Multilevel defects in the hematopoietic niche in essentialthrombocythemia

by Ting Sun, Mankai Ju, Xinyue Dai, Huan Dong, Wenjing Gu, Yuchen Gao, Rongfeng Fu,Xiaofan Liu, Yueting Huang, Wei Liu, Ying Chi, Wentian Wang, Huiyuan Li, Yuan Zhou, Lihong Shi, Renchi Yang, and Lei Zhang

Haematologica 2019 [Epub ahead of print]

Citation: Ting Sun, Mankai Ju, Xinyue Dai, Huan Dong, Wenjing Gu, Yuchen Gao, Rongfeng Fu,Xiaofan Liu, Yueting Huang, Wei Liu, Ying Chi, Wentian Wang, Huiyuan Li, Yuan Zhou, Lihong Shi, Renchi Yang, and Lei Zhang. Multilevel defects in the hematopoietic niche in essential thrombocythemia. Haematologica. 2019; 104:xxxdoi:10.3324/haematol.2018.213686

Publisher's Disclaimer.E-publishing ahead of print is increasingly important for the rapid dissemination of science.Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts thathave completed a regular peer review and have been accepted for publication. E-publishingof this PDF file has been approved by the authors. After having E-published Ahead of Print,manuscripts will then undergo technical and English editing, typesetting, proof correction andbe presented for the authors' final approval; the final version of the manuscript will thenappear in print on a regular issue of the journal. All legal disclaimers that apply to thejournal also pertain to this production process.

Copyright 2019 Ferrata Storti Foundation.Published Ahead of Print on July 9, 2019, as doi:10.3324/haematol.2018.213686.

1

Multilevel defects in the hematopoietic niche in essential

thrombocythemia

Ting Sun, Mankai Ju, Xinyue Dai, Huan Dong, Wenjing Gu, Yuchen Gao, Rongfeng Fu,

Xiaofan Liu, Yueting Huang, Wei Liu, Ying Chi, Wentian Wang, Huiyuan Li, Yuan Zhou,

Lihong Shi, Renchi Yang, and Lei Zhang

State Key Laboratory of Experimental Hematology, National Clinical Research Center for

Hematological disorders, Institute of Hematology & Blood Diseases Hospital, Chinese

Academy of Medical Sciences & Peking Union Medical College, Tianjin Laboratory of Blood

Disease Gene Therapy, CAMS Key Laboratory of Gene Therapy for Blood Diseases, CAMS

Center for Stem Cell Medicine, PUMC Department of Stem Cell and Regenerative Medicine,

Tianjin, 300020, China

Running head: Bone marrow niche dysfunction in ET

Corresponding authors: Lei Zhang, M.D., Renchi Yang, M.D., Lihong Shi, Ph.D., E-mail:

zhanglei1@ihcams.ac.cn, rcyang@ihcams.ac.cn, shilihongxys@ihcams.ac.cn

Abstract word count: 225

Manuscript word count: 3999

Number of figures and tables: 8

Number of supplemental files: 1

Acknowledgements

The authors would like to thank Liyan Zhang, Chengwen Li, and Qi Sun for providing the

cells used in the experiments. This work was supported by the National Natural Science

Foundation of China [grant numbers 81470302, 81600099, 81500084, and 81770128], The

2

Beijing-Tianjin-Hebei basic research project [grant number 18JCZDJC44600/ H2018206423],

Non-profit Central Research Institute Fund of Chinese Academy of Medical Sciences [grant

numbers 2018PT31038, 2018PT32028, and 2017PT31047], CAMS Innovation Fund for

Medical Sciences [grant numbers 2016-I2M-1-018, 2016-I2M-3-002, and 2017-I2M-1-015],

National Key Research and Development Program of China [grant number

2017YFA0103102], and Novartis Foundation. The authors would like to thank all the funding

agencies that supported this research.

3

Abstract

The role of the bone marrow niche in essential thrombocythemia remains unclear. Here, we

observed multilevel defects in the hematopoietic niche of patients with JAK2V617F-positive

essential thrombocythemia, including functional deficiency in mesenchymal stromal cells,

immune imbalance, and sympathetic-nerve damage. Mesenchymal stromal cells from

patients with JAK2V617F-positive essential thrombocythemia had a transformed

transcriptome. In parallel, they showed enhanced proliferation, decreased apoptosis and

senescence, attenuated ability to differentiate into adipocytes and osteoblasts, and insufficient

support for normal hematopoiesis. Additionally, they were inefficient in suppressing immune

responses. For instance, they poorly inhibited proliferation and activation of CD4-positive T

cells and the secretion of the inflammatory factor soluble CD40-ligand. They also poorly

induced formation of mostly immunosuppressive T helper 2 cells and the secretion of the

anti-inflammatory factor interleukin-4. Furthermore, we identified WDR4 as a potent protein

which was low expressed and correlated with increased proliferation, reduced senescence and

differentiation, and insufficient support for normal hematopoiesis in mesenchymal stromal

cells from patients with JAK2V617F-positive essential thrombocythemia. We also observed

that loss of WDR4 in mesenchymal stromal cells downregulated the interleukin-6 level

through the ERK–GSK3β–CREB signaling based on our in vitro studies. Altogether, our

results show that multilevel changes occur in the bone marrow niche of patients with

JAK2V617F-positive essential thrombocythemia, and low expression of WDR4 in

mesenchymal stromal cells may be critical for inducing hematopoietic related changes.

4

Introduction

In essential thrombocythemia (ET) with the acquired JAK2V617F mutation, neoplastic

clones take over the bone marrow (BM) niche, and consequently normal hematopoiesis fails.1

Multiple mechanisms may be involved in this process; however, the specific mechanisms

leading to the replacement of normal hematopoietic stem/progenitor cells (HSPCs) by mutant

HSPCs remain unclear.

Hematopoiesis is a parenchymal process that takes place in the BM, wherein it is tightly

regulated by a complex communication network involving various factors that collectively

form the niche for hematopoiesis. All blood cells are derived from HSPCs that are primarily

present in the perivascular niche, along with mesenchymal stromal cells (MSCs) that

synthesize various factors promoting HSPC maintenance and/or quiescence.2,3 Perivascular

stromal cells marked by nestin (NES) in the BM are closely associated with HSPCs and can

regulate the proliferation, differentiation, and long-term hematopoietic capacity of HSPCs via

direct or indirect pathways. Importantly, these NES-positive cells maintain HSPCs in the BM,

and when ectopically transplanted, they help reconstitute hematopoietic activity in the host

region.4 Although malignant hematopoiesis is mainly caused by genetic abnormalities of the

mutant stem cells themselves, increasing evidence has shown that abnormal regulation of the

hematopoietic niche in the bone marrow has also significant effects.5,6 Recently, several

studies have showed that genetic and physiological changes in MSCs may accompany

hematopoietic disorders, such as myelodysplastic syndrome, and leukemia.7-9 However, little

is known about BM-derived MSCs (BM-MSCs) in patients with ET.

Perivascular NES-positive MSCs are extensively innervated by sympathetic nerve fibers

that play vital roles in hematopoiesis and cancer progression by targeting HSPCs, MSCs, and

osteoblasts via the b3 and b2 adrenergic receptor (B3AR and B2AR) signaling

pathways.4,10,11 The nervous system also regulates immunity and inflammation in the BM,

which have long been known to extensively participate in regulation of hematopoiesis.12 Both

T helper 1 (Th1) and T helper 2 (Th2) cells produce granulocyte-macrophage

colony-stimulating factor (GM-CSF), which promotes the differentiation of macrophages

from hematopoietic stem cells.13 Th2 cells also produce lineage-specific cytokines, such as

5

interleukin (IL)-4, which can increase production of granulocytes and monocytes from

mature unipotential hematopoietic progenitor cells, while contributing to thrombocytopenia

via inhibitory effects throughout the process of megakaryopoiesis.14,15 Emerging reports have

shown that T cell imbalance in the BM and abnormal secretion of inflammatory factors can

impair normal hematopoiesis while accelerating the proliferation of malignant clones that

carry mutations.16,17 Moreover, the inflammatory microenvironment can impair sympathetic

nerve maintenance and regeneration.18 Recently, neuropathy and inflammation have been

reported in a mouse model of JAK2V617F-positive myeloproliferative neoplasms (MPNs),

which tends to exhibit abnormal hematopoiesis.19 Nonetheless, the sympathetic and

inflammatory environment in the BM of patients with ET has not been widely examined.

IL-6 is a multifunctional and pleiotropic cytokine that plays critical roles in the immune

system and in a variety of biological processes including hematopoiesis. It is secreted by

numerous cell types, including monocytes, dendritic cells, macrophages, T cells, B cells,

fibroblasts, osteoblasts, endothelial cells, and particularly MSCs. 20-23 IL-6 has both pro- and

anti-inflammatory properties and is involved in the pathogenesis of nearly all inflammatory

diseases. It has been reported that mice homozygous for a mutation in the IL-6 receptor

signaling subunit glycoprotein 130 (gp130Y757F/Y757F) develop a wide range of hematopoietic

abnormalities, including splenomegaly, lymphadenopathy, neutrophilia, and

thrombocytopenia in addition to elevated myelopoiesis and megakaryopoiesis in the BM.24,25

These mice show glycoprotein 130-dependent signal transduction and hyperactivation of the

transcriptional activator STAT3. IL-6 also participates in the pathogenesis of various blood

disorders by increasing the number of early pluripotent precursor cells and committed

myeloid precursors in the BM.22,26,27 The ERK–GSK3β–CREB signaling pathway has been

demonstrated to be involved in regulating IL-6; however, to date, its role in BM-MSCs

remains unclear.28-30

WDR4, located in human chromosomal region 21q22.3, codes for a member of the WD

repeat protein family, which has been shown to participate in various cellular processes, such

as differentiation, apoptosis, cell cycle progression, and stem cell self-renewal by regulating a

wide range of signaling pathways via epigenetic regulation of gene expression, or

6

ubiquitin-mediated degradation of proteins.31,32 WDR4 is involved in the regulation of an

prometastatic and immunosuppressive microenvironment in lung cancer.33 Downregulation

of WDR4 has been detected in the megakaryocytes and platelets of patients with ET, as

shown in the GEO Profiles (GEO numbers: GSE2006 and GSE567). However, the role of

WDR4 in ET has not been evaluated.

