Nucleosome-Positioning Sequence Repeats Impact Chromatin ... · INVESTIGATION Nucleosome-Positioning Sequence Repeats Impact Chromatin Silencing in Yeast Minichromosomes Sangita A

INVESTIGATION

Nucleosome-Positioning Sequence Repeats ImpactChromatin Silencing in Yeast Minichromosomes

Sangita A. Chakraborty,*,1 Abid A. Kazi,† Tamreen M. Khan,* and Sergei A. Grigoryev*,1

*Department of Biochemistry and Molecular Biology and †Cancer Institute, Pennsylvania State University, College of Medicine,Hershey Medical Center, Hershey, Pennsylvania 17033-0850

ABSTRACT Eukaryotic gene expression occurs in the context of structurally distinct chromosomal domains such as the relatively open,gene-rich, and transcriptionally active euchromatin and the condensed and gene-poor heterochromatin where its specific chromatinenvironment inhibits transcription. To study gene silencing by heterochromatin, we created a minichromosome reporter system wherethe gene silencer elements were used to repress the URA3 reporter gene. The minichromosome reporters were propagated in yeastSaccharomyces cerevisiae at a stable copy number. Conduction of gene silencing through nucleosome arrays was studied by placingvarious repeats of clone-601 DNA with high affinity for histones between the silencer and reporter in the yeast minichromosomes.High-resolution chromatin mapping with micrococcal nuclease showed that the clone-601 nucleosome positioning downstream of theHML-E gene silencing element was not significantly altered by chromatin silencing. Using URA3 reporter assays, we observed that genesilencing was conducted through arrays of up to eight nucleosomes. We showed that the shorter nucleosome repeat lengths, typical ofyeast (167 and 172 bp), were more efficient in conducting silencing in vivo compared to the longer repeats (207 bp) typical of highereukaryotes. Both the longer and the shorter repeat lengths were able to conduct silencing in minichromosomes independently ofclone-601 nucleosome positioning orientations vs. the silencer element. We suggest that the shorter nucleosome linkers are moresuitable for conducting gene silencing than the long repeats in yeast due to their higher propensity to support native-like chromatinhigher-order folding.

EUKARYOTIC DNA is repeatedly coiled by histone oc-tamers into nucleosome cores, the primary structural

units of chromatin (Richmond and Davey 2003). The nucle-osome cores are connected by linker DNA-forming nucleo-some arrays that fold into compact higher-order structures(Luger et al. 2012). One of the critical biological questionshas been deciphering the chromatin structure–function re-lationship in epigenetic regulation of gene expression. Eu-karyotic gene expression occurs mainly in the context of thestructurally open and transcriptionally active state (euchro-matin) while, in the repressive state (heterochromatin),its specific chromatin organization inhibits transcription

(Grewal and Moazed 2003). A combination of transcriptionfactors, DNA modifications, histone modifications, noncod-ing RNA, and chromatin compaction distinguishes hetero-chromatin from the transcriptionally active euchromatin(Moazed 2011). Recently, nucleosome positioning in thegenome and intrinsic affinity of DNA to histones have re-ceived heightened interest, especially since they have beenlinked to regulation of gene expression in euchromatin andhigher-order organization of chromatin (Brogaard et al.2012; Eriksson et al. 2012; Hughes et al. 2012; Struhland Segal 2013). Massive changes in nucleosome occu-pancy and positioning are associated with replicative aging(Hu et al. 2014). Whether the nucleosome positioning,DNA affinity to histones, and chromatin higher-order fold-ing in heterochromatin are instrumental in creating andspreading of the repressive chromatin state remains anopen question.

In Saccharomyces cerevisiae the two silent mating-typeloci, HML and HMR, represent well-defined heterochroma-tin domains where genes are transcriptionally repressed.Transcriptional repression at the HML and HMR loci is a gene

Copyright © 2014 by the Genetics Society of Americadoi: 10.1534/genetics.114.169508Manuscript received April 18, 2014; accepted for publication August 21, 2014;published Early Online September 3, 2014.Supporting information is available online at http://www.genetics.org/lookup/suppl/doi:10.1534/genetics.114.169508/-/DC1.1Corresponding authors: Department of Biochemistry and Molecular Biology, H171,Pennsylvania State University, College of Medicine, Hershey Medical Center, P.O.Box 850, 500 University Dr., Hershey, PA 17033-0850. E-mail: [email protected];[email protected]

Genetics, Vol. 198, 1015–1029 November 2014 1015

http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000000747






http://www.genetics.org/lookup/suppl/doi:10.1534/genetics.114.169508/-/DC1


mailto:[email protected]

mailto:[email protected]

nonspecific mechanism that mediates epigenetic inheritanceof the silent state of the heterochromatin region (Haber2012; Motwani et al. 2012). The cis-acting E or I silencerelements of the HML locus are necessary and sufficient forinitiating and mediating silencing by interacting with a largenumber of trans-acting factors to repress transcription (Morettiet al. 1994; Dillin and Rine 1995). Both the HML-E andHML-I elements are equally capable of silencing genes(Mahoney and Broach 1989; Haber 1998). Chromatin mapsat nucleotide resolution following nuclease digestion andhigh-resolution DNA sequencing showed uniquely organizedchromatin structures at the silent HML locus with arrays ofprecisely positioned pairs of nucleosomes with alternatingshort and long linkers abutting the E and I silencer elements(Weiss and Simpson 1998; Elgin and Workman 2000). Thediscontinuous, non-uniform nucleosome positioning of theHML locus perhaps is necessary for transcriptional repres-sion and formation of higher-order repressive chromatinstructures. Furthermore, it has been reported that DNAsequences that do not favor nucleosome formation and havethe ability to disrupt chromatin structure can also functionas barriers to the propagation of transcriptionally silentchromatin (Bi et al. 2004).

Here we used our recently established URA3-basedyeast minichromosome reporter system containing silencerand antisilencer elements (Chakraborty et al. 2011) to in-vestigate if arrays of nucleosomes with high DNA affinityto histones and varying nucleosome number and repeatlengths will conduct silencing from the HML-E and HML-Ielements to a reporter gene. In this study, we employed theclone-601 DNA sequences that have the highest affinity forthe histone octamer and positions the nucleosome core witha single-base precision (Lowary and Widom 1998). Theclone-601 DNA previously served as an excellent tool forchromatin structure studies (Schlick et al. 2012) and forexploring the relationship between nucleosome structureand transcription in vitro (Bondarenko et al. 2006; Chenet al. 2013) and in vivo (Gaykalova et al. 2011; Peraleset al. 2011). Using clone-601-based reconstituted nucleo-some arrays, we have recently shown that chromatinhigher-order structure is modulated by the length ofDNA linkers (Correll et al. 2012). Now, by placing a num-ber of different clone-601 repeats between the silencerand the URA3 reporter, we were able to examine theirfunction in conducting silencing using in vivo geneticassays.

Here we show that the repeats of up to eight clone-601nucleosomes are able to conduct silencing from both theHML-E and the HML-I silencers to repress the URA3 reporterand that there is an abrupt transition from silent chromatinto active chromatin between 8 and 10 nucleosomes. Theefficiency of silencing is modulated by the nucleosome re-peat length (NRL), but not by orientation of the clone-601nucleosomes vs. the silencer element. We thus establisheda new S. cerevisiae minichromosome-based experimentalsystem to study chromatin structure–function relationship

between gene regulatory elements controlling the geneexpression.

Materials and Methods

Yeast minichromosome constructs

The parent minichromosome shuttle vector (TRP1-ARS1)contains an autonomously replicating sequence, ARS1 [Gen-Bank accession no. NC_001136.10; Saccharomyces GenomeDatabase (SGD): chromosome IV, 462354–463192]; TRP1as a selectable marker for selection in S. cerevisiae (Duckerand Simpson 2000) (GenBank accession no. NC_001136.10;SGD: chromosome IV, 461842–462516); and a pBR322vector-derived sequence with an AmpR gene for propagationin Escherichia coli. The S. cerevisiae minichromosome con-structs (Figure 1A) containing the URA3 reporter gene, theHML-E, and the HML-I silencer elements were generated aspreviously described (Chakraborty et al. 2011).

Nucleosome-positioning minichromosomes

The nucleosome-positioning minichromosome constructscontain the clone-601 nucleosome-positioning sequence(Lowary and Widom 1998) placed into the pUC19 vector atthe XbaI–SphI restriction enzyme site to generate the 601-207 mononucleosome template (Grigoryev et al. 2009). ASpeI restriction enzyme site is positioned near the end of themononucleosome for further modifications. The 601-167(Figure 1A) and the 601-172 mononucleosome templateswere generated from the 601-207 DNA by PCR using primersets listed in Supporting Information, Table S1. Nucleosomeoligomer templates were constructed as described (Grigoryevet al. 2009) and subcloned into the pSC E-silencer and pSC I-silencer constructs (Table S2) to provide a yeast shuttlevector containing repeats of clone-601 DNA. In some con-structs, the boundary elements STAR and TEF2-UAS operat-ing as antisilencers on the minichromosome were positionedupstream of the E-silencer at the SacI restriction site indifferent orientations. Schemes of all constructs containingclone-601 DNA are shown in Table S2.

