The EMBO Journal vol.3 no.13 pp.3247-3255, 1984

Mutational analysis of simian virus 40 large T antigenDNA binding sites

Katherine A.Jones, Richard M.Myers1 and Robert Tjian

Department of Biochemistry, University of California, Berkeley, CA94720, USA

'Present address: Department of Biochemistry and Molecular Biology,Harvard University, Cambridge, MA 02138, USACommunicated by L.Philipson

We have tested the effects of various mutations within SV40T antigen DNA recognition sites I and II on specific T antigenbinding using the DNase footprint technique. In addition, thereplication of plasmid DNA templates carrying these T anti-gen binding site mutations was monitored by Southernanalysis of transfected DNA in COS cells. Deletion mappingof site I sequences defined a central core of - 18 bp that isboth necessary and sufficient for T antigen recognition; thisregion contains the site I contact nucleotides that werepreviously mapped using methylation-interference andmethylation-protection experiments. A similar deletionanalysis delineated sequences that impart specificity of bin-ding to site II. We find that T antigen is capable of specificrecognition of site II in the absence of site I sequences, in-dicating that binding to site II in vitro is not dependent onbinding of T antigen at site I. Site II binding was notdiminished by small deletion or substitution mutations thatperturb the 27-bp palindrome central to binding site II,whereas extensive substitution of site H sequences completelyeliminated specific site II binding. Analysis of the replicationin COS7 cells of plasmids that contain these mutant originsrevealed that sequences both at the late side of binding site Iand within the site II palindrome are crucial for viral DNAreplication, but are not involved in binding T antigen.Key words: simian virus 40/large T antigen/protein-DNAinteractions/SV40 origin-dependent replication

IntroductionThe early gene product of SV40, large T (tumor) antigen, is aregulatory protein that controls both the rate of transcriptionfrom the SV40 early promoter and the rate of viral DNAreplication in lytically-infected cells (for review, see Tooze,1981). T antigen is a 96 000 mol. wt. phosphoprotein(Tegtmeyer, 1975) that recognizes specific sequences of SV40DNA at the viral origin of replication (for review see Tjian,1981). The interaction between large T antigen and SV40DNA directly mediates the repression of SV40 early transcrip-tion (Rio et al., 1980; Myers et al., 1981b; Hansen et al. 1981;Rio and Tjian, 1983), and may also account for the observedstimulation of viral DNA replication by T antigen(Tegtmeyer, 1975; Shortle et al., 1979; Wilson et al., 1982;Margolskee and Nathans, 1984). T antigen has been shown toaggregate into dimers, tetramers, and higher order structuresin solution (Osborn and Weber, 1975; Myers et al., 1981c;Bradley et al., 1982), to catalyze the hydrolysis ofATP (Tjianand Robbins, 1979; Giacherio and Hager, 1979; Tjian et al.,1980), and to form a stable complex with a cellular 53-K pro-

IRL Press Limited, Oxford, England.

tein (Lane and Crawford, 1979; Linzer and Levine, 1979; Mc-Cormick and Harlow, 1980). A major concern among in-vestigators, therefore, has been to establish the relationshipbetween these biochemical properties of T antigen and theknown biological functions carried out by T antigen bothduring lytic infection and virally-induced neoplastic trans-formation.DNase protection and footprinting experiments have defin-

ed three distinct T antigen binding sites in a region of SV40DNA adjacent to the SV40 early promoter and overlappingthe SV40 origin of replication (Tjian, 1978, 1979; DiMaio andNathans, 1980; Myers and Tjian, 1980; Tegtmeyer et al. 1981;Tenen et al., 1982). Sequential binding to these three sites isdictated by different affinities of T antigen for each site;binding to the highest affinity site (site I) is characterized by aKd of 0.5 nM (22°C, 0.15 M NaCl; Myers et al., 1981a).Electron microscopy studies suggest that predominantly tetra-meric forms of T antigen are stably bound at each site (Myerset al., 198 1c). Many of the original observations on the DNAbinding properties of the adenovirus-SV40 D2 hybrid proteinhave subsequently been confirmed using wild-type T antigenisolated from different sources, and the interaction has beenevaluated in a variety of DNA binding assays includingDNase protection, immunoprecipitation, DNase footprintingand methylation protection (Rio et al., 1980; DiMaio andNathans, 1980, 1982; Myers et al., 1981b; McKay, 1981;McKay and DiMaio, 1981; Tenen et al., 1982, 1983; DeLuciaet al., 1983; Tegtmeyer et al., 1983; Lewton et al., 1984). Inaddition, the guanine and phosphates in contact with T anti-gen at sites I and II have been evaluated by alkylation-interference (Jones and Tjian, 1984). In this report, the inter-action between T antigen and SV40 DNA templates contain-ing a variety of binding site mutations is monitored using theDNase footprinting technique (Galas and Schmitz, 1978) asan alternative method for the identification of T antigenrecognition sequences within each binding site. We also com-pare the in vitro binding results with the ability of these mu-tant templates to support origin-specific DNA replication intransfected COS7 cells.

