSTS) (28). The prototypical TCSTShas two protein components: a sensor histidine kinase (HK), oftenlocated in the membrane, which monitors an environmental pa-rameter(s), and a cytoplasmic response regulator (RR), which me-diates changes in gene expression in response to specific signals(27, 31). These TCSTS are associated with a variety of domainsthat function as “input” and “output” elements (28). A typical HKcontains an N-terminal, membrane-associated sensor domainand a C-terminal phosphotransferase domain, made up of a cyto-solic H-box and an ATPase domain. Upon detecting a specificenvironmental stimulus (pH, limiting or excess nutrient, peptide,temperature, osmolarity, etc.), the ATPase domain mediates au-tophosphorylation of the HK at a conserved histidine residue inthe H-box (36). This phosphoryl group is subsequently trans-ferred to an aspartic acid residue of the RR receiver domain, lead-ing to activation of the RR. A typical RR consists of an N-terminalreceiver domain and a C-terminal effector domain. Once acti-vated, the RR then binds to specific regions on the DNA, whichleads to the activation/repression of genes involved in the adaptiveresponse (19). In addition, the ability of these HKs to be faithful totheir cognate RR is still an open question since there is evidence ofcross talk in vitro between noncognate HKs and RRs (34). Forexample a Bacillus subtilis RR has been shown to be sufficientlyphosphorylated when expressed and purified from Escherichia coliby either acetyl-P or another HK (17). Finally, there are even someHKs that respond to multiple signals, like Salmonella enterica sero-var Typhimurium PhoQ, which can sense and respond to bothmagnesium and pH (1), thus adding further complexity to under-standing TCSTS.

Currently, there are 14 known TCSTS in Streptococcus mutans(2). We are particularly interested in the ComED system involvedin the development of competence for natural transformation,bacteriocin production, biofilm formation, and acid tolerance inS. mutans (20, 22). Competence is a physiological state in whichbacteria are able to take up and integrate exogenous free DNAfrom their environment, which enables the recipient organism to

acquire novel genes such as those encoding antibiotic resistanceand other virulence factors (6, 13, 14, 16, 20, 21, 38). Therefore,natural genetic transformation can be an important mechanism toallow bacteria to adapt to a changing environment (6, 16).

In our previous work, we presented quantitative DNA bindingstudies to show that ComE binds to two imperfect direct repeatswithin the intergenic region of nlmC-comC (10). We further char-acterized the binding of ComE to other related sites and identifieda ComE consensus binding site. We extend this work here withmutational and cross-linking analyses to characterize the phos-phorylation state of ComE in S. mutans for the first time. We showthat phosphorylation of ComE has little effect on DNA bindingbut rather strongly promotes oligomer formation. A model forComE regulation is proposed and discussed.

MATERIALS AND METHODSConstruction of D60A and D60E mutations in ComE. To generate twoseparate point mutations in ComE, comE was amplified from S. mutansUA159 chromosomal DNA using ComE-F and ComE-R (Table 1) andcloned into pCR2.1-Topo (Invitrogen, Carlsbad, CA). To modify the pu-tative conserved aspartic acid residue (Asp60) required for phosphoryla-tion, primer ComE-DA (Table 1) changes the GAT (Asp) triplet to GCT(Ala) whereas primer ComE-DE introduces GAG (Glu). Inverse PCR wasperformed with the Elongase enzyme (Invitrogen) to amplify the wholeplasmid with the specific mutagenesis primers (ComE-DA or ComE-DE)and the inverse primer ComE-inv. The primers were then phosphorylatedfor subsequent ligation of the linear plasmid carrying the mutagenizedcomE using standard methods (32). PCR products were purified, ligated,transformed into E. coli DH5�, and selected with ampicillin, and the in-troduction of the mutation was confirmed by sequencing. Subsequently,comE D60A and D60E fragments were cloned into the BamHI and HindIIIsites of expression vector pQE30 (Qiagen) and transformed into E. coli

Received 22 November 2011 Accepted 20 December 2011

Published ahead of print 30 December 2011

Address correspondence to Steven D. Goodman, sgoodman@usc.edu.

D. C. I. Hung and J. S. Downey contributed equally to this article.

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JB.06565-11

0021-9193/12/$12.00 Journal of Bacteriology p. 1127–1135 jb.asm.org 1127

on Septem

ber 16, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

DH5� to generate SG482 and SG500, ComE:DE and ComE:DA, respec-tively, as done previously with wild-type ComE, SG481 (10). Overexpres-sion and purification of these proteins were performed as described pre-viously for wild-type ComE (13).

Construction of ComE in an E. coli strain lacking pta-ackA back-ground. AJW2013, a gift from Alan Wolfe (University of Illinois at Chi-cago), is an E. coli strain lacking pta and ackA, resulting in no internalacetyl-P production (11, 42). To aid in the expression of ComE, AJW2013was transformed with a repressor plasmid, pREP4 (Qiagen), which con-fers a high level of lac repression in trans (SG611, Table 2). Next,pQE30�comE was transformed into SG611 and ComE612 was subse-quently purified from this mutant strain (SG612) as described previously(13).

