OF No. 28, 5, pp. 1993 in L? A. Phosphatidylserine ... · THE JOURNAL OF BIOLOGICAL CHEMI~TRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc. Vol. 268,

THE JOURNAL OF BIOLOGICAL CHEMI~TRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 268, No. 28, Issue of October 5, pp. 21416-21424,1993 Printed in L? S. A.

Phosphatidylserine Decarboxylase from Saccharomyces cereuisiae ISOLATION OF MUTANTS, CLONING OF THE GENE, AND CREATION OF A NULL ALLELE*

(Received for publication, April 16, 1993, and in revised form, May 25, 1993)

Pamela J. Trotter, John Pedretti, and Dennis R. VoelkerS From the National Jewish Center for Immunology and Respiratory Medicine, Denver, Colorado 80206

Phosphatidylserine decarboxylase plays a pivotal role in the synthesis of phospholipid by the mitochondria. The substrate phosphatidylserine is synthesized extramitochondrially and must be translocated to the mitochondria prior to decarboxylation. To understand the properties of the decarboxylase and exploit its unique topology to address basic questions of interor- ganelle cooperation in membrane assembly, we have begun to examine this enzyme in Saccharomyces cerevisiae. Strains of the yeast defective in enzyme activity were isolated by modified brute force using l-acyl- 2[N-(6-[7-nitrobenz-2-oxa-1,3-diazo-4-yl)]aminocaproyl] (NBD)-phosphatidyl[ l’-14C]serine as substrate for permeabilized cells. Mutant strains with less than 5% wild type activity exhibited no defective growth phenotype. The gene for the phosphatidylserine decarboxylase (PSD) was cloned using an oligonucleotide probe degenerate for the sequence VGAT(I)/(N)VGSI, which is the longest stretch of sequence identity between the Escherichia coli sequence (I at position 5) and the putative CHO cell sequence (N at position 5). The gene encodes a 500 amino acid protein with 28- 43% identity to the bacterial and mammalian sequences. The yeast PSD gene maps to the long arm of chromosome 14 between the kex 2 and RAS2 loci. Null mutations created by disrupting the PSD gene with TRPl demonstrate that the gene is not essential for cell growth even when the engineered strains are de- prived of choline and ethanolamine. Analysis of lipid synthesis and enzyme activity in null mutants indicates that there are two PSD genes.

Phosphatidylserine decarboxylase (PSD)’ plays an important role in the biosynthesis of phosphatidylethanolamine (PtdEtn) in both prokaryotes and eukaryotes. In Escherichia coli the gene for PSD is absolutely required for PtdEtn synthesis (1, 2). In yeast and mammalian cells, PtdEtn can be

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) L19930.

To whom correspondence should be addressed Dept. of Medicine, National Jewish Center for Immunology and Respiratory Medicine, 1400 Jackson St., Denver, CO 80206. Tel.: 303-398-1300; Fax: 303-

The abbreviations used are: PSD, phosphatidylserine decarboxylase; CHO, Chinese hamster ovary; NBD, l-acyl-2[N-(6-[7-nitrobenz-2-oxa-1,3-diazo-4-yl)]aminocaproyl]; PtdCho, phosphatidylcholine; PtdEtn, phosphatidylethanolamine; PtdIns, phosphatidylinositol; PtdSer, phosphatidylserine; TAFE, transverse alternating field electrophoresis; kb, kilobase pair(s); bp, base pair(s).

398-1806.

synthesized from phosphatidylserine (PtdSer) via the decarboxylase (3) or by the action of ethanolamine phosphotransferase when ethanolamine is available (4). Studies in mammalian cells reveal that PtdEtn is formed by the decarboxylase reaction in both the presence and absence of ethanolamine (5). Subcellular localization studies indicate that PSD is an enzyme located at the inner mitochondrial membrane of eukaryotes (3,6-9). This location has engendered much interest in the enzyme, because the substrate for the decarboxylase is synthesized extramitochondrially (10-12) and must be imported into the mitochondria for catalysis to occur (5, 13). The topography of the decarboxylase enzyme thus makes it an excellent indicator for translocation and import of PtdSer into the mitochondria. Several laboratories have now ex- ploited this property of the decarboxylase to examine PtdSer transport in intact (13-15) and permeabilized (16-19) cells as well as isolated organelles (20-24).

A central focus of this laboratory has been examination of the intracellular transport and metabolism of PtdSer. To expand our efforts in this area, we have begun to examine the decarboxylase enzyme in Saccharomyces cerevisiae, an orga- nism which is amenable to powerful genetic manipulation. The purpose of this study was to 1) isolate yeast mutants defective in PSD activity, 2) clone and sequence the PSD gene, and 3) create a null mutation by insertional disruption of PSD and determine its essentiality for cell growth. The results demonstrate that the PSD gene has been isolated and that it is not essential for growth even in the absence of exogenous ethanolamine or choline. The results clearly indicate the presence of a second decarboxylase enzyme.

EXPERIMENTAL PROCEDURES

Chemicak-Simple salts, buffers, and media components were purchased from Sigma and Fisher. The radiochemicals 32P, 33P, [a- 32P]dCTP, [Y-~~PIATP, [3-3H]serine, and [l-14C]serine were obtained from Du Pont, Du Pont-New England Nuclear, ICN, and Amersham Corp. Phosphatidyl[l’-“Clserine was synthesized from DL-[1-14C] serine and egg CDP-diacylglycerol by the action of PtdSer synthase. The PtdSer synthase was purified from E. coli strain JA-200 harboring the plasmid pPS3155 which caused 100-fold overproduction of the enzyme (25). This strain was generously supplied by Dr. W. Dowhan, University of Texas, Houston, TX. The NBD-Ptd[l‘-’*C] Ser was synthesized by the same method using NBD-CDP-diacylglycerol prepared by the procedure of Agranoff and Suomi (26) as modified by Raetz and Kennedy (27). Phospholipid standards for thin layer chromatography were obtained from Avanti Polar Lipids. The growth media for yeast were YPD (yeast extract/peptone/dextrose) or SD (minimal dextrose) plus auxotrophic requirements that were prepared by standard methods (28). Choline and ethanolamine were at 2 mM where added. Bacterial media were made by standard methods (29).

Yeast Strains. Plasmids. and Libraries-The strains A364a (MATa adel d e 2 lys2 his7 tyrl ural gall) and 422 (MATa trpl-289 lys2 his7 leu2-3, 112) were obtained from Dr. Robert Sclafani, University of Colorado Health Sciences Center, Denver, CO. The strains Trpla (MATa trpl adel his2 gall ga12), Leu2a (MATa leu2 adel his4 met2

21416

Yeast Phosphatidylserine Decarboxylase 21417

u r d ) , and Adeln (MATn adel leu1 his2 ura3 trpl met14 gall) were obtained from the Yeast Genetic Stock Center. Dr. Michael Yaffe, University of California, San Diego, CA, generously provided the strain SEY 6211 (MATa urd? leu2 his3 trpl ade2 sucZ) and Drs. Robert M. Bell and Russell Hjelmstad, Duke University, Durham, NC, kindly provided strain HJ051 (MATa hisd-A1 leu2-3, 112 u r d - 52 trpl-289 eptl-Al::URAS). The plasmid YEp352 (30) was obtained from Dr. Alex Franzushoff, University of Colorado Health Sciences Center, Denver, CO. The plasmid pJJ280 containing the TRPl gene in known orientation was provided by Dr. Louise Prakash, University of Rochester, NY. Yeast genomic libraries in YEpl3 and YCp50 plasmid vectors were obtained from American Type Culture Collec- tion (Rockville, MD). Dr. W. Dowhan provided an additional YEpl3 plasmid vector library. A YEp24 plasmid vector library was kindly provided by Drs. Thomas Tilman and Robert M. Bell, Duke Univer- sity, Durham, NC.