In the present study, we compared the normal BM niche with that of JAK2V617F-positive

ET patients to have a comprehensive insight into the changes that occur in the BM

microenvironment, and to identify the factors correlated with them.

Methods

Patients and samples

Ninety-one untreated ET patients and fifty healthy donors (HDs) were included in this study.

The characteristics of the subjects are detailed in Supplementary Table S1. This study was

approved by the hospital-based ethics committee.

Isolation, expansion, and characterization of MSCs

BM-MSCs were isolated and expanded in vitro, and their cell morphology,

immunophenotype, proliferation, cell cycle, apoptosis, differentiation, and senescence were

evaluated. Additional information on the experimental design is provided in the Online

Supplementary Material.

Transcriptomics and quantitative real-time PCR (qPCR) analyses

Total RNA was isolated from MSCs at passage four and used for transcriptomic and qPCR

analyses. Detailed information is provided in the Online Supplementary Material.

Measurement of cytokine levels

7

Luminex assay (R&D Systems, Minneapolis, MN, USA) was performed on the supernatants

obtained from the BM extracts to assess for inflammatory factors according to the

manufacturer’s instructions. Enzyme-linked immunosorbent assay (ELISA) was performed

on the supernatants obtained from the BM extracts or from the MSC cultures. A list of the

ELISA kits is provided in Supplementary Table S3.

Colony-forming unit assay

To evaluate the capacity of MSCs to sustain normal hematopoiesis, a colony-forming unit

(CFU) assay was performed according to the manufacturer’s instructions. Detailed

information is provided in the Online Supplementary Material.

Results

Gene expression profiles of BM-MSCs derived from HDs and patients with

JAK2V617F-positive ET

First, we performed RNA sequencing on MSCs of HDs or patients with

JAK2V617F-positive ET. A total of 766 upregulated and 429 downregulated genes were

detected in the patient samples (Figure 1A). Gene Ontology analysis revealed changes in the

gene sets related to cell cycle, differentiation, proliferation, cell death, and aging (Figure 1B).

Further analysis showed a prominent abundance of gene signatures associated with

inflammation (Figure 1C). Gene Set Enrichment Analysis confirmed significant enrichment

of dysregulated genes involved in the cell cycle, inflammatory responses, and hematopoietic

support (Figure 1D). These changes, confirmed by qPCR (Figure 1E), suggested multiple

functional defects in MSCs of patients with JAK2V617F-positive ET.

BM-MSCs from patients with JAK2V617F-positive ET show enhanced proliferation and

attenuated apoptosis, senescence, and differentiation

8

To verify the results of the gene expression analyses, we performed Cell Counting Kit 8

(CCK-8) assays, which revealed that the MSCs of the patients had higher proliferative

capacity than the MSCs of the HDs (Figure 2A). Furthermore, the apoptosis (Figure 2B) and

senescence rates (Figure 2C) of the MSCs derived from the patients were lower. The

adipogenic and osteogenic differentiation potentials of the ET MSCs were also significantly

lower (Figure 2D). In line with the above results, the majority of the ET MSCs were in S and

G2 phases (Figure 2E). Additionally, we detected an increase in the level of NES mRNA

(Figure 2F) and the number of NES-positive cells (Figure 2G, H) in the BM of the patients.

No difference in immunophenotype or morphology was detected between the MSCs of the

HDs and those of the patients (Figure S1 A, B).

BM-MSCs from patients with JAK2V617F-positive ET show insufficient capacity to

support normal hematopoiesis

To assess the capacity of MSCs to support hematopoiesis, we established a coculture

setting involving normal CD34-positive cells and MSCs derived from the HDs or patients

with JAK2V617F-positive ET. The recovered CD34-positive cells after 7 or 14 days of

coculture were plated in a semisolid medium containing methylcellulose or agar in the

presence of a cytokine cocktail, and their hematopoietic potential was estimated by

determining the number of colony-forming units (CFU). We thereby observed that

CD34-positive cells had fewer CFUs in total (CFU-Total), particularly for granulocytes and

macrophages (CFU-GM), when cocultured with the ET MSCs relative to those obtained with

the HD MSCs. There was no significant difference in the number of CFUs for

megakaryocytes (CFU-MK) between the two co-cultures (Figure 3A, B). These results

indicated that BM-MSCs from patients with JAK2V617F-positive ET were deficient in the

maintenance of normal hematopoiesis.

Many cytokines influence hematopoiesis. To identify the effectors, we performed ELISA

on the supernatants of the MSC cultures. We thereby observed that ET MSCs secreted less

IL-6, leptin, and GM-CSF than HD MSCs (Figure 3C).

9

BM-MSCs from patients with JAK2V617F-positive ET show an impaired

immunomodulatory capacity

CD4-positive T cells from patients with JAK2V617F-positive ET showed enhanced

proliferation and activation than the normal controls (Figure 4 A, B). No changes were

observed in the levels of GATA3, T-bet, ROR-γt, or FOXP3 (Figure 4C). Notably, Th2 cell

counts were significantly decreased in patients with JAK2V617F-positive ET (Figure 4D).

The level of the anti-inflammatory factor IL-4 was less in the patient samples, while

pro-inflammatory factors, such as IL-1β, and sCD40L, were upregulated. No difference was

observed in IL-6 levels between the patient and healthy samples (Figure 4E).

We next evaluated whether MSCs play a role in the immune disorder mentioned above.

We observed that CD4-positive T cell proliferation and activation were remarkably enhanced,

and Th2 cell counts were significantly lower when cocultured with ET MSCs relative to

those observed with HD MSCs (Figure 4 F–H). Additionally, IL-4 was downregulated and

sCD40L was upregulated with the ET MSC coculture (Figure 4I).

Downregulation of WDR4 is correlated with enhanced proliferation, decreased

senescence, and impaired differentiation in BM-MSCs of patients with

JAK2V617F-positive ET

WDR4 was one of the differentially expressed genes according to our RNA sequencing

results and was recently reported to regulate the immunosuppressive microenvironment of

solid tumors.25 Downregulation of WDR4 expression was confirmed by qPCR and western

blotting in MSCs derived from patients with JAK2V617F-positive ET (Figure 5 A, B). To

further evaluate the function of WDR4 in BM-MSCs, we used lentiviruses carrying the

WDR4 cDNA (LV-WDR4) or a specific shRNA targeting WDR4 (LV-shWDR4).

LV-shWDR4–infected MSCs had significantly lower WDR4 mRNA and protein levels than

those in the control groups, and LV-WDR4 effectively increased the WDR4 level in

BM-MSCs (Figure 5 C, D). We next established coculture systems between normal

mononuclear or CD4-positive T cells from the bone marrow, and WDR4 knockdown or

overexpressing MSCs. Among the subgroups that had different levels of WDR4 expression,

10

no changes were observed in terms of CD4-positive T cell proliferation and activation,

inflammatory cytokine secretion, or Th2-cell subtype counts (Figure S2). We next examined

the role of WDR4 in BM-MSCs regarding functions besides immunoregulation. In HD MSCs

infected with LV-shWDR4, we observed biological characteristics similar to those in ET

MSCs, including enhanced proliferation (Figure 5E), decreased senescence (Figure 5F), and

an impaired ability to differentiate into adipocytes, osteoblasts, and chondrocytes (Figure 5G).

Conversely, when ET MSCs were infected with LV-WDR4, the previously detected

abnormal biological properties were partially reversed (Figure 5 E–G) except for apoptosis

(Figure S3).

Insufficient action of the WDR4–IL-6 axis decreases hematopoiesis-supporting activities

of BM-MSCs from JAK2V617F-positive ET patients

We next investigated whether WDR4 affected the hematopoiesis-supporting function of

BM-MSCs. Hematopoiesis was studied by analyzing CFUs. After 14 days of coculture of

normal CD34-positive cells with HD MSCs infected with LV-shWDR4, the numbers of

erythroid burst-forming units (BFU-E), CFU-GM, and CFU-Total were significantly lower

than those in the control groups (Figure 6A). In contrast, increasing WDR4 expression

corrected the ET MSC-mediated defects, as evidenced by higher numbers of BFU-E,

CFU-GM, and CFU-Total relative to those in the control groups (Figure 6A). No changes

were observed in the CFU-MK number (Figure 6B).

We next examined whether WDR4 regulated the hematopoietic cytokines mentioned

above that were differentially produced between the two MSC samples. The results revealed

a link between IL-6 and WDR4 (Figure 6C). We next performed qPCR and western blotting

to assess whether IL-6 expression was affected by WDR4. In WDR4 knockdown HD MSCs,

intracellular IL-6 protein (Figure 6D) and mRNA levels (Figure 6E) were decreased.

Furthermore, in the ET MSCs, restoration of WDR4 expression alleviated the decrease in

IL-6 levels (Figure 6 D–E). Taken together, these results indicate that WDR4 promotes the

intracellular expression and secretion of IL-6 by BM-MSCs.