ResultsThe interaction of T antigen with specific SV40 DNA bindingsites creates a sequential pattern of DNase I footprint protec-tion, as illustrated in Figure 1. The highest affinity site, bind-ing site I, spans -30 bp (5185-5215). Binding site II extendsapproximately from the site I boundary at base pair 5215through base pair 15, a region of 45 bp. Binding site IIoverlaps the SV40 origin of replication and the early RNAstart sites, and abuts the early promoter 'TATA' sequence.Methylation-protection experiments (Tjian, 1978) have defin-ed areas of close protein contact to a 15-bp subset of eachbinding site and methylation-interference experiments havefurther defined contact points within these sites (Jones andTjian, 1984). These experiments have shown that both bind-

3247

K.AJones, R.M.Myers and R.Tjian

late

__

SoWw

-

. ~ ~

a

- --~~mlslo Wm

_1--N.- -~~~~~~~

;a 11-ttM5

TATA

f-i

early2 3 A

2A

I-

11 _

Ill

III-46

'O/52*X.

Fig. 1. DNase I footprint protection of wild-type SV40 origin sequences by D2 protein. A DNA fragment containing the EcoRII-G fragment of the SV40origin was 5' end-labelled at either the EcoRI site (late strand) or at the HindlII site (early strand), mixed with various concentrations of D2 protein andtreated with DNase. The resulting DNA fragments were subjected to denaturing polyacrylamide gel electrophoresis and analyzed by autoradiography. Thefragment labelled on the late strand (left panel) was incubated with D2 protein at the following concentrations: 0 nM (lane 1), 6.25 nM (lane 2), 12.5 nM(lane 3), 18.75 nM (lane 4), 25 nM (lane 5) and 37.5 nM (lane 6). The fragment end-labelled at the early strand (right panel) was incubated with D2 protein atthe following concentrations: 0 nM (lane 1), 12.5 nM (lane 3) and 25 nM (lane 4); lane 2 displays guanine sequence markers for this strand. A schematicrepresentation of the SV40 origin fragment is presented below the panels.

ing sites contain two hexanucleotide contact sequences(G)GCCTC, located 6 bp apart in site I. Within site II, onehexanucleotide sequence is in an inverted orientation and twoturns of the helix away from the site I contacts (assuming aB-DNA helical conformation), and a second set of weakercontacts is located at an additional distance of 5 bp andfollows the same orientation as the site I contacts. The effectsof binding site sequence alterations on the recognition by Tantigen have now been evaluated using DNase footprint andfilter binding techniques (Galas and Schmidt, 1978; Myersand Tjian, 1980). The mutant binding site templates used inthis study are illustrated in Figure 2. These mutations fall intofour classes: deletions that extend into site I sequences (dl 2,3, 4); deletions extending into site II sequences from both ear-ly and late directions (dl 22, 18, 23, A, 12) and an external siteII deletion (dl 1); internal site II substitutions (X 8, pIN 4);and insertion mutants that separate binding sites I and II (pIN43, 41).

Binding to site I: effect of binding site deletionsThe interaction between T antigen and residual site I se-quences in deletion mutants dl 2, dl 3 and dl 4 was examinedusing both the nitrocellulose filter binding and DNase I foot-printing techniques. A template lacking early site I sequencesto base pair 5192 was found to bind T antigen with an effi-ciency of 95% that of a wild-type template (containing allthree binding sites) in the nitrocellulose filter assay (mutantdl 4, Figure 3). In contrast, deletion from the late side of site Ito base pair 5207 or 5195 reduced binding in this assay (dl 2,dl 3; Figure 3). Mutant dl 2 removes only one guanine contactfrom site I sequences, whereas the more severely affected mu-tant dl 3 removes one complete hexanucleotide contact se-quence plus intervening nucleotides between the two site Ihexanucleotides. These results were confirmed by DNasefootprinting shown in Figure 4. The binding of T antigen tosite I in mutant dl 4, which retains all contact nucleotides,confers protection of the 9 bp of bacterial DNA replacing thedeleted SV40 site I sequences. Binding to the extensively

3248

II

mEN.3Y

RIM RU

-1 i

-m-

I

T antigen binding and DNA replication mutants

518.0 5190 5200 52105,0 5240 0 2

AAGCTTTI T(;CAAAAGCCTACCCCTCCAAAAAA(;CCTCC-1 CACTACTTCTCGAAM1 ACC1 CA(;A(:(;CC(;A(;(:((;( ( dac1(1(( Al AAA A0 a 0 0 0 0 0 0 0

TTCGAAAAACGTTTTCGGATCCCGAGGTTTTTTCGGAGGAGTGATGAAGACCTTATCGAGTCTCCCGC1'CCGCC(;GAGGCUGAGACG'I'A'I 1 AA A

Hi-d 2BgII

dl 2 5207

dl 3 sdi14 51951dl14 s5204

dl22 5204.