Yeast cells were transformed with plasmid DNA using either spheroplasts (31) or unmodified cells and lithium acetate (32) and selected for complementation of auxotrophic markers carried on plasmid vectors.

Screen for PtdSer Decarboxylase Mutants-To screen large numbers of cells for defects in PtdSer decarboxylase, a modified brute force assay was developed. Cells (strain A364a) that were mutagenized with ethylmethane sulfonate (33) were spread on plates to yield 200- 500 colonies/plate. The colonies were picked and ordered on YPD agar plates and after 1-2 days lifted onto Whatman 42 circles 6 mm in diameter and deposited into microtiter wells. The wells were sealed with aluminum foil and the lid to the microtiter dish using spring clamps and immersed in liquid N, for several minutes. The cells were next thawed at room temperature for 5 min, and the freeze-thaw cycling was repeated four more times. The papers were briefly air- dried, and the wells were next loaded with 100 pl of solution containing 25 mM KH,P04 (pH 6.8), 5 mM EDTA, and 2 X lo' cpm NBD- Ptd[l'-"CISer (50 pCi/pmol). The NBD analog of PtdSer was used as substrate, because it will rapidly partition among all permeabilized cell membranes without the addition of detergents (34). The microtiter plate was next sealed with a Vaseline-coated gasket that contained holes centered above each well. This gasket was overlaid with Whatman 3MM paper saturated with 2 N KOH and backed by a second gasket and a Plexiglas rectangle. The entire apparatus was secured with spring clamps and incubated at 36 "C for 1 h. Following this incubation the KOH-impregnated filter paper, which traps the "CO, produced by decarboxylation of the NBD-Ptd[l'-"CISer, was air-dried, sprayed with ENHANCE, and placed on Kodak XAR5 film. Approximately lo' clones were screened in this manner, and several colonies defective in the decarboxylation of the substrate were identified and rescreened. Two clones were reproducibly defective with the second screening. Subsequent genetic analysis revealed that the clones were noncomplementary and these were assumed to be allelic.

Library Screening-The initial library screening used the modified brute force procedure described above to examine transformed cells for the recovery of defective decarboxylase activity. This approach was unsuccessful with several genomic libraries. As an alternative, degenerate oligonucleotides GTT GGT GCT AC(T/C) A(A/T)(C/T) GTT GGT TCC AT corresponding to the E. coli PSD amino acid sequence VGATIVGSI (35) and the putative CHO-K1 cell PSD amino acid sequence VGATNVGSI (36) were synthesized and used to probe several yeast genomic libraries. Prior to screening libraries for hybridization, the probe was hybridized to restriction digests of yeast genomic DNA (29) and found to give specific binding.

The oligonucleotide probe was routinely end-labeled using T4 polynucleotide kinase and [y3'P]ATP (29). Bacterial colonies harboring the plasmid vectors described above that contained genomic fragments of total yeast DNA were replica plated onto nitrocellulose filters. The replicates were inverted, overlaid with a second filter, and the colonies were allowed to grow overnight on LB plates containing ampicillin and chloramphenicol. Subsequently the bacterial colonies were lysed and washed, and the bound DNA was baked onto the filter using standard methods. The filters were washed in 5 X SSC (1 X ssc consists of 150 mM NaCl, 15 mM sodium citrate (pH 7.0)), 0.5% sodium dodecyl sulfate (SDS), 1 mM EDTA at 50 "C for 1 h, and transferred to a hybridization solution composed of 6 X SSC, 5 X Denhardt's solution, 100 pg/ml single-stranded DNA, 0.5% SDS, and 10% dextran sulfate at 50 "C for 2 h. Hybridization with the radiola- beled oligonucleotide probe was conducted for 16 h at 50 'C. Subse- quently the filters were washed twice in 6 X SSC, 0.1% SDS at room temperature and once at 58 "C. The filters were finally subjected to autoradiography and results from duplicate filters compared to iden-

tify legitimate hybridizing colonies. DNA Sequencing-A 2.1-kb DNA fragment capable of restoring

PSD activity to yeast strains defective in enzyme activity was inserted into the plasmid YEp 352 (30) which contains a universal primer sequence. The insert was sequenced completely in both directions using the double-stranded DNA polymerase chain reaction cycle sequencing procedure (37). The oligonucleotide primers for the DNA sequencing reactions were end labeled using [ Y - ~ ~ P I A T P (29). All reagents used for the polymerase chain reaction reactions except the isotope were from a Life Technologies, Inc. cycle sequencing kit and the manufacturer's recommended protocol was followed. Analysis of the DNA sequence information was performed using the IBI Mac- Vector program.

Chromosomal Mapping-Yeast chromosomes were prepared using strain YPH 149 (38) and subjected to transverse alternating field electrophoresis (TAFE) (39). After electrophoresis, the DNA was transferred to nylon membranes and fixed by baking. The nylon membranes containing the DNA were generously provided by Dr. Katheleen Gardiner, Eleanor Roosevelt Institute for Cancer Re- search, Denver, CO. Labeled probe for screening the blots was prepared from the 2.1-kb PSD insert cleaved out of the vector with HindIII and EcoRI to yield two fragments of -1 kb. The PSD fragments were labeled with [cx-~'P]~CTP (ICN) using a random primer labeling kit (Life Technologies, Inc.). The chromosome blot was prehybridized and hybridized in 6 X SSC, 5 X Denhardt's solution, 100 pg/ml single-stranded DNA, 0.5% SDS, and 10% dextran sulfate at 65 "C by standard procedures (29). Fine structure mapping was performed utilizing the yeast genomic library in phage X of M. Olson (40) obtained from the American Type Culture Collection (ATCC, Rockville, MD). The nylon membranes containing DNA from the clones were probed using the HindIII-EcoRI fragments of PSD labeled with the nonradioactive label, digoxigenin-deoxyuridine triphosphate (DIG-dUTP), which was detected by chemilumines- cence using the Genius System (Boehringer Mannheim). The identity of hybridizing clones was determined using mapping information provided by ATCC and fine structure location determined from the physical map of the M. Olson clones (41).

Construction of PSD Null Mutants-The 2.1-kb PSD clone was subcloned into pUC18, YEp352, and pGem7Z(-) plasmids at the HindIII site within the multiple cloning regions. The TRPl marker gene was cut out of the pJJ280 plasmid. For the disruption construct (see Results), TRPl was cut out with EcoRI and ligated within the PSD sequence in the EcoRI site at bp 1013 using pUC18 or YEp352 as the PSD carrier plasmid.

For the deletion construct (see "Results"), a 0.27-kb fragment of PSD, containing the putative catalytic subunit (see "Discussion"), flanked by the BclI site at bp 1543 and the NdeI site at bp 1813 was removed by digestion with the corresponding restriction enzymes. The 2.1-kb PSD clone used for the BclI-NdeI digests was generated in pGem7Z(-) within competent methylation-deficient E. coli strain DM1 (Life Technologies, Inc.) in order to allow for cleavage by BclI. The TRPl gene was cut out of pJJ280 with BamHI and NdeI, which resulted in the inclusion of a small segment of the lacZ' gene from the plasmid, and was ligated into the BclI-NdeI gap created in PSD. Both the final disruption and deletion constructs were then amplified in competent XL-1 blue E. coli (Stratagene) and the plasmids isolated by standard methods (29). The DNA was linearized with SspI, which cleaves the PSD gene at bp 657, 1632, and 2074 in the disruption construct and at bp 657 and 2074 in the deletion construct. In an

HindIII which cuts at the 5' and 3' ends of the PSD insert. The alternative experiment, the disruption construct was linearized with

linearized-disrupted PSD DNA was then used to disrupt the chromosomal copy of PSD by one-step gene replacement (42). The linearized DNA was transformed into strains auxotrophic for trp: d-26 (TrplaX422), d30 (AdelaxSEY6211), and Trpla by the transformation procedure of Elble (32), and recombinants were selected by the acquisition of trp prototrophy. Recombination of the chromosomal gene was confirmed by hybridization analysis of yeast genomic DNA (43) digested with HindIII and measurement of PSD activity. For PSD activity measurement, strains were grown to early stationary phase in complete medium (YPD) and homogenates prepared using a mini-bead beater (Biospec Products, Bartlesville, OK). Enzyme activity of the homogenates was then determined as described previ- ously (18).