11

WDR4 acts through the ERK–GSK3β–CREB pathway to increase IL-6 expression and

secretion by BM-MSCs

To identify candidate kinases through which WDR4 may act on IL-6, we evaluated the

levels of 43 phosphorylated kinases in HD MSCs infected with LV-shWDR4 relative to those

in the controls. Among the kinases that were affected by LV-shWDR4 infection, GSK3β,

AKT, ERK, and CREB are known to be upstream of IL-6 (Figure 7A). We next validated the

results by western blotting. Phosphorylation levels of GSK3β (S9), AKT1/2/3

(S472/S473/S474), ERK1/2 (T202/Y204, T185/Y187), and CREB (S133) significantly

decreased with WDR4 knockdown in HD MSCs and increased with WDR4-overexpression

in ET MSCs (Figure 7B).

To determine which kinases are involved in WDR4-mediated IL-6 upregulation, we used

kinase inhibitors specific for AKT1/2/3 (GDC-0068), ERK1/2 (SCH772984), and GSK3β

(SB216763), and an siRNA specific for CREB in ET MSCs infected with LV-WDR4. We

thereby found that inhibition of ERK1/2, GSK3β, or CREB could at least partially suppress

WDR4-induced IL-6 upregulation, while inhibition of AKT1, -2, or -3 caused no significant

effect as assessed with qPCR (Figure 7D), western blotting (Figure 7E), and ELISA (Figure

7F). These findings indicate that WDR4 promotes IL-6 expression and secretion via the

ERK–GSK3β–CREB signaling pathway in BM-MSCs.

Neuropathy and aberrant expression of IL-1β in the BM of patients with

JAK2V617F-positive ET

Markedly lower numbers of sympathetic nerve fibers and ensheathing Schwann cells

were found in the BM of patients with JAK2V617F-positive ET (Figure 8A). Norepinephrine,

which is mainly secreted by sympathetic nerve fibers, was also significantly downregulated

in ET BM (Figure 8C). Additionally, B3AR, a norepinephrine receptor, and IL-1β levels were

upregulated in the BM of patients with JAK2V617F-positive ET (Figure 8 B, D).

Discussion

12

In the present study, we observed transcriptional and functional abnormalities in the

hematopoietic niche of patients with JAK2V617F-positive ET, including functional

deficiency in MSCs, immune imbalance, and sympathetic neuropathy, relative to those in HD

controls. BM-MSCs from patients with JAK2V617F-positive ET showed an altered

transcriptome, faster proliferation, attenuated apoptosis and senescence, decreased potential

to differentiate into adipocytes and osteoblasts, and insufficient support for normal

hematopoiesis. These findings partially agree with those found in previous studies about

myelodysplastic syndrome, leukemia, and MPN by other groups, but differ from the

conclusions obtained from an MPN mouse model and patients.7-9,19,34 NES-positive cells have

been reported to be heterogeneous populations comprising mesenchymal cells and

endothelial cells in the BM.4 We co-stained bone marrow samples with NES and CD34

(endothelial cell marker), and found that patients with JAK2V617F-positive ET showed

higher numbers of NES-positive mesenchymal cells in the BM relative to those in the HD

controls. This observation contradicts the results obtained from the MPN mouse model and

patients mentioned above but is consistent with the results obtained in patients with ET,

polycythemia vera (PV), and primary myelofibrosis (PMF) by other group.34 NES−/leptin

receptor−/CXCL12+ MSC subpopulations have been reported to be essential for the

maintenance of HSCs in mouse models.35 Furthermore, in BM sections from patients with

myelodysplastic syndrome, HSCs are mostly in close contact with CD271+/NES− MSCs.36

Hock et al. confirmed that HSCs with elevated proliferation rates were functionally

compromised.37 Therefore, given that MSCs of patients with JAK2V617F-positive ET

showed enhanced proliferation, we hypothesize that functional deficits are also present in

these MSCs. These studies, as well as our data, may explain the poor ability of the expanded

MSCs isolated from patients with JAK2V617F-positive ET to support normal hematopoiesis.

Regarding the paradox with the mouse models of MPN, it is possible that the heterogeneity

of the patients with MPN contributed to the observed discrepancy since our study involved

only patients with JAK2V617F-positive ET as subjects, but not those with PV or PMF.

Because of the low number of the primitive non-passaged BM-MSCs (0.08% of BM

mononuclear cells), MSCs used for functional analysis were expanded ex vivo in the present

13

work. It is possible that this process caused changes that were not completely consistent with

the most primitive state in vivo.38 Additionally, although mouse models are powerful tools for

studying MSCs in vivo, animals may not fully recapitulate the medical conditions in humans,

and inter-species differences in structure, function, and immunophenotype may have

contributed to the contradictory results. Additionally, JAK2V617F mutation is detected in

approximately 95% of patients with PV and 50% of patients with ET and PMF, and mouse

models of JAK2V617F show a tendency to develop a PV phenotype more often than ET.39-40

Furthermore, the hematopoietic niches of different MPN phenotypes may differ to some

extent. Therefore, both animal models and clinical specimens help us to better understand the

intrinsic state of MSCs under medical conditions in humans. The ratio of mutant to wild-type

JAK2 has been proved to be critical for the phenotypic manifestation.41 Nonetheless, a

successful model that accurately recapitulates the human manifestations of JAK2-positive ET

is not available to us for now. Collectively, the present in vitro findings revealed a perturbed

transcriptome and aberrant biological characteristics of BM-MSCs of patients with

JAK2V617F-positive ET.

It has been reported that expansion of BM CD4-positive T cells can lead to exhaustion of

hematopoietic cells.42 In this study, we found that MSCs of patients with

JAK2V617F-positive ET showed reduced inhibition of CD4-positive T cell proliferation and

activation, and secretion of the inflammatory cytokine sCD40L. In addition, they showed

decreased induction of mostly immunosuppressive and antineoplastic Th2 cell formation, and

secretion of the anti-inflammatory cytokine IL-4. Th2 formation is highly dependent on the

activation of signal transducers and activators of transcription 6 by IL-4.43 Thus, low

secretion of IL-4 may be both the cause and consequence of blockage of the Th2 response.

These results are mostly compatible with the results of previous studies.14,15,42 Attenuated

senescence of MSCs from patients with JAK2V617F-positive ET was observed in the present

study. Thus, one paradox arises, given that decreased senescence of MSCs is typically linked

to their anti-inflammatory status. The concept that MSCs are highly plastic and the local

inflammatory environment thus can shape the immunomodulatory effects of MSCs may help

to improve the understanding of the state of MSCs in pathological processes. Specific

14

inflammatory signals prompt MSCs to switch between the proinflammatory and

anti-inflammatory phenotypes.44 One possible explanation for the contradiction between

aging and their inflammatory phenotype is that aging-related changes may be compensated to

some extent by the local inflammatory milieu. Additionally, MSCs can be polarized by

downstream Toll-like receptor (TLR) signaling into two homogenous phenotypes.

TLR4-primed MSCs mostly produce pro-inflammatory cytokines, while TLR3-primed MSCs

express mostly immunosuppressive cytokines.45 TLR4 has been confirmed to inhibit

senescence via epigenetic silencing of senescence-related genes.46 Thus, another possible

explanation is that upregulation of TLR4 and downregulation of TLR3 polarize the MSCs

from patients with JAK2V617F-positive ET to a proinflammatory phenotype with an

anti-senescence effect. Collectively, these results indicate that MSCs contribute at least

partially to the immune imbalance in the BM of ET patients.

The changes mentioned above provide a possible link between the alterations in

hematopoietic niches to the pathophysiology of JAK2V617F-positive ET in humans.

Nonetheless, the underlying mechanisms remain unclear. In this study, we determined a

mechanism whereby WDR4 deficiency impairs the ability of BM-MSCs to support normal

differentiation of hematopoietic progenitors in patients with JAK2V617F-positive ET. This

effect occurs due to decreased IL-6 expression and secretion through suppression of the

ERK–GSK3β–CREB pathway. Overall patients with MPN have been described to have

higher IL-6 levels in the BM and there is published data on the oncogene-dependent

mechanisms of fibroblasts expansion and IL-6 upregulation in fibroblasts in patients with

JAK2V617F-positive MPN.47 Nonetheless, in the present study, a prominent reduction in

IL-6 levels was found in the supernatants of the culture medium of BM-MSCs from patients

with JAK2V617F-positive ET, with no obvious changes in IL-6 levels in the BM extract. This

may be because the myelofibrosis grade of the patients enrolled in this study was 0-1. The

significance of the hematopoiesis-supporting role of IL-6 has been well-documented.24-27

Most HSPCs are in contact with MSCs in the BM, forming a highly sophisticated interaction

network through direct contact and paracrine effects.2 Thus, one possible explanation is that

IL-6 levels in MSCs contribute to the regulation of hematopoietic progenitors through local

15

signals. Interestingly, our CFU assays showed that although some types of colonies depended

on WDR4-IL6 axis, CFU-MK did not. JAK2V617F leads to increased HSC survival and

biased differentiation to the lineages that signal through JAK2, including MK-platelets.41

Therefore, it is reasonable to hypothesize that these JAK2V617F CFU-MK would outgrow

other lineages that are more dependent on the WDR4-IL6 axis in the BM of ET patients.

Further work is required. In the present study, CD34-positive cells cultured with MSCs

infected with LV-shWDR4 showed a different phenotype to those with ET MSCs in terms of

BFU-E. We observed a trend towards BFU-E reduction in patients with ET, but the difference

was not significant. The difference is likely related to the diversity between these groups.

Both groups treated with WDR4 shRNA or control shRNA showed similar characteristics in

terms of clinical or laboratory features, while an overlap existed between BFU-E levels in

patients and control samples, possibly because of the heterogeneity of clinical specimens and

variable disease progression of the patients. Together these findings indicate that

dysregulation of the WDR4-IL6 axis is involved in most dysfunctions in ET MSCs.