The minichromosome constructs with mononucleosomesand oligonucleosomes were verified by DNA sequencingbefore transforming the yeast cells. The yeast strainscontaining minichromosome constructs with oligonucleo-some repeats were tested by sequencing to ensure theabsence of recombination events. Yeast plasmid DNApurified using the standard smash-and-grab method (Roseet al. 1990) were retransformed into E. coli DH5a cells andconfirmed by DNA sequencing using the primers listed inTable S1.

Strains and media used

The minichromosome constructs were transformed intoE. coli DH5a competent cells (Invitrogen, Carlsbad, CA), andbacterial colonies were screened with restriction enzyme digests,PCR analysis, and DNA sequencing. Purified minichromosome

1016 S. A. Chakraborty et al.














http://www.genetics.org/lookup/suppl/doi:10.1534/genetics.114.169508/-/DC1/genetics.114.169508-1.pdf





constructs were retransformed into S. cerevisiae a-cellsYPH499 strain (MATa, ade2101�, his3-Δ200, leu2-Δ1,lys2-801a, trp1-Δ63, ura3-52) (Sikorski and Hieter 1989).High-efficiency yeast transformations were carried out usinglithium acetate and polyethylene glycol (Gietz and Schiestl2007) or using an EZ yeast transformation kit (QbiogeneInc.). Yeast colonies grown on 2Trp media were selectedfor minichromosomes containing a TRP1 marker gene in theconstruct backbone. The expression of the URA3 reportergene and function of the regulatory elements in the minichro-mosome constructs were determined in the presence or

absence of the silencer elements using different selective me-dia (Chakraborty et al. 2011).

Yeast colonies were grown on complete synthetic media(CSM), 2Trp (lacking tryptophan), 2Trp/2Ura (lackingboth tryptophan and uracil), or 2Trp/5-FOA+ (lackingtryptophan, but containing 5-fluroorotic acid). The yeastdropout media were made with yeast nitrogenous base with-out amino acids, 2% dextrose, and the CSM,2Trp,2Trp/2Uramedia were made as per the manufacturer’s instructions.The 2Trp/5-FOA+ media were made by adding 1 mg/ml5-FOA (Toronto Research Chemicals) and uracil to a final

Figure 1 A minichromosome reporter system to studysilencing conductance through nucleosomes. (A) Physicalmap of one of the TRP1-ARS1-derived clone-601DNA containing minichromosome constructs. This exam-ple contains a 167 bp clone-601 mononucleosome placedbetween XhoI and SpeI sites in a minichromosome con-taining the HML–E silencer element and the URA3 reportergene. Other minichromosome constructs contain eithermonomers or nucleosome arrays of 167, 172, or 207 bppositioned between the E-silencer (placed between SacIand XhoI sites) or I-silencer (placed between NotI and KpnIsites) and the URA3 reporter gene in different orientations(see schemes in Table S2). (B–E) The 167 bp fragment con-taining nucleosome positioning sequence of clone-601 DNA(shown by arrows) was positioned between the HML–E si-lencer (B and C) or the HML–I silencer (D and E) and theURA3 reporter in different orientations. The URA3 re-porter gene expression status (on or off) was assayedby the growth phenotypes of S. cerevisiae cells contain-ing various minichromosome constructs tested in the in-dicated selective media by serial dilutions. The clone-601monomer did not inhibit the silencing of the URA3 reportergene by either the E-silencer or the I-silencer. (F) Southernhybridization of linearized minichromosomal and genomicDNA probed with a radiolabeled TRP1-ARS1-containingfragment. Four independent clones were transformedwith a minichromosome construct containing the clone-601 mononucleosome DNA placed between the HML-Esilencer and the URA3 reporter. (G) Histograms show-ing minichromosome copy numbers quantified by scan-ning of the Southern blots (such as shown in F) andnormalized to the genomic TRP1-ARS1 signal. Errorbars represent standard deviations. Where absent, errorbars are too small to be visualized.

Gene Silencing by Nucleosome Repeats 1017











concentration of 35 mg/ml. The functionality was tested usingtwo complementary in vivo assays for URA3 expression: grow-ing on uracil-deficient media and 5-FOA-dependent viability(Chakraborty et al. 2011).

Southern hybridization

The minichromosome construct DNA and copy numberswere examined by Southern hybridization. Yeast-purifiedDNA using standard smash-and-grab method (Rose et al.1990) were linearized and subjected to electrophoretic sep-aration on 1% agarose gel and transferred to Hybond-NXmembrane (Amersham Biosciences) as per standard protocol(Mays Hoopes 1987). DNA was cross-linked with UV lightand hybridized with probe specific to the TRP1-ARS1 back-bone of the minichromosome constructs and random primerlabeled with [a-32P]dATP. The membranes were exposed toa Bio-Rad imaging screen, and the signal intensities wereanalyzed using a Typhoon 9400 Phosphoimager (AmershamBiosciences). The signal intensities were quantified, and thecopy numbers were determined by the ImageQuant 5.2software (Molecular Dynamics) as previously described(Chakraborty et al. 2011).

Spotting assay

The yeast strains with various minichromosomal constructswere grown to mid-log phase in selective liquid 2Trp mediaat 30� as described (Chakraborty et al. 2011). The mating-type a-cells without any minichromosome construct weregrown in non-selective CSM media. The optical density ofthe yeast cultures were adjusted, and 10-fold serial dilutionsor two 10-fold and three 5-fold serial dilutions up to �2 3103 cells/ml were made for the spotting to assess URA3expression (as described in Chakraborty et al. 2011)for assaying the silencing efficiency of the S. cerevisiaestrains under different growth conditions (Fourel et al.1999; Lebrun et al. 2003; Chakraborty et al. 2011).

For each strain, independent transformants were verifiedby Southern hybridization. Transformed cells were grown in2Trp liquid medium and spotted onto various selective me-dia such as CSM, 2Trp, 2Trp/2Ura, and 2Trp/5-FOA+.Cells with repressed URA3 reporter were able to grow in thepresence of 5-FOA known to be toxic for cells expressing thefunctional URA3 gene product (Boeke et al. 1984). The se-lective media plates were spotted and grown for 2 days priorto imaging for studying the growth phenotypes as described(Chakraborty et al. 2011).

Yeast nuclei preparation and micrococcal nucleasedigestion

The S. cerevisiae nuclei were prepared from 1 liter of cellsgrown at 30� to mid-log phase to an OD600 of �1.0in minimal media. The yeast cell walls were lysed withZymolyase 0.5 mg/ml (100T Seikagaku), and spheroplastformation was observed under the microscope. The sampleswere homogenized using a glass barrel on ice. The nucleiwere isolated and digested with micrococcal nuclease

(Worthington) in increasing concentrations from 0, 1, 2, 4,8 units/ml of MNase at 37� for 10 min. The samples weretreated with RNase A followed by Proteinase K, and the DNAwas purified using standard phenol chloroform extractionprocedures (Roth and Simpson 1991; Ravindra et al. 1999).

High-resolution micrococcal nuclease mapping withprimer extension

The high-resolution chromatin mapping with micrococcalnuclease was performed with multi-cycle polymerase primerextension analysis. The purified oligonucleotide primerswere end-labeled with radioisotope [32P ]g-ATP using T4Polynucleotide Kinase (NEB) and were purified. The primersequences used for chromatin mapping are listed in TableS1. The primer extension was carried out with 32P-end-labeled primer and Taq DNA polymerase in a 20-cycle PCR(94�, 1 min; 55�, 1 min; 72�, 1.5 min) followed by 72� fora 5-min extension and cooling to 4�. The DNA was precipi-tated and then dissolved in sample buffer and denatured for5 min at 95�. The gradient buffer system was used with theupper chamber containing 0.53 TBE buffer and the lowerchamber containing 0.663 TBE and 1 M sodium acetatebuffer. The samples were electrophoresed on a 6% poly-acrylamide sequencing gel with 8 M urea in 0.53 TBE,and electrophoresis was carried out at 58 W for �3 hr after20 min of pre-run. The gel was dried, covered with SaranWrap at 80� for 60 min, and exposed to a phosphoimagerscreen (Bio-Rad). The signal intensities were analyzed usingTyphoon 9400 Phosphoimager (Amersham Biosciences) andquantified by the ImageQuant 5.2 software (MolecularDynamics). Nuclease cleavage sites were determined bya primer extension assay (Shimizu et al. 1991; Weiss andSimpson 1997; Simpson 1998).