Lipid Analysis-Cells were grown at 30 "C to saturation in minimal medium containing auxotrophic requirements and lacking choline and ethanolamine. The cells were then diluted 1:20 in the same medium plus either 2 pCi/ml~-[3-~H]serine (Amersham Corp.) or 10

21418 Yeast Phosphatidylserine Decarboxylase

pCi/ml [33P]orthophosphate (Du Pont-New England Nuclear). After 5-6 h (log phase) or 22-24 h (stationary phase) of growth at 30 “C, samples were taken, -10 mg of carrier cells added, and the cells were washed twice with ice-cold water and resuspended in 0.3 ml. Cellular lipids were isolated by a modified ethanol extraction (44) by adding 1.2 ml of absolute ethanol and placing in a boiling waterbath for 45 min. The lipids were then extracted from the 1:4 water:ethanol mixture by adding 4 ml of CHCl3 and 4 ml of methanol and 3.3 ml of 0.2 M KCl, shaking, and centrifuging to separate the phases. The resulting lower CHC13 phase was back-washed twice with 7.6 ml of the practical upper phase (PBS:methanol (9:10, v/v), saturated with CHCl3). The final lower phase was dried under a stream of N2 and redissolved in 100 11 of CHC13:methanol (2:l). The lipids were separated on Silica Gel H thin layer chromatography plates (Analtech) in a solvent system containing CHC13:methanol:2-propanol:0.25% KC1:triethylamine (30:9:25:618, v/v). This chromatography system resolves all of the major phospholipid species of yeast but phosphatidic acid comigrates with phosphatidylinositol. Analysis of psd- mutants and wild type strains a t log phase growth by two-dimensional thin layer chromatography (first dimension, chloroform: methano1:acetic acid, 65:25:10, v/v; second dimension, chloroform:methanol:formic acid, 65:25:10, v/v) demonstrates that phosphatidic acid comprises 1-2% of the phospholipid labeled with 33P. Lipids were identified by cochromatography with authentic standards and were visualized by spraying with 0.1% aqueous 8-anilino-l- naphthalene sulfonic acid and exposure to ultraviolet light. Lipid- associated radioactivity was determined by scraping zones into 0.5 ml of H20 plus 5 ml of Ecofluor scintillation mixture (ICN) and the radioactivity measured on an LS-8000 liquid scintillation spectrom- eter (Beckman).

RESULTS

Isolation of Yeast Mutants Defective in PtdSer Decarboxyl- ase-Yeast strains with reduced PtdSer decarboxylase activity were isolated using a modified brute force technique. Cells with the mutation exhibited from 1 to 4% of the activity of wild type strains (Table I). The strains psd 1-4 and psd 1-5 were found to be noncomplementary and were assumed to be allelic. The strain 15.16C is a derivative of psd 1-4. The psd- mutation was recessive in diploids heterozygous for the allele, which have about 50% PSD activity as compared with wild type (Table I). Strains with the psd- mutation failed to show any altered growth on either complex or minimal media and grew normally with nonfermentable carbon sources. Some modest change in lipid composition of the mutant strains was observed. Most notable was a decreased amount of PtdEtn (by 30-50%) in the psd- mutants as compared with wild type (data not shown). The results suggest that the decarboxylase enzyme is in large excess over the amounts required for rates

TABLE I Phosphatidylserine decarboxylnse activity in yeast strains with defects

in PSD Cell extracts were made from cultures a t early stationary phase

and assayed for enzyme activity as described under “Experimental Procedures.” Values are the mean f S.D. for eight determinations made in two separate experiments.

Strain PSD activity nmol/mg/45 rnin

Parental A364 14.63 f 2.24 422 20.44 & 1.75

Mutants psd 1-4 0.25 f 0.19 psd 1-5 0.54 f 0.25 15.16C 0.18 f 0.25

A364a X 422 (wild type) 13.62 f 2.00 Diploid heterozygotes

422 X psd 1-4 6.69 f 0.88 422 X psd 1-5 6.11 f 0.51

Transformant 15.16 C + YEP 352 - PSD 15-2.1 38.08 f 2.56

of lipid synthesis that support cell growth. Although strains harboring the psd- mutation did not provide significant new information regarding lipid metabolism in yeast, they provided a favorable genetic background for identifying the PSD gene.

Isolation of the Gene for Yeast PtdSer Decarboxylase-We attempted to complement the defect in PtdSer decarboxylase using several libraries and the modified brute force screen. Yeast libraries in YEpl3 and YCp50 and YEp24 failed to complement the defect. An alternative approach was taken using sequence information from the E. coli gene (35) and the putative mammalian PtdSer decarboxylase cDNA clone from CHO-K1 cells (36). Although the homology between both sequences is not very high, one stretch of 9-amino acid sequence is notable: VGATIVGSI in the bacterial sequence and VGATNVGSI in the mammalian sequence. Based on these two amino acid sequences and yeast codon usage, a degenerate oligonucleotide probe was synthesized. This probe identified a 2.1-kb band upon hybridization analysis of HindIII-digested yeast genomic DNA. The probe was used to screen yeast genomic libraries in Xgtll, YEpl3, YCp50, and YEp24 from sources identified above without success. A second YEpl3 library provided by W. Dowhan (University of Texas, Hous- ton, TX) revealed three positive clones in the first 3 X lo4 colonies screened. All three clones yielded a 2.1-kb fragment upon digestion with HindIII. Transformation of psd- strains with a clone designated YEpl3-PSD15, containing a 5.1-kb insert, routinely increased decarboxylase activity 5-8-fold over wild type. The YEpl3-PSD15 was digested with HindIII, and the 2.1-kb DNA sequence was subcloned into the HindIII site of YEp352 (30).

The resultant plasmid, designated YEp352-PSD15-2.1, was purified and used to transform the strain 15.16C ( u r d leu2- 3, 112 his lys2 adel psdl-4) to uracil prototrophy. The prototrophs were assayed for decarboxylase activity as shown in Table I. Relative to the wild type strain A364a, 15.16C has approximately 1% of the decarboxylase activity. The 15.16C strain harboring the YEp352-PSD15-2.1 plasmid has 2.5 times the average PtdSer decarboxylase activity of the cells with the wild type locus. Growth of the transformed 15.16C strain under nonselective conditions (YPD media) for 40 generations resulted in plasmid loss from 50% of the cells as determined by loss of uracil prototrophy. Strains of psd- mutants that had lost the plasmid also re-acquired the defect in PSD activity. These results are consistent with the 2.1-kb HindIII fragment present in YEp352-PSD15-2.1 containing the gene for PSD.

The 2.1-kb HindIII fragment was analyzed by DNA sequencing and the results are shown in Fig. 1. The sequence contains a long open reading frame of 1524 nucleotides begin- ning at nucleotide 278 and ending with an in-frame termina- tion codon at nucleotide 1801. The deduced protein sequence from the first methionine within the open reading frame to the stop codon corresponds to 500 amino acids. The amino acid sequence VGATNVGSI corresponding to that used to generate the oligonucleotide probe is found at positions 402- 410. The DNA sequence for the yeast clone shows a consensus promotor sequence (TATA box) 5’ to the in-frame ATG at nucleotides 162-173. In addition, within the 5”untranslated region there are three putative consensus sequences for described regulatory elements of phospholipid biosynthetic enzymes (45): at nucleotides 139-148 and, in opposite orientation, at 66-58 is the 9-bp sequence 5-ATGTG(A/G)(T/ A)A(T/A)-3’ and at nucleotides 286-276 the 11-bp sequence

Alignment of the deduced yeast amino acid sequence with 5’-CCTTCTTCTTC-3’.


