Nucleotide sequence of cDNA clones encoding the complete precursor for subunit delta of thylakoid-located ATP synthase from spinach

Plant Molecular Biology 10: 323-330 (1988) © Kluwer Academic Publishers, Dordrecht - Printed in the Netherlands 323

Nucleotide sequence of cDNA clones encoding the complete precursor for subunit delta of thylakoid-located ATP synthase from spinach

J. Hermans, Ch. Rother, J. Bichler, J. Steppuhn and R.G. Herrmann* Botanisches Institut der Ludwig-Maximilians-Universitiit, Menzinger Str. 67, D-8000 Miinchen 19, FRG (*author for correspondence)

Received 14 August 1987; accepted in revised form 14 January 1988

Key words: chloroplast ATP synthase, subunit delta, cDNA nucleotide sequence, transit peptide, spinach

Abstract

The nucleotide sequence of the entire nuclear-encoded precursor for subunit delta of the ATP synthase from spinach thylakoid membranes was determined by cDNA sequencing. Appropriate recombinant DNAs were selected from pBR322 and lambda gtl 1 libraries made from polyadenylated RNA of greening spinach seedlings. The mature protein consists of 187 amino acid residues corresponding to a molecular weight of 20468. The precursor protein (257 amino acid residues; M r = 27 676) is probably processed between a Met-Val bond. The predicted secondary structure of the transit sequence (70 residues; 7.2 kDa) resembles that of the Rieske Fe/S polypeptide, but shows little similarity with those of stromal or luminal proteins. The comparison of the chloroplast delta amino acid sequence with the published delta sequences from respiratory ATP synthases of bacterial and mitochondrial sources and from the thylakoid ATP synthase of the cyanobacterium Syn- echococcus suggests substantial divergence at the genic level although structural elements appear to be remarkably conserved.

Introduction

ATP synthases of photosynthetic and respiratory membranes are structurally strikingly similar mul- tisubunit enzyme complexes that consist of a membrane-integral CF 0 or F 0 region involved in proton translocation, and an extrinsic appendix, CF 1 or F1, that catalyses the terminal phosphoryla- tion steps in ATP formation. ATP synthases local- ized in the thylakoid membrane of chloroplasts have been shown to be composed of at least 9 polypeptide species, of which 5, designated alpha to epsilon, con- stitute the coupling factor CF 1 and 4 (I - IV) the in- trinsic subcomplex CF 0 [6, 31]. In spinach, tobacco, pea and Marchantia six of these polypeptides, name- ly alpha, beta, epsilon, CF0-I, -III (proteolipid) and

-IV, are encoded in the plastid chromosome. Their genes have been isolated and sequenced [4, 6, 18, 23, 34, 35]. They are organized in two operons, the atp operons A and B, that are generally 40 kbp away from each other [6, 33, 34]. Arrangement and primary sequence of these genes in higher plants are conserved and remarkably resemble those of the (eight) genes in the atp operon of E. coli [4, 6, 31].

Three ATP synthase subunit species (gamma, delta and CF0-II ) are encoded by nuclear genes, syn- thesized in the cytosol as precursors with a substantial N-terminal extension, the transit peptide, which is removed during or after import into the organelle [9, 28, 33, 34]. In contrast to subunits gamma and delta, CF0-II apparently does not possess a functional equivalent in the E. coli complex indicating

324

the existence of two phylogenetic classes of nuclear- encoded chloroplast proteins [6].

We are engaged in deciphering molecular events related to function, biogenesis and evolution of the photosynthetic membrane and have recently isolated cDNA clones for more than 20 nuclear-encoded thylakoid membrane proteins from spinach including recombinant DNAs for the three nuclear- encoded ATP synthase subunits ([28], and unpub- lished results). We report here the first amino acid sequence of a nuclear-derived ATP snythase subunit precursor polypeptide, the delta subunit, as deduced from the cDNA nucleotide sequence. The analysis of cDNA and/or genomic clones for this subunit and for subunits gamma and CF0-II as well as the comparison of their transit peptides with those that route proteins to different locations within the organelle will be the subject of forthcoming papers.

