Molecular Microbiology (1999) 32(5), 1090–1102

Multiple hok genes on the chromosome ofEscherichia coli

Kim Pedersen and Kenn Gerdes*

Department of Molecular Biology, Odense University,

Campusvej 55, DK-5230 Odense M, Denmark.

Summary

The hok/sok locus of plasmid R1 mediates plasmid

stabilization by the killing of plasmid-free cells. Many

bacterial plasmids carry similar loci. For example,

the F plasmid carries two hok homologues, ¯m and

srnB, that mediate plasmid stabilization by this spe-

cialized type of programmed cell death. Here, we

show that the chromosome of E. coli K-12 codes for

®ve hok homologous loci, all of which specify Hok-

like toxins. Three of the loci appear to be inactivated

by the insertion elements IS150 or IS186 located close

to but not in the toxin-encoding reading frames (i.e.

hokA , hokC and hokE ), one system is probably inacti-

vated by point mutation (hokB ), whereas the ®fth sys-

tem is inactivated by a major genetic rearrangement

(hokD ). In the ECOR collection of wild-type E. coli

strains, we identi®ed hokA and hokC loci without IS

elements. A molecular and a genetic analysis show

that the hokA and hokC loci specify unstable antisense

RNAs and stable toxin-encoding mRNAs that are pro-

cessed at their 38 ends. An alignment of the mRNA

sequences reveals all the regulatory elements known

to be required for correct folding and refolding of the

plasmid-encoded mRNAs. The conserved elements

include fbi that ensure a long-range interaction in the

full-length mRNAs, and tac and antisense RNA target

stem±loops that are required for translation and rapid

antisense RNA binding of the processed mRNAs. Con-

sistently, we ®nd that the chromosome-encoded

mRNAs are processed at their 38 ends, resulting in

the presumed translationally active mRNAs. Despite

the presence of all of the regulatory elements, the

chromosome-encoded loci do not mediate plasmid

stabilization by killing of plasmid-free cells. The chro-

mosome-encoded mRNAs are poorly translated in vitro,

thus yielding an explanation for the lacking phenotype.

These observations suggest that the chromosomal

hok-like genes may be induced by an as yet unknown

signal.

Introduction

In recent years, a large number of genes that mediate pro-

grammed cell death in bacteria have been identi®ed and

analysed (Jensen and Gerdes, 1995; Naito et al., 1995;

Yarmolinsky, 1995; Gerdes et al., 1997; Holcik and Iyer,

1997; Gotfredsen and Gerdes, 1998; Grùnlund and

Gerdes, 1999). The function of these genes has primarily

been ascribed to their ability to mediate plasmid main-

tenance by killing of plasmid-free cells. However, bacterial

chromosomes encode numerous genes that are homo-

logous to the plasmid-encoded killer genes.

Two types of loci that mediate plasmid stabilization

by post-segregational killing (PSK) have been described.

One type, the toxin±antitoxin gene systems, encodes a

stable toxin and an unstable protein antitoxin (Jensen

and Gerdes, 1995; Holcik and Iyer, 1997). The antitoxins

form tight complexes with the toxins and thereby neutral-

ize their toxicity. However, because the antitoxins are

degraded by cellular proteases (Lon or Clp), the plasmid-

free cells will experience a decay of the antitoxins. This,

in turn, leads to activation of the toxins and cell killing. A

large number of such loci have been identi®ed on plasmids,

but it becomes increasingly evident that they are abundant

on bacterial chromosomes as well (Gotfredsen and Gerdes,

1998). Recently, we identi®ed homologues of the E. coli

relBE toxin±antitoxin locus in Gram-positive and in Gram-

negative eubacteria, and in Archeae (Grùnlund and Gerdes,

1999). More surprisingly perhaps, plasmid-encoded restric-

tion modi®cation cassettes also mediate plasmid stabiliza-

tion by PSK (Kulakauskas et al., 1995; Naito et al., 1995).

The other type of PSK genes are regulated by antisense

RNA. Here, the toxins are encoded by stable mRNAs,

whose translation is inhibited by unstable antisense RNAs.