AAGCTTGGCACATATACGACCAATTGTGCTTCTGTATACGCTACGCTATGTAATCACATATCACATGCAGGGTAACCAGCACCTTTTTGGTGTTTTTT~TCTCGAGGT~GGGAC 119 3 ' TATAGTGTA 5

ATCTAAAGCAGGCACAAGCATGTGG~TTTGTTCTTCACC~~~~~~~~CAGCTTACTCAC-GAGACGCCTAGAGGTACGTAGCGCTTTAAGGACTCTTCAGC~GTTGTT 238 3'CTTCTTCTTCC 5'

CAGATCGCTCAAATCCAGTTCTTGGTCGTTATTTTTTGAAGAAGAAGGAAAAGCAAAGCCAGC ATG TCA ATT ATG CCA GTT AAG AAC GCC TTG GCG CAA GGG AGG 343 Met Ser Ile Met Pro Val Lys Asn Ala Leu Ala Gln Gly Arq 14

ACG CTC CTC ATG GGG AGG ATG CCT GCT GTA AAG TTT TCT ACA AGA ATG CAA TTA AGA AAT AGA ACT GCG GTG CTA TGG AAT AGA AAG TTT 433 Thr Leu Leu Met Gly Arq Met Pro Ala Val Lys Phe Ser Thr Arq Met Gln Leu Arg Asn Arq Thr Ala Val Leu Trp Asn Arq LYS Phe 44

TCC ACG CGT CTT TTC GTT CAG CAA CGA CGC AGT TCT GGA GAG ATT GTG GAT CGT GCC AAA GCT GCT GCC GCA AAT AGC GGA AGA AAA CAG 523 Ser Thr Arq Leu Phe Val Gln Gln Arq Arq Ser Ser Gly Glu :le Val Asp Arq Ala Lys Ala Ala Ala Ala Asn Ser Gly Arq Lys Gln 74

GTC TCC ATG AAA TGG GTT GTT TTA ACT AGT TTC ACC ATT GTT CTA GGA ACC ATT TTA CTA GTG TCA AGG AAT GAT AGT ACA GAG GAG GAT 613 Val Ser Met Lys Trp Val Val Leu Thr Ser Phe Thr :le Val Leu Gly Thr Ile Leu Leu Val Ser Arq Asn Asp Ser Thr Glu Glu Asp 104

Ala Thr Glu Gly Lys Lys Gly Arq Arq Thr Arq Lys Ile Lys :le Phe Asn Asn Asn Trp Leu Phe Phe Cy0 Tyr Ser Thr Leu Pro Leu 134 GCT ACA GAG GGC AAA AAA GGG AGA AGG ACA AGA AAA ATC AAA ATA TTT AAC AAT AAT TGG CTC TTT TTC TGC TAT TCT ACT TTA CCG CTG 703

AAT GCG ATG TCT CGA TTA TGG GGC CAA GTA AAT TCT CTT ACG TTA CCC ATT TGG GTT AGA CCA TGG GGT TAC AGG TTA TAT TCT TTC CTT 793 Asn Ala Met Ser Arq Leu Trp Gly Gln Val Asn Ser Leu Thr Leu Pro :le Trp Val Arq Pro Trp Gly Tyr Arq Leu Tyr Ser Phe Leu 164

TTT GGA GTT AAC TTG GAC GAG ATG GAA GAT CCT GAT TTG ACA CAT TAT GCA AAT TTA TCC GAA TTT TTC TAT CGT AAC ATA AAA CCA GGC 883 Phe Gly Val Asn Leu Asp Glu Met Glu Asp Pro Asp Leu Thr H i s Tyr Ala Asn Leu Ser Glu Phe Phe Tyr Arq Asn Ile Lys Pro Gly 194

ACA CGT CCA GTA GCA CAA GGC GAA GAC GTT ATA GCT TCT CCA AGT GAT GGA AAG ATT TTA CAA GTT GGT ATA ATC AAC TCT GAA ACT GGC 973 Thr Arq Pro Val Ala Gln Gly Glu Asp Val :le Ala Ser Pro Ser Asp Gly Lys Ile Leu Gln Val Gly :le :le Asn Ser Glu Thr Gly 224

GAA ATC GAA CAA GTC AAG GGA ATG ACA TAT TCC ATC AAA GAA TTC CTT GGC ACT CAC TCC CAC CCC TTG ATG TCT AAG AGT GCA TCT AGT 1063 Glu Ile Glu Gln Val Lys Gly Met Thr Tyr Ser Ile Lys Glu Phe Leu Gly Thr His Ser His Pro Leu Met Ser Lys Ser Ala Ser Ser 254

CTA GAT TTG ACT TCT GAT GAG GAA AAG CAT AGA GAA TTC GCC AGG GTA AAT AGA ATA CAA TTA GCG GGT TCC GAA GAC ACT GAA CAG CCT 1153 Leu Asp Leu Thr Ser Asp Glu Glu Lys His Arq Glu Phe Ala Arg Val Asn Arq Ile Gln Leu Ala Gly Ser Glu Asp Thr Glu Gln Pro 284

CTT CTT AAC TTT AAA AAC GAG GGC GAT CAA TCT GTT CGA GAG TTC AAA CCA AGT GTG TCC AAA AAT ATA CAT CTT TTA AGT CAA CTT TCT 1243 Leu Leu Asn Phe Lys Asn Glu Gly Asp Gln Ser Val Arq Glu Phe Lys Pro Ser Val Ser Lys A m Ile His Leu Leu Ser Gln Leu Ser 314

TTA AAC TAC TTC TCT AAT GGG TTT TCG TGC TCT GAG CCT CAT GAT ACG GAA CTT TTC TTT GCC GTC ATT TAT TTG GCT CCC GGT GAT TAC 1333 Leu Asn Tyr Phe Ser Asn Gly Phe Ser Cys Ser Glu Pro His Asp Thr Glu Leu Phe Phe Ala Val Ile Tyr Leu Ala Pro Gly Asp Tyr 344

CAT CAT TTC CAC TCT CCA GTT GAC TGG GTT TGT AAG GTT CGC CGC CAT TTC CCA GGT GAT TTA TTC TCC GTG GCA CCT TAT TTC CAG CGT 1423 His His Phe His Ser Pro Val Asp Trp Val Cys Lys Val Arq Arq His Phe Pro Gly Asp Leu Phe Ser Val Ala Pro Tyr Phe Gln Arq 374

AAC TTC CCT AAT CTT TTC GTT CTA AAT GAA AGA GTT GCT TTG TTG GGT AGT TGG AAG TAC GGA TTT TTT AGC ATG ACT CCT GTT GGT GCA 1513 Asn Phe Pro Asn Leu Phe Val Leu Asn Glu Arg Val Ala Leu Leu Gly Ser Trp Lys Tyr Gly Phe Phe Ser Met Thr Pro Val Gly Ala 404

ACA AAT GTT GGT TCA ATC AAG TTG AAT TTT GAT CAA GAA TTT GTG ACA AAT TCA AAG AGC GAC AAA CAC TTG GAA CCA CAT ACC TGC TAC 1603 Thr Asn Val Gly Ser Ile Lys Leu Asn Phe Asp Gln Glu Phe Val Thr Asn Ser Lys Ser Asp Lys His Leu Glu Pro His Thr Cys Tyr 434

CAG GCA GTA TAT GAG AAT GCA AGT AAA ATA TTG GGA GGG ATG CCT TTG GTT AAG GGT GAA GAA ATG GGT GGC TTT GAA TTG GGT AGC ACT 1693 Gln Ala Val Tyr Glu Asn Ala Ser Lys Ile Leu Gly Gly Met Pro Leu Val Lys Gly Glu Glu Met Gly Gly phe Glu J&u..Glr..$sre.Xhr 464

