Nucleotide sequence and copy control function of the extension of the incI region (incI-b) of Rts1

PLASMID 17,46-56(1988)

Nucleotide Sequence and Copy Control Function of the Extension of the incl Region (k/-b) of Rtsl

HATSUMI NOZUE,’ KIMIAKI TSUCHIYA,~ AND YOSHIYUKI KAMIO

Department of Bacteriology. Shinshu University School of Medicine. Asahi 3-1-I. Matsumoto 390, Japan

Received August 3 I, 1987; revised December 2 I, I987

An Rtsl derivative, pTW20, contains three incompatibility (inc) regions, incl-a (incl in previous studies), incll. and newly determined incl-h loci. By restriction analysis, we have located the incl-b adjacent to the incl-a region on the pTW20 map. Nucleotide sequence analysis of the minimal incl-6 region revealed the presence of four repeated sequences, each consisting of 18 bp, which is similar to the incl-a and incII repeats existing on mini-Rts I. All four repeating units were required for expression of a strong incompatibility. In addition, RepA protein, essential for the replication of Rtsl, bound specifically lo the repeated sequences. suggesting that the repeats would titrate out RepA protein as do incl-a and Incll. Insertion of the in&b lo a mini-Rtsl plasmid in a natural arrangement decreases the copy number of mini-Rtsl lo the same level as that of mini-F. The incl-a and incl-b might be a single constituent in incompatibility and copy number control of Rts I. o I ~88 Aadems PRSS, IN.

The copy number of a plasmid is regulated by incompatibility determinant (inc) at its own definite level. In ColEl (Tomizawa et al., 1981) and IncFII plasmids (Light and Molin, 1983; Stougaard et al., 1981; Easton and Rownd, 1982; Rosen et al., 198 1; Wom- ble et al., 1984; Danbara et al., 198 1 ), a small RNA is implicated in copy number control by either inhibiting primer formation required for the initiation of DNA replication or hybridizing with mRNA for the initiator protein. On the other hand, in F (Ssgaard- Anderson et al., 1984; Tsutsui et al., 1983), Pl (Abeles et al., 1984), R6K (Germino and Bastia, 1983; Kolter and Helinski, 1982; Shafferman et al., 1982), and pSClO1 (Churchward et al., 1983), direct repeat DNA sequences in the replication region control their copy number by titrating the initiator protein. Rtsl also belongs to the plasmids that contain the repeated sequences in the replication region (Kamio and Tera- waki, 1983; Kamio et al., 1984).

’ To whom correspondence should be addressed. ’ Present address: Department of Internal Medicine,

Shinshu University School of Medicine, Asahi 3-l-l. Matsumoto 390, Japan.

Rtsl is a low copy number plasmid in its replication (Terawaki et al., 1974) and belongs to the T-incompatibility group (Coet- zee et al., 1972). An Rts 1 deletion derivative, pTW20, contains two incompatibility regions incA and incB (Terawaki et al., 198 1). incA is located on the 1.8-kb EcoRI-Hind111 fragment (mini-Rtsl) which is capable of autonomous replication, and incB on the 5.2- kb EcoRI fragment (ES) adjacent to mini- Rts 1. incA is separable by restriction analysis into two regions, inch and incll (Kamio and Terawaki, 1983). The nucleotide sequence of mini-Rtsl showed that inch and incll con- sists of five 24-bp direct repeats and three 2 1 -bp direct repeats, respectively, and repA encoding a protein (RepA) essential for Rtsl replication is flanked by the two clusters of direct repeats (Kamio et al., 1984). Recently, Kamio has demonstrated that purified RepA protein binds to the repeated sequences (un- published data).

incll is essential for the autonomous replication of mini-Rts 1, since the replication origin region of Rtsl includes incll (Itoh et al., 1987). In contrast, incf is dispensable for the replication, but controls negatively the copy number of the plasmid (Kamio and Tera-

0147-619X/88 $3.00 COPYnLdN 33 1988 by Acadamc Press.. Inc. AlI n&S of rcprcductmn in any form rcwwcd.

46

EXTENDED inc1 REGION OF Rtsl 47

waki, 1983). Since it is predicted that incB is the extension of the inch region being located downstream of repA, incB and incl are newly designated in&b and incl-a, respectively. In this study, we determined the precise locus of incl-b on the pTW20 map and determined its nucleotide sequence. We also examined binding of RepA to in&b in vitro and its function on mini-Rts 1 replication.