The paradigm member of this gene family is hok/sok

of plasmid R1, whose genetic organization is shown in

Fig. 1. The locus encodes a very stable mRNA, which spe-

ci®es the toxic Hok (host killing) protein that can kill the

cells by damaging the cell membrane (Gerdes et al.,

1986a; b). Translation of hok is regulated by Sok-RNA (sup-

pression of killing), an unstable antisense RNA of 63

nucleotides (nts) that is complementary to the hok mRNA

leader (Gerdes et al., 1990b; Nielsen et al., 1991; Thisted

Molecular Microbiology (1999) 32(5), 1090±1102

Q 1999 Blackwell Science Ltd

Received 21 January, 1999; revised 15 March, 1999; accepted 19March 1999. *For correspondence. E-mail [email protected];Tel. (�45) 6557 2413; Fax (�45) 6593 2781.

et al., 1994a). Sok-RNA inhibits translation of the mok

reading frame that overlaps with the hok gene (see Fig.

1). As translation of hok is coupled to translation of mok,

Sok-RNA inhibits hok translation indirectly (Thisted and

Gerdes, 1992). The complex molecular model that explains

activation of hok translation in plasmid-free cells is shown

in Fig. 2 and is described in detail in the legend.

In this article, we describe the analyses of new hok-

homologous loci from the E. coli chromosome. We show

that E. coli K-12 contains ®ve hok-like loci, four of which

encode all of the regulatory elements as described pre-

viously for hok/sok of R1. In E. coli K-12, three of these

loci are inactivated by IS elements. Screening of the ECOR

collection of E. coli wild-type strains reveals hok-homolo-

gous loci that are not inactivated by IS-elements. Molecular

and genetic analyses point to the conclusion that the hok-

homologous genes may be induced by an as yet unknown

signal that affects mRNA translation.

Results

The chromosome of E. coli K-12 encodes ®ve

hok-homologous genes

The gef and relF genes of E. coli K-12 encode Hok-like

proteins that are toxic and that confer similar gross morpho-

logical changes upon host cells as Hok of R1 (Gerdes et al.,

1986b). Recently, genes gef and relF were denoted hokC

and hokD respectively (Gerdes et al., 1997). Using the

database search program BLAST (Altschul et al., 1997),

we identi®ed three additional hok-homologous genes on

the chromosome of E. coli K-12. Thus, E. coli K-12 encodes

®ve hok homologues denoted hokAK12 to hokEK12. The ®ve

chromosomally encoded Hok proteins are aligned with the

other known homologues in Fig. 3.

Genes hokAK12, hokBK12, and hokCK12 encode

active Hok-like polypeptides

The unit copy number cloning vector pKP219 contains

lacI q and the LacI-regulated PA1/O4/O3 promoter (Lanzer

and Bujard, 1988) upstream of a multiple cloning site

(mcs). The construction of pKP219 is described in Experi-

mental procedures. Without IPTG, transcripts from the

Q 1999 Blackwell Science Ltd, Molecular Microbiology, 32, 1090±1102

Fig. 1. Structural organization, RNAs and regulatory elements ofthe hok/sok system from plasmid R1. Genetic nomenclature: mok,mediation of killing; hok, host killing; sok, suppression of killing;sokT, Sok antisense RNA target; fbi, foldback inhibition element;tac, translational activation element, FL full length; TR, truncated.Numbers refer to the coordinates in the mRNAs.

Fig. 2. Molecular model that explains activation of hok translationin plasmid-free cells.A. Folding pathway of hok mRNA. During transcription, ametastable hairpin at the mRNA 58 end prevents formation of thetac stem (translational activation). Formation of the tac stem in thenascent transcript would be expected to lead to prematureactivation of translation or antisense RNA binding. In the full-lengthtranscript, the fbi-element (foldback inhibition) pairs with tacthereby locking the mRNA into an inert con®guration: the SDmok

element is base paired to ucb (upstream complementary box) andthe Sok-RNA target (sokT ) is shielded by the foldback structure.During steady state, a pool of inert full-length mRNA accumulatesin plasmid-containing cells. The full-length mRNA is activated byslow 38 processing, which removes the fbi element. The removalof fbi triggers a refolding of the 58 end of the mRNA with theformation of the tac and antisense target hairpins.B. In plasmid-carrying cells, the truncated mRNA is rapidly boundby Sok-RNA, which prevents translation. Subsequently, the RNAsform a duplex that is cleaved by RNase III.C. In plasmid-free cells, in which the unstable antisense RNA hasdecayed, translation of the truncated hok mRNA is allowed, thusleading to cell killing. The RNA structures shown were veri®ed bynucleotide covariations in phylogenetically related RNAs (Gultyaevet al., 1997) and by mutational and structural analyses (Thistedet al., 1995; Franch and Gerdes, 1996; Franch et al., 1997). Themodel was recently described in a review (Gerdes et al., 1997).