Materials and methods

The construction of spinach seedling cDNA- pBR322 and -lambda gtll expression libraries was previously described [28]. Ca. 1500 members of the pBR322 library were first screened by hybrid select translation and a single clone for ATP synthase subunit delta, designated p6atpD-1, was isolated [9, 27]. This insert which was shown by sequence analysis to carry only a 179 bp C-terminal and 3' untranslated segment [27] was then used, under stringent conditions, as a probe to isolate "full-length" cDNA clones from the lambda gtll library by blot hybridization. Eight signals were obtained, of which the three largest, 1250, 790 and 740 nucleotides, were subject to nucleotide sequence analysis. Both the chemical method [15] and the dideoxynucleotide chain termination method [21] were employed to de- termine the nucleotide sequence. All reagents used were of analytical grade.

Results

A first, incomplete clone for the spinach chloroplast ATP-synthase subunit delta was identified from a pBR322-based cDNA bank. Its insert was shown (i)

to be delta-specific by hybrid select translation [2] and immunoprecipitation using a monospecific an- tiserum directed against subunit delta [16, 27], and (ii) to originate in a nuclear gene by Southern blot hybridization using restricted plastid and nuclear DNA, as well as by translocation and processing of the hybrid-selected product by isolated unbroken spinach chloroplasts [28]. This insert was used to select eight further cDNA clones, including 123SocD-3, from a phage lambda gtll library by plaque filter hybridization [28]. The insert size of this recombinant phage (1250 nucleotides) exceeded that of the mRNA (1050 nucleotides) as estimated by Northern blot analysis [28] since the 5' untranslated region contains a 131 nucleotide segment that is identical to the non-coding strand at the 3' end of this cDNA. This extension is probably an artifact that has been observed in a number of instances (e.g. [24, 25, 29]). The fragment was recloned into the Bluescript vector M13' (Stratagene, San Diego) to yield plasmid p6SocD-3.

Sequence strategy, nucleotide sequence, together with the predicted amino acid sequence of this clone are presented in Figs. 1 and 2. The 1250 nucleotide sequence, excluding a 84 bp poly A-tract, contains a single open reading frame of 771 bp and 191 bp 3' untranslated region. The 3' untranslated region of p6SocD-3 DNA constitutes probably a complete 3' cDNA copy of a mature delta mRNA. It is bordered by a poly A-tract, is rich in A and T nucleotides (ca. 70%) relative to the coding region (ca. 50%), and contains a potential polyadenylation signal, TATAA (nucleotide position 938- 942), 21 bases upstream of the poly A-tract (Fig. 2). Moreover, comparison of the 3' sequences of the four clones sequenced gave identical patterns (disregarding a shorter cDNA lacking a poly A-tract; Fig. 1) indicating that they derived from one gene. However, the isolation of 8 genomic clones from an unamplified EMBL4 library that fall into three restriction classes (4, 2 and 2 recombinant phage, respectively) suggests the pres- ence of several genes or alleles for this protein in chromosomal DNA. At least one of these genes car- ries an intron (J. Bichler, personal communication).

Comparison of the amino acid sequence, deduced from the nucleotide sequence, with the published partial amino acid sequence of the delta subunit

325

I I I I I

I I ,I ' , I 200 860 ooo 2oo

| P J --

Fig. 1. Partial restriction map and sequencing strategy of the p6SocD-3 cDNA insert. The coding region for the mature protein, presented 5 ' to 3 ' , is boxed. The curved arrow marks the 5' terminal segment complementary to part of the mRNA 3' end (nucleotide positions 713-843). Direction and extent of individual sequencing reactions are indicated by arrows; dots mark sequence reactions determined according to Maxam and Gilbert [15], vertical dashes those according to Sanger et al. [21], and rectangles indicate sequence reactions starting from 5' and 3' termini of various recombinant cDNAs.