MATERIALS AND METHODS

Bacterial strains and plasmids. Esche- richia coli K- 12 strains JC 1569 (recA1 gal Ieu his arg met str) (Clark et al., 1966) JG 112 @olA lacy thy str) (Miller et al., 1978), and JM103 (A (lac pro) thi rpsL supE endA sbcB15 hsdR/F’ traD36 proAB IacF IacZ A M 15) (Messing et al., 198 1) were used as host cells. Plasmids used are listed in Table 1.

Media. Penassay broth (Difco Laborato- ries, Detroit, MI) was used for cultivation of bacteria throughout this study, except that

L-broth was used for transformation and cultivation to prepare plasmid DNA.

Enzymes and chemicals. Exonuclease BAL 31, bacterial alkaline phosphatase, T4 DNA ligase, T4 polynucleotide kinase, restriction endonucleases, and phosphorylated linkers were purchased from Takara Shuzo (Kyoto, Japan). [T-~~P]ATP (5000 Ci/mmol) was purchased from ICN Radiochemicals (Irvine, CA) and DNaseI was from Boehringer-Mannheim (Mannheim, West Germany).

Preparation of plasmid DNA and isolation of restricted DNA fragment. Plasmid DNA was purified by the method of Clewell and Helinski ( 1969) and the restricted fragments were extracted from polyacrylamide gels after electrophoresis by the method of Mu- rotsu and Matsubara ( 1980).

Nucleotide sequence determination. Nu- cleotide sequence was determined by the method of Maxam and Gilbert ( 1977).

Construction of deletions in I&-b.

TABLE I

PLASMIDS USED

Plasmid Drug resistance” Composition Reference

pACYC I84 pUC8 pKPlOl3

pTW20 pTW20-HR pTW60 I pTW601 I’ pTW6012’ pTW205 pTWl713 pTWl713-H2 pTWl713-H5 pTW I7 I3-H24 pTW I7 I3-E6

CP, Tc AP

CP, SP

Km CP SP

AP. SP AP, SP

Tc AP AP AP AP AP

Psf I-EcoRI fragment6 + Cp:Sp fragment

E I -E6 fragments’ Hind111 fragmentd + pACYCl84 Mini-Rtsl + Sp fragment pTW60 I + pTW I7 l3-HS pTW60 I + pTW I7 I3-H5 E5 fragment’+ pACYCl84 EcoRI-RsuI fragment8 + pUC8 H2 fragmenth + pUC8 H5 fragmenth + pUC8 H24 fragment” + pUC8 E6 fragmenth + pUC8

Chang and Cohen (1978) Vieira and Messing ( 1982) Maki ef al. (1983)

Terawaki CI al. ( I98 I ) Terawaki ef al. (I 98 1) ltoh et al. ( 1982) This study This study Terawaki ef al. (I 98 I ) This study This study This study This study This study

a Abbreviations: Ap, ampicillin; Cp, chloramphenicol; Km, Kanamycin: Sp, spectinomycin; Tc, tetracycline. ’ 44.0-49.4 kb on the F coordinate. ‘E l-E6 indicate six EcoRI fragments of pTW20. The E6 fragment contains mini-Rtsl. d A HindIll fragment of pTW20 consisting of mini-Rtsl, E5, and a part of E3 fragments. * Restriction map of each plasmid was shown in Fig. 6. ‘An EcoRI fragment of pTW20 containing incl-b. See Fig. I. c An EcoRI-RsuI fragment of pTW205 containing incl-b. See Fig. I. ’ Construction of each fragment was shown in Fig. 3.

48 NOZUE. TSUCHIYA, AND KAMIO

pTW 17 13 (Table 1) linearized by EcoRI or Hind111 digestion was treated with 0.8 U of exonuclease BAL31 in 100 ~1 of incubation buffer as recommended by the supplier. The reaction was terminated at intervals (5 to 15 min) with addition of 100 ~1 of 80% phenol. DNA was recovered by ethanol precipitation and dephosphorylated by alkalline phosphatase in 20 mM Tris-HCl, pH 8.0, at 37°C for 60 min. The dephosphorylated DNA was ligated with T4 DNA ligase in the presence of a IO-fold molar excess phosphorylated EcoRI or Hind111 linker and transformed into JM 103.

