Proc. Natl. Acad. Sci. USAVol. 86, pp. 4445-4449, June 1989Biochemistry

Murine muscle-specific enolase: cDNA cloning, sequence,and developmental expression

(enolase isozymes/sequence conservation/myogenesis)

NOEL LAMANDO*, ALEXANDER M. MAZO*, MARGUERITE LUCAS*, DIDIER MONTARRASt, CHRISTIAN PINSETt,FRANCOIS GROS*, LUCIENNE LEGAULT-DEMARE*, AND MONIQUE LAZAR**Laboratoire de Biochimie Celiulaire, College de France, 11, Place Marcelin Berthelot, 75231 Paris Cedex 05, France; and tInstitut Pasteur, 25, Rue du Dr.Roux, 75724 Paris Cedex 15, France

Communicated by Paul A. Marks, March 27, 1989

ABSTRACT In vertebrates, the glycolytic enzyme enolase(EC 4.2.1.11) is present as homodimers and heterodimersformed from three distinct subunits of identical molecularweight, a, 13, and y. We report the cloning and sequencing ofa cDNA encoding the ,B subunit of murine muscle-specificenolase. The corresponding amino acid sequence shows >80%homology with the ,B subunit from chicken obtained by proteinsequencing and with a and y subunits from rat and mousededuced from cloned cDNAs. In contrast, there is no homologybetween the 3' untranslated regions of mouse a, /3, and yenolase mRNAs, which also differ greatly in length. The short3' untranslated region of ,B enolase mRNA accounts for itsdistinct length, 1600 bases. It is known that a progressivetransition from aa to .8B8 enolase occurs in developing skeletalmuscle. We show that this transition mainly results from adifferential regulation of a and .8 mRNA levels. Analysis ofmyogenic cell lines shows that /8 enolase gene is expressed at themyoblast stage. Moreover, transfection of premyogenicC3H1OT½2 cells with MyoD1 cDNA shows that the initialexpression of/ transcripts occurs during the very first steps ofthe myogenic pathway, suggesting that it could be a markerevent of myogenic lineage determination.

In higher organisms the glycolytic enzyme enolase (2-phospho-D-glycerate hydro-lyase; EC 4.2.1.11) is found ashomodimers and heterodimers formed from three distinctsubunits of identical molecular weight, a, p, and y (1, 2). Inadult tissues, the a subunit is found in many cell types, butthe y and p subunits are specifically expressed in neurons andmuscle cells, respectively (2, 3).aa enolase predominates in the early embryo. In skeletal

muscle, it remains the major form until the perinatal periodwhen a progressive switch from aa to 3/,8 enolase occurs inparallel with the maturation of muscle tissues (3, 4). In adultskeletal muscie, p,8 enolase molecules account for almost allof the enolase activity (3-5), and immunohistochemical anal-ysis has shown that the p subunit is mainly located in type IIfibers (6). In contrast, significant amounts of ubiquitous aaenolase are maintained in adult cardiac and smooth muscles(3). Expression of ,pp enolase seems to be correlated with thefunctional state of muscle tissue (3) and is also considered tobe under neural control (3, 7). Thus, denervation causes adecrease in the rate of synthesis of enolase and other glyco-lytic enzymes (7, 8). Fetal-like patterns of muscle enolases insome neuromuscular disorders have also been reported (9).Consequently, studies on the molecular mechanisms that

control the differential expression of a and p enolase genesshould provide important data concerning the maturation of

muscle cells and their functional capacity in normal andpathological adult tissues.The amino acid sequence of p,8 enolase purified from

chicken skeletal muscle has recently been elucidated (10),confirming that the sequence has been strongly conserved. Italso appears that developmental expression of the /3 subunitis correlated with levels of the corresponding translatablemRNA (11).

Further analysis requires /3 enolase cDNA probes. Wedescribe here the isolation ofa partial-length cDNA clone formurine p enolase mRNA by cross-hybridization with acDNAfor a enolase mRNA previously cloned from mouse brain(12). The 3 cDNA was sequenced, and both the a and 3cDNA probes were used to analyze developmental expres-sion of the corresponding mRNAs in vivo as well as incultured cells.t

MATERIALS AND METHODSScreening of a Skeletal Muscle cDNA Library from Mouse.