-60 -30 TCACACTTCCTATCCTCTCTCTCCACTCTCACTTTCTCTCTCCTCCCTCTATCTCTGTACAGCCGGCAACA

1 30 60 ATG GCG GCG TTG CAA AAT CCA GTA GCC TTA CAA TCC AGA ACA ACA ACC GCC GTT GCA GCA TTA TCA ACT TCA TCC ACC ACC AGT MET Ala Ala Leu Gln Ash Pro Val Ala Leu Gln Set Arg Thr Thr Thr Ala Val Ala Ala Leu Set Thr Set Set Thr Thr Set

90 120 150 CCT CCG AAG CCA TTT TCC CTC TCC TTT TCC TCT TCC ACC GCC ACC TTC AAT CCC CTC AGG CTT AAA ATT TTA ACC GCC TCT AAG Pro Pro Lys Pro Phe Set Leu Set Phe Ser Set Ser Thr Ala Thr Phe Asn Pro Leu Arg Leu Lys Ile Leu Thr Ala Ser Lys

180 210 240 CTC ACC GCC AAA CCT CGC GGC GGA GCT CTT GGT ACC CGC ATG GTG GAC TCC ACC GCT AGC AGG TAC GCC TCC GCG CTC GCT GAT Leu Thr Ala Lys Pro Arg Gly Gly Ala Leu GIy Thr Arg MET~al Asp Ser Thr Ala Ser Arg Tyr Ala Set Ala Leu Ala Asp

270 300 330 GTC GCC GAC GTC ACC GGT ACT CTT GAA GCT ACC AAC TCT GAT GTG GAA AAA CTG ATC AGG ATT TTC TCC GAA GAA CCG GTG TAT Val Ala Asp Val Thr Gly Thr Leu Glu Ala Thr Asn Ser Asp Val Glu Lys Leu Ile Arg lie Phe Set GIU Glu Pro Val Tyr

360 390 420 TAC TTC TTT GCT AAC CCA GTG ATC AGC ATT GAC AAC AAG CGT AGC GTC TTG GAT GAG ATC ATC ACC ACC TCA GGA CTC CAG CCT Tyr Phe Phe Ala Ash Pro Val lie Set rle Asp Ash Lys Arg Ser Val Leu Asp Glu Ile rle Thr Thr Ser Gly Leu Gin Pro

450 480 CAT ACC GCA AAC TTC ATT AAC ATC TTG ATA GAT TCA GAG CGA ATC AAT CTA GTT AAG GAA ATA TTG AAT GAG TTT GAG GAT GTG His Thr Ala Ash Phe Ile Ash Ile Leu Ile Asp Ser Glu Arg Ile Asn Leu Val Ly~ Glu I1e Leu ASh Glu Phe Glu Asp Val

510 540 570 TTT AAT AAG ATT ACC GGC ACT GAA GTG GCA GTG GTG ACT TCG GTG GTA AAG CTG GAG AAT GAT CAC TTG GCT CAG ATT GCT AAG Phe ASh Lys Zle Thr Gly Thr Glu Val Ala Val Val Thr Ser Val Val Lys Leu GIu ASh Asp His Leu A1a Gin Ile Ala Lys

600 630 660 GGT GTC CAG AAG ATT ACG GGG GCA AAG AAT GTG AGG ATT AAG ACA GTG ATC GAC CCC TCA CTG GTT GCT GGC TTC ACT ATC AGG Gly Val Gln Lys Ile Thr Gly Ala Lys Ash Val Arg Ile Lys Thr Val Ile Asp Pro Set Leu Val Ala Gly Phe Thr Ile Arg

690 720 750 TAT GGT AAT GAA GGT TCC AAG TTG GTT GAT ATG AGT GTG AAG AAA CAG CTT GAG GAG ATT GCT GCT CAA CTT GAA ATG GAT GAT Tyr Gly Ash Glu Gly Ser Lys Leu Val Asp MET Set Val Lys Lys Gin Leu Glu GIu Ile Ala Ala Gln Leu Glu MET Asp Asp

780 810 840 GTT ACA CTT GCT GTA TAA ATTTAGTAATTATATGATCATCTAGTAAATTTGGCTCGTAAAAATGTTCTGAATTTAAGTATGGAATTCTGCATTTTTGAAACTATA Val Thr Leu Ala Val -O-

870 900 930 960 TGAACTTATATTTGTATAATCAAATTTATGACAAGCAAATTGTGCCTTTGTCCATTATTTTTGCTTGTTCGGTATCTATAAGATGAGGGTGT•ACATTTTCC (A.)