Nitrocellulose jilter binding assay. The DNA binding assay was performed as described Tsurimoto and Matsubara (198 1) except that the reaction buffer contained 20 mM Tris-HCl (pH 8.0) 40 mM KCl, 10 mtvt MgCl*, 2 mM dithiothreitol, 0.1 mM EDTA, and 50 &ml bovine serum albumin. The purified RepA protein (15 pg; the purification procedure will be described elsewhere by Y. Kamio et al.) was mixed with 32P-end-labeled DNA (20 fmol) in 500 ~1 of reaction buffer. The reaction mixture was kept at 0°C for 20 min, followed by filtration through a nitrocellulose membrane filter (25 mm, Sar- torius SM 1103). The filter was washed with 1 ml of the reaction buffer without bovine serum albumin, and the filtrate was col- lected. The retained DNA on a filter was recovered by washing the membrane with 0.5 ml of elution buffer (0.1% sodium dodecyl sulfate, 5 RIM EDTA). The DNA fragments in each filtrated and retained fractions were separated by electrophoresis on an 8% polyacrylamide gel and detected by autoradio- graphs.

DNaseI protection experiment. The condi- tions used were essentially as described pre- viously (Kamio et al., 1985). The EcoRI- Hind111 fragment of pTW 17 13-H2, which was labeled at the 5’ end of the EcoRI or Hind111 site, was digested with DNaseI after incubation with (1 .O and 1.2 pg) or without RepA protein.

Incompatibility test. Incompatibility between two plasmids was examined by trans-

forming one plasmid into JCl569(recA) harboring the other plasmid. Transformation was carried out as described by Cohen et al. ( 1972). The transformants were selected with either a donor marker or a combination of donor and recipient markers.

Determination of drug resistance level. Cells of JGll2(polA) harboring a plasmid was grown in L-broth at 37°C. Exponentially growing cells were diluted 104-fold and 50 ~1 of the dilution was spread onto a Penassay broth agar plate containing different concentrations of spectinomycin (SP).~ The level of resistance was determined by the maximum concentration of the drug that allowed devel- opment of isolated colonies on the plate after incubation for 16 h at 37°C.

RESULTS

Cloning of the inch-b region. pTW205 (Fig. 1A) was double digested with EcoRI and HincII, and the resulting 0.9-kb EcoRI- HincII fragment was cloned into the EcoRI- HincII site of pUC8. The obtained plasmid, pTW 17 1, expressed incompatibility toward pTW60 1. The 0.6-kb EcoRI-RsaI fragment of pTW 17 1 was subcloned into the EcoRI and HincII sites of pUC8, giving rise to pTW 17 13, which also expressed a strong incompatibility to pTW60 1. To determine the incl-b locus on pTW20, pTW20-HR consisting of pACYC 184 and a 5.2-kb Hind111 fiag- ment containing mini-Rtsl and inch-b (Table 1) was analyzed using restriction endonucleases. The 0.6-kb EcoRI-HincII seg- ment that contains inc1-b was found to be contiguous to mini-Rts 1 (Fig. 1 B).

Nucleotide sequence of incl-b fragment. pTW 17 13 was digested with exonuclease BAL 3 1 from the Hind111 site (see Materials and Methods). Since one of the deletion derivatives, pTW 17 13-H2, showed a similar level of incompatibility to PTW 17 13 toward pTW601 (Table 2), the derivative was used for the nucleotide sequence analysis. A char- acteristic feature of the sequence is the presence of four repeated sequences, designated

’ Abbreviation used: Sp, spectinomycin.

EXTENDED incl REGION OF Rtsl 49

plW205 pTW171 pTW1713

D l

7 *

I I I I I I I

1 100 200 300 LOII 500 hnn (hp)

FIG. 1. Construction of pTWl713 (A), and sequencing strategy of inch-h fragment (B). (A) pTW205 consisting of E5 fragment of pTW20 and pACYC184 was double digested with EcoRI and Hind1 and cloned into the EcoRI-Hind site of pUC8, giving rise to pTW I7 I. pTW 17 I was double digested with EcoRI and RsaI and subcloned into the EcoRI-HincII site of pUC8. (B) The EcoRI site shown separates mini-Rts I and inch-b on pTW20. The EcoRI-RsaI fragment was the cloned incl-b in pTW 17 13. The thick line is the region whose nucleotide sequence was determined. Arrows indicate the direction and extent of the sequence determined and are aligned in the 5’ to 3’ direction. A, AluI; B, &fir; E, EcoRI; HII, H&II; HIII, HindIII; HII, Hid; R, RsaI; S, Sau3AI.

units I to IV from the EcoRI site (Fig. 2). in the same direction with the eight units of Each unit was composed of 18 bp and incl-a and incll, whereas units III and IV are showed a similarity to the consensus se- in the opposite direction. quence of the inch-a and incII repeats (Fig. Incompatibility of the deletions in the re- 3). The repeating units I and II are arranged peated units. The end point of each deletion