E. coli hok homologues 1091

promoter are not detectable by Northern analysis (data not

shown). However, with IPTG, strong transcription is

induced towards the cloning site. We PCR ampli®ed the

hokAK12, hokBK12 and hokCK12 genes and cloned the

resulting DNA fragments into pKP219, which resulted in

plasmids pKP612 (�138 to �368), pKP611 (�147 to

�451) and pKP613 (�136 to �370) respectively (�1 refers

to the ®rst nucleotide at the mRNA 58 ends; see Figs 4 and

5). The plasmids were transformed into strain CSH50 and

subsequently tested in an induction experiment. Addition

of IPTG to cells containing pKP612, pKP611 or pKP613

yielded arrest of cell growth, rapid host cell killing and the

typical Hok-induced changes in cell morphology. These

results show that genes hokAK12, hokBK12 and hokCK12

encode polypeptides that, resembling Hok of R1, are

very toxic to E. coli host cells.

Insertion elements in the hokA, hokC and hokE loci

of E. coli K-12

The hokAK12 gene is located at 80.1 min between glyS and

cspA , see Fig. 4 (Blattner et al., 1997). We noticed that an

IS150 element had inserted 32 bp upstream of the start

codon of hokAK12. Subtraction of the DNA sequence of

the IS element revealed a hok-homologous system with

a potential promoter for a hokA mRNA, fbi and tac ele-

ments in the mRNA, and a processing stem±loop just

downstream of the hokA reading frame (see Fig. 5). A

potential antisense RNA gene is also present in the K-12

sequence. However, the base pairs between IS150 and

hokAK12, which would be expected to encode the ÿ10

sequence of the antisense RNA promoter and the start

of a mok-homologous reading frame (mokA), is missing.

The missing bases are consistent with the proposal that

the insertion element introduced a deletion of 39 bp in a

complete hok-homologous system. Thus, subtraction of

the IS150 element from the E. coli K-12 sequence indi-

cates that the element may have transposed into a system

that had all of the regulatory elements as described for the

hok/sok system of R1. This interpretation is corroborated

by ®ndings described later.

Similarly, the hokCK12 locus (formerly gef ) located at

0.4 min between nhaA and dnaJ contains an IS186 ele-

ment 22 bp downstream of the toxin-encoding reading

frame (Fig. 4). Subtraction of the DNA sequence of the

IS186 element revealed a hokC system with all of the


Fig. 3. Alignment of the known Hok-homologoustoxins. A fully conserved amino acid in theconsensus sequence is underlined and highlyconserved amino acids are shown in bold. SeeFig. 5 for the origin and the sequence of thecorresponding genes.

Fig. 4. Structural organization of the hokA , hokB, hokC, hokD,and hokE loci of E. coli K-12. An IS150 element is located 32 bpupstream of hokA . A deletion of 39 bp is marked with a K. In hokCand hokE, an IS186 element is located 22 and 21 bp downstreamof the toxin-encoding reading frames respectively. The start codonof the mokE homologue is missing (shown with a dotted line). ThehokD system is transcribed in the operon with the relB and relEgenes (a D marks the presumed deletion of the upstream part ofthe hokDK12 locus).

1092 K. Pedersen and K. Gerdes


Fig

.5.

Alig

nm

ent

of

the

mR

NA

sfr

om

the

hok

fam

ily.

hok

isfr

om

pla

sm

idR

1;

¯m

and

srn

Bare

from

pla

sm

idF

;pnd16

and

pnd483

are

from

pla

sm

idR

16

and

R483;

hokA

isfr

om

E.

coli

C,

hokB

isfr

om

K-1

2,

hokC

isfr

om

EC

OR

24,

hokD

and

hokE

are

from

K-1

2and

hokX

isfr

om

E.

coli

B;

hokH

isfr

om

Hafn

iaalv

ei.