Val Val Leu Cys Phe Glu Ala Pro Thr Glu Phe Lys Phe Asp Val Arq Val Gly Asp Lys Val Lys Met Gly Gln Lys Leu Gly :le :le 494 GTT GTA CTT TGT TTT GAA GCT CCC ACT GAA TTT AAG TTC GAT GTT AGG GTT GGT GAT AAG GTT AAG ATG GW\ CAG AAA TTA GGC ATA ATT 1783

GGA AAG AAT GAT TTA AAA TGA A A G C A A T C A T A T G T A A A G T T A G C A T T T A T T G C T G T A T A 1895 Gly Lys Asn Asp Leu Lys * * * 500

FIG. 1. Nucleotide and predicted amino acid sequence of the yeast PSD gene. Base pair (top) and deduced amino acid (bottom) numbering are indicated to the right of the figure. The open reading frame begins at 278 bp and extends to 1801 bp. A potential promoter sequence TATA box is indicated by the dotted line (bp 162-173). Putative transcriptional regulatory sequences are denoted by the double underline (bp 58-66, 139-148, and 276-286). The amino acid sequence used to derive the oligonucleotide probe (amino acids 402-410) is double underlined, and the putative sequence for post-translational modification that includes endoproteolysis and pyruvoyl prosthetic group formation (bp 1682-1693, amino acids 461-464) is shown by a dotted underline.

that of E. coli (35) and mammalian CHO-K1 cells (36) is shown in Fig. 2. The yeast gene shows 43% identity to the mammalian sequence and 28% identity to the bacterial sequence. To accomplish these identities at the positions shown, a large gap had to be inserted into the E. coli sequence (amino acids 253-333) and the mammalian sequence (amino acids 269-330). The sequence LGST at amino acids 461-464 in the yeast gene (Fig. l), which in E. coli is the site for autocatalytic cleavage resulting in modification of the serine to a pyruvoyl moiety (46,47), is entirely conserved among the three species (Fig. 2). This indicates that the yeast as well as mammalian proteins are almost certainly pyruvoyl enzymes. Thus, by the criteria of complementation of mutant strains, elevated activity associated with expression on multicopy plasmids, sequence comparison with the bacterial PSD gene, and the cDNA for the the putative mammalian PSD, the genomic clone isolated appears to encode the yeast PSD gene. In

addition, expression of the yeast PSD in mammalian cells gives approximately 5-fold increase in measurable decarboxylase activity.2

Mapping of the Gene for Yeast PSD-The location of the PSD gene was mapped using the chromosome blotting technique (38). The yeast chromosomes were separated using transverse alternating field electrophoresis (39) and transferred to nylon membranes. The membranes were examined for hybridization with the PSD gene, which localized to chromosome XIV (Fig. 3). For fine structure mapping the PSD gene was hybridized to an ordered yeast library in phage h (40). Comparison of the pattern of hybridization of the PSD probe to the physical map of phage clones within the library (41) revealed that the PSD gene is located between the loci

P. J. Trotter, J. Pedretti, and D. R. Voelker, data to be published elsewhere.

Yeast Phosphatidylserine Decarboxylase

L L N S F K L S L O Y I L P K L W L T R L

Q R K O V S M K W V V L T S F T I V L Q T I L L V S R N D S T E E D A T E Q K K Q R R T R K I K I F N N N W L F F C Y S T L P L N A M S R L

I H T A P V R S L F L L R P V P I L L A T Q Q Q Y A Q Y R O Y E K V R D O K L E K L Q L E I P P K L A S H W E V A L Y K S V P T R L L S R A

. . . . . . . . .

A Q W Q A S K R A Q - W L T K L V I D L F V K Y Y K V D M K E A O K P O T A S Y R T F N E F F V R P L R D E V R P I D T D P N V L V M P A D

W Q O V N S L T L P l W V R P W Q Y R L Y S F L F Q V N L D E M E D P D L T H Y A N L S E F F Y R N I K P Q T R P V A O Q E D V I A S P S D . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . W Q R L N O V E L P Y W L R R P V Y S L V I W T F Q V N M T E A A V E D L H H Y R N L S E F F R R K L K P O A R P V C Q L H S V I ~ S P S D

. . . . .. . . . . . . . . . .

Q V I S O L Q K I . . E E D K I L O A K Q H N Y S L E A L L A Q N Y L M A D L F R N Q T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Q K I L O V Q I l N S E T Q E l E O V K Q M T Y S l K E F L Q - ~ T H S H P L M S K S A S S L D L T S O E E K H R E F A R V N R I O L A Q S

Q K I L T F Q O V K N C - - E V E O V K Q V T Y S L E S F L Q P R T Y T E D L S F P P A S S R D S F R N O L V T R E Q N ~ ~ ~ ~ ~ ~ - ~ ~ - . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F V T T Y L S P R O Y H R V H

E D T E O P L L N F K N E Q D O S V R E F K P S V S K N I H L L S O L S L N Y F S N Q F S C S E P H D T E L F F A V I Y L A P Q D Y H H F H

E L Y H C V I Y L A P Q D Y H C F H

. . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

M P C N Q l L R E M l Y V P Q O L F S V N H L T A O N V P N L F A R N E R V l C L F D T E F Q P M A O I L V Q A T I V Q S I E T V W A Q T I

S P V D W V C K V R R H F P Q O L F S V A P Y F O R N F P N L F V L ~ ~ E R V A L L Q S W K Y Q F F S M T P V Q A T N V Q S I K L N F D O E F

S P T D W T V S H R R H F P Q S L M S V N P Q M A R W I K E L F C H N E R V V L S Q D W K H Q F F S L T A V Q A T N V Q S I R I Y F D O O L

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

T P P R E Q I I K R W T W P . . . . . . . . A O E N D Q S V A L L K Q O E M Q R F K L Q S T V I N L F A P Q K V N L V E O L E S L S V T K I

V T N S K S D K H L E P H T C Y O A V Y E N A S K I L Q Q M P L V K Q E E M Q Q F E L Q S T V V L C F E A P T E F K F D V R V Q D K V K M .

~ ~ N S P R Y S K Q S Y N D L S F V T H - - A N K E - - Q I P M R K Q E H L Q E F N L Q S T I V L I F E A P K D F N F R L K A Q O K l R F -

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Q O P L A V S T E T F V T P D A E P A P L P A E E I E A E H D A S P L V D D K K D O V

Q O K L Q I I Q K N D L K

Q E A L Q S L

. . .

. . .

70

13

21

140

83

90

210

152

132

278

210

147

348

220

217

418

298

279

487

36 3

322

500

370

FIG. 2. Comparison of the predicted amino acid sequence of the yeast PSD with E. coli PSD and the mammalian cDNA. The amino acid sequence is aligned with the 322 amino acid sequence of the E. coli PSD proenzyme (35) and the 370-amino acid partial sequence from CHO-K1 cells (36). Gaps were inserted to allow alignment that gives the greatest identity. Identical amino acids are denoted with a dot.

kex 2 and RAS 2 on the long arm of chromosome 14 (data not shown).

Creation of the Null Phenotype for PSD-Diploid strains homozygous for the trpl mutation and wild type for the PSD gene were transformed to tryptophan prototrophy using a linear DNA sequence containing the TRPl gene inserted into an EcoRI site at nucleotide position 1013 in the PSD gene (Fig. 4A) (42). In one linear construct, the 5’ and 3’ ends of the transforming DNA were bounded by Ssp1 sites corresponding to nucleotides 637 and 1632, respectively, in the PSD gene. The orientation of the TRPl gene relative to the PSD gene was also determined and its direction of transcription was opposite to that for PSD. A second linear transforming construct was also made which was bounded on the 5’ and 3‘ ends by the HindIII sites of the PSD clone. The physical map in Fig. 4A predicts that upon HindIII digestion of genomic DNA from transformed strains, the intact PSD gene will yield a 2.1-kb DNA fragment, and the disrupted PSD gene will yield a 1.6- and a 1.3-kb DNA fragment.