50 NOZUE, TSUCHIYA. AND RAM10

TABLE 2

INCOMPATIBILITY OF incl-b CLONED PLASMID AND hs DERIVATIVES TOWARD MINI-~1~1”

Donor plasmid incl-b fragment

No. of transformants selected with

Both Donor markers marker

Percentage resident plasmid in

transformant

pUC8 pTW1713 pTW1713-H2 pTW1713-H5 pTW 17 13-H24 pTWl713-E6

EcoRI-Rsnl fragment H2 fragmentb H5 fragmentb H24 fragmentb E6 fragmentb

1.6 x lo4 1.3 x IO4 100 <I x 10 2.1 x IO4 0 <l x 10 4.9 x IO4 0 <I x 10 2.7 X IO4 0 1.8 x 10’ 3.9 x lo4 8 3.2 x IO’ 2.6 X IO’ 100

’ Approximately 0.5 rg of donor plasmid DNA was used to transform JCI 569 (recA) harboring pTW6Ol. Drugs used for selection were 30 pg of spectinomycin/ml for resident plasmid and 100 rg of ampicillin/ml for donor plasmids.

’ See Fig. 3.

derivative constructed from pTW 17 13 was determined by the nucleotide sequence analysis. pTW1713-H2 and pTW17 13-H5 contained all four repeating units. In contrast, pTW 17 13-H24 was deleted for units III and IV, and pTW 17 13-E6 had lost unit I entirely and 14 bp within unit II (Fig. 3). Their incompatibility toward pTW601 was examined in a recA host. As shown in Table 2, when pTW 17 13-H2 and pTW 17 13-H5 were introduced into JC 1569 harboring pTW601,

L&RI 20 40

5’ 3’

no transformants retaining pTW60 1 were obtained, indicating that both plasmids are incompatible with TW60 1. In accordance with the deletion of the repeats, pTW17 13- H24 partially lost the incompatibility function, and pTW 17 13-E6 showed no incompatibility toward pTW60 1.

Interaction between incl-b and RepA. A protein-DNA binding experiment using a nitrocellulose membrane filter was performed to examine whether purified RepA

60 80 100

120 140 160 180 200 I

TCCTGCTCGTCCCACTTGC~C~TATIGTTCmAGTAMATTCGAT AGGACGAGCAGCCTGAACGGACmATAACMCAAATCATTrCGCTA

< II

220 240 260 280 300 1

TAMTAATGCTCAAACAGAAAAMA GACGACAMAICGGGCTAmCCGACGACmCCCCCCCGAT ATTTATTACGAGTTTGTCmTmCTCCTCTm AGCCCCATAAAGGCTGCTCMAGGGGAGTCGCCTGTGGMA4TGCCCCTTTTIACTTCCTATTTA

> m

320 340 360 380 392 t 1

C~CTT~ACTGTTCCCM~M~A~TACCTTCCCC 3’ GGAGAAGATGACAAGGCACCCTCATIACtIACXTA~ AGTCGT~~AAAACTAGGGG~AGGTGGTCGTTTTCTATCGGGG 5’

l Y

FIG. 2. Nucleotide sequence of incl-b determinant started from EcoRl site. Underlines show repeated

EXTENDED inc1 REGION OF Rt.sl 51

1 100 200 300 400 500 600 (W)

inor-bfraqment , I I 1

HZ

Ifs

H 24

E6

I n m PJ

+ 4. 7 7 0 I E 6 Hf.1 S HmClinker)

, , E Hmflinker)

8 I E Hm(linker)

I I (linkerIE rt/Hm

mn8ensue l equence TTCCCCPyPyPuPuCACCCACC

I ~SCCCCCTGACACACA~C

It TTCCCCCCAGCACACACC

m TTCCCCTCAGC?i:ACACC

Y TTCCCCTCACCAiACACC

FIG. 3. The in&b fragment and its deletion derivatives. Arrows indicate the location and the direction (from 5’to 33 of repeated sequences denoted at the bottom. The sequences of four repeats are aligned in the 5’ to 3’ direction and the consensus sequence in inch and incll is shown at the top. Asterisks indicate nonconsensus bases. E, EcoRI; HIM, HindIII; HII, Hid; S, Sau3AI: Py, pyrimidine base; Pu, purine base.

protein of Rtsl specifically binds to the incl- b region. “P-labeled DNAs used as binding probes were a 360-bp H5 fragment containing four repeats of in&-b and a 285-bp EcoRI-&I fragment from mini-Rts 1 hav- ing the five incl-a repeats (see Fig. 1 B). Other in&b subregions without any part of the repeated sequences, i.e., an approximately 230-bp HindIII-Sau3AI fragment and a 70-bp Z&RI-Sau3AI fragment of pTW 17 13 (see Fig. lB), were also used. While all the fragments were recovered from the filtration after incubation without RepA (Fig. 4, I), H5 and in&a fragments were retained on the nitrocellulose filter when incubated with RepA, and the two fragments that contained no repeated sequence were filtrated (Fig. 4, II). Thus, RepA binds to both H5 and in&a fragments but not to the latter two fragments, It should be mentioned that RepA protein appears to bind more preferentially to the incl-a fragment than to the incl-b fragment as determined by the binding ex-

periment using various concentrations of RepA protein (data not shown).