A cDNA library from hind thigh muscle of 12-day-old mice(13) was kindly provided by D. P. Leader (University ofGlasgow). It was screened forl enolase sequences by usingthe nick-translated mouse a enolase 1800-base-pair (bp)cDNA insert from pBE a6 and a 250-bp fragment excisedfrom its 325-bp 3' untranslated region (3' UTR) (12).Sequence Analysis. Sequencing of the cDNA insert from

pBE ,B1 was performed according to Maxam and Gilbert (14)and completed by the dideoxy chain-termination method (15)using appropriate synthetic oligodeoxynucleotides as prim-ers. Each segment of the sequence was determined at leasttwice on both strands. A consensus sequence was compiledand analyzed with the computer programs ofStaden (16). Thenucleotide sequence of the pBE .1 insert was compared withother enolase sequences by using (i) published data for rat aand y enolase cDNAs (17) and (ii) unpublished data formurine a and 'y enolase cDNAs (N.L., M.L., F.G., L.L.-D.,M.L., M. Khagad, and D. Caput).

Preparation and Source of RNAs. Total RNA from murineskeletal muscle at various stages of development, kindlyprovided by Ian Garner (Institut Pasteur, Paris), was pre-pared according to Chirgwin et al. (18). Total RNA fromcultured cells was obtained as described (19) from the fol-lowing: (i) the permissive myogenic C2.7 cell line and aC2.7-derived "inducible" variant previously described (19);(ii) the embryonic C3H1OTY2 cell line (20) obtained from H.Arnold (Medical School, University of Hamburg, F.R.G.);(iii) the myogenic T4 clone derived from 5-azacytidine-treated C3H10TYV cells according to Konieczny and Emerson

Abbreviations: E, embryonic day; P, postnatal day; 3' UTR, 3'untranslated region.MThe sequence reported in this paper has been deposited in theGenBank data base (accession no. M20745).

4445

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Janu

ary

11, 2

020

4446 Biochemistry: Lamandd et al.

(21); (iv) the myogenic 2.5 clone isolated by transfection ofC3H1OTY2 cells with the plasmid vector pVZClla carryingMyoDi cDNA (22) and a plasmid carrying the neomycin-resistance gene pRSV-Neo (23).RNA Blot Hybridization Analysis. Denaturation, electro-

phoresis, transfer of total RNA onto GeneScreenPlus mem-branes (NEN), and hybridization conditions were as de-scribed (24). Washes were performed in 0.1 x SSC (1x SSC= 0.15 M NaCI/0.015 M sodium citrate, pH 7)/0.1%NaDodSO4 at 60'C. The nick-translated 32p probes were asfollows: (i) the entire 1200-bp insert from pBE (1; (ii) a1200-bp fragment excised from the pBE a6 insert (12) includ-ing 84% of the coding sequence of a enolase mRNA; (iii) acDNA fragment specific for the 3' UTR of a enolase mRNA(see "screening of library" above). A cDNA fragment spe-cific for the 3' UTR of mouse a actin mRNA (25) was labeledwith [a-32P]dCTP by random primer extension. The amountsof specific mRNAs on the blots were determined by densi-tometric scanning of autoradiograms, as described (24).

Preparation of Mouse DNA and Southern Analysis. DNA>100 kilobases (kb) in size was prepared from BALB/cmouse spleens. The tissue was crushed to a fine powderunder liquid nitrogen and the following steps were carried outas described (26). After digestion with restriction enzymes(Boehringer Mannheim) and electrophoresis, DNA frag-ments were transferred to a GeneScreenPlus membrane asspecified by the supplier's protocol (NEN). Hybridizationwas performed at 65°C according to Maniatis et al. (27).cDNA from pBE P1 (Fig. 1), labeled by [a-32P]dCTP to aspecific activity of 109 cpm/,ug by random primer extension,was used as a probe. Blots were washed under high strin-gency conditions (0.1 x SSC/0.1% NaDodSO4 at 75°C).

RESULTSIsolation of cDNA Clones for (3 Enolase mRNA. A cDNA

library from skeletal muscle of 12-day-old mice was screenedby using cDNA probes for mouse a enolase mRNA asdescribed in Materials and Methods. The library was ex-pected to contain both a and l3 enolase sequences (3).

Accordingly, colony hybridization using a cDNA probe forthe entire length of mouse a mRNA revealed strongly andweakly positive signals, probably corresponding to a and ,8recombinants, respectively. Indeed, with a second cDNAprobe specific for the 3' UTR of a mRNA, only the stronglypositive clones yielded a hybridization signal. The nonreac-tive clones were thus selected as putative (3 enolase clones.The clone containing the longest insert (1200 bp), designatedpBE P1, was used for further analysis.