The diploid trp+ prototrophs were examined by DNA hybridization analysis of HindIII-digested genomic DNA. All of the prototrophic strains were heterozygous at the PSD locus, containing one copy of the wild type PSD gene (2.1 kb) and a disrupted PSD gene (1.6 and 1.3 kb) (Fig. 5A) . The diploid

strains were induced to sporulate and analyzed for the segre- gation of tryptophan prototrophy and PSD activity. Analysis of 13 tetrads using the NBD-Ptd[l’-14C]Ser screening technique showed perfect cosegregation of tryptophan prototrophy and the loss of PSD activity and indicated that the PSD gene is not necessary for viability on rich media. Results from two representative tetrads are shown in Table 11. These strains were also examined for ethanolamine and choline auxotrophy, since this is an expected phenotype of psd- mutants. The results clearly show the cosegregation of the trp+ psd- geno- type but all strains examined failed to exhibit any requirement for either choline or ethanolamine. In addition, all strains were capable of growing on nonfermentable carbon sources (i.e. rho+). However, we have observed that strains containing disrupted PSD genes have a pronounced tendency to form rho- strains. Typically strains grown for 2 days on complex medium plus glucose contain about 50% rho- cells.

More detailed enzymatic analysis of tetrad derived strains is presented in Table I11 and relevant DNA hybridization analysis is shown in Fig. 5B. The enzymology clearly shows that the trp+ prototrophs containing the disrupted PSD gene have very low decarboxylase activity that is 2-5% the value found in sibling spores wild type for the locus. The residual activity is linear with time and protein concentration and is


Well -

CHROMOSOME

IV, XI1 xv- x111 r "I1 XVI JF

I1 X l V T - - PSD

XI - Vlll - V-

1x - 111 - VI -

I -

VI1 - FIG. 3. Chromosomal localization of the yeast PSD gene.

Yeast chromosomes were separated by TAFE and probed for PSD as described under "Experimental Procedures." The Roman numerals indicate the location of the chromosomes (I-XVZ).

inhibited by boiling and hydroxylamine treatment. Hydrox- ylamine is a potent irreversible inhibitor of PtdSer decarboxylase. The result suggests the presence of a second PtdSer decarboxylase enzyme or incomplete inactivation of the PSD gene. To verify that the PSD gene was disrupted in the haploid strains, a trp-, psd+ strain (PTY 7.3) and a trp+, psd- strain (PTY7.4) were analyzed by DNA hybridization as shown in Fig. 5B. Following HindIII digestion of genomic DNA, the trp-, psd" strain contained an intact PSD gene of 2.1 kb and the trp+, psd- strain contained a disrupted PSD gene composed of 1.6- and 1.3-kb pieces. These results reveal that no unusual genetic rearrangements have occurred to account for the residual decarboxylase activities.

There are three likely explanations for the observation that the strains harboring a disrupted PSD gene are not choline or ethanolamine auxotrophs and exhibit measurable decarboxylase activity. The simplest explanation is that there are two decarboxylase genes. A second explanation is that the TRPl insertion has yielded an active fusion protein between TRP and PSD (due to low level read through a stop codon) and the third is that the decarboxylase gene contains a weak internal promoter downstream of the disruption site. The physical map shown in Fig. 4A clearly rules out the possibility of a fusion protein, because the transcription of TRPl and PSD proceed in opposite directions. To rule out the presence of an internal promoter, a deletion in the PSD gene was constructed in conjunction with the TRPl insertion (see Fig. 4B). This deletion spans the region from nucleotide 1543 to 1813 and comprises 46 amino acids of the putative large PSD subunit and all of the small catalytic subunit (based on comparison with the E. coli sequence and subunit structure (35,47)). This construct was made by digesting the PSD gene with BclI and NdeI to create the deletion and excising the TRPl gene from plasmid pJJ280 using endonucleases BamHI and NdeI. Subsequently the DNA fragment containing the TRPl gene was ligated into the deletion within the PSD gene. The TRPl gene also contains a small fragment of lncZ' as a result of the restriction enzymes used, but the presence of this

A

r 0.6 H

0.5 S E E S H

0.5 I

I 0.6 I H s

0.9

FIG. 4. Physical maps of constructs utilized to disrupt the PSD locus. The 2.1-kb cloned insert containing the PSD gene was disrupted at the EcoRI site a t bp 1013 by the insertion of the TRPl gene ( A ) . A disruption within a deletion in PSD was also constructed ( B ) by deleting a DNA fragment from the BclI site a t bp 1543 to the NdeI site a t bp 1813, and inserting the TRPl gene, bounded by a BarnHI site and NdeI site. The numbers indicate the size of restriction fragments in kilobases. The abbreviations for the restriction enzymes are: B, BarnHI; E, EcoRI; H, HindIII; L, BclI; N, NdeI; S, SspI. Symbols: dark line, cloned DNA including PSD, light shaded line, TRPl gene; hatched bar, hcZ' carried over from pJJ280 plasmid. Arrows indicate the direction of gene transcription.

extraneous DNA is inconsequential. Both diploid and haploid cells were directly transformed with linear DNA excised from the final construct using the endonuclease SspI. The presence of the deletion in the PSD gene was confirmed by DNA hybridization analysis (Fig. 5 C ) , in which the gene with the deletion is indicated by a 1.8-kb HindIII fragment in place of the 2.1-kb wild type fragment (see Fig. 4). Haploid cells containing PSDA1::TRPl (e.g. strain PTY11) are virtually identical to the PSD::TRPl strains described above. The PSDA1::TRPl strains express low but measurable decarboxylase activity (Table 111) and are neither choline nor ethanolamine auxotrophs. The results implicate the presence of a second decarboxylase gene as responsible for the residual decarboxylase activity found in the disruption mutants.

Lipid Metabolism in PSD Null Mutants-Comparison of lipid synthesis from a [3H]serine precursor by strains with


1.6 1.3

- a ~ f ] PSD::TRP 1 )r) f Disruption

@ k B 1 2 3 2.1 * 0 f Intact PSD 1.6 * 0 - f ] PSD::TRP 1 1.3 * f Disruption

Intact PSD f PSDA::TRP 1

Disruption FIG. 5. Hybridization analysis of the PSD disruption. Ge-

nomic DNA from PSD::TRPl ( A and B ) , PSDA::TRPl ( C ) , and wild type strains was digested with HindIII, separated by size in a 0.7% agarose gel, transferred to nitrocellulose, and hybridized with 3zP- labeled EcoRI-Hind111 fragments (1 kb) of the PSD gene (see Fig. 4). A, diploids transformed with PSD::TRPl: lane 1 , digested plasmid control; lanes 2 and 3, wild type diploids d26 (422 X Trpla) and d30 (Adela X SEY 6211); lanes 4 and 7-9, trp prototrophs of d26; lanes 5 and 6, trp prototrophs of d30. B, spores obtained from PSD::TRPl diploid (d26): lane 1 , digested plasmid control; lane 2, trp-, psd+ spore PTY 7.3; lane 3, trp+, psd- spore PTY 7.4. C, strains transformed with PSDA::TRPl: lane 1, digested plasmid control; lane 2, trp-, psd+ haploid strain; lane 3, trp+, psd- transformant of Trpla; lane 4, trp+ transformant of diploid d30.

TABLE I1 Cosegregation of trp prototrophy and the psd- phenotype in tetrads derived from a diploid transformed with the PSD::TRPl construct

Trpl a trpl adel gall gal2 his2 + & 422 a trpl + + + his7 lys2 leu2

Genotype of parental strain d-26 (Trpla X 422).