RepA protein binding site. To determine the RepA binding site on the inch-b region, a DNaseI protection experiment was performed. The 5’-end-labeled H2 fragment (Fig. 3) was digested with DNaseI after incubation with RepA and the digested DNA was analyzed on a denatured polyacrylamide gel. The DNA sequences corresponding to the repeating units I-IV were protected from DNaseI digestion. However, the protection of II and III repeats were not clear when the lowest RepA concentration (1 .O &lo0 ml) that protected I and IV repeats was used (Fig. 5, A-4, and C-4). Accordingly, a slightly higher concentration of RepA was used to see the protection of II and III repeats (Fig. 5, B-5 and D-5).

Efect of inch-b on the replication of mini- Rtsl. To examine the effect of incl-b on the copy number of mini-Rtsl, the whole genome of pTW17 13-H5 containing all four

52 NOZUE, TSUCHIYA. AND RAM10

I II

F 8 F E3

a

i?

d

FIG. 4. Binding of RepA protein to incl-b determinant. The S-end-labeled DNA fragments incubated with (II) or without (I) purified RepA protein were filtered through a nitrocellulose membrane. The filtrate (lane F) and membrane-bound (lane B) DNAs were separated on acrylamide gel electrophoresis and autoradiographed. a, A 360-bp id-b EcoRI-Hind111 fragment from pTW 17 13-H5; b, a 285-bp in&a EcoRI-A/u1 fragment from mini-Rtsl; c, a 230-bp HindIILSuu3AI fragment from pTW 17 13; d, a 70-bp EcoRI-Sau3AI fragment from pTW 17 13. c and d are without repeated sequences.

repeats of in&b was ligated to the EcoRI site of pTW60 1. By the procedure, two recombinant plasmids, pTW6011 and pTW6012 (Fig. 6), were obtained. It should be noted that, in the former plasmid, in&b is placed in the natural sequence as in the parent plasmid pTW20. These plasmids were introduced into JG112 (poti), and the level of Sp resistance was determined to estimate the copy number of the plasmids, since Sp resistance conferred by a plasmid is known to be dependent on gene dosage in JC 1569 (recA) (Terawaki and Itoh, 1985). A control plasmid, pTW601-8, consisting of pTW601 and pUC8, showed the same level of Sp resistance as pTW601 in JGl12 (Table 3). As shown in pTW60 11 and pTW60 12, the presence of inch-b in the cis position significantly lowered the Sp resistance of the mini-Rtsl plasmid expressed in JG112. Especially, the

resistance level specified by pTW6011 was the same as that by pKP 10 13, indicating that the copy number of pTW6011 (in JG112) would be one per chromosome equivalent. This means that the ligation of incl-b to mini-Rtsl in a natural arrangement causes a three- to fourfold reduction of the copy number of mini-Rtsl, which was estimated by comparing the levels of drug resistance conferred by pTW601 and pISP1013 in JC1569.

Stability of mini-Rtsl:incI-b plasmid. JGl12 cells harboring plasmids were grown in L-broth at 37°C without selective drugs, and inheritance of the plasmid was examined. Approximately 30 and 15% fractions of the cells that had harbored pTW6011 and pTW60 12, respectively, lost the plasmid during six generations, although pTW60 1 and pTW60 l-8 were stably inherited in JG 112 during the same generations.

DISCUSSION

In this study, the incl-b region was found to contain four repeated sequences (I to IV) and to be located adjacent to incl-a of mini- Rtsl on the pTW20 map. An overall arrangement of the inc-repeated sequences (shown in Fig. 7) indicates that incl-b to- gether with incl-a would constitute a single incompatibility region “incl”, consisting of nine repeats, among which seven repeats (incl-a I-V and in&b I-II) are aligned in the same direction as incZ1 repeats and the re- maining two repeats (incl-b III-IV) are in the opposite direction. As shown in the incompatibility study using the deletion derivatives of the incl-b region, the units I-II exhibited an evident incompatibility toward a mini- Rtsl plasmid, but the repeats III and IV did not contribute efficiently to the incompatibility.