S -1I

5215 -

-~~0

5238 l5243

523%CCI'CGAC.,GCACCTCC

'~kWWWAWVW'---u rn I 5241

d 12 523:P

Fig. 2. Nucleotide sequences of the wild-type and mutant SV40 origin templates used in these studies. The sequence of both strands of the wild-type origin isshown, with the HindIII (base pair 5182) and BgII (base pair 5243) restriction sites marked. The SV40 BBB base pair numbering system is used (Buckman etal., 1980) and the approximate DNase footprint boundaries for each site are indicated by parentheses on the schematic template above the sequence. The solidbars within the parentheses represent the areas where guanine residues are protected from DMS methylation by the D2 protein. The number of the last SV40base pair contained in each deletion mutant is given, and in all deletion mutants the SV40 DNA sequences are abutted to bacterial pBR322 DNA. MutantspIN 43 and pIN 41 contain insertions of 65 bp of bacterial polylinker DNA insertion between binding sites I and II. These two mutants differ only in thejunction between bacterial and SV40 site II sequences. Mutant pIN4 contains a substitution of sequences between base pairs 5220 and 9 (Rio and Tjian,1983).

deleted mutant dl 3 is much less localized but appears to becentered about the single contact hexanucleotide sequencethat remains in this mutant construction (Figure 4). Site Ibinding to mutant dl 2, which contains all contact nucleotidesexcept one, appears normal at the T antigen concentrationsused in this experiment. These experiments establish that se-quences between base pairs 5192 and 5220 are required for therecognition of site I by T antigen; this region includes the se-quences (5191 -5208) of close protein contact determined bymethylation-protection and alkylation-interference ex-periments.

Clearly the filter binding results could be misleading if theinteraction of T antigen with additional binding sites on thetemplate contributes to the retention of the fragment onnitrocellulose filters, since site II sequences are deleted inmutants dl 2 and dl 3 (not bound to the filter) and retained inmutant dl 4 (retained on the filter, Figure 3). In order toassess the contribution of multiple binding interactions to thefilter assay, the interaction of T antigen with an isolated site Ifragment derived from mutant pIN 41 was evaluated usingthe filter-binding technique (site II sequences were removedby nuclease digestion within the linker region between sites Iand II and the site I fragment was purified by gel electro-phoresis). T antigen complexes with the isolated site I

[ 1AI_ (mgnl )

Fig. 3. Filter binding assay of site I mutant origin templates. Various con-

centrations of R284 T antigen were incubated with 5' end-labelled (Hinf-digested) mutant or wild-type DNA fragments for 10 min at 22°C andpassed through nitrocellulose filters. DNA fragments tested were derivedfrom wild-type (wt), dl 4, dl 2, dl 3, and control pBR plasmid DNA (c).

3249

dl 18pIN43.

pIN41-

d123dli1

piN 4A

i

_

sn221- @

K.A.Jones, R.M.Myers and R.Tjian

dl 2 d13

2 3 A 5 6 11 3 4 5 t

dl4 wt

IL UB1%

00.p

dl 3 &

dl 4_ _.

Fig. 4. DNase footprint protection of site I in wild-type and mutant templates by D2 protein. DNA fragments were 5' end-labeled at the Hinf site (base pair5135). The left panel shows the protection patterns for templates dl 2 and dl 3 in each case lane 1 contains guanine sequence markers and lanes 2-6 containthe DNase pattern in the presence of 0 nM, 12 nM, 15 nM, 20 nM and 30 nM of R284 T antigen, respectively. A schematic representation of each templateis presented below the autoradiograms.

fragments were retained by nitrocellulose filters with a 900/oefficiency relative to wild-type fragments containing all threebinding sites (data not shown). These results indicate thatfilter binding is an accurate measure at least of site I binding,and that mutants dl 2 and dl 3 are defective for site I bindingin this assay whereas mutant dl 4 is not.

Binding to site II in the absence of site IWe previously reported that isolated site II sequences are noteffectively bound to nitrocellulose in the presence of T anti-gen even at concentrations exceeding that required for DNasefootprint experiments (Myers et al., 1981b). With this assaywe detected only low levels of specific binding of T antigen orAd2D2 protein to templates lacking site I sequences(including mutants dl 22, dl 18, and dl 23; Figure 2), in-dicating that site II recognition is altered in the absence of siteI. These mutant DNAs were re-examined using the DNasefootprinting technique. Surprisingly, and in contrast with ourresults obtained using the filter-binding assay, specific bind-ing to site II sequences was observed using mutants lackingsite I sequences (Figure 5, dl 22 and dl 18). Wild-type levels ofprotection from DNase digestion were also observed inmutants that contain polylinker DNA insertions that separatebinding sites I and II (Figure 5, pIN 41 and pIN 43), and in-dependent interactions were observed at both sites I and II.

To eliminate the remote possibility that T antigen binding tosite I was able to facilitate binding to site II even across adistance of 65 bp, the binding capacities of these mutantswere re-evaluated after the removal of site I sequences.