Neuropathy was detected in the present study in BM sections of patients with

JAK2V617F-positive ET. Although 10 µm sections are not optimal for accurate identification

and quantification of BM fibers, no thicker sections were approved due to the scarcity of the

clinical specimens. Aberrant expression of NE and B3AR were also detected in the BM of the

patients. IL-1β, secreted by hematopoietic progenitors and many types of stromal cells, has

been shown to mediate neuropathy in the BM of JAK2V617F-positive MPN mice and

patients.19 We also found elevated IL-1β levels in the BM extract of patients with

JAK2V617F-positive ET, which may explain why neuropathy was detected. Neuropathy has

been linked to the loss of NES-positive cells in MPN mice and patients,19 while denervation

of the BM in HDs or patients with acute myeloid leukemia can lead to increased numbers of

NES-positive cells.9 A higher number of NES-positive cells was estimated in this study when

thinner sections (5 µm) were used. Given that combining data derived from sections with

different thickness may introduce significant bias, further studies are required to understand

the relevance between neuropathy and NES-positive cells. IL-1β has previously been

reported to upregulate NES,48 suggesting that immune cues are involved in altering both the

16

sympathetic nervous system and MSCs. NE inhibits nuclear factor-κB activity and

pro-inflammatory cytokine release by binding to B2AR and B3AR on MSCs and other

immune cells.12,18 The decreased production of NE, possibly caused by increased neurotoxic

inflammatory cytokines, in ET can facilitate the formation of an inflammatory environment.

Further studies are required to elucidate the connection between MSCs, immunity, and

sympathetic nerves.

In summary, this study revealed multilevel defects in the hematopoietic

microenvironment of patients with JAK2V617F-positive ET and demonstrated that one of the

differentially expressed genes, WDR4, underlies most dysfunctions in ET MSCs via

downregulation of IL-6 expression and secretion through suppression of the

ERK–GSK3β–CREB pathway. Activation of the JAK-STAT3 pathway through IL-6 binding

and its receptor is essential for maintaining normal hematopoiesis. A study recently revealed

that IL-6 stimulated JAK2-STAT3 signaling in PV and PMF, but suppressed this signaling in

ET.49 Our results, alongside with those of previous studies, provide a compelling rationale for

exploring the in vivo effect of the WDR4-IL-6 axis against ET in the future. Due to technical

limitations, we also suggested a lot of hypotheses and potential explanations for the

paradoxes with other groups and future work is required for their validation.

Conflict of Interests Statement: The authors declare that they have no conflicts of interest.

Supplementary information is available on the website of Haematologica.

References

1. Vainchenker W, Kralovics R. Genetic basis and molecular pathophysiology of classical

myeloproliferative neoplasms. Blood. 2017;129(6):667-679.

17

2. Crane GM, Jeffery E, Morrison SJ. Adult haematopoietic stem cell niches. Nat Rev

Immunol. 2017;17(9):573-590.

3. Cordeiro Gomes A, Hara T, Lim VY, et al. Hematopoietic stem cell niches produce

lineage-instructive signals to control multipotent progenitor differentiation. Immunity.

2016;45(6):1219-1231.

4. Xie L, Zeng X, Hu J, Chen Q. Characterization of Nestin, a selective marker for bone

marrow derived mesenchymal stem cells. Stem Cells Int. 2015;2015:762098.

5. Korn C, Mendez-Ferrer S. Myeloid malignancies and the microenvironment. Blood.

2017;129(7):811-822.

6. Himburg HA, Termini CM, Schlussel L, et al. Distinct bone marrow sources of

pleiotrophin control hematopoietic stem cell maintenance and regeneration. Cell Stem Cell.

2018;23(3):370-381.e5.

7. Manso BA, Zhang H, Mikkelson MG, et al. Bone marrow hematopoietic dysfunction in

untreated chronic lymphocytic leukemia patients. Leukemia. 2019;33(3):638-652.

8. Ping Z, Chen S, Hermans SJF, et al. Activation of NF-kappaB driven inflammatory

programs in mesenchymal elements attenuates hematopoiesis in low-risk myelodysplastic

syndromes. Leukemia. 2019;33(2):536-541.

9. Hanoun M, Zhang D, Mizoguchi T, et al. Acute myelogenous leukemia-induced

sympathetic neuropathy promotes malignancy in an altered hematopoietic stem cell niche.

Cell Stem Cell. 2014;15(3):365-375.

10. Hanoun M, Maryanovich M, Arnal-Estape A, Frenette PS. Neural regulation of

hematopoiesis, inflammation, and cancer. Neuron. 2015;86(2):360-373.

11. Maestroni GJM. Adrenergic modulation of haematopoiesis. J. Neuroimmune. Pharmacol.

2019 Feb 14. [Epub ahead of print].

12. Pavlov VA, Chavan SS, Tracey KJ. Molecular and functional neuroscience in immunity.

Annu Rev Immunol. 2018;36:783-812.

13. Broxmeyer HE, Bruns HA, Zhang S, et al. Th1 cells regulate hematopoietic progenitor

cell homeostasis by production of oncostatin M. Immunity. 2002;16(6):815-825.

14. Gao A, Gong Y, Zhu C, et al. Bone marrow endothelial cell-derived interleukin-4

18

contributes to thrombocytopenia in acute myeloid leukemia. Haematologica. 2019 Feb 21.

[Epub ahead of print].

15. Keller U, Aman MJ, Derigs G, Huber C, Peschel C. Human interleukin-4 enhances

stromal cell-dependent hematopoiesis: costimulation with stem cell factor. Blood.

1994;84(7):2189-2196.

16. Agarwala S, Tamplin OJ. Neural crossroads in the hematopoietic stem cell niche. Trends

Cell Biol. 2018;28(12):987-998.

17. Tripodo C, Burocchi A, Piccaluga PP, et al. Persistent immune stimulation exacerbates

genetically driven myeloproliferative disorders via stromal remodeling. Cancer Res.

2017;77(13):3685-3699.

18. Buttner R, Schulz A, Reuter M, et al. Inflammaging impairs peripheral nerve

maintenance and regeneration. Aging Cell. 2018;17(6):e12833.

19. Arranz L, Sanchez-Aguilera A, Martin-Perez D, et al. Neuropathy of haematopoietic

stem cell niche is essential for myeloproliferative neoplasms. Nature. 2014;512(7512):78-81.

20. Jones SA, Jenkins BJ. Recent insights into targeting the IL-6 cytokine family in

inflammatory diseases and cancer. Nat Rev Immunol. 2018;18(12):773-789.

21. Verboogen DRJ, Revelo NH, Ter Beest M, van den Bogaart G. Interleukin-6 secretion is

limited by self-signaling in endosomes. J Mol Cell Biol. 2019;11(2):144-157.

22. Csaszar E, Wang W, Usenko T, et al. Blood stem cell fate regulation by Delta-1-mediated

rewiring of IL-6 paracrine signaling. Blood. 2014;123(5):650-658.

23. Jiang C, Zhang Q, Shanti RM, et al. Mesenchymal stromal cell-derived interleukin-6

promotes epithelial-mesenchymal transition and acquisition of epithelial stem-like cell

properties in ameloblastoma epithelial cells. Stem Cells. 2017;35(9):2083-2094.

24. Jenkins BJ, Roberts AW, Najdovska M, Grail D, Ernst M. The threshold of

gp130-dependent STAT3 signaling is critical for normal regulation of hematopoiesis. Blood.

2005;105(9):3512-3520.

25. Jenkins BJ, Roberts AW, Greenhill CJ, et al. Pathologic consequences of STAT3

hyperactivation by IL-6 and IL-11 during hematopoiesis and lymphopoiesis. Blood.

2007;109(6):2380-2388.

19

26. Chiba Y, Mizoguchi I, Hasegawa H, et al. Regulation of myelopoiesis by

proinflammatory cytokines in infectious diseases. Cell Mol Life Sci. 2018;75(8):1363-1376.

27. Maeda K, Mehta H, Drevets DA, Coggeshall KM. IL-6 increases B-cell IgG production

in a feed-forward proinflammatory mechanism to skew hematopoiesis and elevate myeloid

production. Blood. 2010;115(23):4699-4706.

28. Li R, Xin T, Li D, Wang C, Zhu H, Zhou H. Therapeutic effect of Sirtuin 3 on

ameliorating nonalcoholic fatty liver disease: The role of the ERK-CREB pathway and

Bnip3-mediated mitophagy. Redox Biol. 2018;18:229-243.

29. Rodionova E, Conzelmann M, Maraskovsky E, et al. GSK-3 mediates differentiation and

activation of proinflammatory dendritic cells. Blood. 2007;109(4):1584-1592.

30. Yun MR, Choi HM, Kang HN, et al. ERK-dependent IL-6 autocrine signaling mediates

adaptive resistance to pan-PI3K inhibitor BKM120 in head and neck squamous cell

carcinoma. Oncogene. 2018;37(3):377-388.

31. Lin S, Liu Q, Lelyveld VS, Choe J, Szostak JW, Gregory RI. Mettl1/Wdr4-mediated

m(7)G tRNA methylome is required for normal mRNA translation and embryonic stem cell

self-renewal and differentiation. Mol Cell. 2018;71(2):244-255.e5.

32. Schapira M, Tyers M, Torrent M, Arrowsmith CH. WD40 repeat domain proteins: a

novel target class? Nat Rev Drug Discov. 2017;16(11):773-786.

33. Wang YT, Chen J, Chang CW, et al. Ubiquitination of tumor suppressor PML regulates

prometastatic and immunosuppressive tumor microenvironment. J Clin Invest.

2017;127(8):2982-2997.

34. Avanzini MA, Bernardo ME, Novara F, et al. Functional and genetic aberrations of in

vitro-cultured marrow-derived mesenchymal stromal cells of patients with classical

Philadelphia-negative myeloproliferative neoplasms. Leukemia. 2014;28(8):1742-1745.