In vitro phosphorylation of ComE by phosphoramidate (PA) andcross-linking by dimethyl suberimidate (DMS). To phosphorylateComE, 11.6 �M ComE was incubated with 62.5 mM PA (gift of LindaKenney, University of Illinois at Chicago) in phosphorylation buffer (50mM Tris [pH 7.5], 20 mM MgCl2, 50 mM KCl) in a total volume of 20 �lfor 2 h at room temperature. For the cross-linking reaction, 8.7 �M phos-phorylated ComE was incubated with 25 mM DMS in 50 mM boric acid(pH 10) (Pierce Biotechnologies Inc.) in a total volume of 10 �l for anadditional 2 h at room temperature. Cross-linking reactions were mixedwith an equal volume of 2� sample buffer (0.005% bromophenol brilliantblue, 4% SDS, 125 mM Tris, 20% glycerol) and separated by electropho-resis on a 4 to 20% Tris-glycine gel (Invitrogen). Gels were stained withCoomassie blue to observe ComE in its unreacted and oligomerized state.

To verify the identity of ComE oligomers, Ni-NTA-Atto conjugates(Sigma), which specifically detect polyhistidine-tagged proteins, wereused according to the manufacturer’s protocol. Briefly, gels were fixed in40% ethanol-10% acetic acid for 1 h, washed twice with water and incu-bated with 1:1,000 Ni-NTA-Atto in PBST (136 mM NaCl, 2.6 mM KCl, 10mM Na2HPO4, 1.5 mM KH2PO4, 0.2% Tween 20) in the dark overnight.Finally, gels were washed in water for 2 h in the dark and scanned with thePharosFX Molecular Imager system (Bio-Rad).

DNase I footprinting assay. Footprinting assays were done as de-scribed previously (10). Briefly, labeled substrate of comC (oSG316-oSG317) was incubated with ComE in footprinting buffer at roomtemperature for 30 min. After incubation, DNase I was added for an addi-tional minute before the reaction was quenched with DNase I stop buffer. TheDNA was extracted with phenol-chloroform, ethanol precipitated, and resus-

pended in sequencing stop buffer. Reactions were separated on a 6% sequenc-ing gel and run at 40 V/cm for approximately 3 h. The gel was dried andscanned with the PharosFX Molecular Imager system.

EMSA. Electrophoretic mobility shift assays (EMSAs) were done aspreviously described (13). Briefly, 15 nM ComE was incubated at roomtemperature for 30 min in reaction buffer (52.5 mM HEPES [pH 6.5], 50�M EDTA, 9.5% glycerol, and 50 �g/ml bovine serum albumin [BSA]),100 ng salmon sperm DNA, and 1 nM isotopically labeled DNA substratein a final volume of 20 �l. Following incubation, EMSA reactions wereanalyzed on a 6% nondenaturing polyacrylamide gel, run at 10 V/cmfor 3 h, subsequently dried, and visualized with the PharosFX Molec-ular Imager system.

RESULTSQuantitative binding analysis and footprinting of mutant pro-teins ComE:DE and ComE:DA. Response regulators are oftenphosphorylated at a conserved aspartate residue, e.g., CheB andOmpR are phosphorylated at D56 and D55, respectively (18, 35).Using the SIM alignment tool for protein sequences (web.expasy.org/tools/sim), we were able to align D56 of CheB and D55 ofOmpR with D60 of ComE (data not shown). Based on this align-ment, we constructed two point mutations where D60 waschanged to either glutamic acid or alanine. The change from as-partic acid to glutamic acid extends the negative charge of the sidechain and has previously been shown to mimic the phosphory-lated state of aspartate (12). The change from aspartic acid toalanine removes the negative charge of the side chain preventingComE phosphorylation. To find out if ComE:DE and ComE:DAbind with different affinities than ComE, the equilibrium dissoci-ation constant of the two ComE mutants was determined, as de-scribed previously for ComE (10). Briefly, a binding isotherm wascreated by keeping the concentrations of purified ComE:DE andComE:DA proteins constant and varying the concentration of iso-topically labeled comC� substrate (a defined ComE single bindingsite derived from the upstream region of comC) (13). The concen-tration of DNA, which produced the half-maximal amount ofshifted complex (ComE bound to comC� substrate), was used toestimate the Kd (equilibrium dissociation constant). Although thisapproach does not identify the oligomeric state of the proteinprotomer (monomer, dimer, etc.), it does indicate the active ratioof protomer in our preparations; this quantity is identical to themaximal amount of molar equivalents of shifted DNA (Bmax). Wefound that ComE had a Kd of 3.4 � 10�9 M and a Bmax value of5.9 � 10�9 M (10), indicating that only 39% of the added 15 nMComE is active in binding DNA, given that at this point we have noevidence to suggest the oligomeric state of ComE under physio-logical conditions, we have assumed here that ComE is present asa monomer. Therefore, in order to normalize the amount of activeprotein in each binding assay, all our protein preparations were

TABLE 1 Primers used for DNase I footprinting and mutagenesis ofComE

Primer Sequence Gene target

ComE-DA 5= GATTTTCTTTTTGGCTATTGAAATC 3= ComE:DAComE-DE 5= GATTTTCTTTTTGGAGATTGAAATC 3= ComE:DEComE-inv 5= TGGTGATTGCCCTTTTCAG 3= ComE DA/DEComE-F 5= AGATAAGTAGGGTTATTAAGTTAGTAG 3= comEComE-R 5= AGTTAATAAACCATTTGAAAGTATCATTAAG 3= comEoSG316 5= CCCATTTTTAGTTTTTTGTCTG 3= comCoSG317 5= GAAAAAATCATGGATTTTCTTG 3= comC