Plasmid pIN 41 or pIN 43 was cut at restriction sites in thepolylinker sequence between sites I and II and in the vector

3250

DNA, and the site II fragment was isolated by gel electro-phoresis. The isolated site II fragment was found to bind Tantigen as effectively as a wild-type DNA fragment (Figure6A); an extensive titration of site II binding at lower T antigenconcentrations failed to reveal any significant difference inthe binding affinities of these templates (data not shown). Wealso observed specific site II binding to a fragment containinga larger deletion of sequences on the early side of site II (dele-tion mutant dl 12; Figure 6B), although in this case we cannotrule out the possibility of a relatively small decrease (2- to4-fold) in affinity for site II in the mutant relative to the wild-type template. Therefore, we conclude that the filter-bindingassay is not accurate in the detection of specific site II protein-DNA complexes, and that the DNase protection assay widelyused to monitor binding (Myers et al., 1981b; Tegtmeyer etal. 1983) appears to be unreliable when used to monitor site II

binding because this procedure relies on nitrocellulose filterretention of protein-site II complexes.Binding to site II: effect of binding site mutationsBecause the affinity of T antigen for site II appears to belargely independent of adjacent site I binding, we decided tomap the nucleotides responsible for site II recognition direct-ly, using DNase footprint analysis of DNA fragments con-

taining site II sequence alterations. No specific site II protec-tion was observed using a mutant which contains site I but inwhich 33 bp of site II are substituted by bacterial DNA (mu-tant pIN 4; Figure 7), indicating that nucleotides within thesubstituted region of base pair 5220 to 9 are specifically re-

quired for site II recognition. However, DNA fragments thatcontain either a 4-bp deletion (5239- 5242) or an 8-bp

wt

dl 2

-J

I

I

is-1114D-

AM.

am

::.: do.":tw ..

40 do-40.....

1;.:- MDA 7

l

weIm4m. --

Q-41M.-

qm 4m 400

4m Ift. -..

-..-4m *a -- ,,

""Mo-WAM"W ". %% 4ft ,,qft *ft ftb" ,a

.,

NW ". -..-

T antigen binding and DNA replication mutants

dl 222 3 4

dl18* 3 4

_

I_ 4

a

goose

_

3..'a........I~

FE

to.

Ii

plN43 plN411 2 3 4 2 3 a

I-i

13

ii

sow_

Al-,.

II11 _

_

m .I

_+r I

I

NOLs

I-.:,

WA.

I* .-

I UI.I -.e .

Ws m -w

f o

I ~~~~~~~~~~~~~~~~Ifl ll~~~~~~~~~~~~wt

dl22

d118pIN43 i- -_ _ __ _

pIN41 I

Fig. 5. DNase I footprint analysis of mutant site II templates deleted of site I sequences. DNA fragments were 5' end-labeled on the late strand at the EcoRIsite. Lanes 1-4 show the DNase pattern obtained in the presence of 0 nM, 12.5 nM, 25 nM and 37.5 nM of D2 protein, respectively. A schematic represen-tation of the mutants is presented below the autoradiograms.

substitution (5239- 5246) within site II were found to beunaffected for site II binding (dl 1 and pX 8; Figure 7). Thisresult was surprising because these two mutants disrupt thesymmetry of the 27-bp palindrome central to binding site II.

Nevertheless, both of these mutants contain the 'major' hexa-nucleotide contact sequence identified in interference ex-

periments (Jones and Tjian, 1984). Although the spacing or

sequence of the 'weaker' hexanucleotide contacts is altered inthe mutants, we note that this sequence is directly repeatedand may provide an altemate set of contact nucleotides for Tantigen. The site II binding affinities for these mutants alsoappear to be equal in DNase footprint titrations at lower Tantigen concentrations (data not shown). Finally, a fragmentthat contains only the early half of site II was found to bind Tantigen but confer DNase protection only to the residual siteII sequences (mutant dl A, data not shown), indicating that Tantigen requires sequences within both halves of binding siteII in order to provide the complete footprint protectionobserved for site II in the wild-type template.Replication of mutant plasmids in COS7 cellsThe plasmids used in the binding studies above were testedfor their ability to replicate in COS7 cells, a monkey cell linetransformed with an origin-defective SV40 virus (Gluzman etal., 1980; Gluzman, 1981). COS7 cells produce constitutive

levels of T antigens (Gluzman, 1981) sufficient to allowreplication of plasmids containing the SV40 origin of replica-tion (Myers and Tjian, 1980). Wild-type and mutant originplasmid DNA was introduced into COS7 cells by the DEAE-dextran transfection procedure (McCutchan and Pagano,1968) and small mol. wt. DNA was isolated by the Hirt lysateprocedure (Hirt, 1967) from the cells at 0, 12 and 48 h. Super-coiled and relaxed circular molecules were separated byagarose gel electrophoresis, transferred to nitrocellulose(Southern, 1975), and hybridized to radioactivity-labelledpBR322 DNA. In all cases, trace amounts of input super-coiled and relaxed circular DNA could be seen at 0 h. At 12 hafter transfection, no supercoiled molecules were observedand trace amounts of relaxed circular DNA were present. Inthe case of plasmids containing the wild-type origin (pSV01),a large increase in the amount of supercoiled molecules was

observed at 48 h, indicating that the plasmid replicated. Den-sitometry of autoradiograms was carried out comparing thelevels of pSV01 and mutant supercoiled DNA accumulatingat 48 h in transfected COS7 cells. The results are summarizedin Table I. Mutants dl 4 and dl 22, which lack portions of Tantigen binding site I, replicate at wild-type levels in COS7cells. Mutant dl 18, which lacks binding site I but contains the

region between sites I and II, replicates 4- to 5-fold less effi-

3251

II

i

__-_ '

K.AJones, R.M.Myers and R.Tjian

pIN pINd2183 43 41 rwt.

l 2 3 1 2 3 1 2 3 1 2B. w.t.