35. Greenbaum A, Hsu YM, Day RB, et al. CXCL12 in early mesenchymal progenitors is

required for haematopoietic stem-cell maintenance. Nature. 2013;495(7440):227-230.

36. Flores-Figueroa E, Varma S, Montgomery K, Greenberg PL, Gratzinger D. Distinctive

contact between CD34+ hematopoietic progenitors and CXCL12+ CD271+ mesenchymal

stromal cells in benign and myelodysplastic bone marrow. Lab Invest.

20

2012;92(9):1330-1341.

37. Hock H, Hamblen MJ, Rooke HM, et al. Gfi-1 restricts proliferation and preserves

functional integrity of haematopoietic stem cells. Nature. 2004;431(7011):1002-1007.

38. Moravcikova E, Meyer EM, Corselli M, Donnenberg VS, Donnenberg AD. Proteomic

profiling of native unpassaged and culture-expanded mesenchymal stromal cells (MSC).

Cytometry A. 2018;93(9):894-904.

39. Lacout C, Pisani DF, Tulliez M, Gachelin FM, Vainchenker W, Villeval JL. JAK2V617F

expression in murine hematopoietic cells leads to MPD mimicking human PV with secondary

myelofibrosis. Blood. 2006;108(5):1652-1660.

40. Akada H, Yan D, Zou H, Fiering S, Hutchison RE, Mohi MG. Conditional expression of

heterozygous or homozygous Jak2V617F from its endogenous promoter induces a

polycythemia vera-like disease. Blood. 2010;115(17):3589-3597.

41. Tiedt R, Hao-Shen H, Sobas MA, et al. Ratio of mutant JAK2-V617F to wild-type Jak2

determines the MPD phenotypes in transgenic mice. Blood. 2008;111(8):3931-3940.

42. Pinto AI, Brown N, Preham O, Doehl JSP, Ashwin H, Kaye PM. TNF signalling drives

expansion of bone marrow CD4+ T cells responsible for HSC exhaustion in experimental

visceral leishmaniasis. PLoS Pathog. 2017;13(7):e1006465.

43. Nemeth K, Keane-Myers A, Brown JM, et al. Bone marrow stromal cells use TGF-beta

to suppress allergic responses in a mouse model of ragweed-induced asthma. Proc Natl Acad

Sci USA. 2010;107(12):5652-5657.

44. Mounayar M, Kefaloyianni E, Smith B, et al. PI3kalpha and STAT1 interplay regulates

human mesenchymal stem cell immune polarization. Stem Cells. 2015;33(6):1892-1901.

45. Le Blanc K, Mougiakakos D. Multipotent mesenchymal stromal cells and the innate

immune system. Nat. Rev. Immunol. 2012;12(5):383-396.

46. Kim SJ, Shan P, Hwangbo C, et al. Endothelial toll-like receptor 4 maintains lung

integrity via epigenetic suppression of p16(INK4a). Aging Cell. 2019:e12914.

47. Hoermann G, Cerny-Reiterer S, Herrmann H, et al. Identification of oncostatin M as a

JAK2 V617F-dependent amplifier of cytokine production and bone marrow remodeling in

myeloproliferative neoplasms. FASEB J. 2012;26(2):894-906.

21

48. Li Y, Wang L, Pappan L, Galliher-Beckley A, Shi J. IL-1beta promotes stemness and

invasiveness of colon cancer cells through Zeb1 activation. Mol Cancer. 2012;11:87.

49. Suboticki T, Mitrovic Ajtic O, Beleslin-Cokic BB, et al. IL-6 stimulation of DNA

replication is JAK1/2 mediated in cross-talk with hyperactivated ERK1/2 signaling. Cell Biol.

Int. 2019;43(2):192-206.

50. Dominici M, Le Blanc K, Mueller I, et al. Minimal criteria for defining multipotent

mesenchymal stromal cells. The International Society for Cellular Therapy position statement.

Cytotherapy. 2006;8(4):315-317.

Figure legends

Figure 1

Transcriptomic analysis revealed multiple abnormalities in BM-MSCs from patients

with JAK2V617F-positive ET

A. Heatmap of transcriptomic analysis from eight MSC samples (control, n = 5; untreated

patients with JAK2V617F-positive ET, n = 3) demonstrated that MSCs from patients with

JAK2V617F-positive ET differed from those isolated from HDs. Briefly, 1 195 genes were

identified with a cut-off of greater than 2.0-fold for gene expression change and p < 0.05. B.

GO analysis of genes enriched in terms of different function showed changes in gene sets

related to the cell cycle, cell differentiation, proliferation, death, and aging. C. KEGG

analysis was carried out to identify differential pathway enrichment between ET and control.

Rich factor refers to the ratio of the number of genes differentially expressed in the pathway

entry to the total number of genes in the pathway entry. A larger rich factor indicates a higher

degree of enrichment. The Q value is the p-value after multiple-hypothesis test corrections,

ranging from 0 to 1 (a value closer to zero indicates a more significant enrichment). The

figure is plotted with the top 20 paths sorted according to the Q value from small to large and

shows enrichment of genes of inflammation pathways. D. GSEA using MSigDB identified

22

differential gene enrichment between ET and the control. NES, Normal p and FDR q values

for each gene set are shown. The results revealed differential expression of genes involved in

cell cycle, inflammatory responses, and hematopoietic support. E. qPCR validation of

relevant genes (control, n = 16; untreated patients with JAK2V617F-positive ET, n = 16).

MSCs used for gene analysis were isolated and expanded in vitro and identified according to

the minimal criteria for defining multipotent mesenchymal stromal cells stated by the

International Society for Cellular Therapy position at passage four.50 *p < 0.05; **p < 0.01,

***p < 0.001; ****p < 0.0001. Data are presented as the mean or mean ± SEM.

Abbreviations: ET, essential thrombocythemia; HDs, healthy donors; GO, Gene Ontology;

KEGG, Kyoto Encyclopedia of Genes and Genomes; GSEA, gene set enrichment analysis;

MSigDB, Molecular Signatures Database; NES, normalized enrichment score; qPCR,

quantitative real-time polymerase chain reaction; n, number of unique donors in each group;

ns, not significant.

Figure 2.

BM-MSCs from patients with JAK2V617F-positive ET show enhanced proliferation and

attenuated apoptosis, senescence, and differentiation

A. Growth curves of BM-MSCs isolated from HDs (n = 12) and patients with

JAK2V617F-positive ET (n = 12). The ET MSCs grew progressively faster than controls. B.

Decreased apoptosis of BM-MSCs derived from patients with JAK2V617F-positive ET as

determined by flow cytometry (control, n = 16; ET, n = 16). C. The number of

β-galactosidase–positive cells were lower in BM-MSCs derived from patients with

JAK2V617F-positive ET compared to those from control patients (control, n = 16; ET, n =

16). D. Differentiation potentials of MSCs toward adipocytes, osteoblasts, and chondroblasts

were assessed by Oil Red O, Alizarin Red, and Alcian Blue staining, respectively, after

induction for 14–21 days. Representative micrographs of BM-MSCs derived from HDs, and

patients with JAK2V617F-positive ET are shown. Variations in the differentiation between

HD (n = 12) and ET samples (n = 16) were quantified by the staining index described in the

23

Methods section. E. Cell cycle status was determined by flow cytometry. Patients with

JAK2V617F-positive ET had less MSCs in the G1 phase and more in the S and G2 phases

relative to those in the HD controls (control, n = 12; ET, n = 12). F. NES mRNA expression

in BM cells of the controls (n = 17) and patients with JAK2V617F-positive ET (n = 16). G.

NES-positive cells in the bone marrow of an HD control (n =1) and patient with

JAK2V617F-positive ET (n = 1) shown by immunofluorescence. H. BM sections of the

controls and patients with JAK2V617F-positive ET immunostained with NES (brown).

(control, n = 8; ET, n = 37; upper panels); BM sections of the controls and patients with

JAK2V617F-positive ET immunostained with NES (red) and CD34 (brown). (control, n = 8;

ET, n = 37; lower panels). MSCs used in each assay were at passage four (except for those

immunostained with NES or NES and CD34). *p < 0.05; **p < 0.01, ***p < 0.001; Data are

presented as the mean ± SEM. Abbreviations: ET, essential thrombocythemia; HDs, healthy

donors; n, number of unique donors in each group; IF, immunofluorescence; ns, not

significant.

Figure 3

BM-MSCs from patients with JAK2V617F-positive ET show insufficient ability to

support normal hematopoiesis

A. Representative micrographs of CFUs formed by purified normal CD34-positive cells in

the presence of BM-MSCs from HDs (n = 12) and patients with JAK2V617F-positive ET (n =

16). B. Numbers of BFU-E, CFU-E, CFU-GM, CFU-Mix, CFU-Total, and CFU-MK formed

by purified normal CD34-positive cells after coculture with BM-MSCs from HDs (n = 12) or

from patients with JAK2V617F-positive ET (n = 16) for 7 or 14 days. After 7 or 14 days of

coculture of purified normal CD34-positive cells and MSCs from patients with

JAK2V617F-positive ET, the numbers of CFU-GM and CFU-Total were significantly lower,

with no significant changes in the numbers of BFU-E, CFU-E, CFU-Mix, and CFU-MK. C.

Cytokines secreted by BM-MSCs into the culture medium analyzed by ELISA (control, n =

16; JAK2V617F-positive ET, n = 16). MSCs used in each assay were at passage four. *p <

24

0.05; **p < 0.01, ***p < 0.001. Data are presented as the mean ± SEM. Abbreviations: ET,

essential thrombocythemia; HDs, healthy donors; ELISA, enzyme-linked immunosorbent

assay; n, number of unique donors in each group; ns, not significant; BFU-E, burst-forming

unit erythroid; CFU-E, colony-forming units erythroid; CFU-GM, colony-forming units of

granulocyte macrophages; CFU-Mix, colony-forming units mixed; CFU-Total, total

colony-forming units; CFU-MK, colony-forming units, megakaryocytes.