TABLE 2 Bacterial strains used in this study

Strain Relevant characteristics Source or reference

DH5� F��80lacZ�M15 �(lacZYA-argF)U169 deoR recA1 endA1 hsdR17(rK� mK

�)phoA supE44 thi-1 gyrA96 relA1 ��

Invitrogen

SG611 E. coli AJW2013 (�ackA pta) containing pREP4 (Tetr Kanr) This studySG481 E. coli DH5� containing pQE30�comE (Ampr) 10SG482 E. coli DH5� containing pQE30�comE:DE (Ampr) This studySG500 E. coli DH5� containing pQE30�comE:DA (Ampr) This studySG612 SG611 containing pQE30�comE (Ampr Tetr Kanr) This studySG515 E. coli Top10 containing pFW5::�(nlmCp�DRII-luc) (Spcr) 13

Hung et al.

1128 jb.asm.org Journal of Bacteriology

on Septem

ber 16, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

assumed to be in a monomeric state. The Bmax for each bindingisotherm was utilized to determine the percentage of activeprotein, and then the measured Kd was divided by this numberto determine the adjusted Kd value for each protein (Table 3).As shown in Table 3, ComE:DE has a Kd value of 3.7 � 10�9 M(adjusted Kd value is 11.6), which is very similar to the ComEKd value (3.4 � 10�9 M, adjusted Kd value is 8.7) (10). Incontrast, ComE:DA has an adjusted Kd value approximately144% and 87% higher than ComE and ComE:DE, respectively.Should the oligomeric state of any of these proteins vary fromthe monomer form, it would of course alter the true value of the

Kd. Given our simple assumptions, it seems that the changes atthis putative phosphorylation site had a decidedly modest ef-fect on binding affinity.

To further characterize this binding, we performed DNase Ifootprinting. As shown in Fig. 1, DNase I footprint analysis ofComE:DE with the wild-type upstream sequence of comC andcomC� sites showed that ComE:DE protected the same regionscompared to ComE (10). Interestingly, when ComE:DA was usedin the DNase I footprinting analysis with comC and comC� sub-strates (Fig. 2), the same region of protections were observed asthose of ComE and ComE:DE; however, the protections were sig-nificantly weaker and no hypersensitive sites were observed oncomC. ComE and ComE:DE required 97.5 nM (10) and 80 nM,respectively, for strong protection, whereas 240 nM ComE:DAwas required to produce only weak protection on either comC orcomC� substrate. These weaker footprints correspond to the rel-ative Kd values (Table 3), i.e., the Kd of ComE:DA is higher thanthat of ComE and ComE:DE, which means ComE:DA has a lowerbinding affinity and explains why a greater concentration of pro-tein was required to generate a weak footprint compared to ComEand ComE:DE (Fig. 2). More importantly, the hypersensitive sitesare present in both ComE and ComE:DE, indicating a similarlyformed protein-DNA complex.

TABLE 3 Kd, Bmax, and adjusted Kd values of ComE, ComE:DE, ComE:DA, and ComE612

ProteinMeasured Kd

(� 10�9 M)a

Bmax

(� 10�9 M)a

% activemonomer

Adjusted Kd

(� 10�9 M)b

ComE 3.4 � 0.5 (10) 5.9 � 0.8 (10) 39 8.7ComE:DE 3.7 � 0.05 4.8 � 0.2 32 11.6ComE:DA 5.2 � 0.5 3.6 � 0.3 24 21.7ComE612 4.9 � 0.5 4.5 � 0.2 30 16.3a Calculated from at least three replicate experiments.b Adjusted Kd is the measured Kd divided by the % active monomer. The error wasdetermined by standard error of the mean.

FIG 1 DNase I footprint assay with ComE:DE. comC (A), comC� (B). The protected regions are shown on the right side of the figure. The solid lines on thesequence represent the direct repeats of the ComE binding sites (dotted lines on the gel), bold bases indicate the hypersensitive sites (� on the gel), and lowercaseletters are not protected. Numbers on the top of the sequences represent the position of the sequence from the ATG of comC. Lanes 1 to 3: 0, 16, and 80 nMComE:DE. Lane 4: no DNase I control.

Oligomerization of S. mutans ComE

March 2012 Volume 194 Number 5 jb.asm.org 1129

on Septem

ber 16, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

In vitro phosphorylation by small molecule phosphate do-nors. RRs typically receive a phosphate group from HKs and oftenthis phosphorylation activates the RRs for function. Studies haveshown, however, that RRs can also be phosphorylated by smallmolecule phosphodonors such as acetyl-P (41). Typically, a phos-phorylated RR binds to a DNA binding site with a higher affinitythan that of an unphosphorylated RR (7, 26). Although we haveshown that ComE binds to its binding site with high affinity (Kd,

�10�9 M), the phosphorylation state of ComE is unknown. Toinvestigate whether the addition of acetyl-P can increase the bind-ing affinity of ComE, we performed EMSA analysis of ComE bind-ing in the presence of acetyl-P. We observed that ComE binding tothe comC DNA substrate was not significantly improved with in-creasing concentrations of acetyl-P (up to 100 mM), and in fact,there appears to be diminution of the extent of the shifted com-plex (data not shown). It is possible that ComE might have alreadybeen phosphorylated endogenously when it was purified from E.coli DH5�. Ladds et al. have shown that purified Spo0A, a RRinvolved in sporulation of B. subtilis, is sufficiently phosphory-lated by either acetyl-P or another E. coli HK (17). Although todate, in vivo cases of cross talk with native HKs and RRs have onlybeen reported in mutant backgrounds under specific conditions(34). To exclude that ComE may have been phosphorylated byendogenous acetyl-P, ComE was purified from an E. coli strain,

SG612 (henceforth referred to as ComE612), which lacks the twogenes, ackA and pta, that are responsible for the production ofacetyl-P (11, 15, 41).