G 1 2 34

Ukm-.

w_ _ a

~ ~ ~ ~ a

*? 's l_-ai~

11 11

ad-,_g

abg_iasso-

_ r.aiam.0_ pk_j-_m_0 u

JW;!- ....

Q

-b

....̂ . am m*

"

o0ama

Hg. 6. DNase footprint analysis of mutant site II templates. (A) The DNase pattern for mutant and wild-type SV40 DNA, 5' end-labeled on the early strand.The wild-type DNA fragment was incubated in the absence of D2 protein (wt, lane 1), or with 25 nM D2 protein (lane 2). The site II fragments for mutantspIN 41, pIN 43, and mutant dl 18 were incubated in the absence of D2 protein (lane I in each panel) or at D2 concentrations of 25 nM (lane 2) and 50 nM(lane 3). (B) The DNase I footprint analysis of wild-type and mutant dl 12 DNA fragments in the presence of R284 T antigen at the following concentrations:0 nM (lane 1), 19 nM (lane 2), 28 nM (lane 3) and 57 nM (lane 4).

ciently than wild-type DNA. Mutants pIN 43 and pIN 41,which contain a 65-bp insertion between sites I and II, do notreplicate at all in COS7 cells and no replication of mutants dl23, dl 2, dl 1, X8, pIN 4, or dl A was observed. Thus, most ofbinding site I can be removed without affecting origin func-tion. However, when site I is completely removed, the originis moderately defective. Mutations that remove both site Iand the sequences between sites I and II or that separate sitesI and II by inserted bacterial sequences completely destroy theability of the origin to replicate. Likewise, mutations affec-ting only binding site II destroy origin function.

DiscussionHere we describe the effects of various DNA templatemodifications on the interaction of SV40 T antigen with bin-ding sites I and II at the SV40 origin of replication. While wefind that the nitrocellulose filter-binding and DNase footprintprotection assays are equally suited for the analysis of site Ibinding, we observe no specific nitrocellulose filter retentionof T antigen-site II complexes in the absence of binding site I.

The observation that deletion mutant dl 23 (Figure 2) is notretained on nitrocellulose filters in the presence of T antigen(Myers and Tjian, 1980) originally led to the conclusion thateither sequences within site I or the binding of T antigen tosite I promotes binding to site II, possibly in a manner consis-tent with positive cooperativity as observed in the binding of Xrepressor to adjacent binding sites at the ORM operator. Herewe report that specific site I binding, apparently identical to

3252

the site II binding interactions observed with wild-typetemplates can be detected in the absence of site I sequenceswhen the DNAse footprint assay is used (mutants dl 18, 41,43, dl 22; Figures 5, 6). We also observe the formation of Tantigen-site II complexes with deletion mutant dl 22 using animmunoaffinity assay (Jones and Tjian, 1984) and the site II-T antigen complex can also be detected using the filter bind-ing assay if antibody directed against T antigen is present inthe binding reaction (data not shown). These findings suggestthat binding to sites I and II are independent events in vitro,and that T antigen contacts specific sequences within eachbinding site. We note that DNase footprint analysis of themore extensively deleted mutants dl 23 and dl 12 does not ruleout the possibility of a relatively small effect on binding dueto deletion of sequences between the two binding sites and,moreover, we have not eliminated the possibility of interac-tions between T antigen multimers bound at sites I and II thatdo not contribute to the binding affinity. Similar observationsconcerning the binding to site II in the absence of site I se-quences have been reported by others (DiMaio and Nathans,1982; Tenen et al., 1983).The deletion analysis presented here indicates that site I

binding is diminished or less specific in the absence of se-quences between base pairs 5192 and 5220. The late boundaryis established from the isolated site I fragment of mutant pIN41, which appears to have an unaltered affinity for site I whenassayed by filter-binding. These sequences contain the close Tantigen contacts as defined by methylation-protection (Tjian,

A.

ll

d112/ 1 2 3 4 G

_4 'an

4 _a

_m _

lof

11

- -

--_g_b_WOqf

T antigen binding and DNA replication mutants

plN4 X8 wt

I

11

a

a-

III

piN 4

Fig. 7. DNase footprint analysis of mutant site II templates. Wild-type and mutant dl-l DNA templates, 5' end-labeled at the early strand, were incubatedwith D2 protein at concentrations of 0 nM, 15 nM, 3 nM, 45 nM and 60 nM (left panel, lanes 1-5, respectively). The right panel shows the DNase footprintpattern of mutants pX8, pIN4, and the wild-type template in the presence of 0 nM, 20 nM, 40 nM and 60 nM of D2 protein (lanes 1-4, respectively).