The

alig

nm

ent

em

phasiz

es

the

main

regula

tory

ele

ments

and

vis

ualiz

es

the

ste

m±

loop

str

uctu

res

pre

sent

at

vari

ous

times

inth

em

RN

Alif

ecycle

(i.e

.th

enascent,

the

full-

length

and

the

truncate

dtr

anscri

pts

).T

he

main

ste

m±

loop

str

uctu

res

are

show

nw

itharr

ow

sand

are

num

bere

din

the

follo

win

gord

er:

I,m

eta

sta

ble

;II

,exte

nded

ucb

/SD

mok;

III,

dcb

/SD

hok;

IV,

pro

cessin

g;

V,

ucb

/SD

mok;

VI,

top

of

the

tac

ste

min

full-

length

mR

NA

;V

II,

antis

ense

targ

et;

VII

I,ta

cste

min

truncate

dm

RN

A;

IX,

short

ened

ucb

/SD

mok;

X,

short

ened

dcb

/SD

hok.

The

conserv

ed

sequence

ele

ments

are

underl

ined

and

sequences

involv

ed

inlo

ng-

range

base

pair

ing

are

show

nw

ithaste

risks

(*).

The

sequences

fbiand

anti

sokT

8are

paired

with

tac

and

sokT

8in

the

full-

length

mR

NA

(str

uctu

res

XI

and

XII

respectiv

ely

),w

here

as

anti-

hok

ispaired

with

the

TIR

of

hok

(readin

gfr

am

ein

italic

)in

the

truncate

dm

RN

A(s

tructu

reX

III)

.T

he

sequences

inbold

indic

ate

the

pro

mote

rele

ments

of

the

antis

ense

RN

As

inth

ecom

ple

menta

ryD

NA

str

and.

The

alig

nm

ent

isbased

on

the

pre

vio

usly

descri

bed

conserv

ed

secondary

str

uctu

ral

ele

ments

and

couple

dcovari

atio

ns

(Gerd

es

et

al.

,1997;

Gultyaev

et

al.

,1997

)and

was

assis

ted

by

the

com

pute

rpro

gra

ms

MF

OLD

and

PIL

EU

Pto

inclu

de

the

new

sequences

(Wis

consin

GC

Gpackage

9.1

).


regulatory elements as previously described for the hok

system of plasmid R1, including fbi, tac, promoter ele-

ments for hokC mRNA and SokC antisense RNA and a

mok-homologous reading frame that we denote mokC

(formerly orf69 ) (see Fig. 5). This suggests that the

hokA and hokC loci of E. coli K-12 were inactivated by

IS-elements.

The hokEK12 gene is located at 13.1 min between genes

nfnB and entD. Interestingly, an IS186 element is located

21 bp downstream of the hokEK12 reading frame (see Fig.

4). Subtraction of the DNA sequence of the IS186 element

again revealed a hok-homologous system that contains all

of the regulatory elements as previously described for hok

of R1, except for the start codon of a mok-homologous

reading frame (see Fig. 5). Thus, the chromosome of E.

coli K-12 contains three hok-homologous loci that prob-

ably have been inactivated by insertion elements.

The hokBK12 locus is located between trg and cysB at

32.2 min (Fig. 4). This system contains all the regulatory

elements as described for hok, such as fbi, tac, appro-

priate promoter sequences and a second overlapping

reading frame that we denote mokB.

The ®fth homologue, hokDK12 (formerly relF ; Gerdes et

al., 1986b), is encoded by the third gene of the relB operon

at 35.4 min (Fig. 4). Interestingly, the ®rst two genes of the

operon encode a toxin±antitoxin system (Gotfredsen and

Gerdes, 1998). A potential fbi sequence is located at the

appropriate position downstream of the hokDK12 reading

frame, whereas the upstream regulatory elements are

missing. Thus, the hokDK12 gene may be a relic of a pre-

viously intact hok-homologous gene system.

Two additional chromosomal hok loci have been identi-

®ed. In E. coli B, a hok locus that we denote hokX is located

adjacent to cysH (Ostrowski et al., 1989). The HokX homo-

logue is aligned with the other Hok-like toxins in Fig. 3.

Curiously, an IS186 element is also located 21 bp down-

stream of the hokX reading frame. The upstream, regula-

tory part of hokX is also present in K-12, including a

putative antisense RNA gene, but the toxin-encoding read-

ing frame is missing. Furthermore, in the enterobacterium

Hafnia alvei, we identi®ed a hok-homologous gene system

just downstream of the ldc gene (Fecker et al., 1986). The

system, denoted hokH, is missing a mok-homologous

reading frame (Fig. 5).