Figure 4

BM-MSCs from patients with JAK2V617F-positive ET have an impaired

immunomodulatory capacity

A–B. Proliferation (A) and activation (B) of CD4-positive T cells from HDs (n = 12) and

patients with JAK2V617F-positive ET (n = 12). C. Expression of T-cell subset transcription

factors in bone marrow mononuclear cells (BMMCs) derived from HDs (n = 12) and patients

with JAK2V617F-positive ET (n = 12). T-cell–expressed transcription factors T-bet, GATA-3,

RORγt, and FOXP3, representing Th1, Th2, Th17, and Treg cells, respectively. D.

Flow-cytometric analysis of the T-cell subset in the bone marrow of HDs (n = 16) and

patients with JAK2V617F-positive ET (n = 16). CD4-positive cells were sorted into Th1, Th2,

Th17, and Treg subsets according to the expression of IFN-γ, IL-4, IL-17 and FOXP3 with

CD25. The number of the Th2 subset in patients with JAK2V617F-positive ET was lower

relative to that in the control group. E. A Luminex assay performed using the supernatant of

bone marrow extract from HDs (n = 20) and from patients with JAK2V617F-positive ET (n =

24), revealed a decreased level of IL-4 and elevated IL-1β and sCD40L levels in ET. F–G.

Proliferation (F) and activation (G) of normal CD4-positive T cells were higher after

coculture with BM-MSCs from patients with JAK2V617F-positive ET (n = 8) relative to

those observed with HD MSCs (n = 8). H. Flow-cytometric analysis of T-cell subsets showed

lower number of Th2 cells formed from normal BMMCs after coculture with BM-MSCs

from patients with JAK2V617F-positive ET (n = 12) relative to those with HD MSCs (n = 12).

I. Decreased level of IL-4 and increased level of sCD40L were found in the supernatant of

25

cell coculture medium of normal CD4-positive T cells and BM-MSCs isolated from patients

with JAK2V617F-positive ET, as determined by ELISA (control, n = 12; ET, n = 12). MSCs

used in each assay were at passage four. *p < 0.05; **p < 0.01. Data are presented as the

mean ± SEM. Abbreviations: ET, essential thrombocythemia; HDs, healthy donors; BMMCs,

bone marrow mononuclear cell; ELISA, enzyme-linked immunosorbent assay; n, number of

unique donors in each group.

Figure 5

Low expression of WDR4 is correlated with enhanced proliferation, decreased

senescence, and impaired differentiation of BM-MSCs isolated from patients with

JAK2V617F-positive ET

A. WDR4 mRNA expression in BM-MSCs isolated from the controls (n = 20) and patients

with JAK2V617F-positive ET (n = 15). B. WDR4 protein expression in BM-MSCs isolated

from the controls (n = 4) and patients with JAK2V617F-positive ET (n = 4). C–D. WDR4

shRNA and cDNA decreased or increased WDR4 expression in BM-MSCs efficiently, as

determined by qPCR (C) and western blotting (D). E. WDR4 cDNA treatment decreased the

proliferative capacity of BM-MSCs, while WDR4 shRNA treatment increased the

proliferation of BM-MSCs, as measured by the CCK-8 assay. F. WDR4 cDNA increased

senescence of BM-MSCs as measured by β-galactosidase staining while WDR4 shRNA had

the opposite effect. G. WDR4 increased the differentiation potential of BM-MSCs into

adipocytes, osteoblasts, and chondrocytes as indicated by Oil Red O, Alizarin Red, and

Alcian Blue staining, respectively. MSCs used in each assay were at passage four. All the

experiments (except for quantitation of WDR4 mRNA and WDR4 protein expression in

clinical samples) were repeated at least three times. *p < 0.05; **p < 0.01; ***p < 0.001;

****p < 0.0001. Data are presented as the mean ± SD (except for mRNA expression of

WDR4 in clinical samples, mean ± SEM). Abbreviations: ET, essential thrombocythemia;

CCK-8, Cell Counting Kit 8; n, number of unique donors in each group; NC, normal control.

26

Figure 6

Insufficient action of the WDR4–IL-6 axis decreases hematopoiesis-supportive activities

of BM-MSCs from patients with JAK2V617F-positive ET

A–B. Numbers of BFU-E, CFU-E, CFU-GM, CFU-Mix, and CFU-MK formed by purified

normal CD34-positive cells after coculture with BM-MSCs infected with LV-shWDR4, or

LV-WDR4. WDR4 increased the number of BFU-E, CFU-GM, and CFU-Total formed by

normal CD34-positive cells (A). No changes were observed in the number of CFU-MK (B).

C. WDR4 increased the secretion of IL-6 from BM-MSCs as determined by ELISA on the

supernatants obtained from the MSC cultures. D–E. WDR4 increased the intracellular

expression of IL-6 in BM-MSCs as determined by western blotting (D) and qPCR (E). MSCs

used in each assay were at passage four. All the experiments were repeated at least three

times. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. Data are presented as the mean

± SD. Abbreviations: qPCR, quantitative real-time polymerase chain reaction; BFU-E,

burst-forming unit erythroid; CFU-GM, colony-forming units, granulocyte macrophages;

CFU-Total, total colony-forming units; CFU-MK, colony-forming units, megakaryocytes; n,

number of unique donors in each group; ns, not significant; NC, normal control.

Figure 7

WDR4 acts through the ERK–GSK3β–CREB pathway to enhance IL-6 expression and

secretion by BM-MSCs

A. Graphic representation of the quantification of 12 proteins with the most significant

difference in phosphorylation status between MSCs infected with LV-shWDR4 and MSCs in

the control group, as measured by a phospho-kinase array of 43 phosphorylated kinases. B.

Western blot analysis of phosphorylation levels of GSK3β (S9), AKT1/2/3 (S472/S473/S474),

ERK1/2 (T202/Y204, T185/Y187), and CREB (S133) in MSCs infected with LV-shWDR4

or LV-WDR4 and their respective controls. C. CREB-specific siRNA decreased CREB

expression in BM-MSCs efficiently, as determined by qPCR and western blotting. D–F. IL-6

27

induction by WDR4 overexpression was at least partially suppressed by an ERK1/2 inhibitor

(SCH772984), GSK3 inhibitor (SB216763), or CREB-specific siRNA as determined by

qPCR (D), western blotting (E), and ELISA (F). MSCs used in each assay were at passage

four. All the experiments were repeated at least three times. *p < 0.05; **p < 0.01; ***p <

0.001; ****p < 0.0001. Data are presented as the mean ± SD. Abbreviations: qPCR,

quantitative real-time polymerase chain reaction; ELISA, enzyme-linked immunosorbent

assay; NC, normal control.

Figure 8

Neuropathy and aberrant expression of IL-1β in the bone marrow of patients with

JAK2V617F-positive ET

A. Sympathetic nerve fibers quantitated with the help of an anti-TH antibody (control, n = 9;

ET, n = 42), and Schwann cells visualized using an anti-GFAP antibody (control, n = 9; ET,

n = 40) decreased in the bone marrow of patients with JAK2V617F-positive ET relative to

those in the HDs, as determined by immunohistochemistry. B. Increased expression of B3AR

in the bone marrow of patients with JAK2V617F-positive ET (n = 4) relative to the HDs (n =

4) as determined by western blotting. C–D. Lower NE levels (C) (control, n = 20; ET, n = 20)

and higher IL-1β levels (D) (control, n = 20; ET, n = 20) in the bone marrow of patients with

JAK2V617F-positive ET relative to the control, as measured by ELISA on the supernatant of

the bone marrow aspirates. E. A model illustrating bone marrow hematopoietic dysfunction

in JAK2V617F-positive ET. *p < 0.05; **p < 0.01, ***p < 0.001; ****p < 0.0001. Data are

presented as the mean ± SEM. Abbreviations: ET, essential thrombocythemia; HDs, healthy

donors; n, number of unique donors in each group; TH, tyrosine hydroxylase; GFAP, glial

fibrillary acidic protein; NE, norepinephrine; B3AR, β3 adrenoceptor; IHC,

immunohistochemistry.

Supplementary Materials

Supplementary Tables

Table S1. Demographics of patients and healthy donors

ET (n = 91) HD (n = 50)

Age (years) 53 (23–79) 34 (14–52)