The presence of inc repeats located downstream of rep has been reported in mini-P1 (incA; Chattoraj et al., 1985) and F (inch Tsutsui et al., 1983) as well as mini-Rtsl (Kamio and Terawaki, 1983). Especially in mini-P 1, the downstream repeats (in&) consist of nine repeating units, in which six are aligned in the opposite direction with the

EXTENDED inc1 REGION OF Rtsl

A B C D

123L 1235 123L 12 35

53

FIG. 5. DNaseI protection experiment of an i&-b fragment. The 0.4-kb EcoRI-Hi&III fragment isolated from pTW 17 13-H2 was labeled at the 5’ end of the EcoRI site (A,B) or the Hi&III site (C,D) and were subjected to a DNaseI protection experiment as described under Materials and Methods. Lane 1, A>G chemical degradations; lane 2, C+T chemical degradations; lane 3, without RepA protein; lane 4, 1 .O-fig RepA protein; lane 5, 1.2-pg RepA protein. I-IV indicate four repeated sequences. The numbers on the left refer to in&b determinant coordinates (see Fig. 2).

HI

pTW6011 pTW6012

Fro. 6. Restriction map of pTW60 1 chimeric plasmids with incl-b. Both pTW6011 and pTW6012 were obtained by ligating pTW601 with pTW1713-H5 at the EcoRI site. In pTW6011, the incZ-b region (H5) is placed with the natural arrangement relative to mini-Rts 1.

other three units and incC repeats. Thus, the replication region of Rts 1 shows a great similarity to that of PI, considering that inch and incI-b constitute a single incompatibility determinant. These downstream repeats are dispensable for replication of the respective plasmid and removal of the repeats from the plasmid results in an increase of copy number of the plasmid (Chattoraj et al., 1985; Bergquist et al., 198 1; Seelke et al., 1982; Tsutsui et al.. 1983; Kamio and Terawaki, 1983). That the inc1-b also contributes to the copy control was evidenced from the finding

54 NOZUE, TSUCHIYA, AND RAM10

TABLE 3

LEVEL OF DRUG RESISTANCE’

Spectinomycine resistance (rglml)

Plasmid Composition JG I 1 S(poL4) JC 1569(recA)

pTW60 1 200 pTW601-8 pTW60 1 + pUC8 200 pTW601 I* pTW60 1 + pTW 17 l3-H5 40 pTW6012” pTW601 + pTW1713-H5 80 pKP1013 Mini-F + Cp:Sp fragment 40

4 Level of drug resistance was determined as described under Materials and Methods. ‘See Fig. 6.

100

30

that insertion of inch-b into a mini-Rtsl plasmid resulted in a three- to fourfold reduction of the plasmid copy number. The binding of RepA in vitro to i&-b-repeated sequences supports the notion that the copy control of the plasmid is mediated by titrating Rep molecules with inc repeats, as al- ready shown in F and Pl (Tokino et al.. 1986; Abeles, 1986). It should be mentioned that although in&b repeats are apart from each other as compared with the other inc repeats of Rtsl, RepA protein could bind specifically to all four (I to IV) repeated sequences. The binding to in&-b, however, was less efficient than that to incl-a.

As shown in Table 3, the copy-control function of incl-b was more effective when it was ligated to mini-Rts 1 in a natural arrange-

ment (pTW6011) than the case that inserted separately from incl-a (pTW60 12). This supports the notion that incl-a and incl-b are a single constituent of incompatibility of mini-Rts 1. The copy number of pTW60 11 is estimated at only one per chromosome, since the level of drug resistance conferred by this plasmid is the same as that by mini-F, which in turn suggests that the copy number of the parent Rtsl would be one per chromosome. The copy numbers of pTW6011 and pTW60 12 are so small that their inheritance in JGl12 host was unstable as shown in the stability test. Among the two plasmids, pTW6011 was more unstable than pTW60 12, which would reflect a lower copy number of the former plasmid than of the latter.

1 SW 1000 1100 ZOO” 2500 (bp) I , I I I I

-------w--m,

RepA 03 W)

FIG. 7. An overall arrangement of the three inc-repeated sequences in the replication region of Rtsl. Arrows indicate the direction of consensus sequence of the repeats arranged in the 5’ to 3’ direction. It should be noted that in the ordinary mini-Rtsl map the EcoRl site is the coordinate 1 and the Hind111 site is the coordinate 1855.