Tetrad SDore osd" tm," chofetn" rho"

PTY 7 1 - + 2 + 3 + 4

PTY 8 1 + 2 3 4 +

- -

- + + + -

- -

- a A + indicates wild type activity (psd , rho) or nutrient prototrophy

(trp, choletn) and a - indicates defective activity (psd , rho) or nutrient auxotrophy (trp, choletn). The term rho refers to the ability to grow on nonfermentable carbon sources.

wild type (PTY 7.3) and disrupted (PTY 7.4) PSD loci is shown in Fig. 6. Log phase cells display dramatic differences in the amounts of labeled phospholipids. The labeling of the phosphatidylcholine (PtdCho) pool in the PSD::TRPl strain is nearly twice the value of that found in the wild type strain. In contrast, the labeling of PtdEtn is reduced by 74%, when a strain with the disrupted PSD gene is compared with that having an intact gene. In stationary phase cells, the labeling pattern appears more comparable, but the amount of radiolabel present in PtdEtn in the strain containing the disrupted PSD is still half that found for the strain with the wild type locus. The very low labeling of the phosphatidylinositol (PtdIns) pool is included in the figure to demonstrate that incorporation of isotope into the glycerol backbone or fatty

TABLE I11 Phosphatidylserine decarboxyhe activity of trp prototrophic strains

containing the PSD::TRPl or PSDA::TRPl disruption Values are the mean f S.D. for eight determinations from two

separate experiments. Strain TRP prototrophy PSD activity

Parental

422 Trpla

PTY 7.1 PTY 7.2 PTY 7.3 PTY 7.4

Dissected spores, PSD::TRPl

Directly transformed haploid," PSDA::TRPl

PTY 11 Haploid transformed was Trpla.

nml/mg/45 min

14.35 f 6.67 19.63 f 3.12

0.63 2 0.51 14.09 f 1.16 13.44 f 1.48 0.36 f 0.22

0.36 f 0.25

Or &idCho PldChO PldSer PldEln Pldks Or <FIdCho PldCho PIdS.Yr PtdEln UdlnS

PdOH PldOH

FIG. 6. Incorporation of ['Hlserine into phospholipids of PSD+ and PSD::TRPl mutant strains. Cells were grown to saturation in minimal SD medium, then diluted 1:20 into SD plus 2 pCi/ml~-[3-~H]serine (0.06 p ~ ) and incubated for 6 h (log phase) or 24 h (stationary phase). Lipids were extracted and separated as described under "Experimental Procedures." Values are the mean & S.D. of four determinations made in two separate experiments. Ab- breviations are: Or, origin; QtdCho, the region between Or and PtdCho; PtdOH, phosphatidic acid.

100

LOO PHASE STATIONARY PHASE

pTy7.4 (PSD::TRPl)

Or <PidCho PldCho PtdSer PldEln Ptdlns Or <PidCho PldCho PtdSer PldEln PtdlnS

PldOH PidOH +

FIG. 7. Comparative "P labeling of PSD+ and PSD::TRPl mutant strains. Incubations were carried out as in Fig. 6, except the label added was [33P]orthophosphate at 10 pCi/ml. Incubation times and abbreviations were as in Fig. 6. Values are the mean & S.D. of five or six determinations from three separate experiments.

acids of lipids by the 13H]serine precursor is negligible. A total phospholipid profile of the wild type and mutant

strain was determined by measuring the incorporation of [33P] phosphate into the phospholipid pool (as shown in Fig. 7). At log phase, the total amount of labeled PtdEtn in the mutant


was -40% of that in wild type cells. PtdSer, PtdCho, and PtdIns levels, however, were increased between 20 and 30% in the mutant. At stationary phase, the mutant had a some- what lower total amount of PtdCho (-20%) as compared with wild type. Interestingly, at stationary phase the mutant had a comparable level of PtdEtn with the wild type. These data demonstrate that despite the disruption in the PSD gene, the mutant is capable of maintaining a relatively normal lipid profile in the absence of either choline or ethanolamine. Taken together, with the [3H]serine data described above, these results clearly implicate either a second decarboxylase enzyme or an ancillary pathway for ethanolamine formation (48, 49) (via sphingolipid catabolism) as an important route of metabolic bypass of the engineered inactivation of the PSD gene.

DISCUSSION

The experiments described in this report provide clear evidence for the development of partial and null mutants in a structural gene for yeast PtdSer decarboxylase and isolation of the gene for the enzyme. Sequence analysis of the gene indicates that it encodes for a protein of 500 amino acids. The location of the gene is between the RAS 2 and kex 2 loci on the long arm of chromosome XIV.

The enzyme from eukaryotes has been localized by frac- tionation and proteolytic topology studies to the inner mitochondrial membrane (6-9). The major structural motifs of the amino terminus of the yeast decarboxylase are consistent with the general rules for proteins that localize to and are imported into the mitochondria. The amino terminus of the yeast PtdSer decarboxylase contains approximately 20% evenly dispersed basic residues in the first 60 amino acids. This distribution of positive charges is similar to that found for subunit 9 of the FQ-ATPase from Neurospora crassa (50). These sequence motifs could not be identified in the putative mammalian PSD gene (36), because an unknown amount of the amino terminus was missing. From the remainder of the amino acid sequence data there is 43% identity with the mammalian protein and 28% identity with the bacterial protein. The amino-terminal structure suggests an inner membrane sorting pathway for the decarboxylase (51). Little is known about the processing of the eukaryotic protein, but it is anticipated that the amino terminus forms a mitochondrial- targeting sequence that will be cleaved in the mature protein. It is also likely that this protein will be a pyruvoyl-enzyme, since the amino acid sequence at residues 461-464 is identical to that for the bacterial enzyme at positions 252-255 where autoproteolytic processing to form the mature protein occurs (35, 47). These potential processing events should provide convenient biochemical markers for assembly of this protein into the mitochondrial inner membrane.

The gene for PSD is not required for growth in simple media lacking choline and ethanolamine. The result is sur- prising, since mutation in PtdSer synthase, the preceding enzyme in the pathway for PtdEtn synthesis, is lethal in the absence of choline or ethanolamine supplementation (52,53). The results with the gene disruption experiments reveal that there remains a very low level of PtdSer decarboxylase activity that may represent a second gene present in sufficient copy number to enable bypass of the null mutation in the PSD gene that we have cloned. The residual decarboxylase activity in PSD::TRPl cannot be the consequence of a fusion protein with the TRPl gene (that might occur with a low percentage read through the stop codon), because the directions of transcription for PSD and TRPl are opposite. Furthermore, construction of the deletion mutant PSDA1::TRPl removes the

putative catalytic subunit of the yeast gene (deduced by sequence comparison with the bacterial gene (35, 47)). Thus, the resultant strains are likely to have a second decarboxylase activity that accounts for the PtdEtn formation observed with [3H]serine and 33P precursors.

A potential alternative pathway for PtdEtn formation is via the formation of sphingosine phosphate and its cleavage to form phosphoethanolamine (49, 54) that is used as a substrate in the formation of CDP-ethanolamine. This latter idea seems unlikely for two reasons. First, the activity of this pathway appears inadequate to support PtdEtn synthesis in strains containing defects in PtdSer synthase without the application of either mutagenesis or selective pressure to develop secondary mutations (49). Second, introduction of the PSD::TRPl or PSDA1::TRPl constructs into strains containing null mutations in ethanolamine phosphotransferase (eptl-A1::URA 3 ) yields strains that still are viable ( d a t a not shown). Since the null ept- strain is defective in use of ethanolamine for PtdEtn synthesis (55), the likelihood that phosphoethanolamine salvage from sphingolipid catabolism accounts for the PtdEtn synthesis observed in the PSD::TRPl strains is remote.

The labeling experiments with [3H]serine indicate that during log phase growth the cells with the PSD::TRPl mutation incorporate much higher levels of radiolabel into PtdCho compared with wild type cells and have significantly lower amounts of PtdEtn. Results using 33P labeling also demonstrated lower PtdEtn levels and elevated PtdCho formation in log phase mutant strains as compared with wild type cells. A simple interpretation of this result is that the putative second decarboxylase enzyme produces PtdEtn that is efficiently shunted to the methylation pathway (45) for the purpose of making PtdCho. Upon reaching stationary phase, however, both wild type strains and those with the insertion- ally inactivated PSD gene contain comparable amounts of labeled PtdCho. The equivalent PtdCho levels at stationary phase may indicate that PtdEtn shunting to the methylation pathway decreases as the growth rate slows.