Results

Clone-601 nucleosome-positioning sequence conductssilencing on yeast minichromosomes

To study the structure and function of positioned nucleo-somes, we used the S. cerevisiae minichromosome system. Inthe prototype constructs, either the HML–E (positioned up-stream of the URA3 reporter) or HML–I (positioned down-stream of the URA3 reporter) alone were capable ofsilencing the expression of the URA3 reporter gene(Chakraborty et al. 2011). Here we examined if placinga clone-601 DNA sequence in combination with linker DNAof variable lengths between the silencer and the reporterwould impede or facilitate silencing of the URA3 reporter gene.The clone-601 DNA sequence that directs positioning of the147 bp nucleosome core (Nikitina et al. 2013) is referred to asthe “nucleosome-positioning sequence.” We placed a 167 bpDNA fragment (601-16731) containing one nucleosome-posi-tioning sequence between the E-silencer and the URA3 re-porter gene (as shown in Figure 1, A–C, and schematicrepresentations) and between the I-silencer and the URA3reporter gene in different orientations (Figure 1, D and E,


















and schematic representations). The nucleosome-positioningsequences were placed �250 bp downstream of the E- andthe I-silencers to accommodate the silencer-flanking genomicsequences from the HML locus and thus to mimic native HMLand negate a possible interference between the silencing-po-sitioned nucleosome number 20 (see Weiss and Simpson1998) and the clone-601 nucleosome by separating themwith a DNA linker. We observed that the URA3 reporterwas repressed by each of the silencer elements in the pres-ence of the 601-16731 DNA sequence. The cells were able togrow on CSM and –Trp, but were unable to grow on 2Trp/2Ura media and were 5-FOA-resistant due to the absence ofa functional URA3 gene product (Figure 1, B–E, spottingassays), showing that clone 601 did not perturb silencing.We also placed the 601-16731 DNA sequences in differentorientations to see if it exhibited any directionality andobserved that the 601-16731 DNA sequence did not in-hibit silencing of the URA3 reporter in either of the twodifferent orientations examined (Figure 1, B–E, schematicrepresentations and spotting assays). Thus, clone-601 nu-cleosome DNA appeared to be permissive for silencing in-dependently of its orientation vs. the silencer. The copynumbers of the multi-copy S. cerevisiae minichromosomeswere tested by Southern hybridization with specific TRP1-ARS1 probe and quantified using the Image Quant softwareto be �20 copies compared to the genomic copy (Figure 1,F and G).

Clone-601 nucleosome-positioning sequence does notinterfere with antisilencing activities ofSTAR and TEF2-UAS

As the monomer of the nucleosome-positioning sequencedid not interfere with silencing of the URA3 reporter byeither E- or I-silencer elements, we examined if placingof the nucleosome-positioning sequences between the E-silencer and URA3 in the presence of antisilencing elementscould affect URA3 transcription. Previously, we showed thatthe heterochromatin boundary and antisilencing elements

STAR and TEF2-UASrpg could activate the URA3 reportereven if placed upstream of the silencing element ina minichromosome (Chakraborty et al. 2011; Bi andBroach 1999; Fourel et al. 1999). Here we placed STAR orTEF2UASrpg antisilencer elements upstream of the E-silencerin two different orientations in the minichromosome con-taining a monomer of clone 601-16731 between the E-silencer and the URA3 reporter (Figure 2, A–D, schematicrepresentations). We found that, in both orientations tested,the STAR and TEF2-UASrpg acted as antisilencer elementseven in the presence of a monomer nucleosome-positioningsequence and were able to derepress URA3 (Figure 2, A–D,spotting assays). This experiment demonstrates that clone-601 DNA does not perturb the ability of an antisilencer placedupstream of the E-silencer to activate transcription of the re-porter gene (Chakraborty et al. 2011). In further work, weused this property of the antisilencer elements to activatetranscription without changing the sequence of chromatinblock including the silencer, the array of clone-601 nucleo-somes, and the reporter.

High-resolution micrococcal nuclease mapping revealssimilar nucleosome organizations in the active andsilenced states

Nuclei with yeast minichromosomes containing clone-601-167 monomer �250 bp downstream of the E silencer (con-struct 601-16731) were digested with increasing amountsof MNase showing nucleosome ladder formation on agarosegel (Figure 3A). The chromatin structure of the MNase-digested samples was analyzed using high-resolution primerextension analysis for chromatin mapping. The strainYPH499 (untransformed a-cells) was used as a negative con-trol. As expected, no significant DNA bands were observedin the control after digesting with MNase, as the end-labeledprimers were specific only for the minichromosome and notfor the genomic DNA (Figure 3B).

A silent minichromosome construct containing a clone-601 mononucleosome in which the URA3 reporter was

Figure 2 Boundary elements STAR and TEF2-UAS blockURA3 silencing in the presence of a clone-601 mononu-cleosome. Clone-601-16731 DNA (167 bp NRL, open ar-row) was positioned between the HML–E silencer and theURA3 reporter gene. The antisilencers STAR (A and B) orTEF2-UAS (C and D), shown by shaded arrows, werepositioned upstream of the HML–E silencer in differentorientations. The URA3 reporter status was tested by spot-ting assay as in Figure 1.



















repressed by the E-silencer was mapped by MNase diges-tion (Figure 3C). The high-resolution mapping of clone-601 mononucleosome in the silent construct was conductedusing primer SC-PE-N1 specific to the backbone ofthe minichromosome (Table S1). The first and the last lanes(M) are the end-labeled DNA size markers. As expected,

a single band �350 bp can be seen in the second lane con-taining 0 unit/ml of MNase sample that was digested withClaI restriction endonuclease as a hybridization control(lane C). The remaining lanes contain samples digested with0, 1, 2, 4, and 8 units/ml of MNase. The MNase cutting pat-tern was prominent with increasing enzyme concentrations

Figure 3 High-resolution MNase mapping of the clone-601 167 bp mononucleosome in the silent and the active states. (A) Ethidium-stained agarosegel showing nucleosome ladder of chromatin samples prepared from isolated nuclei of yeast cells transformed with 601-16731 minichromosomes anddigested with increasing amounts of micrococcal nuclease. “M” indicates the DNA size marker. Lanes marked 0, 1, 2, 4, and 8 represent units permilliliter of MNase used for digestion. (B) A control for the high-resolution chromatin mapping using the YPH499 (untransformed a-cells) and primerextension analysis of chromatin digested with increasing amounts of micrococcal nuclease from 0, 1, 2, 4, and 8 units/ml of MNase (shown by the solidtriangle). In this phosphoimager image, the first and the last lane M is an AluI-digested dephosphorylated DNA marker and a Promega phiX174 DNAdephosphorylated marker respectively, end-labeled with a [32P ]g-ATP radioisotope. (C and D) High-resolution chromatin maps obtained by a primerextension analysis of silent (C) and active (D) 601-16731 mononucleosome digested with increasing amounts of micrococcal nuclease from 0, 1, 2, 4,and 8 units/ml of MNase as shown by the solid triangle. The first and the last lanes named M are the end-labeled AluI-digested DNA dephosphorylatedmarker and Promega phiX174 DNA dephosphorylated marker respectively. The lane C is a control showing a single �350 bp band of ClaI-digestedchromatin. In the accompanying schemes, the ovals represent the predicted clone-601 nucleosome core positions and “E” denotes the HML-E silencerelement. The nuclease hypersensitive cutting sites (A-T) are marked with arrows, and the sequence information is provided for the strongest MNasecutting. The five asterisks denote an �10 bp cutting pattern in the middle of the nucleosome core. The active state minichromosome construct (D)contains a STAR antisilencer element upstream of the HML-E silencer. (E) A nucleotide sequence scheme showing the primer sequence (in boldface), theclone-601 core nucleosome sequence (in uppercase letters), and the E-silencer as a rectangle. The nuclease hypersensitive cutting sites are marked byvertical arrows. The size of the arrows denotes the extent of MNase cutting. The asterisks in the chromatin mapping figures are shown by underlinedand boldface letters. The lowercase letters are sequences from the nucleosome linker and the minichromosome backbone sequences, and the under-lines are restriction enzyme sites used for multiple cloning.



Figure 3 (Continued)


as expected and consistent with MNase preferentiallycutting at A-T-rich nucleotides in the nucleosome linkersin vitro (Nikitina et al. 2013). The strongest MNase cuttingsites are shown by boldface arrows (Figure 3C). The extentof cutting is denoted by the size of the arrows, where largerarrows correspond to more extensive cuts. The five asterisksdenote �10 bp (A/T) nuclease cutting pattern in the nucle-osome core (Figure 3C). The observed cutting pattern of theclone-601 nucleosome sequence is also schematized in Fig-ure 3E. The dyad axis position at nucleotide 131 is accordingto nucleosome structural studies (Makde et al. 2010; Nikitinaet al. 2013).