EXTENDED incl

ACKNOWLEDGMENTS

We are greatly indebted to Yoshiro Terawaki for his support and encouragement throughout this work. We thank Yoshifumi ltoh for his advice and critical reading of the manuscript and Hideki Matsumoto for his valu- able suggestions. This study was supported by grants from the Ministry of Education, Science and Culture, Japan.

REFERENCES

ABELES, A. L. (1986). PI plasmid replication: Purifica- tion and DNA-binding activity of the replication protein RepA. J. Biol Chem. 261, 3548-3555.

ABEL& A. L., SNYDER, K. M., ANDCHATTORAI, D. K. (I 984). Pl plasmid replication: Replicon structure. J. Mol. Biol. 173, 307-324.

BERGQUIST, P. L., D~WNNARD, R. A., CAUGHEY, P. A., GARDNER, R. C., AND LANE, H. E. D. (1981). Analy- sis of mini-F plasmid replication by transposition mutagenesis. J. Bacferiol. 147, 888-899.

CHANG, A. C. Y., AND COHEN, S. N. (1978). Construc- tion and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmids. J. Bucreriol. 134, 114 I-1 156.

CHAT-TORAJ, D. K., ABELES, A. L., AND YARMOLINSKI, B. M. (1985). PI plasmid maintenance: A paradigm of precise control. In “Plasmid in Bacteria” (D. Helinski, S. Cohen, and D. Clewell, Eds.), pp. 355-381. Ple- num, New York.

CHURCHWARD, G., LINDER, P., AND CARO, L. (1983). The nucleotide sequence of replication and maintenance functions encoded by plasmid pSC IO I. Nucleic Acids Res. 11, 5645-5659.

CLARK, A. J., CHAMBERLIN, M., AND BOYCE, R. P. (I 966). Abnormal metabolic response to UV light of a recombinant deficient mutant of E. coli K-12. J. Mol. Biol. 19.442-453.

CLEWELL, D. B., AND HELINSKI, D. R. (I 969). Super- coiled circular DNA-protein complex in Escherichiu coli: Purification and induced conversion to an open circular DNA form. Proc. h’utl. Acud. Sci. USA 62, 1159-l 166.

COETZEE, J. N., DATTA, N., AND HEDGES, W. (I 972). R factors from Proteus ret&en’. J. Gen. Microbial. 72, 543-552.

COHEN, S. N., CHANG, A. C. Y., AND Hsu, L. (1972). Nonchromosomal antibiotic resistance in bacteria: Genetic transformation of Escherichiu coli by R factor DNA. Proc. Natl. Acad. Sci. USA 69,2 I I O-2 114.

DANBARA, H., BRADY, G., TIMMIS, J. K., AND TIMMIS, K. N. ( 198 1). Regulation of DNA replication: “Tar- get” determinant of the replication control elements of plasmid R6-5 lies within a control element gene. Proc. Natl. Acad. Sci. USA 78, 4699-4703.

EASTON, A. M., AND ROWND, R. H. ( 1982). The incompatibility product of IncFlI R plasmid NRI controls

REGION OF Rtsl 55

gene expression in the plasmid replication region. J. Bacterial. 152, 829-839.

GERMINO, J., AND BA~TIA, D. (I 983). Interaction of the plasmid R6K-encoded replication initiator protein with its binding sites on DNA. Cell 34, I25- 134.

ITOH, Y., KAMIO, Y., F~JRUTA, Y., AND TERAWAKI, Y. (I 982). Cloning of the replication and incompatibility regions of a plasmid derived from Rtsl. Plasmid 8, 232-243.

ITOH, Y., KAMIO, Y., AND TERAWAKI, Y. (1987). Es- sential DNA sequence for the replication of Rtsl . J. Bacferiol. 169, 1153-I 160.

KAMIO, Y., LIN, C., REGUE, M., AND WV, H. C. (1985). Characterization of the ileS-lsp operon in Escherichiu coli. Identification of an open reading frame upstream of the ilesgene and potential promoter(s) for the i/es- Isp operon. J. Biol. Chem. 268, 5616-5620.

KAMIO, Y., TABUCHI, A., ITOH, Y., KATAGIRI, H., AND TERAWAKI, Y. (1984). Complete nucleotide sequence of mini-Rtsl and its copy mutant. J. Bucteriol. 158, 307-312.

KAMIO, Y., AND TERAWAKI, Y. (1983). Nucleotide sequence of an incompatibility region of mini-Rtsl that contains five direct repeats. J. Bucferiol. 155, 1185-1191.

KOLTER, R., AND HELINSKI, D. R. (1982). Plasmid R6K DNA replication. II. Direct nucleotide sequence repeats are required for an active origin. J. Mol. Biol. 161,45-56.