In Fig. 3, ComE612 generated similar footprints compared tothose by ComE (10), including the extent of protection and thehypersensitive sites. Furthermore, we show that this protein bindswith a Kd of 4.9 � 10�9 M (adjusted Kd value is 16.3), indicating amodest decrease similar to ComE:DA (ComE612’s adjusted Kd is83% higher than ComE’s adjusted Kd) but otherwise generatessimilar hypersensitive cleavages in DNase I footprinting com-pared to ComE. We did try to phosphorylate ComE612 withacetyl-P but observed no improvement in the DNA binding activ-ity in EMSA experiments (data not shown) and therefore did notattempt footprints with acetyl-P-treated ComE612.

Even though acetyl-P serves as a phosphate donor for manyRRs, there are examples of RRs that cannot be phosphorylatedwith acetyl-P, such as PhoP of B. subtilis (23). Therefore, we uti-lized another high-energy phosphate donor, PA, which has beenshown to successfully phosphorylate other RRs in vitro (25). InFig. 4, we demonstrate that when ComE is incubated with PA for2 h at room temperature, the binding declines at the higher con-centrations of treated ComE. To further test whether PA-treatedComE binds to DNA like untreated ComE, we performed DNaseI footprinting analysis. As shown in Fig. 5, PA-treated ComE gen-

FIG 2 DNase I footprint assay with ComE:DA. comC (A), comC� (B). The protected regions are shown on the right side of the figure. The solid lines on thesequence represent the direct repeats of the ComE binding sites (dotted lines on the gel), bold bases indicate hypersensitive sites (� on the gel), and lowercaseletters are not protected. Numbers on the top of the sequences represent the position of the sequence from the ATG of comC. Lanes 1 to 5: 0, 12, 80, 160, and 240nM ComE:DA. Lane 6: no DNase I control (lane absent in B).

Hung et al.

1130 jb.asm.org Journal of Bacteriology

on Septem

ber 16, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

erated the same footprint and hypersensitive sites as seen for un-treated ComE. However, a higher concentration of protein wasrequired to observe the same protection for PA-treated ComEthan was required for ComE. Overall, we have shown that underour experimental conditions, acetyl-P and PA treatment appearsto modestly decrease the binding affinity of ComE and ComE612but does not diminish its ability to protect comC. In addition,

treatment of ComE with PA and untreated ComE612 showed adecrease in binding and thus more ComE was required for pro-tection in a DNase I experiment. Although we found no evidencethat phosphorylation of ComE affected DNA binding affinity, wecannot rule out that our in vitro binding conditions might varysufficiently compared to in vivo such that we could not resolve adifference between the phosphorylated and unphosphorylatedstate of ComE in target binding.

Phosphorylation stimulates ComE dimerization. We wantedto investigate how the phosphorylated form of ComE differs fromthat of the unphosphorylated state. Since E. coli-expressed ComE(presumably unphosphorylated) already has a high affinity forDNA, we tested whether phosphorylation affects the oligomericstate of ComE in an in vitro cross-linking experiment. To do this,we treated ComE in the presence and absence of PA with a cross-linking reagent, DMS, a homobifunctional reagent with imidoes-ter reactive groups that react with primary amines of aminoacid residues (5, 25). Reactions were then analyzed by SDS-polyacrylamide gel electrophoresis, followed by Coomassie bril-liant blue or Ni-NTA-Atto conjugate staining, the latter beingspecific for His-tagged proteins. As shown in Fig. 6A, two addi-tional bands with slower electrophoretic mobility appeared in thepresence of PA and DMS. These two bands are unique and areabsent when ComE was treated with either PA or DMS alone. Thissuggests that these bands represent the dimeric form of ComEsince their apparent molecular weight is �64 kDa, which is twice

FIG 3 DNase I footprint assay of ComE612 with comC substrate. The pro-tected regions are shown on the right side of the figure. The solid lines on thesequence represent the direct repeats of ComE binding sites (dotted lines onthe gel), bold bases indicate the hypersensitive sites (� on the gel), and lower-case letters are not protected. Numbers on the top of the sequences representthe position of the sequence from the ATG of comC. Lanes 1 to 6: 0, 15, 30, 75,150, and 227.4 nM ComE612. Lane 7: no DNase I control.

FIG 4 EMSA analysis of PA treated ComE with comC substrate. Increasingconcentration of PA treated ComE at room temperature for 2 h. EMSA ofComE without PA (A) and EMSA of ComE-PA (B). Lanes 1 to 7: 0, 1, 2, 4, 8, 16,and 32 nM ComE.

FIG 5 DNase I footprint assay of ComE with preincubation of PA. The pro-tected regions of the comC substrate are shown on the right side of the figure.The solid lines on the sequence represent the direct repeats of ComE bindingsites (dotted lines on the gel), bold bases indicate hypersensitive sites (� on thegel), and lowercase letters are not protected. (A) Lanes 1 to 4: 0, 19.5, 39, and97.5 nM ComE. Lane 5: no DNase I control. (B) Lanes 1 to 4: 0, 19.5, 39, and97.5 nM ComE-PA. Lane 5: no DNase I control.