Female/male 73/18 12/38

Cytogenetics JAK2V617F-positive -

Treatment untreated or discontinued -

ET = essential thrombocythemia; HD = healthy donor

Table S2. Gene-specific primers used in this study

GAPDH Forward Primer GGAGCGAGATCCCTCCAAAAT

Reverse Primer GGCTGTTGTCATACTTCTCATGG

NES Forward Primer CTGCTACCCTTGAGACACCTG

Reverse Primer GGGCTCTGATCTCTGCATCTAC

IL-6 Forward primer ACTCACCTCTTCAGAACGAATTG

Reverse primer CCATCTTTGGAAGGTTCAGGTTG

BTG2 Forward primer CCTGTGGGTGGACCCCTAT

Reverse primer GGCCTCCTCGTACAAGACG

FOS Forward Primer GGGGCAAGGTGGAACAGTTAT

Reverse Primer CCGCTTGGAGTGTATCAGTCA

T-bet Forward Primer GTCCAACAATGTGACCCAGAT

Reverse Primer ACCTCAACGATATGCAGCCG

GATA3 Forward Primer GCCCCTCATTAAGCCCAAG

Reverse Primer TTGTGGTGGTCTGACAGTTCG

ROR-γt Forward Primer GTGGGGACAAGTCGTCTGG

Reverse Primer AGTGCTGGCATCGGTTTCG

FOXP3 Forward Primer GTGGCCCGGATGTGAGAAG

Reverse Primer GGAGCCCTTGTCGGATGATG

WDR4 Forward Primer TAACCGATGACAGTAAGCGTCT

Reverse Primer TCTCCTCCGAGGCTATGAAAG

CREB Forward Primer ATTCACAGGAGTCAGTGGATAGT

Reverse Primer CACCGTTACAGTGGTGATGG

CCND1 Forward Primer GCTGCGAAGTGGAAACCATC

Reverse Primer CCTCCTTCTGCACACATTTGAA

CDKN1C Forward Primer CATCCACGATGGAGCGTCTTGTC

Reverse Primer TCTGGTCCTCGGCGTTCAGC

WNT9A Forward Primer GCATCTGAAGCACAAGTATGAG

Reverse Primer CAGAAGCTAGGCGAGTCATC

DAPK1 Forward Primer ACGTGGATGATTACTACGACACC

Reverse Primer TGCTTTTCTCACGGCATTTCT

CEBPA Forward Primer GACAAGAACAGCAACGAGTAC

Reverse Primer TCATTGTCACTGGTCAGCTC

LEP Forward Primer TGCCTTCCAGAAACGTGATCC

Reverse Primer CTCTGTGGAGTAGCCTGAAGC

MMP1 Forward Primer AAAATTACACGCCAGATTTGCC

Reverse Primer GGTGTGACATTACTCCAGAGTTG

TLR3 Forward Primer AATCTGTCTCTGAGTAACAGCC

Reverse Primer GGAAAGATCGAGCATAGTGAGA

TLR4 Forward Primer GACTGGGTAAGGAATGAGCTAG

Reverse Primer ACCTTTCGGCTTTTATGGAAAC

Table S3. ELISA kits used in this study

Human IL-6 Quantikine ELISA Kit D6050 (R&D Systems, Minnneapolis,

MN, USA)

Human CXCL12/SDF-1 alpha

Quantikine ELISA Kit

DSA00 (R&D Systems, Minnneapolis,

MN, USA)

Human SCF Quantikine ELISA Kit DCK00 (R&D Systems, Minnneapolis,

MN, USA)

Norepinephrine ELISA Kit KA1891 (Abnova, Taiwan, China)

Human IL-1 beta/IL-1F2 Quantikine

ELISA Kit

DLB50 (R&D Systems, Minnneapolis,

MN, USA)

Human IL-4 Quantikine ELISA Kit D4050 (R&D Systems, Minnneapolis,

MN, USA)

Human CD40 Ligand/TNFSF5

Quantikine ELISA Kit

DCDL40 (R&D Systems, Minnneapolis,

MN, USA)

Human Leptin Quantikine ELISA Kit DLP00 (R&D Systems, Minnneapolis,

MN, USA)

Human Thrombopoietin Quantikine

ELISA Kit

DTP00B (R&D Systems, Minnneapolis,

MN, USA)

Human VEGF Quantikine ELISA Kit DVE00 (R&D Systems, Minnneapolis,

MN, USA)

Human G-CSF Quantikine ELISA Kit DCS50 (R&D Systems, Minnneapolis,

MN, USA)

Human M-CSF Quantikine ELISA Kit DMC00B (R&D Systems,

Minnneapolis, MN, USA)

Human GM-CSF Quantikine ELISA Kit DGM00 (R&D Systems, Minnneapolis,

MN, USA)

Table S4. Antibodies and inhibitors used in this study

Anti-Nestin antibody [10C2] ab22035 (Abcam, Cambridge, UK)

Anti-CD34 antibody [EP373Y] (ab81289) (Abcam, Cambridge, UK)

Goat Anti-Mouse IgG H&L (Alexa

Fluor® 594)

ab150116 (Abcam, Cambridge, UK)

GAPDH (D4C6R) Mouse mAb 97166 (Cell Signaling Technology,

Boston, MA, USA)

Anti-WDR4 antibody [EPR11052] ab169526 (Abcam, Cambridge, UK)

Goat Anti-Rabbit IgG H&L (HRP) ab6721 (Abcam, Cambridge, UK)

Rabbit Anti-Mouse IgG H&L (HRP) ab6728 (Abcam, Cambridge, UK)

Goat Anti-Mouse IgG H&L (Alkaline

Phosphatase)

ab97020 (Abcam, Cambridge, UK)

Anti-IL-6 antibody ab6672 (Abcam, Cambridge, UK)

Anti-AKT3 + AKT2 + AKT1 antibody

[Y89]

ab32505 (Abcam, Cambridge, UK)

Anti-AKT3 (phospho S472) + AKT2

(phospho S474) + AKT1 (phospho

S473) antibody [EPR18853]

ab192623 (Abcam, Cambridge, UK)

Anti-ERK1 + ERK2 antibody

[EPR17526]

ab184699 (Abcam, Cambridge, UK)

Anti-Erk1 (pT202/pY204) + Erk2

(pT185/pY187) antibody [EP197Y]

ab76299 (Abcam, Cambridge, UK)

Anti-GSK3 beta antibody [Y174] ab32391 (Abcam, Cambridge, UK)

Anti-GSK3 beta (phospho S9) antibody

[EPR2286Y]

ab75814 (Abcam, Cambridge, UK)

Anti-CREB antibody [E306] ab32515 (Abcam, Cambridge, UK)

Anti-CREB (phospho S133) antibody

[E113]

ab32096 (Abcam, Cambridge, UK)

Anti-Adrenergic Receptor Antibody, β 3 AB5122 (Merck Millipore, Darmstadt,

Germany)

Anti-Tyrosine Hydroxylase antibody ab112 (Abcam, Cambridge, UK)

Anti-GFAP antibody [2A5] ab4648 (Abcam, Cambridge, UK)

pan-Akt inhibitor (GDC-0068) CAS No. : 1001264-89-6

(MedChemExpress, NJ, USA)

ERK1 and ERK2 inhibitor

(SCH772984)

CAS No. : 942183-80-4

(MedChemExpress, NJ, USA)

Selective GSK-3 inhibitor (SB216763) CAS No. : 280744-09-4

(MedChemExpress, NJ, USA)

Ultra-LEAF™ Purified anti-human CD3

Antibody

317326 (BioLegend, San Diego, CA,

USA)

Ultra-LEAF™ Purified anti-human

CD28 Antibody

302934 (BioLegend, San Diego, CA,

USA)

APC anti-human CD69 Antibody 310910 (BioLegend, San Diego, CA,

USA)

PE anti-human CD25 Antibody 302606 (BioLegend, San Diego, CA,

USA)

PE anti-human CD73

(Ecto-5'-nucleotidase) Antibody

344004 (BioLegend, San Diego, CA,

USA)

PE anti-human CD105 Antibody 323206 (BioLegend, San Diego, CA,

USA)

PE anti-human CD11a Antibody 301208 (BioLegend, San Diego, CA,

USA)

PE anti-human CD14 Antibody 367104 (BioLegend, San Diego, CA,

USA)

PE anti-human CD19 Antibody 392506 (BioLegend, San Diego, CA,

USA)

PE anti-human CD34 Antibody 343606 (BioLegend, San Diego, CA,

USA)

PE anti-human IgG Fc Antibody 409304 (BioLegend, San Diego, CA,

USA)

FITC anti-human CD90 (Thy1)

Antibody

328108 (BioLegend, San Diego, CA,

USA)

FITC anti-human CD45 Antibody 368508 (BioLegend, San Diego, CA,

USA)

FITC anti-human HLA-DR Antibody 307604 (BioLegend, San Diego, CA,

USA)

Supplementary Figures

Figure S1

B

Items JAK2V617F+ ET (%) Healthy donors (%) p

CD73 95.6 ± 0.41 97.19 ± 0.92 > 0.05

CD90 98.00 ± 0.21 98.26 ± 0.33 > 0.05

CD105 85.21 ± 0.37 84.39 ± 0.71 > 0.05

CD11a - - -

CD14 - - -

CD19 - - -

CD34 - - -

CD45 - - -

HLA-DR - - -

Figure S1

Immunophenotypes and morphology of mesenchymal stromal cells (MSCs) from

healthy donors and patients with JAK2V617F-positive ET.

A. Representative morphology of MSCs derived from HDs and patients with

JAK2V617F-positive ET. There were no obvious differences between the HD-MSCs

and ET-MSCs. B. Immunophenotypic analysis showed that MSCs from both HDs and

JAK2V617F-positive ET patients expressed high levels of MSC surface markers

(CD73, CD90, and CD105), but did not express hematopoietic surface markers, such

as CD11a, CD14, CD19, CD34, CD45, and HLA- DR.

Figure S2

Figure S2

WDR4 in MSCs does not bias the inflammation state of CD4-positive T cells.

A-C. WDR4 in MSCs does not bias the proliferation (A), activation (B), secretory

phenotype (C) of CD4-positive T cells and show no influence on the number of Th2

cells (D).

Figure S3

Figure S3

Apoptosis was not influenced by WDR4 in MSCs

A. The level of WDR4 expression had no effect on the apoptosis of MSCs. B.

Representative micrographs of MSCs transfected with WDR4 complementary DNA

(cDNA) or short hairpin RNA (shRNA) and their respective controls.

Supplementary Methods

Patients and samples

Eighty-seven never treated or currently untreated patients with ET and forty-eight

healthy donors (HDs) were included in this study with maximum number of

specimens in each experiment was forty-two. The patients that had been diagnosed

with ET according to the 2016 version of the World Health Organization (WHO)

diagnostic criteria for myeloid neoplasms were JAK2V617F-positive.1 The clinical

specimens used in the present study were sourced primarily from the pathological cell

bank of our hospital. The study was conducted according to the Declaration of

Helsinki and approved by our local institutional review board.