Fig. 2. Nucleotide sequence and deduced amino acid sequence of the p6SocD-3 cDNA insert. The 5' complementary duplication is exclud- ed (cf. Fig. 1). Numbering of the nucleotide sequence begins at the putative initiative methionine of the precursor; the terminal processing site of the transit peptide is marked by an arrowhead. The complete sequence of the delta precursor protein is presented in triplets. A potential polyadenylation signal is underlined.

326

from spinach [1] confirms the identification of the chimeric plasmids and phage, respectively. The sequence of the nucleotide interval 211-315 cor- responds exactly to that of the 35 N-terminal residues established for the purified spinach protein by Edman degradation. This implies that the cDNA contains the entire amino acid-coding region for the mature protein, that the mature spinach delta subunit consists of 187 residues, corresponding to a molecular mass of 20.4 kDa, and that the transitory transit peptide (70 amino acid residues; 7.2 kDa) ter- minates with residue Met (Fig. 2; see below). These assignments are consistent with the size of both the delta subunit and its precursor as estimated from its electrophoretic mobility in SDS-containing poly- acrylamide gels (27 and 19.5 kDa respectively; [34]).

The derived amino acid sequence preceding the putative N-terminus of the mature protein harbors the transit sequence for subunit delta. Unfortunate- ly, the reading frame extends 5' for 24 triplets to the very end of the largest cDNA insert (and up to 164 residues in the corresponding genomic clone) with- out an in-phase stop codon. The calculated mass of this polypeptide chain substantially exceeds the size of the transit peptide, estimated from the electrophoretic mobility difference between precursor and mature protein (7.5 kDa; [34]) and, hence, with- out direct amino acid sequence data from the precursor protein, we cannot be certain of exactly where the transit peptide begins. However, the indicated initiator methionine, 70 codons upstream, gives the best (and only possible) fit with translational initiation of mRNA for subunit delta. It is the only methionine residue in the entire in-frame upstream sequence, and application of Kozak's rule [12] for "scanning translational initiation sites" of eukaryotic mRNAs predicts initiation at the chosen methionine (consen- sus motif PuXX/ATG/G vs. ACA/ATG/G in Fig. 2). In addition, the amino acid sequence in the indicated interval exhibits properties similar to those of transit sequences. At the N-terminal third, the sequence is rich in hydroxylated and basic amino acids; acidic residues are absent. We conclude from this that the transit sequence of subunit delta is comprised of 70 amino acid residues.

The comparison of the transit sequence with those of other nuclear-encoded thylakoid membrane pro-

teins reveals some similarity with the transit peptides for the Rieske Fe/S protein [26], subunit gamma and CF0-II (to be published), but substantial difference in primary sequence and predicted secondary structure to those of the luminal proteins plastocyanin [20, 24] and the "33 kDa", "23 kDa", and "16 kDa" polypeptides associated with the water ox- idation complex [10, 29], remarkably also to those of the small subunits of ribulose bisphosphate car- boxylase/oxygenase and the chlorophyll a/b apoproteins of light-harvesting complexes (summa- rized in [11]). Subunit delta shares import through the two organelle envelope membranes with the lat- ter group while the former traverse three membranes (outer and inner envelope; thylakoid membrane). This suggests that transit sequences for chloroplast proteins can be grouped into at least 3 different classes, although there appears to be no need for a substantially different transit sequence between those proteins imported into the stroma. However, from the plastome-encoded subunits CF0-I in spinach and wheat [6, 31] and CF0-IV in spinach (Gr/iber, personal communication) it has been postulated that 17 and 18 amino acids, respectively, may be removed from the N-terminus to produce the mature subunits found in the ATP-synthase complex. It is conceivable, therefore, that the mature subunit delta is preceded by a composite transit sequence, similar to those found for the nuclear-encoded luminal proteins [10, 20, 24, 29], but for a different reason. The design of the putative CF0-I and CF0-IV leaders differs substantially from that of transit sequences. These polypeptide extensions might be needed for subcellular differentiation, that is, to direct both subunits to their proper location within CF 0. It will therefore be highly interesting to establish whether subunit delta is processed in one or two steps.