Oligomerization of S. mutans ComE

March 2012 Volume 194 Number 5 jb.asm.org 1131

on Septem

ber 16, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

the size of a His-tagged ComE monomer (33 kDa). It is plausiblethat one band is a dimer formed between two phosphorylatedComE monomers, while the other band is a heterodimer of onephosphorylated and one unphosphorylated ComE monomers;the doubly phosphorylated species being the faster of the two ow-ing to its higher charge-to-mass ratio. To clarify that this doubletis indeed an oligomeric form of ComE, we used an Ni-NTA-Attoconjugate specific for the histidine tag. As shown in Fig. 6B, wedemonstrated that in addition to the ComE monomer, bothshifted bands were detected with the histidine tag-specific probe,indicating the bands were ComE dimers. Given that the cross-linking occurs only under conditions of phosphorylation, thissuggests that some of ComE is likely to be in an at least adimer state upon phosphorylation. In addition, ComE:DE andComE:DA were analyzed under the same conditions to test fortheir oligomeric state and neither formed a dimer species in thepresence of phosphoramidate and DMS (Fig. 6C and D). Theband visible in Fig. 6C and D (Fig. 6) below the 64 kDa marker isan unknown contaminating protein from the purification ofComE:DE and ComE:DA and not an oligomer of ComE, as it ispresent in the absence of both PA and DMS. These results areconsistent with D60 acting as the site of phosphorylation andphosphorylation affecting the oligomeric state of ComE. It alsodemonstrates that the D60E mutation is not sufficient to elicitdimerization, suggesting it is not a good substitute for the phos-phorylated form of ComE.

DISCUSSION

The physiologic state of a protein can dictate its biological func-tion. For RRs, phosphorylation plays an essential role in the signalrelay of the TCSTS. In this work, we examined the S. mutans RRComE, focusing on its phosphorylation state and its capacity toform oligomers. We provide evidence that phosphorylation failsto strongly affect both the specificity and affinity of binding of

ComE to its cognate binding site. In contrast, phosphorylationappears to affect the oligomeric state of the protein, perhaps beingcritical for downstream functions after binding.

A variety of mechanisms have been identified by which phos-phorylation activates RRs. Here we examined if the positionalnegative charge was necessary and sufficient to replace phosphor-ylation and the active site aspartate. A change in the conservedaspartic acid to glutamic acid can mimic the phosphorylated formof some RRs, and the consequences of this change differs from onespecies to another (3, 8, 12, 29, 33, 35). To examine the effect ofthis mutation on ComE, the putative active site aspartic acid wasaltered to glutamate or alanine. From binding affinity experi-ments, we found that ComE:DE has a similar equilibrium disso-ciation constant as ComE (Table 3). However, ComE:DA has ahigher Kd than either ComE or ComE:DE, which suggests that thereplacement of aspartic acid with alanine, in either negative chargeor configuration, has a marginal effect on ComE binding, demon-strating that phosphorylation is not an intrinsic quality of protein-DNA interactions.

We further tested these two mutant ComE proteins in DNase Ifootprinting assays with two comC substrates. We found the iden-tical protection pattern for both wild-type ComE and ComE:DE(Fig. 1). Interestingly, the footprint of ComE:DA showed a differ-ence compared to ComE and ComE:DE (Fig. 1 and 2). Similarprotection of the comC substrate was observed; however, the pro-tection was modestly weaker and no hypersensitive sites werefound on the ComE:DA footprint (although there was a hypersen-sitive site on the comC� substrate) (Fig. 2). Hypersensitive spotsfrom footprinting analysis usually indicate the bending of theDNA by the protein of interest. As described previously by Hooveret al., integration host factor (IHF) facilitated the activation ofnitrogen fixation nif operon by bending the regulatory region ofthe DNA to promote the interaction of transcription factor NifA

FIG 6 SDS-PAGE of cross-linking of ComE, ComE:DE, and ComE:DA with PA and DMS. The molecular weights are indicated in kilodaltons on the left of thefigures, and the ComE dimers are indicated on the right. Coomassie-stained gels of ComE (A), ComE stained with NTA-Atto-conjugated probe (B), andCoomassie-stained gels ComE:DE (C) and ComE:DA (D). Lane 1, PA�, DMS�; lane 2, PA�, DMS�; lane 3, PA�, DMS�; lane 4, PA�, DMS�.

Hung et al.

1132 jb.asm.org Journal of Bacteriology

on Septem

ber 16, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

and RNA polymerase (9). Although the role of DNA bending byComE has not been elucidated, the lack of hypersensitive spots byComE:DA could mean that the aspartic acid plays a significantrole in the biological function of ComE. It is plausible that thechange from aspartic acid to alanine results in a less active form ofComE, which is consistent with the finding that ComE:DA has aslightly higher equilibrium dissociation constant and a lack ofhypersensitive sites as judged by DNase I footprinting. The simi-larity in binding pattern and affinity for ComE:DE and ComE isnot unusual and has been seen with Caulobacter crescentus CtrAD51E, which binds to DNA with similar affinity as the wild-typeunphosphorylated CtrA (33).