Sequence Analysis of P Enolase cDNA. As shown in Fig. 1,the pBE P1 insert included the entire 78-bp 3' UTR and a1128-bp coding region specifying 376 amino acids-i.e.,about 87% of the expected length of the mouse 3 enolasesubunit (5, 10, 28). The deduced amino acid sequence showed86% homology with the chicken muscle (3 enolase sequencebetween glycine 58 and lysine 433 (10), the differences inamino acids being scattered along the sequence rather thanclustered in small regions. Arginine 414 and histidine 191, tworesidues suggested to be involved in substrate and Mg2+binding, respectively (29), were found at the expected posi-tion in the mouse ( sequence (Fig. 1).A homology of 83% at the amino acid level and of 78% at

the nucleotide level was also found with the coding regionsboth of a and 'y enolase cDNAs from rat. In contrast, theshort 3' UTR of mouse ,3 enolase cDNA showed no signifi-cant homology with the longer 3' UTR of rat a and y cDNAs(17). Similar results were obtained by using mouse a and yenolase cDNAs for sequence comparisons (see Materials andMethods, "sequence analysis") in agreement with our col-ony hybridization data.RNA Gel Blot and Southern Blot Analyses. Blot hybridiza-

tion of total RNA from skeletal and cardiac muscles, usingpBE (1 cDNA as a probe, revealed a single sequence of 1600bases corresponding to mouse ( enolase mRNA. In agree-ment with the muscle-specific expression of P enolase sub-unit (3), this sequence was undetectable in brain and liver(Fig. 2A). It was also clearly shorter than a enolase mRNA(Fig. 3B).

Southern blots of mouse DNA probed with pBE ,81 cDNAshowed simple band patterns suggesting that there is a single

GGG AAA GGA GTG CTG AAG GCT GTG GM CAC ATC AMC AAG ACT CTA GGT CCT GCT CTG CTG GAA AAG MA CTA AGT GTT GTG GAT CM GAA 90Gly Lys Gly Val Leu Lys Ala Val Glu His Ile Asn Lys Thr Leu Gly Pro Ala Leu Leu Glu Lys Lys Leu Ser Val Val Asp Gln Glu

AM GTT GAC AAG TTC ATG ATT GAG CTG GAC GGG ACC GAG AAT AAG TCC MG TTT GGG GCC AAC GCC ATC CTG GGT GTG TCC CTG GCT GTC 180Lys Val Asp Lys Phe Met Ile Glu Leu Asp Gly Thr Glu Asn Lys Ser Lys Phe Gly Ala Asn Ala Ile Leu Gly Val Ser Leu Ala ValTGC AAG GCT GGA GCA GCT GAG MA GGG GTC CCT CTC TAC CGA CAC ATC GCA GAT CTT GCA GGC MT CCC GAC CTC GTA CTC CCT GTG CCT 270Cys Lys Ala Gly Ala Ala Glu Lys Gly Val Pro Leu Tyr Arg His Ile Ala Asp Leu Ala Gly Asn Pro Asp Leu Val Leu Pro Val Pro

GCC TTT AAT GTG ATC AMC GGC GGC TCT CAT GCT GGA AAC AAG CTG GCC ATG CAG GAG TTC ATG ATT CTG CCA GTG GGA GCC AGC TCT TTC 360Ala Phe Asn Val Ile Asn Gly Gly Ser His Ala Gly Asn Lys Leu Ala Met Gln Glu Phe Met Ile Leu Pro Val Gly Ala Ser Ser Phe

AAG GAA GCC ATG CGC ATC GGC CCT GAG GTC TAC CAC CAC CTC AAG CGG GTC ATC MG GCC AAG TAT GGG AAG GAC GCC ACC MC GTG GGG 450Lys Glu Ala Met Arg Ile Gly Ala Glu Val Tyr H' His Leu Lys Gly Val Ile Lys Ala Lys Tyr Gly Lys Asp Ala Thr Asn Val GlyGAT GAG GGT GGC TTT GCA CCC AAC ATC CTG GAG AAC AMT GAG GCC CTG GAG CTG CTA AAG ACA GCC ATC CAG GCC AAC GCT TAC CCG GAC 540Asp Glu Gly Gly Phe Ala Pro Asn Ile Leu Glu Asn Asn Glu Ala Leu Glu Leu Leu Lys Thr Ala Ile Gln Ala Asn Ala Tyr Pro AspAAG :;TG GTG ATC GGC ATG GAT GTA GCT GCG TCT GAA TTC TAC CGC AAC GGC AAG TAT GAT CTG GAC TTC MG TCA CCC GAT GAC CCT GCC 630Lys Val Val Ile Gly Met Asp Val Ala Ala Ser Glu Phe Tyr Arg Asn Gly Lys Tyr Asp Leu Asp Phe Lys Ser Pro Asp Asp Pro Ala