Isolation, expansion, and characterization of MSCs

Following isolation by density centrifugation, 2–4 × 107 mononuclear cells were

cultured in Dulbecco’s Modified Eagle Medium Nutrient Mixture F-12 (Ham)

containing 12% fetal bovine serum and 1% penicillin/streptomycin/L-glutamine

(Sigma-Aldrich, St Louis, MO, USA) at 37°C and 5% CO2 in a humidified

atmosphere. The medium was changed after 48 h and every 3–4 days thereafter.

When the cultures reached 80% confluence, the cells were passaged and frozen for

study. To fulfill the criteria of the international society for cellular therapy, and to

exclude contamination of MSC cultures by hematopoietic cells, the MSCs were

analyzed for the expression of CD73, CD90, CD105, CD11a, CD14, CD19, CD34,

CD45, and HLA-DR, by flow cytometry.2 In addition to the analysis of surface

markers, differentiation assays were performed in passage four. We deposited 5 × 104

MSCs in 24-well plates, and performed adipogenic, osteogenic, and chondrogenic

differentiation using a StemPro™ Adipogenesis Differentiation Kit, a StemPro™

Osteogenesis Differentiation Kit, and a StemPro™ Chondrogenesis Differentiation

Kit, respectively (all Invitrogen Gibco, Carlsbad, CA, USA). All images were

captured using an Axiovert 25 microscope (Zeiss, Jena, Germany). For the purpose of

quantification, the differentiation was graded according to microscopic analysis of the

stain index determined by multiplying the score for staining intensity with the score

for positive areas. Two members of our experimental team conducted double-blind

readings. We used semi-quantitative results to determine the percentage of positive

cells and the staining intensity under the microscope. Five high-power fields were

observed in each plate, and the staining intensity and percentage of positive cells was

counted. The staining intensity was scored as follows: 0 = no dyeing; 1 = weak dyeing;

2 = moderate dyeing; 3 = intense dyeing. The frequency of positive dyeing cells was

defined as follows: 0, less than 5%; 1, 5–25%; 2, 26–50%; 3, 51–75%; 4, greater than

75%.3, 4

MSC proliferation assay

We deposited 1 × 104 MSCs in 96-well plates. The MSC proliferation assay was

performed using Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies,

Rockville, MD, USA), according to the manufacturer’s protocol.

Cell cycle analysis of MSCs

For cell cycle analysis, we collected 5 × 104 of the cultured cells and fixed them in

70% ethanol for 30 min. After washing the cells with phosphate-buffered saline (PBS)

and treating them with RNase A (Sigma-Aldrich, St. Louis, MO, USA) for 30 min, we

incubated the cells with propidium iodide (Sigma-Aldrich, St. Louis, MO, USA) for

15 min, and investigated them using flow cytometry.

Investigation of apoptosis in the MSCs

Apoptosis was determined by detecting phosphatidylserine exposure on the cell

plasma membrane. We harvested 5 × 104 cells and washed them in ice-cold PBS,

resuspended them in 300ul of binding buffer, and incubated them with 5ul of Annexin

V-647 solution for 30 min at 4°C in the dark. This step was followed by further

incubation with 5ul of propidium iodide for 5 min, after which the samples were

immediately analyzed by flow cytometry.

Investigation of MSC senescence

We deposited 5 × 104 MSCs in 24-well plates, and used a Senescence β-Galactosidase

Staining Kit (Cell Signaling Technology, Boston, MA, USA) according to the

manufacturer’s instructions to evaluate the senescence in the MSCs. The cells were

counted using a light microscope, and the fraction of senescent cells

(β-galactosidase-positive) was determined.

Transcriptomic and quantitative real-time polymerase chain reaction (qPCR)

analysisof the MSCs

Total RNA was isolated from MSCs at passage four using an RNeasy Mini Kit

(Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Following

extraction of the total RNA, the eukaryotic mRNA was enriched using Oligo(dT)

beads, and the prokaryotic mRNA was enriched by removing rRNA using a

Ribo-ZeroTM Magnetic Kit (Epicentre, Madison, WI, USA). The enriched mRNA was

then separated into short fragments using a fragmentation buffer, and

reverse-transcribed into complementary DNA (cDNA) with random primers.

Second-strand cDNA molecules were synthesized by DNA polymerase I and RNase H

using dNTPs and a buffer. We then purified the cDNA fragments with a QIAquick

PCR extraction kit, repaired the ends, added a poly(A) tail, and ligated the molecules

to Illumina sequencing adapters. The ligation products were size-selected by agarose

gel electrophoresis, amplified by PCR, and sequenced using Illumina HiSeq™ 2500

(Gene Denovo Biotechnology, Guangzhou, China). We carried out gene ontology

(GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and gene set enrichment

analysis (GSEA) computational assays. To verify the authenticity of the sequencing

results, we carried out qPCR with sequence-specific oligonucleotide primers, as

described in a previous study.5

Isolation of CD34-positive cells

We obtained mononuclear cells by the density gradient method. Subsequently,

CD34-positive cells were sorted using magnetic beads according to the

manufacturer’s instructions (Miltenyi Biotec, Bergisch Gladbach, Germany).

Colony-forming unit assay

We co-cultured the MSCs and healthy donor-derived CD34-positive cells for 7 or 14

days. The suspended cells were seeded in methylcellulose medium H4534 (Stem Cell

Technologies, Vancouver, Canada), and cultured for 2 weeks. Following co-culture in

H3000 medium (StemCell Technologies, Vancouver, Canada), we cultured a

suspension of cells on semi-solid medium 04971 (StemCell Technologies, Vancouver)

for CFU-MK analysis. Two weeks later, we dehydrated and fixed the cells and

sequentially stained the cells according to the manufacturer’s instructions. We then

counted the clones to evaluate the in vitro effect of MSCs on CFU growth.

Isolation of CD4-positive cells

We obtained mononuclear cells from the bone marrow aspirate by the density gradient

method, and subsequently sorted the CD4-positive cells using magnetic beads

according to the manufacturer’s instructions (Miltenyi Biotec, Bergisch Gladbach,

Germany).

CD4-positive cell proliferation assay

We deposited 1 × 105 CD4-positive cells in 96-well plates. The proliferation assay

was performed using Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies,

Rockville, MD), according to the manufacturer’s instructions.

CD4-positive T cell activation

We deposited 1 × 105 CD4-positive cells and stimulated them with soluble anti-CD3

(5 µg/mL) and anti-CD28 (5 µg/mL) in the presence of IL-2 (300 U/mL) in 96-well

plates. The CD4-positive T cells were analyzed by flow cytometry using antibodies to

CD25 and CD69.

Detection of Th1, Th2, and Th17 cells and regulatory T cells (Tregs)

Bone marrow mononuclear cells (BMMCs) were obtained from HDs and stimulated

by standard procedures.6 Th1, Th2, and Th17 cells were detected using the Human

Th1/Th2/Th17 Phenotyping Kit (BD Biosciences, San Jose, CA, USA), and Tregs

were detected with the True-NuclearTM One Step Staining Human Treg FlowTM Kit

(Biolegend, San Diego, CA, USA) according to the manufacturer’s instructions.

Gene silencing and overexpression

Lentiviruses carrying WDR4 shRNA or cDNA were purchased from Genechem Co.,

Ltd. (Shanghai, China). MSC transduction was performed according to the

manufacturer’s protocols. Briefly, an 80–100% infection rate was achieved.

Phospho-kinase antibody array

Total protein samples were extracted from MSCs and assessed for the

phospho-kinases with the Human Phospho-Kinase Array (R&D Systems, Catalog #

ARY003B) according to the manufacturer’s instructions.

Western blotting

Western blotting was performed using standard procedures. A list of antibodies is

provided in Supplementary Table S4.

Immunohistochemical and immunofluorescent analyses

Sections (10µm for nerve fibers and 5um for others) were prepared from

paraffin-embedded tissue samples and then incubated with antibodies using standard

procedures. ImageJ software (NIH, Bethesda, MD, USA) was used to calculate the

number of positively stained cells per unit area. A list of antibodies is provided in

Supplementary Table S4.

Statistical analysis

We analyzed data that conformed to Gaussian distribution using the Student’s t-test.

Data that did not conform to Gaussian distribution were analyzed using the

Mann–Whitney U rank sum test. All data are reported as mean values and SDs or

SEMs. We considered data with p-values < 0.05 to be statistically significant. The

analysis described above was performed using GraphPad Prism software (version

7.0a).

References

1. Arber DA, Orazi A, Hasserjian R, et al. The 2016 revision to the World Health

Organization classification of myeloid neoplasms and acute leukemia. Blood.

2016;127(20):2391-2405.

2. Dominici M, Le Blanc K, Mueller I, et al. Minimal criteria for defining

multipotent mesenchymal stromal cells. The International Society for Cellular

Therapy position statement. Cytotherapy. 2006;8(4):315-317.

3. Geyh S, Oz S, Cadeddu RP, et al. Insufficient stromal support in MDS results

from molecular and functional deficits of mesenchymal stromal cells. Leukemia.

2013;27(9):1841-1851.

4. Stefansson IM, Salvesen HB, Akslen LA. Prognostic impact of alterations in

P-cadherin expression and related cell adhesion markers in endometrial cancer. J Clin

Oncol. 2004;22(7):1242-1252.

5. Zhao Y, Guo J, Zhang X, et al. Downregulation of p21 in myelodysplastic

syndrome is associated with p73 promoter hypermethylation and indicates poor

prognosis. AM J CLIN PATHOL. 2013;140(6):819-827.

6. Talaat RM, Mohamed SF, Bassyouni IH, et al. Th1/Th2/Th17/Treg cytokine

imbalance in systemic lupus erythematosus (SLE) patients: Correlation with disease

activity. Cytokine. 2015;72(2):146-153.