There are strong nuclease hypersensitive cutting sites atthe AAT sequence at the beginning of the core and also atA-T-rich regions denoted by arrows within the core sequenceof clone 601. A characteristic �10 bp cutting pattern (A/T)(shown by the asterisks) for every helical turn of the DNAwas observed as five strong bands spanning a region of �40bp in the core upstream of the dyad. There is a very strongnuclease hypersensitive cutting site at the ATATATA se-quence at the end of the core (position 195 in Figure 3C).This position apparently corresponds to the end of a nucleo-some core shifted by �8 bp from the predicted clone-601core/linker boundary at position 203 (Figure 3E), suggest-ing that clone-601 DNA confers a unique nucleosome posi-tion in vivo that is different from in vitro.

We then mapped chromatin of a clone-601 mononucleo-some in the active state. In this case, the URA3 reporter wasnot silenced by the E-silencer due to the presence of theupstream STAR antisilencer element (Figure 3D). Thein vivo high-resolution chromatin structure of the clone-601 mononucleosome in the active state is shown in Figure3D. As with the silent construct, the samples were digestedwith 0, 1, 2, 4, and 8 units/ml of MNase, and the cleavagepatterns within the 601-167 bp mononucleosome of the ac-tive construct were determined to be very similar. Similarto the silent construct, in the active chromatin, the MNase

cutting was observed at the linkers and the core includingthe strong cutting sites at the A-T-rich regions in the begin-ning and toward the end of the core shown by arrows withinthe active clone-601 mononucleosome. Although the char-acteristic �10 bp cutting pattern was seen, the active chro-matin MNase cutting sites were less intense compared to thesilent chromatin (Figure 3D). In particular, the digestion atsites 195 and 145 was notably slower compared to that ofthe silent chromatin (Figure 3C).

To examine if clone-601 DNA maintains its organizationindependently of its precise position vs. the E-silencer, weused a 601-20731 monomeric template to place a clone-601 nucleosome starting �300 bp downstream of the E- orI-silencer, i.e., further downstream than the 601-16731nucleosome. We observed that, being placed at a longerdistance from the silencer, the monomer of the 207 bpclone-601 nucleosome core did not hinder silencing of theURA3 reporter by either E- or I-silencers (Figure 4, A–D,spotting assays). High-resolution MNase mapping (FigureS2) shows that in this position clone 601 is separated bya longer linker from the E-silencer nucleosome number 20(see Weiss and Simpson 1998). However, the pattern of in-ternal MNase cleavage in the mononucleosome 601-207 isdramatically different, showing that clone-601 DNA organi-zation depends on its position downstream of E-silencer. Atthe same time, the footprints of the E-silencer proximalnucleosomes numbers 20 and 21 (see Weiss and Simpson1998) were preserved in the modified construct. We con-clude that clone-601 nucleosome positioning is altered by itsgenomic context in the yeast minichromosome and does notdisrupt the integrity of the yeast silencer in either active orinactive states.

The number of nucleosome repeats influencessilencing on minichromosomes

To relate in vitro studies of longer clone-601 nucleosomepositioning sequence (Correll et al. 2012) to in vivo studies,

Figure 4 A monomer of clone-601 DNA (207 bp NRL)placed between the silencer and the reporter gene doesnot block silencing. Arrows indicate 207 bp clone-601monomers placed in different orientations between theHML–E silencer (A and B) or the HML–I silencer (C andD) elements and the URA3 reporter gene. The URA3 re-porter status was tested by spotting assay.






we decided to test several longer nucleosome repeat lengthsand repeat numbers of clone 601 in yeast minichromosomes.First, we used a 601-20731 monomeric template to placea clone-601 nucleosome starting �300 bp downstream ofthe E- or I-silencer, i.e., further downstream than the 601-16731 nucleosome to accommodate the longer linker andthe silencer-flanking genomic sequences from the HML. Weobserved that, being placed at a longer distance from thesilencer, the monomer of the 207 bp clone-601 nucleosomecore did not hinder silencing of the URA3 reporter by eitherE- or I-silencers (Figure 4, A–D, spotting assays). In contrast,we observed 12-mer uniform arrays of 601-207312 (Figure5, A–D, spotting assays) and similar size arrays with variablelinker DNA lengths [601-(20762)312] were able to blocksilencing of the reporter from both the E- and the I-silencerelements (Figure S1, schematic representations and spottingassays).

To identify the maximal number of repeats capable ofconducting silencing on a minichromosome, we constructedand examined a dimer (601-20732), tetramer (601-20734), hexamer (601-20736), octamer (601-20738),and decamer (601207310) positioned in between the E-silencer and the URA3 reporter (Figure 6, A–E, schematicrepresentation). We have also conducted low-resolutionmapping of 601-207 tetranucleosomes (Figure S3). We ob-served that the nucleosome repeats of the clone-601 oligo-nucleosomes were very similar to the bulk yeast nucleosomerepeat.

Using our reporter assay, we observed that the firstthree constructs allowed the silencing of the URA3 re-porter by the E-silencer (Figure 6, A–C, spotting assays).However, with the octamer and the decamer repeats, thesilencing was disrupted and URA3 reporter was expressed(Figure 6, D and E, spotting assays). We thus concludedthat more than six consecutive clone-601 nucleosomeswere restricting the free conductance of silencing betweenthe E- and I-silencers and the reporter gene. Similar

results were obtained with the I-silencer, where the silenc-ing was conducted through dimer up to hexamer (Figure6, F–H) but not through the 8-mer and 10-mer (Figure 6, Iand J).

Arrays with shorter spacing between the nucleosomesconduct silencing for a longer distance

We then examined silencing conductance by shorter repeatsof clone-601 DNA sequence containing 167 bp of nucleo-some-positioning DNA sequences close to the predominantnucleosome repeats in yeast (Thomas and Furber 1976).Nucleosome arrays with 167 bp repeats had been shownto promote a tighter higher-order folding of chromatin fibersthan arrays with 207 bp repeats in vitro (Routh et al. 2008;Correll et al. 2012). We observed that the repeats from thedimer to the octamer effectively conducted silencing ema-nating from the E-silencer (Figure 7, A–D, spotting assays).However, the decamer and the dodecamer were not able toconduct the silencing, which led to the expression of theURA3 reporter (Figure 7, E and F, spotting assays). Weobtained very similar results when we placed the nucleo-some-positioning sequences between the URA3 reporterand the I-silencer (Figure 7, G–L).

In a recent work we observed that the 172 bp nucleosomespacing, more abundant in S. cerevisiae than the 167 bp re-peat (Wang et al. 2008), inhibits tight nucleosome folding ascompared to the 167 bp repeats in vitro (Correll et al. 2012).To examine whether the difference observed between theNRL of 167 and 172 bp would affect chromatin silencingon a yeast minichromosome in vivo, we constructed andplaced a series of 172 bp NRL nucleosome-positioningsequences between the E-silencer and the URA3 reporter.We observed, however, that substitution of the 167 bp re-peat with the 172 bp repeat did not have a significanteffect on yeast silencing conductance by the E-silencer(Figure 8, A–C, spotting assays). We also did not observe eitheran increased silencing by the 167 bp repeat as compared

Figure 5 An array of 12 regular repeats of clone-601nucleosomes (207 bp NRL) blocks silencing of the URA3reporter. Arrows indicate 207 bp clone-601 oligomers(regular 601-207312 repeats) placed in different orienta-tions between the HML–E silencer (A and B) or the HML–Isilencer (C and D) elements and the URA3 reporter gene.The URA3 reporter status was tested by spotting assay.












to the 172 bp repeat or a stronger protection of the silentminichromosomes by MNase. It thus appears that both shorternucleosome repeat lengths (167 and 172 bp) are moreefficient in promoting silencing in yeast minichromosomesin vivo than the longer 207 bp repeat, consistent withthe more unfolded structure of the latter repeat in vitro.

As an additional control, yeast strains with the minichro-mosome constructs containing different repeats (8-mers, 10-mers, and 12-mers oligonucleosomes) were isolated fromyeast and sequenced. Yeast minichromosome DNA sam-ples purified using standard protocols (Rose et al. 1990)were retransformed and grown in E. coli followed byDNA sequencing using the primers listed (Table S1).The sequences confirmed that no recombination eventsoccurred.

Yeast genomic DNA sequence conducts silencing moreefficiently than the clone-601 repeats

Since DNA repeats are known to promote heterochromatinformation in higher eukaryotes (Dorer and Henikoff 1994;Roshina et al. 2008; Kagansky et al. 2009), we examinedwhether silencing conductance is as efficient on a uniquegenomic DNA as on clone-601 repeats. Therefore, we placednatural DNA sequences from the LYS2 ORF of the length ofoctamer, decamer, and dodecamer between the E-silencerand the URA3 reporter as a control for the size comparableto the 601-17238, 601-172310, and 601-172312 con-structs (Figure 8, A–C, schematic representations). LYS2DNA has been shown before not to interfere with silencingimposed by the E- and I-silencer elements (Maillet et al.