AGG CAC ATC AGT GGG GAG MG CTT GGG GAG CTG TAC AAG AAC TTC ATC CAG AAC TAT CCC GTG GTC TCC ATT GAG GAC CCC TTT GAC CAG 720Arg His Ile Ser Gly Glu Lys Leu Gly Glu Leu Tyr Lys Asn Phe Ile Gln Asn Tyr Pro Val Val Ser Ile Glu Asp Pro Phe Asp Gln

GAT GAC TGG GCC ACA TGG ACC TCA TTC CTC TCT GGG GTG GAC ATC CAG ATT GTG GGA GAT GAC CTC ACG GTA ACC AAC CCC AAG AGG ATT 810Asp Asp Trp Ala Thr Trp Thr Ser Phe Leu Ser G1Y Val Asp Ile Gln Ile Val Gly Asp Asp Leu Thr Val Thr Asn Pro Lys Arg IleGCT CAG GCT CTO GAG AAG AAG GCC TGC AMT TGC CTG CTC CTG AAG GTC AAC CAG ATC GGC TCC GTG ACG GAG TCC ATC CAG GCC TGT MA 900Ala Gln Ala Val Glu Lys Lys Ala Cys Asn Cys Leu Leu Leu LYs Val Asn Gln Ile Gly Ser Val Thr Glu Ser Ile Gln Ala Cys LysCTT GCA CM TCT AAT CGC TOG GGA GTG ATG GTG AGC CAC CCC TCT CGC GAG ACC GM GAC ACT TTC ATC GCT GAC CTT GTG GTG GGA CTC 990Leu Ala Gln Ser Asn Gly Trp Gly Val Met Val Ser His Arg Ser Gly Glu Thr Glu Asp Thr Phe Ile Ala Asp Leu Val Val Gly Leu

TGC ACA GGA CAG ATC AAG ACT GGT GCT CCC TGC CGT TCA GAG CGT CTG GCA AAA TAC MC CAG CTT ATG AGG ATT GAG GAG GCT CTT GGG 1080Cys Thr Gly Gln Ile Lys Thr Gly Ala Pro Cys Arg Ser Clu Arg Leu Ala Lys Tyr Asn Gln Leu Met Ajg Ile Glu Glu Ala Leu GlyGAC AAA GCT GTC TTT GCT GGA AC AAG TTC CGT AAT CCA AAG GCC AAA TGA GGAGCTGGAC.ACTCCAGGCTTTCACAGGAAAGACACAGGCGTTCMGCCCT 1182Asp Lys Ala Val Phe Ala Gly Arg Lys Phe Arg Asn Pro Lys Ala Lys *

TCTCCCAGAAATAAACACTGCCAAACC (A)

FIG. 1. Nucleotide and deduced amino acid sequences of the pBE ,81 insert. Nucleotides are numbered in the 5' -3' direction. Amino acidresidues differing from chicken skeletal muscle (,3( enolase are underlined. Arrowheads indicate the histidine and arginine residues possiblyinvolved in Mg2+ and substrate binding, respectively. The poly(A) signal is underlined twice.

Proc. Natl. Acad. Sci. USA 86 (1989)

Dow

nloa

ded

by g

uest

on

Janu

ary

11, 2

020

Proc. Nadl. Acad. Sci. USA 86 (1989) 4447

B

16_

10_

7.6_

6.2. ' 4

A 5.1.-.

4.2-

1.6.. c

2.4_

2.-

1 2 3 4 1 2 3

FIG. 2. RNA gel blot and Southern blot analyses. (A) Fourmicrograms of total RNA from mouse adult skeletal muscle (lane 1),cardiac muscle (lane 2), brain (lane 3), and liver (lane 4) waselectrophoresed, transferred to GeneScreenPlus membranes, andhybridized with 32P-labeled pBE (1 insert. mRNA size is expressedin kb. (B) Twenty micrograms each ofHindlIl- (lane 1), BamHI- (lane2), and EcoRl- (lane 3) digested mouse DNA was run on a 0.6%agarose gel, transferred to GeneScreenPlus membranes, and hybrid-ized with 32P-labeled pBE (1 insert. Size markers are indicated in kb.