As previously indicated, phosphorylation of an RR plays anessential part in activation and often increases its affinity for targetDNA. In order to test the effects on binding activity of phosphor-ylated ComE, we directly phosphorylated ComE with small mol-ecule phosphate donors and purified ComE from an E. coli pta-ackA double mutant strain, which eliminated the production ofacetyl-P and reduced the likelihood of an endogenously phos-phorylated ComE. ComE612 showed identical protection and hy-persensitive site cleavages of the comC substrate as the wild-typeComE (Fig. 3). This indicates that the gross binding and structuralimposition of each protein on the DNA are indistinguishable.However, we did note a 2-fold difference in binding affinity of theComE612 protein to DNA but in the absence of any additionaldata cannot determine if this difference is intrinsic to the proteinitself or to the preparations of protein purified; therefore, thebinding affinity difference remains an open question. We do,however, distinguish the DNA binding abilities of ComE:DA andComE612 despite similar DNA binding affinities; the DNase Ifootprint of ComE612 appears identical to ComE while theComE:DA footprint does not. Finally, we tried to phosphorylateComE612 with acetyl-P but observed no improvement in theDNA binding activity in EMSA experiments (data not shown).

One possibility is that ComE cannot be phosphorylated byacetyl-P. In fact, not all RRs are phosphorylated when pretreatedwith acetyl-P (23, 24). However, other phosphodonors, such ascarbamyl phosphate and PA, have been used to phosphorylateRRs in vitro (24, 26, 44). We used PA as an alternative donor tophosphorylate ComE. Treatment with PA reduced ComE bindingactivity to comC substrate in EMSA. There are at least three pos-sibilities for why we may not have seen an enhancement of bindingaffinity when ComE was phosphorylated by a phosphate donor.First, unphosphorylated ComE may be the active form of ComE ashas been observed with B. subtilis DegU (4). Another possibility isthat ComE is efficiently phosphorylated but has a fast and spon-taneous autodephosphorylation rate as reported recently byThomas et al. (37). However, since ComE lacks some of the im-portant amino acids identified in the Thomas study, which wereindicative of high autodephosphorylation rates, we were unable topredict with confidence at what relative rate ComE is predisposedto autodephosphorylate. An empirical experiment would have tobe performed to determine the autodephosphorylation rate ofComE. A third possibility is that while phosphorylation might beimportant to activate RRs for gene expression, it may not play arole in ComE binding, as has been observed for S. TyphimuriumNtrC (43). Currently, we do not know whether phosphorylation isrequired for ComE to regulate gene expression, but our analysis ofComE binding strongly favors that phosphorylation does not playa role in DNA binding affinity.

In addition to an increase in binding affinity and activation ofgene regulation by phosphorylation, some RRs oligomerize uponphosphorylation. NtrC of enteric bacteria oligomerizes whenphosphorylated, and this oligomer catalyzes the isomerization ofclosed complexes between �54 holoenzyme and the promoter toopen complexes, which activate transcription (40). On the otherhand, simple DNA recognition by the RR can promote oligomer-ization (25). In E. coli, the RR involved in osmotic regulation,OmpR, was shown to dimerize upon phosphorylation or by DNAbinding (25). To address if ComE forms an oligomer when phos-phorylated, we used a homobifunctional cross-linker, DMS, toexamine the effect of phosphorylation on ComE oligomerization.We showed that when ComE is phosphorylated by PA, a shift to adimer state becomes favored. However, we observed dimerizationonly in a small fraction of ComE. There may be a kinetic barrierpreventing dimer formation, for example, this phosphorylation-induced dimer could be very unstable or the conformation neces-sary for dimerization has too short a half-life. Alternatively, it ispossible that the DMS reacts nonproductively so that dimers arenot prone to form. A similar phenomenon was observed forOmpR in which only a portion of OmpR became dimerized in thepresence of PA and the cross-linking reagent (25). However, incontrast to OmpR (25), addition of DNA did not increase thedimer formation in the cross-linking reaction (data not shown).Interestingly, when ComE:DE and ComE:DA were incubatedwith PA and DMS, we did not observe oligomerization of eitherprotein. This result is consistent with D60 of ComE being theactive-site aspartic acid for phosphorylation and phosphorylationfacilitating oligomerization.

The significance of the phosphorylation-induced ComE dimerremains unknown, but we considered two possibilities. Onemodel is that unphosphorylated ComE binds to one repeat withhigh affinity as a monomer, and this binding induces a cooperativeinteraction to the second direct repeat. Once two ComE protom-ers occupy each direct repeat, phosphorylation of the ComEmonomers would regulate gene expression. This model seems un-likely since we were able to show that phosphorylation of ComE byPA also induces cooperative binding to approximately the samedegree as unphosphorylated ComE (data not shown). A secondpossibility is that phosphorylation induces the dimer formation ofComE before binding to the direct repeats and then this dimerbinds to the target site to regulate gene expression. In addition, theorientation of the ComE dimers with respect to the RNA polymer-ase might serve as a mechanism to distinguish between activationand repression of genes. Studies have shown that NtrC activatestranscription by contacting RNA polymerase by means of a DNAloop, which allows the polymerase to gain access to the templateDNA strand in a productive way (30, 39, 43). It is possible thatComE binds in a head-to-tail fashion, and the formation of theoligomer (greater than dimers) extends ComE monomers to ac-complish a similar contact with RNA polymerase, e.g., when thehead of ComE contacts the RNA polymerase, the gene is turnedoff, and when the tail contacts the RNA polymerase, gene expres-sion is activated or vice versa (Fig. 7). Previously, we have pub-lished that ComE acts bifunctionally where it both activates mu-tacin (nlmC) production and represses CSP biosynthesis throughthe same intergenic space (13). This model accounts for howComE could regulate these two genes differently while utilizingthe same intergenic sites.