Figure 6 The 207 bp NRL arrays of up to six nucleosomesconduct silencing of the reporter gene by the E- or I-silencer elements. (A–E) The repeats of clone-601 DNA with207 bp-long NRL (shown by open arrows) were positionedbetween the HML–E silencer and the URA3 reporter. TheURA3 reporter status was tested by spotting assay. (F–J) Therepeats of clone-601 DNA with 207 bp-long NRL (shown byopen arrows) were positioned between the HML–I silencerand the URA3 reporter. The URA3 reporter status wastested by spotting assay.






1996). We found that the silencing was not interrupted bythe control sequences and that the URA3 reporter was re-pressed by the E-silencer (Figure 8, D–F, spotting assays). Itthus appears that the silencing conducted by the yeast ge-nomic sequences is more efficient compared to the repeatsof clone-601 high DNA–histone affinity nucleosome arraysin vivo.

Discussion

Previous genetic screening revealed a number of nucleo-some-size sequences acting in a position- and orientation-dependent manner to block spreading of heterochromatin

silencing in yeast (Bi and Broach 2001). Previously, weshowed that two boundary elements were specifically block-ing silencing in our S. cerevisiae minichromosome system(Chakraborty et al. 2011). Here we used the same systemas a tool to investigate the conductance of chromatin silenc-ing in vivo through repeats of the clone-601 nucleosome-positioning sequence (Lowary and Widom 1998). We foundthat a single clone-601 mononucleosome was effectivelyconducting silencing of the URA3 reporter by either theHML-E or the HML-I silencer elements and hence had nospecific barrier activity. This is in contrast to a number ofother artificial DNA sequences such as short GC-rich DNArepeats and dA-dT tracts that did not support nucleosome

Figure 7 The 167 bp NRL arrays of up to eight nucleo-somes conduct silencing of the reporter gene by the E- orI-silencer elements. (A–F) The repeats of clone-601 DNAwith 167 bp NRL (shown by open arrows) were positionedbetween the HML–E silencer and the URA3 reporter. TheURA3 reporter status was tested by spotting assay. (G–L)The repeats of clone-601 DNA with 167 bp NRL (shown byopen arrows) were positioned between the HML–I silencerand the URA3 reporter. The URA3 reporter status wastested by spotting assay.




formation and efficiently blocked conductance of silencingwith only 40–80 bp of such sequences inserted between theE-silencer and URA3 reporter (Bi et al. 2004). However, weobserved that the silencing was disrupted when repeats ofmore than six clone-601 nucleosomes were inserted be-tween the silencer and URA3 reporter. Interestingly, the nu-cleosome arrays with shorter repeat lengths (167 and 172bp) were more efficient in conducting silencing when com-pared to the longer (207 bp) nucleosome repeats. Onepotential explanation of this phenomenon could be theincreasing distance between the silencer and the promoter,and the other one could be the formation of an alternativechromatin higher-order structure, as six nucleosomes arelikely to be the minimal unit needed to form one turn ofa helical 30 nm fiber (Ghirlando and Felsenfeld 2008).Whether the nucleosomes should fold into a helical fiberfor conducting silencing signals across nucleosome arraysis of significant interest for further studies.

Since previous studies have demonstrated positional-dependent variegation of reporter genes regulated bytelomeric heterochromatin (Gottschling et al. 1990; Smithet al. 2002), initially we expected that some of our con-structs would impose a variegating phenotype. In this studyand in our previous work (Chakraborty et al. 2011), we havegenetically tested more than one hundred minichromosomeconstructs containing various nucleosome-positioningsequences, known silencing regulators, and DNA controls.However, there was not a single case of phenotypic instabil-ity or variegation in our minichromosomes (either promot-ing or inhibiting silencing). Previous data suggested thatsilencing could be spread over a distance of 7 kb througha Ty retrotransposon sequence inserted at the HML a-locus(Mastrangelo et al. 1992) and that the dose of an architec-tural factor Sir3 protein was limiting for a longer spread-ing of heterochromatin-mediated silencing at telomeres

(Renauld et al. 1993; Hecht et al. 1996). Since in yeastcells our reporter minichromosomes are represented by�20 copies (Figure 1, F and G), it appears that an in-creased copy number of silent nucleosomes makes an effi-cient threshold to buffer natural dosage variation of thesilencing factors. It is also known that plasmid-bornesilencers are less constrained than those in the chromo-somes and may interact in trans with multiple peritelo-meric repressive compartments, rather than with just thenearby telomeric region (Lebrun et al. 2003), so that thevariegating in cis spreading would be negated by the intrans interactions. In addition, if silencing is conductedvia a distinct superhelical density (Bi and Broach 1997) or analtered looped topography as was proposed most recently(Thurtle and Rine 2014), then in the yeast minicromosomesthe alternative looping could be facilitated by topologicaltransitions in the covalently closed minichromosome DNA.Our system allows one to isolate yeast minichromosomes intheir native state, so that future structural studies could clar-ify whether any topological or other conformational altera-tions distinguish the silent and active minichromosomes.

In vitro, the nucleosome repeats with short NRL such as167–177 bp form a compact higher-order structure in theabsence of linker histone H1 (Correll et al. 2012). In vivo,yeast S. cerevisiae has an average nucleosome repeat of 167bp, which may represent a mixture of quantized repeatswith maximal distribution of 162 and 172 bp (Wang et al.2008; Brogaard et al. 2012; Eriksson et al. 2012). Yeast alsohave a relatively low level of the linker histone comparedto higher eukaryotes (Freidkin and Katcoff 2001; Downset al. 2003), which inhibits rather than promotes silencing(Yu et al. 2009). The decreased potential of the longer NRL(207 bp), and hence a lesser nucleosome density to fold thechromatin fiber and conduct silencing, is consistent with theglobal transcriptional upregulation observed as a result of

Figure 8 A native S. cerevisiae genomic DNA sequence ismore efficient in conducting silencing than the arrays ofthe nucleosome-positioning sequence. (A–C) Octamer (A),decamer (B), and dodecamer (C) repeats of clone-601DNA with 172 bp long NRL (shown by open arrows) werepositioned between the HML–E silencer and the URA3reporter. (E and F) A natural genomic sequence controlequivalent to the length of an octamer, decamer, anddodecamer of 601–172 bp (from the S. cerevisiae LYS2ORF shown by the shaded arrows) was placed betweenthe HML–E silencer and the URA3 reporter. The URA3 re-porter status was tested by spotting assay.






decreased nucleosome density in yeast undergoing replica-tive aging (Hu et al. 2014).

Previous in vitro transcriptional experiments showed thatpositioned nucleosomes presented barriers for transcriptiondepending on their sequence orientation vs. the transcrip-tion direction (Bondarenko et al. 2006). In our experiments,we observed no orientation dependency in mononucleo-somes or oligonucleosomes inserted between the URA3 re-porter and E- or I-silencers. Our results are consistent withthe previous finding that the clone-601 and -603 mononu-cleosome-positioning sequences affected transcription froma yeast reporter gene in an orientation-independent mannerin vivo (Gaykalova et al. 2011).

We also found no differences between the uniform andthe variable nucleosome repeats, as both were equallystrong in conducting silencing of the URA3 reporter by thesilencer elements (Figure S1). The in vivo genetic results areconsistent with recent in vitro experiments showing no dif-ference in higher-order folding between the variable lengthand uniform repeats of clone-601 nucleosomes (Correll et al.2012). However, with a natural yeast sequence, the silenc-ing appeared to be conducted for a longer distance as theURA3 reporter was fully repressed by the longest fragmentof LYS2 equal to a clone 12-mer. The weight of evidence,therefore, favors that the extent of silencing by yeast HML-Eand HML-I is not promoted by the repeated nature of un-derlying DNA in contrast to higher eukaryotic systems(Dorer and Henikoff 1994; Roshina et al. 2008; Kaganskyet al. 2009).

The design of oligonucleotide primer for the clone 601allowed us to map the clone-601 mononucleosome in the E-silencer area with high precision. Here we observed that thechromatin organization of the HML-E silencer previouslymapped in the yeast genome (Weiss and Simpson 1998) isretained in the minichromosomes and is very similar to thestructure and function of the silencer elements in the genome.Our high-resolution mapping of the yeast minichromosomesin the silent and active states with micrococcal nucleaseclearly shows that the complete minichromosome wasreadily accessible to the nuclease in sharp contrast toviral minichromosomes in human cells (Kumala et al.2012). Moreover, in our experiments the silent chromatinappears to be digested notably faster by the MNase thanthe active chromatin (Figure 3C) although the MNasecleavage patterns of the active chromatin and the silentchromatin are similar (Figure 3, C and D). Thus, our mini-chromosome reporter that is remarkably robust in relationto copy number and recombination stability readily con-ducts repressive signals from HML silencers to the URA3gene without any major chromatin unfolding and nucleo-some losses or repositioning.