,B enolase gene in the mouse genome (Fig. 2B). Evidence hasalso been obtained from Southern blot analysis and genomiccloning that a, (3, and y enolase subunits are encoded by threedistinct genes (data not shown).

Developmental Expression of .8 and a Enolase mRNAs inSkeletal Muscle. A large increase in ( enolase mRNA oc-curred between E20 and P60 (Fig. 3A) coinciding with musclematuration, as indicated by the accumulation of skeletal actintranscripts (Fig. 3D). In contrast, the level of a enolasemRNA was weakly modulated and reached a minimal valueat P60 (Fig. 3C). Although the a and , probes were of similarlength and specific radioactivity, the time required to visu-alize ca mRNA was 6-fold longer than for ( mRNA (Fig. 3 A

(Days) E20 P0 P4 P60A '12' 234' 7 8'9

gl e S*@ 1.6

B

C_1.8

D*.* a a a a a1.B

FIG. 3. RNA gel blot analysis of 8 and a enolase mRNAs and aactin mRNA at various stages of development of mouse skeletalmuscle. For each panel, lanes 1, 3, 5, and 7 and lanes 2, 4, 6, and 8correspond to 2 ;&g and 4 ,ug, respectively, of total RNA. Hybrid-ization probes were as follows: pBE ,81 insert (A), a cDNA fragmentincluding part of the coding region ofa mRNA (B), cDNA fragmentsspecific for the 3' UTR of a enolase and a actin mRNAs (C and D,respectively). Exposure times of autoradiograms were different foreach mRNA; thus direct comparison between band intensities can bemade only within each panel. RNA sizes are indicated in kb. E,embryonic day; P, postnatal day.

and B). Furthermore, under the high stringency conditionsused, cross-hybridization was visible between the a probeand (3 mRNA (Fig. 3B) but not between the P probe and amRNA (Fig. 3A). Both of these observations suggest thatduring the developmental period examined, 8 enolase tran-scripts are considerably more abundant than a enolase tran-scripts.

Expression of 13 Enolase Transcripts Occurs at the MyoblastStage. Expression of (3 enolase transcripts was investigated inpermissive and inducible C2.7 myoblasts (19), in C3H1OT1/2cells, and in the myogenic derivatives of the latter. Fig. 4 band c show that (3 enolase mRNA was present in proliferatingand quiescent myoblasts and accumulated when terminaldifferentiation occurred. This clearly contrasts with skeletalactin transcripts, which were detected only in differentiatedcells (Fig. 4d). As a premyogenic candidate we usedC3H1OTY2 cells that can be converted into myoblasts eitherby treatment with DNA hypomethylating agents (T4 cells)(21, 30) or by transfection with MyoD1 cDNA (2.5 cells) (22).Fig. 4b shows that (3 enolase transcripts were undetectable ineither proliferating or quiescent C3H1OTYz cells, even after alonger exposure time (Fig. 4c). Interestingly, ( enolasemRNA was already present in proliferative T4 and 2.5 cells(Fig. 4 b and c). Fig. 4a shows that transcripts ofthe a enolasesubunit were present in all cells examined.

Expression of (3 Enolase Transcripts Increases During Ter-minal Differentiation of Myoblasts. A time course of thechanges in (3and a enolase, as well as a actin mRNA levelsduring terminal differentiation of myoblasts, is presented inFig. 5. For this analysis, C2.7 inducible myoblasts, whichbecome able to differentiate only under defined culture con-ditions, were used (19). The level of 83 enolase transcriptsincreased moderately during the first 24 hr following additionof differentiation medium to quiescent cells. During the next2 days a more pronounced increase was observed. Thisincrease accompanied terminal differentiation of myoblasts asindicated by the parallel accumulation of skeletal actin tran-scripts. The relative modulation of , mRNA with respect to a