Table I. Mutant plasmid replication in COS7 cells

DNA % wild-type replication

pSVo1 100

dl2 n.d.

dl 3 n.d.

dl 4 100

dl 22 100

dl 18 20-25

pIN 43 <0.5

pIN 41 <0.5

dl 23 <0.5

dl 12 <0.5

dl I <0.5

X8 <0.5

pIN 4 <0.5

dA <0.5

1978) and by alkylation-interference (Jones and Tjian, 1984).DNase footprint analysis of the site II substitution mutantpIN 4 indicates that sequences between base pairs 5220 and 9are important for specific binding of T antigen. Binding tomutants dl 1 and pX 8, which contain alterations internal tobinding site II, indicates that the essential sequences are not

contained within base pairs 5239 to 3 and must thereforereside at the early side and/or late side of this region. Deletionof late side sequences to base pair 5241 (mutant dl A) altersthe footprint boundary of site II, but does not affect the af-finity of T antigen for site II. Therefore, we conclude that Tantigen recognizes contacts in both early and late portions ofthe binding site II palindrome. This conclusion is confirmedby the results of interference experiments which indicate thatbase pairs 5232 to 5237 and 5243 to 5 are in direct contactwith the protein complex at site II (Jones and Tjian, 1984).Although the latter set of nucleotide contacts are partiallysubstituted in mutant pX 8 and the spacing between the twosets of contacts is severely altered in mutant dl 1, the identicalsequence is directly repeated from base pairs 6 to 11.Regardless of the actual contacts made in these mutants, it isclear that the symmetry of the palindrome at binding site II isnot required for recognition by T antigen.We have also characterized the replication efficiency in

monkey (COS7) cells of plasmids containing mutant originsequences. In agreement with previous reports (Shortle andNathans, 1979) we find that the two site I deletion mutants(dl 4, dl 22) replicate with approximately wild-type efficiency(Table I). Surprisingly, all deletions that extend beyond basepair 5205 are deficient in replication, even though most ofthem appear to be capable of the normal T antigen-site II in-teraction. Clearly, the binding of T antigen to site II is not initself sufficient for DNA replication. The replication-positivemutant, dl 22, contains all of the sequences previously map-

3253

wt dl 1

1 2 3 4511 2 34 5

1

11

11

I_ _ -,__om--

.,o

040 w4

11

i .

m

_ .

____-

wt

dl 1

11

X8 1*-

I

a I

I

I

Il

K.A.Jones, R.M.Myers and R.Tjian

ped to the SV40 minimal origin (base pairs 5208-30; Learn-ed et al., 1981; Myers and Tjian, 1980; DiMaio and Nathans,1980). The binding of T antigen to site I in mutant dl 22 ischaracterized by a weak affinity and produces a severely trun-cated reigon of DNase protection (determined both by DNasefootprinting and alkylation-interference techniques) in-dicating that complete site I binding is not required forreplication but, rather, that sequences in the region of basepairs 5205 -5221 are critical for viral DNA replication. It isinteresting in this regard that the origin of bidirectionalreplication in vivo has also been mapped to this region (basepairs 5210-5211; Hay and DePamphilis, 1982). In addition,the major initiation sites for Okazaki fragment synthesis mapto nucleotides 5239 and 12 on the early mRNA strand withinT antigen binding site II (Hay and DePamphilis, 1982). It ispossible that the replicative failure of site II mutants dl 1 andpX 8 is due to the absence of appropriate primer initiation se-quences in both mutants.

Finally, we note that mutants in which binding sites I andII are separated by 65 bp are replication-deficient in COS7cells (pIN 41, pIN 43; Table I). Because these mutants bind Tantigen at both sites with wild-type affinities, we concludethat the altered spacing between base pairs 5205 and 5212 insite I and essential sequences in site II somehow disrupts thenormal replication process. Recently, these insertion mutantswere also found to be defective in vitro in the repression oftranscription by T antigen (Rio and Tjian, unpublishedresults). Therefore, interactions between T antigen multimersbound at each site may contribute to the mechanism of auto-regulation, although the data presented here indicate thatdirect protein-protein interactions do not contribute signifi-cantly to the affinity of T antigen for each binding site.