It thus appears that spreading of chromatin silencingdoes not require a higher DNA–histone affinity or a tighterchromatin folding. This is consistent with the previous find-ings (Sekinger and Gross 2001; Chen et al. 2005) thatchromatin silencing does not present a strong hindrance

for a transcriptional factor’s access to the silent promoters.Perhaps other aspects of chromatin structure such as spe-cial architectural factors, the intrinsic interaction of histonetails, and/or nucleosome chain topography (see, e.g., Wanget al. 2013; Thurtle and Rine 2014), rather than mere com-paction, plays a critical role in the transmission of silencingsignals from the silencer to the reporter. Future structuralstudies using the minichromosome reporters isolatedfrom yeast cells in a native state should reveal the struc-tural changes accompanying heterochromatin spreading inS. cerevisiae.

Acknowledgments

We thank the Department of Biochemistry and MolecularBiology, Pennsylvania State University, for providing equip-ment and reagents; the late Robert Simpson for insights;Evgenya Popova, Ralph Keil, Laura Carrel, and Avery Augustfor helpful discussions; and Ji Qi and Ross Keller fortechnical assistance. We acknowledge funding support byNational Science Foundation grant MCB–1021681 (to S.A.G.)and an American Association of University Women DoctoralFellowship Award (to S.A.C.). This project was also funded, inpart, by a grant from the Pennsylvania Department of Healthusing Tobacco Settlement Funds.

Literature Cited

Bi, X., and J. R. Broach, 1997 DNA in transcriptionally silentchromatin assumes a distinct topology that is sensitive to cellcycle progression. Mol. Cell. Biol. 17: 7077–7087.

Bi, X., and J. R. Broach, 1999 UASrpg can function as a hetero-chromatin boundary element in yeast. Genes Dev. 13: 1089–1101.

Bi, X., and J. R. Broach, 2001 Chromosomal boundaries in S.cerevisiae. Curr. Opin. Genet. Dev. 11: 199–204.

Bi, X., Q. Yu, J. J. Sandmeier, and Y. Zou, 2004 Formation ofboundaries of transcriptionally silent chromatin by nucleo-some-excluding structures. Mol. Cell. Biol. 24: 2118–2131.

Boeke, J. D., F. LaCroute, and G. R. Fink, 1984 A positive selec-tion for mutants lacking orotidine-59-phosphate decarboxylaseactivity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen.Genet. 197: 345–346.

Bondarenko, V. A., L. M. Steele, A. Ujvari, D. A. Gaykalova, O. I.Kulaeva et al., 2006 Nucleosomes can form a polar barrier totranscript elongation by RNA polymerase II. Mol. Cell 24: 469–479.

Brogaard, K., L. Xi, J. P. Wang, and J. Widom, 2012 A map ofnucleosome positions in yeast at base-pair resolution. Nature486: 496–501.

Chakraborty, S. A., R. T. Simpson, and S. A. Grigoryev, 2011 A singleheterochromatin boundary element imposes position-independentantisilencing activity in Saccharomyces cerevisiae minichromosomes.PLoS ONE 6: e24835.

Chen, D., M. Dundr, C. Wang, A. Leung, A. Lamond et al.,2005 Condensed mitotic chromatin is accessible to transcriptionfactors and chromatin structural proteins. J. Cell Biol. 168: 41–54.

Chen, K., M. A. Wilson, C. Hirsch, A. Watson, S. Liang et al.,2013 Stabilization of the promoter nucleosomes in nucleosome-free









regions by the yeast Cyc8-Tup1 corepressor. Genome Res. 23: 312–322.

Correll, S. J., M. H. Schubert, and S. A. Grigoryev, 2012 Shortnucleosome repeats impose rotational modulations on chroma-tin fibre folding. EMBO J. 31: 2416–2426.

Dillin, A., and J. Rine, 1995 On the origin of a silencer. TrendsBiochem. Sci. 20: 231–235.

Dorer, D. R., and S. Henikoff, 1994 Expansions of transgene re-peats cause heterochromatin formation and gene silencing inDrosophila. Cell 77: 993–1002.

Downs, J. A., E. Kosmidou, A. Morgan, and S. P. Jackson,2003 Suppression of homologous recombination by the Sac-charomyces cerevisiae linker histone. Mol. Cell 11: 1685–1692.

Ducker, C. E., and R. T. Simpson, 2000 The organized chromatindomain of the repressed yeast a cell-specific gene STE6 containstwo molecules of the corepressor Tup1p per nucleosome. EMBOJ. 19: 400–409.

Elgin, S. C. R., and J. L. Workman, 2000 Chromatin Structure andGene Expression. Oxford University Press, Oxford.

Eriksson, P. R., D. Ganguli, V. Nagarajavel, and D. J. Clark,2012 Regulation of histone gene expression in budding yeast.Genetics 191: 7–20.

Fourel, G., E. Revardel, C. E. Koering, and E. Gilson,1999 Cohabitation of insulators and silencing elements inyeast subtelomeric regions. EMBO J. 18: 2522–2537.

Freidkin, I., and D. J. Katcoff, 2001 Specific distribution of theSaccharomyces cerevisiae linker histone homolog HHO1p inthe chromatin. Nucleic Acids Res. 29: 4043–4051.

Gaykalova, D. A., V. Nagarajavel, V. A. Bondarenko, B. Bartholomew,D. J. Clark et al., 2011 A polar barrier to transcription can becircumvented by remodeler-induced nucleosome translocation.Nucleic Acids Res. 39: 3520–3528.

Ghirlando, R., and G. Felsenfeld, 2008 Hydrodynamic studies ondefined heterochromatin fragments support a 30-nm fiber hav-ing six nucleosomes per turn. J. Mol. Biol. 376: 1417–1425.

Gietz, R. D., and R. H. Schiestl, 2007 High-efficiency yeast trans-formation using the LiAc/SS carrier DNA/PEG method. Nat.Protoc. 2: 31–34.

Gottschling, D. E., O. M. Aparicio, B. L. Billington, and V. A. Zakian,1990 Position effect at S. cerevisiae telomeres: reversible re-pression of Pol II transcription. Cell 63: 751–762.

Grewal, S. I., and D. Moazed, 2003 Heterochromatin and epige-netic control of gene expression. Science 301: 798–802.

Grigoryev, S. A., G. Arya, S. Correll, C. L. Woodcock, and T. Schlick,2009 Evidence for heteromorphic chromatin fibers from anal-ysis of nucleosome interactions. Proc. Natl. Acad. Sci. USA 106:13317–13322.

Haber, J. E., 1998 Mating-type gene switching in Saccharomycescerevisiae. Annu. Rev. Genet. 32: 561–599.

Haber, J. E., 2012 Mating-type genes and MAT switching in Sac-charomyces cerevisiae. Genetics 191: 33–64.

Hecht, A., S. Strahl-Bolsinger, and M. Grunstein, 1996 Spreadingof transcriptional repressor SIR3 from telomeric heterochroma-tin. Nature 383: 92–96.

Hu, Z., K. Chen, Z. Xia, M. Chavez, S. Pal et al., 2014 Nucleosomeloss leads to global transcriptional up-regulation and genomicinstability during yeast aging. Genes Dev. 28: 396–408.

Hughes, A. L., Y. Jin, O. J. Rando, and K. Struhl, 2012 A functionalevolutionary approach to identify determinants of nucleosomepositioning: a unifying model for establishing the genome-widepattern. Mol. Cell 48: 5–15.

Kagansky, A., H. D. Folco, R. Almeida, A. L. Pidoux, A. Boukabaet al., 2009 Synthetic heterochromatin bypasses RNAi andcentromeric repeats to establish functional centromeres. Science324: 1716–1719.

Kumala, S., Y. Hadj-Sahraoui, J. Rzeszowska-Wolny, and R. Hancock,2012 DNA of a circular minichromosome linearized by restric-

tion enzymes or other reagents is resistant to further cleavage: aninfluence of chromatin topology on the accessibility of DNA. Nu-cleic Acids Res. 40: 9417–9428.

Lebrun, E., G. Fourel, P. A. Defossez, and E. Gilson, 2003 A methy-ltransferase targeting assay reveals silencer-telomere interactionsin budding yeast. Mol. Cell. Biol. 23: 1498–1508.

Lowary, P. T., and J. Widom, 1998 New DNA sequence rules forhigh affinity binding to histone octamer and sequence-directednucleosome positioning. J. Mol. Biol. 276: 19–42.

Luger, K., M. L. Dechassa, and D. J. Tremethick, 2012 New in-sights into nucleosome and chromatin structure: An orderedstate or a disordered affair? Nat. Rev. Mol. Cell Biol. 13: 436–447.