1OT 2.5 T4 C2.7(iv) C2.7G C G D G D G C O G D

1.8 .... q - a

1.6_0 * *.Sb

1.63. * * S d

FIG. 4. Comparative expression of a and (3 enolase and a actinmRNAs in C3H1OTY2 cells and various myogenic cell lines: Gel blotanalysis ofa enolase mRNA (a), (3enolase mRNA (b and c, differentexposure times), and a actin mRNA (d) in growing (G), quiescent (C),and differentiated (D) cells. Abbreviations above each line refer tothe following cell lines: C3H1OTV2, 2.5 clone (experiment 1), T4, C2.7inducible variant (iv), C2.7 permissive cells (experiment 2). Sevenmicrograms ofeach RNA was analyzed by using the same a enolase,( enolase, and a actin probes as described for Fig. 3 A, C, and D,respectively. In each experiment exposure times of the autoradio-grams were different for each mRNA; thus direct comparisonbetween band intensities can be made only within each panel. RNAsizes are indicated in kb. Culture conditions for T4 and 2.5 cells werethose described for permissive and inducible C2.7 cells (19). Quies-cent cells were collected after 7 days in growth medium, anddifferentiated cells were collected after 2 days (T4, 2.5, and C2.7permissive cells) or 3 days (C2.7 inducible cells) in differentiationmedium (19). Since the 2.5 clone had a slower growth rate, prolif-erating cells were collected 5 days after plating with one change ofmedium on day 3.

Biochemistry: Lamande' et al.

40 is .,4 a

Dow

nloa

ded

by g

uest

on

Janu

ary

11, 2

020

4448 Biochemistry: Lamandd et al.

c

.- 5

S.2'U

11. oO2030405O6070Hours

FIG. 5. Changes in the levels of,8-enolase, a-enolase, and a-actinmRNAs during differentiation of inducible C2.7 myoblasts. For eachtime point, 2 jig and 4 lag of total RNA was electrophoresed andanalyzed by using the probes indicated for Fig. 3 A, B, and D. Theamounts of each mRNA were quantified (see text) and expressedrelative to the value obtained at 76 hr of induction, which was set at1. Each amount is the mean of the two RNA doses. , ,8 mRNA; r,

a actin mRNA. (Inset) Changes in the ratio of relative levels of j3- anda-enolase mRNAs.

mRNA levels in the same experiment is presented in Fig. 5

Inset. The ratio of to a mRNA levels increased 4-fold,indicating that the 83 enolase transcript is preferentially accu-mulated during terminal differentiation of myoblasts.

DISCUSSION

We report here the cloning and sequencing of a cDNAencoding the subunit ofmouse muscle-specific enolase. Weshowed that the transition from aa to (3,8 enolase in devel-oping skeletal muscle mainly results from a differential reg-ulation of a and enolase mRNA levels. Our data alsoindicate that the expression of the enolase gene alreadyoccurs at the myoblast stage and further increases withterminal differentiation of muscle cells.Evidence for the cloning ofa partial-length cDNA clone for

the subunit is based on RNA gel blot and sequenceanalyses. By using the pBE (31 insert as a probe, mouseenolase mRNA was found to be a single species, 1600 basesin length, showing the same specificity oftissue expression asthe subunit (3). It was clearly shorter than a and y enolasemRNAs (12). The amino acid sequence deduced from thepBE ,81 insert showed a high degree of homology with that ofthe chicken (3 subunit obtained by direct protein sequencing(10) as well as with those deduced from cloned cDNAs for rat(17), mouse (N.L., M.L., F.G., L.L.-D., M.L., M. Kaghad,and D. Caput, unpublished data), and human (31, 32) a and'y subunits. In contrast, no homology was found between the78-bp 3' UTR of (8 enolase mRNA and the 3' UTR of mousea and 'y mRNAs, which are about 4- and 10-fold longer,respectively, and heterologous themselves. It remains un-known whether the different lengths and sequences of the 3'UTR in mouse a, (3, and 'y mRNAs are related to thespecificity of their cellular expression. It is interesting to notein this respect that the length and sequence of the 3' UTR ofneuron-specific 'y mRNA are highly conserved between ratand human species (32).

Postnatal development of rat and mouse skeletal muscle isaccompanied by a large increase in total enolase activity due

to the specific accumulation of .8f3 enolase, whereas the aaisoform decreases to a negligible level (3, 4). In adult ratskeletal muscle about 96% of all enolase molecules was foundto be (,3( dimers (3). The modulations of a and (3 enolasemRNA levels observed in developing mouse thigh muscle areconsistent with these data. At birth, both a and ( enolasetranscripts are expressed. Thereafter (3 mRNA level in-creases greatly up to the adult stage while a mRNA becomesbarely detectable. Changes in the levels of both mRNAsappear, therefore, to be involved in the regulation of thetransition from aa to muscle-specific 3,8 enolase. Furtherstudies are required to determine whether the regulation ofenolase subunit levels in developing muscle operates at thetranscriptional level.The use ofmyogenic cells in culture permitted examination