In summary, we have characterized conditions that lead to the

Oligomerization of S. mutans ComE

March 2012 Volume 194 Number 5 jb.asm.org 1133

on Septem

ber 16, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

oligomeric state of ComE. We determined that phosphorylationcan facilitate dimer formation of ComE and is likely responsiblefor downstream activities, possibly through interactions withRNA polymerase.

ACKNOWLEDGMENTS

We thank Linda Kenney (University of Illinois at Chicago) for kindlyproviding phosphoramidate, Alan Wolfe (University of Illinois at Chi-cago) for providing bacterial strains, and Eduardo A. Ayala for the criticalreading of our manuscript.

This study was supported by NIH grants 5R01DE013230 (D.G.C. andS.D.G.), 4R00DE018400 (J.K.), RO1-DE014757 (F.Q.), and 1R01DE020102-01(W.S.).

REFERENCES1. Bearson BL, Wilson L, Foster JW. 1998. A low pH-inducible, PhoPQ-

dependent acid tolerance response protects Salmonella Typhimuriumagainst inorganic acid stress. J. Bacteriol. 180:2409 –2417.

2. Biswas I, Drake L, Erkina D, Biswas S. 2008. Involvement of sensorkinases in the stress tolerance response of Streptococcus mutans. J. Bacte-riol. 190:68 –77.

3. Bourret RB, Hess JF, Simon MI. 1990. Conserved aspartate residues andphosphorylation in signal transduction by the chemotaxis protein CheY.Proc. Natl. Acad. Sci. U. S. A. 87:41– 45.

4. Dahl MK, Msadek T, Kunst F, Rapoport G. 1992. The phosphorylationstate of the DegU response regulator acts as a molecular switch allowingeither degradative enzyme synthesis or expression of genetic competencein Bacillus subtilis. J. Biol. Chem. 267:14509 –14514.

5. Davies GE, Stark GR. 1970. Use of dimethyl suberimidate, a cross-linkingreagent, in studying the subunit structure of oligomeric proteins. Proc.Natl. Acad. Sci. U. S. A. 66:651– 656.

6. Davison J. 1999. Genetic exchange between bacteria in the environment.Plasmid 42:73–91.

7. Federle MJ, Scott JR. 2002. Identification of binding sites for the group Astreptococcal global regulator CovR. Mol. Microbiol. 43:1161–1172.

8. Green BD, Olmedo G, Youngman P. 1991. A genetic analysis of Spo0Astructure and function. Res. Microbiol. 142:825– 830.

9. Hoover TR, Santero E, Porter S, Kustu S. 1990. The integration hostfactor stimulates interaction of RNA polymerase with NIFA, the transcrip-tional activator for nitrogen fixation operons. Cell 63:11–22.

10. Hung DC, et al. 2011. Characterization of DNA binding sites of ComEresponse regulator from Streptococcus mutans. J. Bacteriol. 193:3642–3652.

11. Klein AH, Shulla A, Reimann SA, Keating DH, Wolfe AJ. 2007. Theintracellular concentration of acetyl phosphate in Escherichia coli is suffi-cient for direct phosphorylation of two-component response regulators. J.Bacteriol. 189:5574 –5581.

12. Klose KE, Weiss DS, Kustu S. 1993. Glutamate at the site of phosphor-ylation of nitrogen-regulatory protein NTRC mimics aspartyl-phosphateand activates the protein. J. Mol. Biol. 232:67–78.

13. Kreth J, et al. 2007. The response regulator ComE in Streptococcus mutansfunctions both as a transcription activator of mutacin production andrepressor of CSP biosynthesis. Microbiology 153:1799 –1807.

14. Kreth J, Merritt J, Zhu L, Shi W, Qi F. 2006. Cell density- and ComE-dependent expression of a group of mutacin and mutacin-like genes inStreptococcus mutans. FEMS Microbiol. Lett. 265:11–17.

15. Kumari S, et al. 2000. Regulation of acetyl coenzyme A synthetase inEscherichia coli. J. Bacteriol. 182:4173– 4179.

16. Kuramitsu HK, Trapa V. 1984. Genetic exchange between oral strepto-cocci during mixed growth. J. Gen. Microbiol. 130:2497–2500.

17. Ladds JC, et al. 2003. The response regulator Spo0A from Bacillus subtilisis efficiently phosphorylated in Escherichia coli. FEMS Microbiol. Lett.223:153–157.

18. Lan CY, Igo MM. 1998. Differential expression of the OmpF and OmpCporin proteins in Escherichia coli K-12 depends upon the level of activeOmpR. J. Bacteriol. 180:171–174.

19. Laub MT, Goulian M. 2007. Specificity in two-component signal trans-duction pathways. Annu. Rev. Genet. 41:121–145.

20. Li YH, et al. 2002. A quorum-sensing signaling system essential for ge-netic competence in Streptococcus mutans is involved in biofilm forma-tion. J. Bacteriol. 184:2699 –2708.

21. Li YH, Hanna MN, Svensater G, Ellen RP, Cvitkovitch DG. 2001. Celldensity modulates acid adaptation in Streptococcus mutans: implicationsfor survival in biofilms. J. Bacteriol. 183:6875– 6884.