Materials and methodsRestriction enzymes and nuclease Bal31 were purchased from BethesdaResearch Laboratories. T4 polynucleotide kinase was from P-L Biochemicalsand DNase I was from Worthington.Construction of plasmids containing wild-type and mtuant SV40 origin se-quencesThe 31 l-bp EcoRII G fragment of SV40 was inserted at the EcoRI site ofpBR322 (Myers and Tjian, 1980), creating plasmid pSVOI, the wild-typeorigin plasmid used in the replication studies. A plasmid containing thesetandem copies of the EcoRII G fragment, pSVO7, was used in the bindingstudies. Construction of deletion mutants dl 1, dl 4, dl 22, dl 23, and dl 12 hasbeen previously described (Myers and Tjian, 1980), and the creation ofsubstitution mutant pIN 4 was detailed by Rio and Tjian (1983). Mutant dl Awas created by Bal31 digestion of plasmid pSV1096 cut at a HinclII site withinsite III; this mutant is lacking sequences from base pair 5241 to 52. MutantpX 8 was a gift from Michael Fromm and Paul Berg (Fromm and Berg,1982). Insertion mutants pIN 41 and pIN 43 were constructed as follows: afragment containing all of site I and 65 bp of bacterial DNA at the site II pro-ximal side of site I was isolated from insertion mutant pIN 1 (Myers et al.,1981b) by cutting the polylinker sequence with BamHI, trimming the endswith nuclease Bal3J, followed by complete digestion with EcoRI. A vector forthis insert was generated by cutting plasmid pSV01097 (a plasmid containingthe origin fragment from CS1097; Shortle and Nathans, 1979) with HindIIIand treating with nuclease Bal31 to remove site I sequences, followed byEcoRI digestion. The ligated plasmid forms the sequence site I -bacterialDNA -site II-site III, as diagrammed in Figure 2. Viral and plasmid DNAswere purified by a modified Hirt extraction (Hirt, 1967), followed by CsClethidium bromide gradient centrifugation. Ethidium was removed withDowex AG 50W-X8 resin in 10 mM Tris, pH 7.9, 1 mM EDTA and 1 MNaCl and the samples were dialyzed extensively against 10 mM Tris 7.9, andI mM EDTA at 4°C.Purification of T antigenWe have used two sources of T antigen in the binding studies reported here,both derived from HeLa cells infected with defective adenovirus-SV40 hybridviruses. The Ad2+D2 virus encodes a 107-K protein that is the functionalequivalent of SV40large T antigen (DeLucia et al., 1983) consisting of - 10 K

3254

of an adenovirus polypeptide at the amino terminus (Hassell et al., 1978). TheAd-SVR284 hybrid virus produces full-length T antigen (Thummel et al.,1983). Both proteins were purified to homogeneity by the method of Tjian(1978), and were stored at 4-6 mg/ml concentrations in 10 mM Tris, pH 8,0.5 M, NaCl, 0.2 mM dithiothreitol, 10% glycerol at - 80°C. The source ofT antigen used for each experiment is indicated in the individual figurelegends.DNA-binding protocolsThe nitrocellulose filter-binding assay has been described (Myers and Tjian,1980). Origin-containing fragments were 5' end-labeled with [7y-32P]ATP andpolynucleotide kinase and purified by agarose or polyacrylamide gel electro-phoresis for use in footprinting experiments. The restriction site in the pro-cedure is indicated in the individual figure legends. Approximately 10- 13 mol(150 ng) of each fragment was incubated with various concentrations of D2protein in 100 i1 25 mM 1,4-piperazinediethanesulfonic acid (Pipes), pH 6.8,0.1 M NaCl, 10% glycerol, 10 jug/ml BSA (5 min, 22°C) and cut 60 s with3 ng DNase I in 15mM MgCl2, 100mM CaCI. The digestion was terminated bythe addition of 200 /l 2 M ammonium acetate, 100 mM EDTA and150 jzg/ml sonicated calf thymus DNA, and the DNA was precipitated with2.5 volumes of ethanol. DNA pellets were resuspended in 200 Al 2.5 M am-monium acetate and reprecipitated from ethanol. After drying, the pelletswere resuspended in 25 mM NaOH and 75% formamide, heated for 2 min at100°C and subjected to polyacrylamide gel electrophoresis (8-16%acrylamide, 19:1 acrylamide:bisacrylamide). The gels were analyzed byautoradiography for 8-24 h at -80°C using an X-ray intensifer screen.DNA replication assayThe protocol followed in the analysis of plasmid replication in COS cells isoutlined by Myers and Tjian (1980). COS7 cells, a monkey cell line con-stitutively producing SV40 T antigen, were kindly provided by Yakov Gluz-man.

AcknowledgementsWe thank Dan DiMaio and Dan Nathans for providing cs1097 viral DNA andfreely discussing unpublished data, Michael Fromm and Paul Berg forplasmid pX 8, and Don Rio for mutant pIN 4 DNA. We also thank CarlThummel and Terri Grodzicker for Ad-SVR284 viral stocks, and Robin Clarkfor assistance in the purification of R284 T antigen. We are grateful to KarenErdley for typing this manuscript. This work was funded by a National In-stitute of Environmental Health Sciences Center grant. K.A.J. was the reci-pient of a postdoctoral fellowship from the National Institutes of Health.

ReferencesBradley,M.K., Griffin,J.D. and Livingston,D.M. (1982) Cell, 28, 125-134.Buckman,A.R., Burnett,L. and Berg,P. (1980) in Tooze,J. (ed.), DNATumor Viruses, Part II, Cold Spring Harbor Laboratory Press, NY, pp.799-829.

DeLucia,A.L., Lewton,B.A., Tjian,R. and Tegtmeyer,P. (1983) J. Virol.,46, 143-150.