The availability of primary structures for ATP synthase subunits represents an indispensible step towards a detailed understanding of ATP synthase function, establishing the three-dimensional structure of the enzyme complex and its evolution. Characterization by biochemical analysis has established that many features of ATP synthases from all sources studied are conserved [17, 22, 31]. The pre- cise function of subunit delta is not known. Recon- stitution assays have demonstrated that this subunit

enhances coupling activity and suggest that it is involved in binding of CF~ to the membrane sector [1, 17, 31]. Sequence comparisons show that the ATP synthase subunits have evolved at different rates [6, 31]. The beta- and, to a lesser extent, alpha- and proteolipid sequences have been highly conserved, whereas the conservation of others is generally con- fined to rather restricted regions of the polypeptide chains.

Comparison of the delta sequences, of that of oscp, the bovine equivalent for subunit delta [19], of mitochondrial and bacterial ATP synthases and of that from the thylakoid ATP synthase of the cyanobacterium Synechococcus [3] shows that this subunit is poorly conserved (Fig. 3; cf. [31]). A total

327

of 6% of the residues are identical in the five polypeptides for which such data are available. It is therefore not surprising that this conclusion extends to the delta subunit of the ATP synthase from chloroplasts. Only a few regions of short homology (ca. 6%) are found with the strongest relationships in the C- terminal and N-terminal parts of the chains (Fig. 3). (Similarity between delta subunits is substantially greater, more than 20%, in pairwise comparison and if conservative replacements are allowed.) Neverthe- less, the sequence comparison leads to two points of general interest:

(1) The delta subunit of the chloroplast ATP synthase from spinach doubtlessly represents the

Synechococcus 6301 E. coli Rps.blastica Rsp.rubrum Bovine oscp Sp.oleracea

MTST ....... MSE ...MAEAASI ...MSSHKAG FAKLVRPPVQ ........ VD

VG RY r UVS SKQN U QVEKELL

LFRS'I~ASA AFAAEVTKNE ALKD~GSP SLKAM~DESG RVGQI~.KEP KLIRIFSEEP


DLRHLLENPT QM.AELLSGA DLGAMIA~ DLRRVIAS~V

.VYYFFA~.~V

FSS AVflU V GSSW

TALAEKAGFH IGRDDQRK~ EIVR~LGVV

ISIDNKRS%~ DEIITTSGLQ ~HT~FINIL

VDR~AFLD

s K FAq

IDS~INLVK

Synechococcus 6301 E, coli Rps.blastica Rsp.rubrum Bovine oscp Sp.oleracea

GIADRYQALL DVLE~HLR QVLSALAGLI G M I G i ~ E R L AWS STMM EILNE~EDVF

..R .LR VV RADV -eZ T ' VQVITE

S KKLAE T SALTT

KVKQ.L~A AMEKRLSR.K TLKAKV.~.K

VLKSFLKKGQ GVQ,KI~K


~ IESQ~ LNCK~K LNTT~E IDAS~D~

VLKLEVK~P

• . .~V

IG[. E.. KY%I~M I~AKTKIQ~.