In summary, this report provides evidence demonstrating the isolation of a PtdSer decarboxylase gene from S. cereuisiae that we propose should be designated PSDl. The gene encodes a protein with structural similarity to the E. coli gene product and the partial gene product from mammalian cells. Muta- tions in the structural gene for the decarboxylase that also include large deletions encompassing the putative active site have minimal impact on cellular lipid metabolism and no effect on cell growth. The results clearly implicate the presence of a second gene for the decarboxylase enzyme.

Acknowledgment-We thank Peggy Hammond for excellent sec- retarial assistance, Dr. Robert Sclafani for advice regarding yeast genetics, and Dr. Katheleen Gardiner for generously providing yeast chromosomal blots.

REFERENCES

2. Hawrot, E., and Kennedy, E. P. (1975) Pruc. NUL A d . Sci. U. S. A. 72, 1. Kanfer, J. N., and Kennedy, E. P. (1964) J. BWL Chem. 239,172CL1726

3. Dennis, E. A., and Kennedy, E. P. (1972) J. Lipid Res. 13,263-267 4. Kennedy, E. P., and We&, S. B. (1956) J. BWL Chem. 222,19%214 5. Voelker, D. R. ( 1 W ) Pm. NUL Acad. Sci. U. S. A. 81,2669-2673 6. Van Golde, L. M. G., Raben, J., Batenburg, J. J., Fleischer, B., Zambrano,

7. Zborowski, J., Dygas, A., and Wojtcmk, L. (1983) FEBS Lett. 167, 179- F., and Fleiscber, S. (1974) Bioehim. Biophys. Acto 360 , 179-192

1112-1116

8. Kuchler, K., D a m , G., and Paltauf, F. (1986) J. BacterioL 166,901-910 9. Zinser, E., Sperka-Gottlieb, C. D. M., Fascb, E. V., Kohlwein, S. D.,

182

Paltauff, F., and Da-, G. (1991) J. Bacterid 173.2026--2034 10. Hiibscber. G. (1962) Bwhim. BwDhw. Acto 66. .55!G.S61 11. K a n f e r , J : N . ~ 1 9 7 2 j ~ . ~ L i p i d R ~ ~ 1 3 ~ 4 6 8 - 4 7 6 " ~ ~ -~~ 12. Bjerve, K. S. (1973) Bloeham Ewphys. Acto 296,549-562 13. Voelker, D. R. (1985) J. BioL Chem 260. 14671-14676 14. Vance, J. E., and Vance, D. E. (1986) J. BWL Chem 261, -91 15, Gnamuscb, E., Kalaus, C., Hrastnik, C., Paltauf, F., and Dawn, G. (1992)


16. 17. 18. 19. 20. 21. 22. 23. 24.

25.

Voelker, D. R. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,9921-9925 Voelker, D. R. (1990) J. Biol. Chem. 266,14340-14346 Voelker, D. R. (1991) J. BioL Chem. 266,12185-12188 Voelker, D. R. (1993) J. Bwl. Chem. 268, 7069-7074 Voelker, D. R. (1989) J. Biol. Chem. 264,8019-8025 Vance, J. E. (1990) J. BWL Chem. 266, 7248-7256

Ardail, D., Lerme, F., and Louiso, P. (1991) J. Biol. Chem. 266,7978-7984 Simbeni, R., Paltauf, F., and Daum, G. (1990) J. Bwl. Chem. 266,281-285

Hovius, R., Faber, B., Brigot, B., Nicolay, K., and de Kruijff, B. (1992) J.

Ohta. A,. Waaaoner. K., Louie. K.. and Dowhan. W. (1981) J. Biol. Chem.

Biochim. Biophys. Acta 11 11,120-126

Biol. Chem. 267,16790-16795 . .

256,2219"ii25 ' . . . .

26. Agranoff, B. W., and Suomi, W. D. (1963) Biochem. Prep. 10,46-51 27. Raetz, C. R. H., and Kennedy, E. P. (1973) J. Biol. Chem. 248,1098-1105 28. Sherman. F. (1992) Methods EnzvmoL 194.3-21 29. Sambrook, J.; Fritsch, E. F., and"Maniatis, T. (1989) Molecular Cloning: A

Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

30. Hill, J. E., Myers, A. M., Koerner, T. J., and Tzagoloff, A. (1986) Yeast 2,

31. Sherman, F., Fink, G. R., and Hicks, J. B. (1983) in Methods in Yeast Genetics. A Laboratory Manual, pp. 112-115, Cold Spring Harbor Laho- ratory, Cold Spring Harbor, NY

32. Elble, R. (1992) BioTechniqws 13, 18-20 33. Lawrence, C. W. (1989) Methods Enzymol. 194,273-281 34. Pagano, R. E., and Sleight, R. G. (1985) Scienee 229,1051-1057 35. Li, Q. X., and Dowhan, W. (1988) J. Biol. Chem. 263,11516-11522

163-167

36. Kuge, O., Nishijima, M., and Akamatsu, Y. (1991) J. Biol. Chem. 266,

37. Murray V. (1989) Nucleic Acids Res. 17,8889 38. Gerrin ' S. L., Connelly, C., and Hieter, P. (1991) Methods Enzymol. 194,

39. Gardiner K. and Patterson D. (1989) Electrophoresis 10,296-302 40. Olson Id Dutchik J. Graham M Brcdeur, G. Helms, C., Frank M

6370-6376

57-8

Makoiiin, M., Sbhhnman RI, aGd Frank, T. (1986) Proc. NatL Acad 41. Jong S. C and Edwards M. J. (1990) in Catalo w of Yeasts 18th Ed., pp.

Sci. U. S. A. 83,7826-7831'

42. Rothstein, R. (1991) M e k s Enzymol. 194,281-301 1Ok-163,' American T ' e Culture Collection, Lkvi l le , Mb

43. Phili psen, P., Stotz, A,, and Scherf, C. (1991) Methods Enzymol. 194, 168-182

44. Hanson B. A., and Lester, R. L. (1980) J. Lipid Res. 21,309-315 45. Carma: G. M. and Hen S. A. (1989) Annu. Reu. Blochem. 68,635-669 46. Satre, hi., and kennedy,%l P. (1978) J. Bwl. Chem. 263,479-483 47. L1 €). X., and Dowhan, W. (1990). J. Blol. Chem. 266,4111-4115 48. Stbf el, W , Stlcht, G., and Le Kim, D. (1968) Hoppe-Seyler's 2. Physiol.

Chmn RAR. 1745-1 7AR 49. Atkinson K. b. (1984) Genetics 108 533-543 50. Viebrock' A. Perz A and Sehald 1. (1982) EMBO J. 1 565-571 51. Sepi-Rial, h., StGa;, R. A., and hreupert, W. (1992) FEbS Lett. 313,2-

- . .- . . . . - - - - . - - - . - -

52. Atlcccson, K., Fogel, S., and Henry, S. A. (1980) J. Bwl. Chem. 266,6653-

53. Atkinson K. D., Jensen, B., Kolat, A. I., Storm, E. M., Henry, S. A., and

54. Stoffel, W., and Asaman, G. (1972) Hoppe-Seyler's 2. Physwl. Chem. 363,

0001

Fogel, k. (1980 J Bacterlol 141,558-564 965-97n

55. Hjelmstad, R. H., and Bell, R. M. (1988) J. Biol. Chem. 263,19748-19757 _" _."

Documents

OF No. 28, 5, pp. 1993 in L? A. Phosphatidylserine ... · THE JOURNAL OF BIOLOGICAL CHEMI~TRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc. Vol. 268,