Mahoney, D. J., and J. R. Broach, 1989 The HML mating-typecassette of Saccharomyces cerevisiae is regulated by two sepa-rate but functionally equivalent silencers. Mol. Cell. Biol. 9:4621–4630.

Maillet, L., C. Boscheron, M. Gotta, S. Marcand, E. Gilson et al.,1996 Evidence for silencing compartments within the yeastnucleus: a role for telomere proximity and Sir protein concen-tration in silencer-mediated repression. Genes Dev. 10: 1796–1811.

Makde, R. D., J. R. England, H. P. Yennawar, and S. Tan,2010 Structure of RCC1 chromatin factor bound to the nucle-osome core particle. Nature 467: 562–566.

Mastrangelo, M. F., K. G. Weinstock, B. K. Shafer, A. M. Hedge, D. J.Garfinkel et al., 1992 Disruption of a silencer domain by a ret-rotransposon. Genetics 131: 519–529.

Mays Hoopes, L. L., 1987 Nucleic acid blotting: Southern andNorthern, 8.2.1-8.2.24 in Current Protocols: Essential LaboratoryTechniques, edited by F. Ausubel.

Moazed, D., 2011 Mechanisms for the inheritance of chromatinstates. Cell 146: 510–518.

Moretti, P., K. Freeman, L. Coodly, and D. Shore, 1994 Evidencethat a complex of SIR proteins interacts with the silencer andtelomere-binding protein RAP1. Genes Dev. 8: 2257–2269.

Motwani, T., M. Poddar, and S. G. Holmes, 2012 Sir3 and epige-netic inheritance of silent chromatin in Saccharomyces cerevi-siae. Mol. Cell. Biol. 32: 2784–2793.

Nikitina, T., D. Wang, M. Gomberg, S. A. Grigoryev, and V. B.Zhurkin, 2013 Combined micrococcal nuclease and exonucle-ase III digestion reveals precise positions of the nucleosomecore/linker junctions: implications for high-resolution nucleo-some mapping. J. Mol. Biol. 425: 1946–1960.

Perales, R., L. Zhang, and D. Bentley, 2011 Histone occupancyin vivo at the 601 nucleosome binding element is determinedby transcriptional history. Mol. Cell. Biol. 31: 3485–3496.

Ravindra, A., K. Weiss, and R. T. Simpson, 1999 High-resolutionstructural analysis of chromatin at specific loci: Saccharomycescerevisiae silent mating-type locus HMRa. Mol. Cell. Biol. 19:7944–7950.

Renauld, H., O. M. Aparicio, P. D. Zierath, B. L. Billington, S. K.Chhablani et al., 1993 Silent domains are assembled continu-ously from the telomere and are defined by promoter distanceand strength, and by SIR3 dosage. Genes Dev. 7: 1133–1145.

Richmond, T. J., and C. A. Davey, 2003 The structure of DNA inthe nucleosome core. Nature 423: 145–150.

Rose, M. D., F. Winston, and P. Hieter (Editors), 1990 Methods inYeast Genetics: A Laboratory Course Manual. Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

Roshina, M. P., N. N. Loginova, A. B. Devin, and V. A. Gvozdev,2008 [Heterochromatic DNA repeats in Drosophila and un-usual gene silencing in yeast cells] Genetika 44: 752–760.

Roth, S. Y., and R. T. Simpson, 1991 Yeast minichromosomes.Methods Cell Biol. 35: 289–314.


Routh, A., S. Sandin, and D. Rhodes, 2008 Nucleosome repeatlength and linker histone stoichiometry determine chromatin fiberstructure. Proc. Natl. Acad. Sci. USA 105: 8872–8877.

Schlick, T., J. Hayes, and S. Grigoryev, 2012 Toward convergenceof experimental studies and theoretical modeling of the chro-matin fiber. J. Biol. Chem. 287: 5183–5191.

Sekinger, E. A., and D. S. Gross, 2001 Silenced chromatin is permis-sive to activator binding and PIC recruitment. Cell 105: 403–414.

Shimizu, M., S. Y. Roth, C. Szent-Gyorgyi, and R. T. Simpson,1991 Nucleosomes are positioned with base pair precision ad-jacent to the alpha 2 operator in Saccharomyces cerevisiae.EMBO J. 10: 3033–3041.

Sikorski, R. S., and P. Hieter, 1989 A system of shuttle vectors andyeast host strains designed for efficient manipulation of DNA inSaccharomyces cerevisiae. Genetics 122: 19–27.

Simpson, R. T., 1998 Chromatin structure and analysis of mech-anisms of activators and repressors. Methods 15: 283–294.

Smith, C. M., Z. W. Haimberger, C. O. Johnson, A. J. Wolf, P. R.Gafken et al., 2002 Heritable chromatin structure: mapping“memory” in histones H3 and H4. Proc. Natl. Acad. Sci. USA99(Suppl 4): 16454–16461.

Struhl, K., and E. Segal, 2013 Determinants of nucleosome posi-tioning. Nat. Struct. Mol. Biol. 20: 267–273.

Thomas, J. O., and V. Furber, 1976 Yeast chromatin structure.FEBS Lett. 66: 274–280.

Thurtle, D. M., and J. Rine, 2014 The molecular topography ofsilenced chromatin in Saccharomyces cerevisiae. Genes Dev. 28:245–258.

Wang, F., G. Li, M. Altaf, C. Lu, M. A. Currie et al.,2013 Heterochromatin protein Sir3 induces contacts betweenthe amino terminus of histone H4 and nucleosomal DNA. Proc.Natl. Acad. Sci. USA 110: 8495–8500.

Wang, J. P., Y. Fondufe-Mittendorf, L. Xi, G. F. Tsai, E. Segal et al.,2008 Preferentially quantized linker DNA lengths in Saccha-romyces cerevisiae. PLOS Comput. Biol. 4: e1000175.

Weiss, K., and R. T. Simpson, 1997 Cell type-specific chromatinorganization of the region that governs directionality of yeastmating type switching. EMBO J. 16: 4352–4360.

Weiss, K., and R. T. Simpson, 1998 High-resolution structuralanalysis of chromatin at specific loci: Saccharomyces cerevisiaesilent mating type locus HMLalpha. Mol. Cell. Biol. 18: 5392–5403.

Yu, Q., H. Kuzmiak, Y. Zou, L. Olsen, P. A. Defossez et al.,2009 Saccharomyces cerevisiae linker histone Hho1p func-tionally interacts with core histone H4 and negatively regulatesthe establishment of transcriptionally silent chromatin. J. Biol.Chem. 284: 740–750.

Communicating editor: M. Hampsey


GENETICSSupporting Information


Nucleosome-Positioning Sequence Repeats ImpactChromatin Silencing in Yeast Minichromosomes

Sangita A. Chakraborty, Abid A. Kazi, Tamreen M. Khan, and Sergei A. Grigoryev

Copyright © 2014 by the Genetics Society of AmericaDOI: 10.1534/genetics.114.169508

S. A. Chakraborty et al. 2 SI

Figure S1 The variable 601‐(207±2) x12 nucleosome array blocks silencing of the URA3 reporter.

The variable (irregular) 601‐(207±2) x12 repeats (comprising of 205 bp – 207 bp – 209 bp × 4) shown in arrows, were examined in different orientations in the presence of the HML – E silencer (A‐B) or the HML – I silencer (C‐D) and the URA3 reporter. The URA3 reporter gene expression status (on or off) was tested by spotting assay.


A B

Figure S2 High‐resolution MNase mapping of clone‐601‐207x1 mononucleosome in the silent state. A: The autoradiograph shows high‐resolution PAGE of control naked DNA that was subjected to digestion with 0, 1, 2, 4, 8 U/ml of MNase before high‐resolution chromatin mapping by primer extension analysis. Lane M is the end‐labeled Promega phiX174 dephosphorylated DNA marker. B: The autoradiograph shows high‐resolution chromatin mapping of the silent minichromosome containing 601‐207x1 DNA and digested with 0, 1, 2, 4, 8 U/ml of MNase as shown by the solid triangle. Lane M is the end‐labeled Promega phiX174 DNA dephosphorylated marker. The ovals represent positioned nucleosomes including 22, 21, 20 (Weiss and Simpson 1998; Elgin and Workman 2000) and the 601‐207 monomer, the adjoining line represents the linker region, E denotes the HML‐E silencer element with conserved genomic nuclease hypersensitive site (Oliver, van der Aart et al. 1992; Weiss and Simpson 1998). The nuclease hypersensitive cutting sites are marked with arrows and the nucleotide sequences are shown for the strong MNase cutting.