I S ...... LAA ...... QS

. Q L

• SR~I~QIL AQL~LAV

Fig. 3. Alignment of the protein sequences of the mature delta subunits of ATP synthases from spinach thylakoid membranes (this paper), beef (ospc-subunit, [19]), E. coli [32], Rhodopseudomonas blastica and Rhodospirillum rubrum [5, 30] and the cyanobacterium Syn- echococcus 6301 [3]. Identical residues in at least four proteins are boxed, gaps are introduced to allow for maximal homology. Due to the low degree of conservation alignments are inherently arbitrary and somewhat different arrangements may be possible. Note that the delta subunits of Neurospora crassa [13] and bovine mitochondria [19] were designated on the basis of electrophoretic mobility and are the functional counterparts of subunit epsilon in other organisms studied.

328

homologue to the corresponding mitochondrial and bacterial proteins reinforcing the functional equivalence and common phylogenetic root of photosynthetic and respiratory ATP synthases [6, 31]. This follows from the conserved pattern

of various amino acids and is even more evident by secondary structure predictions that demon- strate the equivalence of structural elements at corresponding positions (Fig. 4 and below). The hydropathy pattern shows that the chloroplast

A

~[, t;o ,75~--~---~00 2~ ~o~-

2 . . - - - - - - . - - - . - - ~

B

1-

O-

-t 1 -2

Fig. 4. Hydropathy profiles of the delta subunit of ATP synthase from spinach chloroplasts (A) and Rhodopseudomonas blastica (B, [30]). The gain of free energy during transition of an ll-residue moving segment from water into the membrane is calculated according to Kyte and Doolittle [14].

subunit delta, as expected, is largely hydrophilic which is consistent with the observation that the major portion of the delta sequence is exposed to the aqueous phase (Fig. 4). The chain includes only a few relatively hydrophobic seg- ments that are too short and too polar to form membrane-spanning regions. In general, hydropathic indices > 2 and domains of at least 18 residues in an c~-helical conformation are re- quired to traverse the membrane. The outlined pattern is phylogenetically conserved (Fig. 4).

(2) The poor conservation of primary structure suggests that, indeed, structural aspects rather than primary sequences are important in some common features of delta subunits and that this subunit fulfils primarily a structural rather than a catalytic role which certainly would be more constrained. The most remarkable, predicted property shared includes three amphipathic helices at the N-terminus, centrally and at the C- terminus (positions 7 - 23, 55 - 104, 166-175; cf. also [1]), suggesting that delta subunits from different sources will be folded in a similar way and may have co-evolved by compensatory mutations with other subunits of the complex. The well conserved sided o~-helices and other local regions, e.g. at amino acid positions (mature protein) Asn 74, Arg 84, Asp 144 and 164, may therefore be involved in forming subunit/ subunit interfaces or intramolecular chain/ chain interaction. The significance of the structural aspects and short homologies in ATP synthase subunits and the possible role of compensatory mutation in the acquisition of biological specificity that is, for example, seen in inter- specific plastid/nuclear hybrids (reviewed in [7, 8]) will probably become clear if better two- and three-dimensional structural information comes along.

Acknowledgements

The expert technical assistance of Ms. Gabriele Wil- lig is gratefully acknowledged. This work was sup- ported by the Deutsche Forschungsgemeinschaft (grant He 693; SFB 184) and the Fonds der Chemischen Industrie.

329

References

1. Berzborn R J, Finke W, Otto J, V61ker M, Meyer H, Nier W, Oworah-Nkruma R, Block J: Partial protein sequence of the subunit delta from spinach and maize CF 1 and topographi- cal studies on the binding region between CF Z and CF o. In: Biggins J (ed.) Progress in Photosynthesis Research, Vol. III. Martinus Nijhoff Publishers, Dordrecht (1987) pp 99-102.

2. Biinemann H, Westhoff P, Herrmann RG: Immobilization of denatured DNA to macroporous supports: I. Efficiency of different coupling procedures. Nucl Acids Res 10: 7163 - 7180 (1982).

3. Cozens AL, Walker JE: The organization and sequence of the genes for ATP synthase subunits in the cyanobacterium Syn- echococcus 6301. J Mol Biol 194:359-383 (1987).