of the expression of enolase mRNAs during the initial stepsof muscle fiber formation. An increase in ,8 enolase transcriptlevel accompanied terminal differentiation and paralleled theexpression of other markers of myogenesis in culture (19, 33)such as a actin examined here. The increase in the ratio of 3to a enolase mRNA levels indicates that the developmentaltransition to the adult pattern of enolase isozymes coincideswith myotube formation. It appears from our study that C2.7inducible and permissive cells already express a low butsignificant amount of 83 enolase transcripts at the myoblaststage. This cannot be due to leakage from the cell systemsince at the same time accumulation of skeletal actin tran-script was not detected. This is particularly true in the caseof inducible myoblasts that can be totally prevented fromterminally differentiating (19). In these cells, none of themyogenic markers analyzed so far (cholinergic receptor,skeletal and cardiac actin, and myosin light chains) is detect-able at the myoblast stage (19).An immunohistochemical study has recently shown that

proliferating myoblasts do have a particular biochemicalphenotype defined at present only by the expression ofdesmin in the case of mouse myoblasts (34). These datasuggest that this phenotype depends on regulatory eventsoccurring prior to the onset of terminal differentiation. Theearly expression of (3 enolase transcripts represents a newbiochemical trait of replicating myogenic cells.The cells of embryonic C3H1OTY2 line can be experimen-

tally converted into myoblasts, chondroblasts, and adipo-blasts (21). In this regard it can be considered as a modelsystem for experimental analysis of myogenic lineage deter-mination and differentiation. Interestingly, it appears fromour data that (3 enolase transcripts are undetectable in divid-ing and quiescent C3H1OT1/2 cells. However, proliferativemyogenic T4 cells derived from C3H1OT1/2 cells treated with5-azacytidine do contain (3 enolase transcripts as does the 2.5clone derived from the same cells transfected with MyoD1cDNA. It has been shown (22, 35) that the MyoD1 gene is partof a regulatory gene pathway that controls the determinationand differentiation of myogenic lineages. The fact thatC3H1OTY2 cells converted into myoblasts by transfectionwith MyoD1 gene express (3 enolase transcripts shows that (3gene expression, in culture, occurs during early stages in themyogenic pathway and supports the notion that it could be amarker event of myogenic lineage determination in vivo.However it must be pointed out that C3H1OTY2 cells mayrepresent an especially permissive environment for the effectof the MyoD1 gene that does not reflect the complexity ofmyogenic determination in the embryo.

Further in vivo and in vitro studies are required for a criticalevaluation of the specificity of the early appearance of (3enolase transcripts in the myogenic lineage. It is noteworthy,in this respect, that low levels of (3(3 enolase molecules havebeen found in some adult cartilaginous tissues (3).

Proc. Natl. Acad Sci. USA 86 (1989)

Dow

nloa

ded

by g

uest

on

Janu

ary

11, 2

020

Proc. Natl. Acad. Sci. USA 86 (1989) 4449

In any cases /3,1 enolase will be a particularly interestingtool for studying the early stages in the expression of themyogenic program.

Note. Since submission of this manuscript the cloning of rat muscle-specific enolase has been reported (36).

We are very grateful to Drs. D. P. Leader for the gift of mousemuscle cDNA library, I. Garner for the gift of total RNAs frommouse muscle and the a-actin cDNA probe, A. B. Lassar forsupplying the MyoDl cDNA, and M. Ruberg for her helpful criticalreading of the manuscript. This work was supported by the CentreNational de la Recherche Scientifique (URA 129), the InstitutNational de la Sante et de la Recherche Mddicale (CRE 856015), andthe Ministere de la Recherche et de l'Enseignement Supdrieur (CR86C0240).

1. Rider, C. C. & Taylor, C. B. (1974) Biochim. Biophys. Acta365, 285-300.

2. Zomzely-Neurath, C. E. (1983) Handb. Neurochem. 4, 403-433.

3. Kato, K., Shimizu, A., Semba, R. & Satoh, T. (1985) Biochim.Biophys. Acta 841, 50-58.

4. Fletcher, L., Rider, C. C., Taylor, C. B., Adamson, E. D.,Luke, B. M. & Graham, C. F. (1978) Dev. Biol. 65, 462-475.

5. Tanaka, M., Sugisaki, K. & Nakashima, K. (1985) J. Biochem.(Tokyo) 98, 1527-1534.

6. Ibi, T., Sabashi, K., Kato, K., Takahashi, A. & Sobue, I. (1983)Muscle Nerve 6, 661-663.

7. Shackelford, J. E. & Lebherz, H. G. (1981) J. Biol. Chem. 256,6423-6429.

8. Previtt, M. A. & Salafsky, B. (1970) Am. J. Physiol. 218, 69-74.

9. Edwards, Y. H., Tipler, T. P., Morgan-Hughes, J. A., Neerun-jun, J. S. & Hopkinson, D. A. (1982) J. Med. Genet. 19, 175-183.