Figure S3 Low‐resolution Micrococcal Nuclease mapping of clone‐601‐207 tetranucleosome in the silent state. A: Ethidium stained agarose gel (lanes 1,2) and Southern blotting of the same gel (lanes 3,4) showing molecular weight marker (lanes 1,3) and SacI digestion of yeast DNA transformed with 601‐207x4 minichromosomes (lanes 2,4). Arrow shows the position of SacI digest corresponding to the expected ~ 7 Kb size of the 601‐207x4 minichromosome construct. Southern blot was probed with 601‐207x4 minichromosome DNA, containing vector DNA recognizing the molecular weight marker. B: Ethidium stained agarose gel (lanes 5‐12) and Southern blotting of the same gel (lanes 13‐20) probed with clone‐601 DNA showing MNase digestion of naked DNA (lanes 5‐8 and 13‐16) and nuclear chromatin samples (lanes 9‐12 and 17‐20) from isolated nuclei of yeast cells transformed with 601‐207x4 minichromosomes and digested with Units/ml of Micrococcal Nuclease: 1U (lanes 5, 13, 9, 17); 2U (lanes 6, 14, 10, 18); 4U (lanes 7, 15, 11, 19); and 8U (lanes 8, 16, 12, 20).


Table S1 PRIMERS used in the gene silencing study

PRIMERS SEQUENCES USED FOR

E Forward (SacI) 5’ – AACGAGCTCGTGGATGGATCTAG

GGTTTTATGC – 3’

HML‐E

pSC‐E Silencer

E Reverse (XhoI) 5’ – ACCCTCGAGGGTACGATTTTTCTG

AAATCTTTGTTTACA – 3’

HML‐E

pSC‐E Silencer

I Forward (NotI) 5’ – ATTTGCGGCCGCTTTAATTATTATA

AAATTATAGCAGGATAGTTC – 3’

HML‐I

pSC‐I Silencer

I Reverse (KpnI) 5’ – AGGGGTACCCCAAGAGATCGAA

AGAAAGCTCCC ‐ 3’

HML‐I

pSC‐I Silencer

SacI Forward 5’ – CACCCTTACGATTCCTTGCC – 3’ SacI‐Stuffer Fragment

SacI Reverse 5’ – CCTGAGGCTGTAGCTGATGCT – 3’ SacI‐Stuffer Fragment

P601‐20 5’ – ACATGCATGCATGACTAGTCATG

CACAGGATGTATATATCTGACAC – 3’

601‐167 bp Monomer

P601‐23 5’ – TGCTCTAGATATCCCGCCCT – 3’ 601‐167 bp Monomer

P601‐25 5’ – TGCTCTAGATATCCCGCCCTGG

AGAATCCCG – 3’

601‐167 bp Monomer

SC‐PE‐E1 5’ – CTGGATCTGACGTCGAGCTCGTG

GATG – 3’

Chromatin Mapping

SC‐PE‐N1 5’ – GCAGCGTTGGGTCCTGGCCACGGG – 3’ Chromatin Mapping

Ndel‐F 5’ – CTCTAGATATCCATATGCCGCCC

TGGAGAATCC – 3’

Chromatin Mapping

Y167‐R 5’ – GCATGCATGACTAGTCATGCACAG

GATG – 3’

Chromatin Mapping

167MonoF 5’ – CCCGGTGCCGAGGCCGCTCAA

TTGGTC – 3’

Chromatin Mapping

167MonoR 5’ – GACACGTGCCTGGAGACTAGGGA

GTAATCCCC – 3’

Chromatin Mapping

URA3‐F 5’ – GTCGAAAGCTACATATAAGGAAC

GTGCTGCTAC – 3’

Chromatin Mapping

URA3‐R 5’ – CGTCATTATAAAAATCATTACGA

CCGAGATTCCCGGG – 3’

Chromatin Mapping

URA3‐UF 5’ – CGGTAATCTCCGAACAGAAGGAAG

AACGAAGG – 3’

Chromatin Mapping

Core601F 5’ – ACGCGCTGTCCCCCGCGTTTTAAC – 3’ Chromatin Mapping

Core601R 5’ – TAAAACGCGGGGGACAGCGCG Chromatin Mapping


TAC – 3’

ESilent F 5’ – CGCATGCATGTCTCGAGGGTAC

GA – 3’

Chromatin Mapping

UUF2 5’ – CGGTAATCTCCGAACAGAAGG

AAG – 3’

Chromatin Mapping

Con4merF 5’ – GCTCTAGAGCCAAACCCAAGGAA

CCTGGGATA – 3’

Control Sequence

Con4merR 5’ – ACATGCATGCATGACTAGTCAAATC

ATTTAATTGGTGGTGCTGC – 3’

Control Sequence

Con6merF 5’ – GCTCTAGAGCTGGTACTGTTGGA

ACCACCTA – 3’

Control Sequence

Con6merR 5’ – ACATGCATGCATGACTAGTCCAC

GTTGGTCAAGAAATCA – 3’

Control Sequence

LYS2Fcon 5’ – CATGCATGCCGTTCAGCTACTAGT

TGTTAACAGG – 3’

Distance Control for

8mer

LYS2Rcon 5’ – GCTCTAGAGCCTCATCTGAAAGAC

CAAATTGGC – 3’

Distance Control for

8mer

SC‐SEQ1F 5’ – GGGCAGCGTTGGGTCCTG – 3’ Sequencing

SC‐SEQ2R 5’ – GCACATAGAATGAAATGTAAAC – 3’ Sequencing

LYS2R10 5’ – GCTCTAGAGCCTTTCACCTGC

ACGTCTAATGATG – 3’

Distance Control ‐

10mer

LYS2R12 5’ – GCTCTAGAGCCTTCATTCCTGTC

AATAACAGACG – 3’

Distance Control ‐

12mer

The table above contains list of primers and their sequences used in the study.


Table S2 MINICHROMOSOME constructs containing clone‐601 positioning nucleosomes.

CONSTRUCTS PARENT VECTORS SCHEMES

1) pSC‐E 601‐207x1 Forward pSC‐E Silencer & pUC19 E‐207x1(F)‐U

2) pSC‐E 601‐207x1 Reverse pSC‐E Silencer & pUC19 E‐207x1(R)‐U

3) pSC‐I 601‐207x1 Forward pSC‐I Silencer & pUC19 I‐207x1(F)‐U

4) pSC‐I 601‐207x1 Reverse pSC‐I Silencer & pUC19 I‐207x1(R)‐U

5) pSC‐E 601‐207x12r

Forward

pSC‐E Silencer & pUC19 E‐207x12r(F)‐U

6) pSC‐E 601‐207x12r Reverse pSC‐E Silencer & pUC19 E‐207x12r(R)‐U

7) pSC‐I 601‐207x12r Forward pSC‐I Silencer & pUC19 I‐207x12r(F)‐U

8) pSC‐I 601‐207x12r Reverse pSC‐I Silencer & pUC19 I‐207x12r(R)‐U

9) pSC‐E 601‐207x12i Forward pSC‐E Silencer & pUC19 E‐207x12i(F)‐U

10) pSC‐E 601‐207x12i Reverse pSC‐E Silencer & pUC19 E‐207x12i(R)‐U

11) pSC‐I 601‐207x12i Forward pSC‐I Silencer & pUC19 I‐207x12i(F)‐U

12) pSC‐I 601‐207x12i Reverse pSC‐I Silencer & pUC19 I‐207x12i(R)‐U












24) pSC‐E 601‐167x1 Reverse pSC‐E Silencer & pUC19 E‐167x1(R)‐U


26) pSC‐I 601‐167x1 Reverse pSC‐I Silencer & pUC19 I‐167x1(R)‐U

















42) pSC‐E 8mer‐Control pSC‐E Silencer & pUC19 E‐8mer Con‐U



45) pSC‐E 601‐Con‐1350 pSC‐E Silencer & pUC19 E‐Con‐1350‐U

46) pSC‐STAR(F) E 601‐

167x1Forward

pSC‐E Silencer & pUC19 STAR(F)E‐167x1(F)‐U

47) pSC‐STAR(R) E 601‐

167x1Forward

pSC‐E Silencer & pUC19 STAR(R)E‐167x1(F)‐U

48) pSC‐TEF2(F) E 601‐

167x1Forward

pSC‐E Silencer & pUC19 TEF2(F)E‐167x1(F)‐U

49) pSC‐ TEF2(R) E 601‐

167x1Forward

pSC‐E Silencer & pUC19 TEF2(R)E‐167x1(F)‐U

In the table above the letters represent the following: U – URA3; E – E silencer; I – I Silencer; S – STAR; T – TEF2; (F) –

Forward; (R) – Reverse; 601 – Clone 601 Nucleosome Positioning Sequence; r – Regular; i – Irregular; 1350 – 1350 bp;

207 – 207 bp; 172 – 172 bp; 167 – 167 bp; x 1, x 2, x 4, x 6, x 8, x 10, x 12 – Number of Repeats; Con – Control.

Documents

Nucleosome-Positioning Sequence Repeats Impact Chromatin ... · INVESTIGATION Nucleosome-Positioning Sequence Repeats Impact Chromatin Silencing in Yeast Minichromosomes Sangita A