4. Cozens AL, Walker JE, Phillips AL, Huttly AK, Gray JC: A sixth subunit of ATP synthase, an F 0 component, is encoded in the pea chloroplast genome. EMBO J 5 :217-222 (1986).

5. Falk G, Walker JE: Transcription ofRhodospirillum rubrum atp operon. Biochem J 229:663-668 (1985).

6. Hennig J, Herrmann RG: Chloroplast ATP synthase of spinach contains nine nonidentical subunit species, six of which are encoded by plastid chromosomes in two operons in a phylogenetically conserved arrangement. Mol Gen Genet 203:117-128 (1986).

7. Herrmann RG, Possingham JV: Plastid DNA - the plastome. In: Reinert J (ed.) Results and Problems in Cell Differentia- tion, Vol. X. Springer Verlag, Berlin/Heidelberg/New York (1980) pp 45-96.

8. Herrmann RG, Seyer P, Schedel R, Gordon K, Bisanz C, Winter P, Hildebrandt JW, Wlaschek M, Alt J, Driesel A J, Sears BB: The plastid chromosomes of several dicotyledons. In: Biicher T, Sebald W, Weiss H (eds) Biological Chemistry of Organelle Formation. Springer Verlag, Ber- lin/Heidelberg/New York (1980) pp 97-112.

9. Herrmann RG, Westhoff P, Alt J, Winter P, Tittgen J, Bisanz C, Sears BB, Nelson N, Hurt E, Hauska G, Viebrook A, Se- bald W: Identification and characterization of genes for polypeptides of the thylakoid membrane. In: Ciferri O, Dure (III) L (eds) Structure and Function of Plant Genomes. Ple- num Publishing Corporation (1983) pp 143-153.

10. Jansen T, Rother C, Steppuhn J, Reinke H, Beyreuther K, Jansson C, Andersson B, Herrmann RG: Nucleotide sequence of cDNA clones encoding the complete "23 kDa" precursor and "16 kDa" precursor proteins associated with the photosynthetic oxygen-evolving complex from spinach. FEBS Letters 216:234-240 (1987).

11. Karlin-Neumann GA, Tobin EM: Transit peptides of nuclear- encoded chloroplast proteins share a common amino acid framework. EMBO J 5 : 9 - 1 3 (1986).

12. Kozak M: Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44:283-292 (1986).

13. Kruse B, Sebald W: Nucleotide sequences of the nuclear genes for the proteolipid and delta subunit of the mitochondrial ATP synthase of Neurospora crassa. Eur Bioenerget

330

Cong Rep 3B: 67-75 (1984). 14. Kyte J, Doolittle RF: Nucleotide sequences of the nuclear

genes for the proteolipid and delta subunit of the mitochondrial ATP synthase of Neurospora crassa. J Mol Biol 157: 105-132 (1982).

15. Maxam AM, Gilbert W: Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol 65: 499- 560 (1980).

16. Nelson N, Nelson H, Schatz G: Biosynthesis and assembly of the proton-translocating adenosine triphosphate complex from chloroplasts. Proc Natl Acad Sci (USA) 77:1361-1364 (1980).

17. Nelson N: Proton-ATPase of chloroplasts. Current Topics Bioenerget 11:1-33 (1981).

18. Ohyama J, Fukuzawa H, Kohchi T, Shirai H, Sano T, Sano S, Umesono K, Yasuhiko S, Takeuchi M, Chang Z, Aota S-I, Inokuchi H, Ozeki H: Chloroplast gene organization deduced from complete sequence of liverwort Marchantia

polymorpha chloroplast DNA. Nature 322: 572- 574 (1986). 19. Ovchinnikov YA, Modyanov NN, Grinkevich VA, Aldanova

NA, Trubetskaya OE, Nazimov IV, Hundal T, Ernster L: Amino acid sequence of the oligomycin sensitivity- conferring protein (OSCP) of beef-heart mitochondria and its homology with the/t-subunit of the F1-ATPase of Es- cherichia coli. FEBS Letters 166:19-22 (1984).