10. Russel, G. A., Dunbar, B. & Fothergill-Gilmore, L. A. (1986)Biochem. J. 236, 115-126.

11. Tanaka, M., Sugisaki, K. & Nakashima, K. (1985) Biochem.Biophys. Res. Commun. 133, 868-872.

12. Lazar, M., Lucas, M., Lamandd, N., Bishop, J. G., Gros, F.& Legault-Demare, L. (1986) Biochem. Biophys. Res. Com-mun. 141, 271-277.

13. Leader, D. P., Gall, I., Campbell, P. & Frischauf, A. M. (1986)DNA 5, 235-238.

14. Maxam, A. M. & Gilbert, W. (1980) Methods Enzymol. 65,499-560.

15. Messing, J. (1983) Methods Enzymol. 101, 20-78.16. Staden, R. (1982) Nucleic Acids Res. 10, 4731-4752.17. Sakimura, K., Kushya, E., Obinata, M. & Takahashi, Y. (1985)

Nucleic Acids Res. 13, 4365-4377.18. Chirgwin, J., Przybyla, A., MacDonald, R. & Rutter, W. (1979)

Biochemistry 18, 5294-5299.19. Pinset, C., Montarras, D., Chenevert, J., Minty, A., Barton, P.,

Laurent, C. & Gros, F. (1988) Differentiation 38, 28-34.20. Reznikoff, C. A., Brankow, D. W. & Heidelberger, C. (1973)

Cancer Res. 33, 3231-3238.21. Konieczny, S. F. & Emerson, C. P., Jr. (1984) Cell 38, 791-

800.22. Davis, R. L., Weintraub, H. & Lassar, A. B. (1987) Cell 51,

987-1000.23. Cribbs, L. L., Shimizu, N., Bugaisky, G. E., Fiszman, M. Y.,

Jakovcic, S. & Umeda, P. K. (1987) in Advances in Myochem-istry, ed. Benzl, G. (Libbey Eurotext, London), pp. 173-184.

24. Lucas, M., Lamande, N., Lazar, M., Gros, F & Legault-Demare, L. (1988) Dev. Neurosci. 10, 91-98.

25. Minty, A., Caravatti, M., Robert, B., Cohen, A., Daubas, P.,Weydert, A., Gros, F. & Buckingham, M. E. (1981) J. Biol.Chem. 256, 1008-1014.

26. Gros-Bellard, M., Oudet, P. & Chambon, P. (1973) Eur. J.Biochem. 36, 32-38.

27. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) MolecularCloning:A Laboratory Manual (Cold Spring Harbor Lab., ColdSpring Harbor, NY), pp. 387-389.

28. Shimizu, A., Suzuki, F. & Kato, K. (1983) Biochim. Biophys.Acta 748, 278-284.

29. Chin, C. Q., Brewer, J. M. & Wold, F. (1981) J. Biol. Chem.256, 1377-1384.

30. Jones, P. A. & Taylor, S. M. (1980) Cell 20, 85-93.31. Giallongo, A., Feo, S., Moore, R., Croce, C. H. & Showe,

L. C. (1986) Proc. Natl. Acad. Sci. USA 83, 6741-6745.32. Day, I. N. M., Allsopp, M. T. E. P., Moore, D. C. McN. &

Thompson, R. J. (1987) FEBS Lett. 222, 139-143.33. Caravatti, M., Minty, A., Robert, B., Montarras, D., Weydert,

A., Cohen, A., Daubas, P. & Buckingham, M. E. (1982)J. Mol.Biol. 160, 59-76.

34. Kaufman, S. J. & Foster, R. F. (1988) Proc. Natl. Acad. Sci.USA 85, 9606-9610.

35. Pinney, D. F., Pearson-White, S. H., Konieczny, S. F.,Latham, K. E. & Emerson, C. P., Jr. (1988) Cell 53, 781-793.

36. Ohshima, Y., Mitsui, H., Takayama, Y., Kushiya, E.,Sakimura, K. & Takahashi, Y. (1989) FEBS Lett. 242, 425-430.

Biochemistry: Lamande' et al.

Dow

nloa

ded

by g

uest

on

Janu

ary

11, 2

020