22. Li YH, Lau PC, Lee JH, Ellen RP, Cvitkovitch DG. 2001. Natural genetictransformation of Streptococcus mutans growing in biofilms. J. Bacteriol.183:897–908.

23. Liu W, Hulett FM. 1997. Bacillus subtilis PhoP binds to the phoB tandempromoter exclusively within the phosphate starvation-inducible pro-moter. J. Bacteriol. 179:6302– 6310.

24. Lukat GS, McCleary WR, Stock AM, Stock JB. 1992. Phosphorylation ofbacterial response regulator proteins by low molecular weight phospho-donors. Proc. Natl. Acad. Sci. U. S. A. 89:718 –722.

25. Maris AE, Walthers D, Mattison K, Byers N, Kenney LJ. 2005. Theresponse regulator OmpR oligomerizes via beta-sheets to form head-to-head dimers. J. Mol. Biol. 350:843– 856.

26. Mattison K, Oropeza R, Byers N, Kenney LJ. 2002. A phosphorylationsite mutant of OmpR reveals different binding conformations at ompF andompC. J. Mol. Biol. 315:497–511.

27. Nixon BT, Ronson CW, Ausubel FM. 1986. Two-component regulatorysystems responsive to environmental stimuli share strongly conserved do-mains with the nitrogen assimilation regulatory genes ntrB and ntrC. Proc.Natl. Acad. Sci. U. S. A. 83:7850 –7854.

28. Parkinson JS, Kofoid EC. 1992. Communication modules in bacterialsignaling proteins. Annu. Rev. Genet. 26:71–112.

29. Pazour GJ, Ta CN, Das A. 1992. Constitutive mutations of Agrobacte-rium tumefaciens transcriptional activator virG. J. Bacteriol. 174:4169 –4174.

30. Popham DL, Szeto D, Keener J, Kustu S. 1989. Function of a bacterialactivator protein that binds to transcriptional enhancers. Science 243:629 – 635.

31. Ronson CW, Nixon BT, Ausubel FM. 1987. Conserved domains inbacterial regulatory proteins that respond to environmental stimuli. Cell49:579 –581.

32. Sambrook J, Russell D. 2001. Molecular cloning: a laboratory manual,3rd ed, vol 1-3. Cold Spring Harbor Laboratory Press, Cold Spring Har-bor, NY.

33. Siam R, Marczynski GT. 2003. Glutamate at the phosphorylation site ofresponse regulator CtrA provides essential activities without increasingDNA binding. Nucleic Acids Res. 31:1775–1779.

34. Siryaporn A, Goulian M. 2010. Characterizing cross-talk in vivo avoidingpitfalls and overinterpretation. Methods Enzymol. 471:1–16.

35. Stewart RC, Roth AF, Dahlquist FW. 1990. Mutations that affect controlof the methylesterase activity of CheB, a component of the chemotaxisadaptation system in Escherichia coli. J. Bacteriol. 172:3388 –3399.

36. Stock AM, Robinson VL, Goudreau PN. 2000. Two-component signaltransduction. Annu. Rev. Biochem. 69:183–215.

37. Thomas SA, Brewster JA, Bourret RB. 2008. Two variable active siteresidues modulate response regulator phosphoryl group stability. Mol.Microbiol. 69:453– 465.

38. van der Ploeg JR. 2005. Regulation of bacteriocin production in Strepto-coccus mutans by the quorum-sensing system required for development ofgenetic competence. J. Bacteriol. 187:3980 –3989.

39. Wedel A, Weiss DS, Popham D, Droge P, Kustu S. 1990. A bacterialenhancer functions to tether a transcriptional activator near a promoter.Science 248:486 – 490.

FIG 7 Proposed mechanism on how ComE activates nlmC and repressescomC. ComE (open arrow bar) binds to a consensus binding site in a head-to-tail fashion and forms oligomers to extend and contact with RNA polymerase(RNAP; diamond shape). When the head contacts RNAP, as in the case forcomC, gene expression is turned off, and when the tail contacts RNAP fornlmC, gene expression is turned on.

Hung et al.

1134 jb.asm.org Journal of Bacteriology

on Septem

ber 16, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

40. Weiss DS, Batut J, Klose KE, Keener J, Kustu S. 1991. The phosphory-lated form of the enhancer-binding protein NTRC has an ATPase activitythat is essential for activation of transcription. Cell 67:155–167.

41. Wolfe AJ. 2005. The acetate switch. Microbiol. Mol. Biol. Rev. 69:12–50.42. Wolfe AJ, et al. 2003. Evidence that acetyl phosphate functions as a global

signal during biofilm development. Mol. Microbiol. 48:977–988.

43. Wyman C, Rombel I, North AK, Bustamante C, Kustu S. 1997. Unusualoligomerization required for activity of NtrC, a bacterial enhancer-bindingprotein. Science 275:1658–1661.

44. Zapf JW, Hoch JA, Whiteley JM. 1996. A phosphotransferase activity ofthe Bacillus subtilis sporulation protein Spo0F that employs phosphora-midate substrates. Biochemistry 35:2926 –2933.

Oligomerization of S. mutans ComE

March 2012 Volume 194 Number 5 jb.asm.org 1135

on Septem

ber 16, 2020 by guesthttp://jb.asm

.org/D

ownloaded from