LIGHT, J., AND MOLIN, S. (1983). Post-transcriptional control of expression of the repA gene of plasmid RI mediated by a small RNA molecule. EMBO J. 2, 93-98.

MAKI, S., KURIBAYASHI, M., MIKI, T., AND HORIUCHI, T. ( 1983). An amber replication mutant of F plasmid mapped in the minimal replication region. Mol. Gen. Gene!. 191, 231-237.

MAXAM, A., AND GILBERT, W. (1977). A new method for DNA sequence analysis. Proc. Nurl. Acad. Sci. L’S,4 74, 560-564.

MESSING, J., CREA, R., AND SEEBURG, P. H. (1981). A system for shotgun DNA sequencing. Nucleic Acid.7 Res. 9, 309-32 I.

MILLER, J., MANIS, J., KLINE, B., AND BISHOP, A. (I 978). Nonintegrated plasmid-folded chromosome complexes. Plasmid 1.273-283.

MUROTSU, T., AND MATXJBARA, K. (1980). Role of an autorepression system in the control of dv plasmid copy number and incompatibility. Mol. Gen. Genet 179,509-519.

ROSEN, J., RYDER, T., OHTSUBO, H., AND OHTSU~O, E. (198 I). Role of RNA transcripts in replication incompatibility and copy number control in antibiotic resistance plasmid derivatives. Nature (London) 290, 794-799.

SEELKE, R. W., KLINE, B. C., TRAWICK, J. D., AND RIGS, G. D. (1982). Genetic studies of F plasmid

56 NOZUE, TSUCHIYA, AND KAMIO

maintenance genes involved in copy number control, incompatibility and partitioning. Plasmid 7, 163-179.

SHAFFERMAN, A., KOLTER, R., STALKER, D., AND HE- Llh’SKI, D. (1982). Plasmid R6K DNA replication. 111. Regulatory properties of the initiation protein. J. Mol. Biol. 161, 57-76.

SIZIGAARD-ANDERSON, L., ROKEACH, L. A., AND MOLIK, S. (1984). Regulated expression of a gene im- portant for replication of plasmid F in E. coli. EMBO J. 3, 251-262.

STOUGAARD, P., MOLIN, S., AND NORDSTROM, K. (1981). RNAs involved in copy-number control and incompatibility of plasmid R 1. Proc. Naf/. Acad. Sci. USA 78,6008-60 12.

TERAWAKI, Y., AND ITOH, Y. (1985). Copy mutant of mini-Rts 1: Lowered binding affinity of mutated RepA protein to direct repeats. J. Bacferiol. 162, 72-77.

TERAWAKI, Y., KOBAYASHI, Y., MATSUMOTO, H., AND KAMIO, Y. (198 1). Molecular cloning and mapping of a deletion derivative of the plasmid Rtsl Plasmid 6, 222-234.

TERAWAKI, Y., ROWND, R., AND NAKAYA, R. (1974). Effects of inhibition of protein synthesis on the replication of the R factor Rtsl in Proteus mirabilis. J. Bacterial. 117.687-695.

TOKINO, T., ML~ROTSIJ, T., AND MATSUBARA, K. ( 1986). Purification and properties of the mini-F plas-

mid-encoded E protein needed for autonomous replication control of the plasmid. Proc. Natl. Acad. Sci. USA83,4109-4113.

TOMIZAWA, J., ITOH, T., SELZER, G., AND SOM, T. (198 1). Inhibition ofColE I RNA primer formation by a plasmid-specified small RNA. Proc. Nat/. Acad. Sci. USA 78, 1421-1425.

TSURIMOTO, T., A&D MATSUBARA, K. (198 I). Purilica- tion of bacteriophage 0 protein that specifically binds to the origin of replication. Mol. Gen. Genef. 181, 325-331.

TSUTSUI, H., FUJIYAMA, A., MUROTSU, T., AND MAT- SUBARA, K. (1983). Role of nine repeating sequences of the mini-F genome for expression of F-specific incompatibility phenotype and copy number control. J. Bacterial. 155, 337-344.

VIEIRA, J.. AND MESSING, J. (1982). The pUC plasmids, an M 13mp7derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19,259-268.

WOMBLE, D. D., DONG, X., WV, R. U., LUCKOW, V. A., MARTINEZ, A. F.. AND ROWND, R. H. (1984). IncFIl plasmid incompatibility product and its target are both RNA transcripts. J. Bacferiol. 160, 28-35.

Communicated by Barry Polisky

Documents

Nucleotide sequence and copy control function of the extension of the incI region (incI-b) of Rts1