20. Rother C, Jansen T, Tyagi A, Tittgen J, Herrmann RG: Plastocyanin is encoded by an uninterrupted nuclear gene in spinach. Curr Genet ll: 171-176 (1986).

21. Sanger F, Nicklen S, Coulson AR: DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci (USA) 74: 5463- 5467 (1977).

22. Senior AE, Wise JG: The proton ATPase of bacteria and mitochondria. Membrane Biol 73: 105-124 (1983).

23. Shinozaki K, Ohme M, Tanaka M, Wakasugi T, Hayashida N, Matsubayashi T, Zaita N, Chungwongse J, Obokata J, Yamaguchi-Shinozaki K, Ohto C, Torazawa K, Meng BY, Sugita M, Deno H, Kamogashira T, Yamada K, Kusuda J, qhkaiwa F, Kato A, Tohdoh N, Shimida H, Sugiura M: The complete nucleotide sequence of the tobacco chloroplast genome: its gene organization and expression EMBO J 5: 2043-2049 (1986).

24. Smeekens S, de Groot M, van Binsbergen J, Weisbeek P: Se- quence of the precursor of the chloroplast thylakoid lumen

protein plastocyanin. Nature 317:456-458 (1985). 25. Smeekens S, van Rinsbergen J, Weisbeek P: The plant fer-

redoxin precursor: nucleotide sequence of a full length cDNA clone. Nucl Acids Res 13:3179-3194 (1985).

26. Steppuhn J, Rother G, Hermans J, Jansen T, Salnikow J, Hauska G, Herrmann RG: The complete amino-acid sequence o f the Rieske FeS-precursor protein from spinach chloroplasts deduced from cDNA analysis. Mol Gen Genet 210:171-177 (1987).

27. Tittgen J: Die Klonierung von genomischer und copy-DNA- Untersuchungen an nukle~iren Genen fiir plastid~ire Polypep- tide aus Spinacia oleracea. Dissertation, Universit~t Diissel- dorf (1985).

28. Tittgen J, Hermans J, Steppuhn J, Jansen T, Jansson C, An- dersson B, Nechushtai R, Nelson N, Herrmann RG: Isolation of cDNA clones for fourteen nuclear-encoded thylakoid membrane proteins. Mol Gen Genet 204:258-265 (1986).

29. Tyagi A, Hermans J, Steppuhn J, Jansson C, Vater F, Herr- mann RG: Nucleotide sequence of cDNA clones encoding the complete "33 kDa" precursor protein associated with the photosynthetic oxygen-evolving complex from spinach. Mol Gen Genet 297:288-293 (1987).

30. Tybulewicz VLJ, Falk G, Walker JE: Rhodopseudomonas blastica atp operon. J Mol Biol 179:185-214 (1984).

31. Walker JE, Fearnley IM, Gay N J, Gibson BW, Northrop FD, Powell S J, Runswick M J, Saraste M, Tybulewicz VLJ: Primary structure and subunit stoichiometry of FrATPase from bovine mitochondria. J Mol Biol 184: 677- 701 (1985).

32. Walker JE, Gay N J, Saraste M, Eberle N: DNA sequence around the Escherichia coli unc operon. Biochem J 224: 799-815 (1984).

33. Westhoff P, Alt J, Nelson N, Herrmann RG: Genes and tran- scripts for the ATP synthase CF 0, subunits I and II from spinach thylakoid membranes. Mol Gen Genet 199: 290- 299 (1985).

34. Westhoff P, Nelson N, Btinemann H, Herrmann RG: Locali- zation of genes for coupling factor subunits on the spinach plastid chromosome. Curr Genet 4: 109-120 (1981).

35. Zurawski G, Bottomley W, Whitfeld PR: Structures of the genes for the ~ and ~ subunits of spinach chloroplast ATPase indicate a dicistronic mRNA and an overlapping translation stop/start signal. Proc Natl Acad Sci (USA) 79:6260-6264 (1982).

Documents

Nucleotide sequence of cDNA clones encoding the complete precursor for subunit delta of thylakoid-located ATP synthase from spinach