DiMaio,D. and Nathans,D. (1980) J. Mol. Biol., 140, 129-142.DiMaio,D. and Nathans,D. (1982) J. Mol. Biol., 156, 531-548.Fromm,M. and Berg,P. (1982) J. Mol. Appl. Genet., 1., 457-481.Galas,D.J. and Schmitz,A. (1978) Nucleic Acids Res., 5, 3157-3170.Giacherio,D. and Hager,L.P. (1979) J. Biol. Chem., 254, 8113-8116.Gluzman,Y. (1981) Cell, 23, 175-182.Gluzman,Y., Sambrook,J.F. and Frisque,R.J. (1980) Proc. Natl. Acad. Sci.

USA, 77, 3898-3902.Hansen,U., Tenen,D.G., Livingston,D.M. and Sharp,P.A. (1981) Cell, 27,

603-612.Hassell,J.A., Lukanidin,E., Fey,G. and Sambrook,J. (1978) J. Mol. Biol.,

120, 209-247.Hay,R.T. and DePamphilis,M.L. (1982) Cell, 28, 767-779.Hirt,B. (1967) J. Mol. Biol., 26, 365-369.Jones,K.A. and Tjian,R. (1984) Cell, 36, 155-162.Lane,D.P. and Crawford,L.V. (1979) Nature, 278, 261-263.Learned,R.M., Myers,R.M. and Tjian,R. (1981) in Ray,D.S. and Fox,C.F.

(eds.), ICN-UCLA Symposium on Molecular and Cellular Biology, Vol.21, Academic Press, NY, pp. 555-566.

Lewton,B.A., DeLucia,A.L. and Tegtmeyer,P. (1984) J. Virol., 49, 9-13.Linzer,D.I.H. and Levine,A.J. (1979) Cell, 17, 43-52.Margolskee,R.F. and Nathans,D. (1984) J. Virol., 49, 386-393.McCormick,F. and Harlow,E. (1980) J. Virol., 34, 213-224.McCutchan,J.H. and Pagano,J.S. (1968) J. NatI. Cancer Inst., 41, 351-356.McKay,R.D.G. (1981) J. Mol. Biol., 145, 471-488.McKay,R. and DiMaio,D. (1981) Nature, 289, 810-813.Myers,R.M. and Tjian,R. (1980) Proc. Natl. Acad. Sci. USA, 77, 6491-

6495.

T antigen binding and DNA replication mutants

Myers,R.M., Kligman,M. and Tjian,R. (1981a) J. Biol. Chem., 256, 10156-10160.

Myers,R.M., Rio,D.C., Robbins,A.K. and Tjian,R. (1981b) Cell, 25, 373-384.

Myers,R.M., Williams,R.C. and Tjian,R. (1981c) J. Mol. Biol., 148, 347-353.Osborn,M. and Weber, K. (1975) J. Virol., 15, 636-644.Rio,D.C. and Tjian,R. (1983) Cell, 32, 1227-1240.Rio,D., Robbins,A., Myers,R. and Tjian,R. (1980) Proc. Nat!. Acad. Sci.USA, 77, 5706-5710.

Shortle,D. and Nathans,D. (1979) J. Mo!. Biol., 131, 801-817.Shortle,D.R., Margolskee,R.F. and Nathans,D. (1979) Proc. Nat!. Acad.

Sci. USA, 77, 5706-5710.Southern,E.M. (1975) J. Mol. Biol., 26, 365-369.Tegtmeyer,P. (1975) J. Virol., 15, 613-618.Tegtmeyer,P., Anderson,B., Shaw,S.B. and Wilson,V.G. (1981) Virology,

115, 75-87.Tegtmeyer,P., Lewton,B.A., DeLucia,A.L., Wilson,V.G. and Ryder,K.

(1983) J. Virol., 46, 151-161.Tenen,D.G., Haines,L.L. and Livingston,D.M. (1982) J. Mol. Biol., 157,

473-492.Tenen,D.G., Taylor,T.S., Haines,L.L., Bradley,M.K., Martin,R.G. and

Livingston,D.M. (1983) J. Mol. Biol., 168, 791-808.Thummel,C., Tjian,R., Hu,S.-L. and Grodzicker,T. (1983) Cell, 33,455-464.Tjian,R. (1978) Cell, 13, 165-179.Tjian,R. (1979) Cold Spring Harbor Symp. Quant. Biol., 43, 655-662.Tjian,R. (1981) Cell, 26, 1-2.Tjian,R. and Robbins,A. (1979) Proc. Nat!. Acad. Sci. USA, 76, 610-614.Tjian,R., Robbins,A. and Clark,R. (1980) Cold Spring Harbor Symp. Quant.

Biol., 44, 103-111.Tooze,J. (1981) Molecular Biology of Tumor Viruses, 2nd ed., DNA Tumor

Viruses, published by Cold Spring Harbor Laboratory Press, NY.Wilson,V.G., Tevethia,M.J., Lewton,B.A. and Tegtmeyer,P. (1982) J.

Virol., 44, 458-466.

Received on 8 August 1984; revised on 28 September 1984

3255