Identi®cation and cloning of hokA and hokC loci from

other E. coli strains

Using PCR, we screened strain collections for potentially

intact hokA and hokC loci. By `intact', we mean hok-homo-

logous genes without closely linked insertion elements.

We found that E. coli C and 38 out of the 72 wild-type

strains of the ECOR collection (Ochman and Selander,

1984) encode a hokA system without an IS150 element

(K. Pederson and K. Gerdes, unpublished). All strains con-

tained the hokA gene at the same chromosomal position.

Using PCR, we cloned the hokAC system of E. coli C into

the R1 cloning vector pOU82, thus resulting in pKP110

(ÿ294 to �466). The mcs region of the pOU82 vector is

only weakly transcribed. However, to avoid effects of for-

tuitous expression of HokAC, we used the Hok-resistant E.

coli K-12 strain NWL37 as the recipient in the cloning pro-

cedure. The DNA sequence of the hokA system of E. coli C

revealed all the known regulatory elements, as described

previously for hok/sok of R1 (see Fig. 5). A schematic

drawing of the hokC locus is shown in Fig. 4. Comparisons

between the hokA loci of E. coli K-12 and C indicate that

the IS150 element present in the K-12 sequence probably

caused a deletion of 39 bp, which removed the start of

mokAK12 and the ÿ10 sequence of the antisense RNA pro-

moter. The comparison also revealed a number of single

base pair substitutions. In conclusion, E. coli C encodes

a potentially active hok-homologous gene system (see

Discussion ).

A second screening of the entire ECOR collection

revealed that 28 out of the 72 wild-type E. coli strains

encode a hokC system without an IS186 element. We

cloned the intact hokC system from ECOR24 into pOU82,

resulting in pKP208 (ÿ640 to �400). As in the case of

hokAC, the DNA sequence of hokCECOR24 revealed an

intact hok-like system with all the regulatory elements, as

described previously for the hok system of R1 (Fig. 5).

Thus, the wild-type ECOR24 strain and a number of

other wild-type E. coli strains contain hokC systems with-

out a linked IS186 element (data not shown). Comparison

of the hokC sequences of E. coli K-12 and ECOR24 revealed

only a few differences at the level of single base pairs.

The new hokAC and hokCECOR24 genes were cloned

into the expression vector pKP219, resulting in the plasmids

pKP602 and pKP608 respectively. Inductions experiments

showed that the hokAC and hokCECOR24 genes also encode

active toxins.

For comparison, the hokB locus of E. coli K-12 was also

PCR ampli®ed and cloned into pOU82, thus resulting in

pKP302 (ÿ1090 to �451).

Smaller DNA fragments encoding the entire hokAC

(ÿ114 to �466), hokBK12 (ÿ74 to �451) and hokCECOR24

(ÿ225 to �400) genes were also generated by PCR and

cloned into pOU82, thus resulting in pKP101, pKP301

and pKP201 respectively. Again, the Hok-resistant strain

NWL37 was used as recipient in the cloning procedure.

For reasons unknown, we were not able to transfer plas-

mids pKP101 (hokAC) and pKP201 (hokCECOR24) to Hok-

sensitive K-12 strains such as CSH50 or MC1000. In the

case of the hokBK12 carrying plasmids pKP301, we encoun-

tered no such problem, and none of the plasmids carrying

longer hokAC- and hokCECOR24-encoding fragments yielded

cloning problems. Similar toxicity was expressed from



short hokA- and hokC- encoding fragments derived from

other ECOR strains without IS150 or IS186 respectively

(data not shown). Northern analyses of RNAs encoded

by short and long hokAC and hokCECOR24 DNA fragments

produced similar amounts of mRNA and antisense RNAs

(not shown). Thus, we believe that the toxicity expressed

by the short versions of the DNA fragments may re¯ect

cloning artefacts caused by the removal of the hokA and

hokC genes from their natural context. Curiously enough,

the toxicity expressed by the short DNA fragments encod-

ing hokAC and hokCECOR24 was relieved by cloning the

fragments into high copy number plasmids (not shown).

We believe that this relief is caused by the concomitant

increased concentration of the antisense RNAs, which

repress translation of the cognate toxin-encoding mRNAs.

The hokAC, hokBK12, and hokCECOR24 loci

encode stable mRNAs that are processed at their

3 8 ends

Total RNA was prepared from NWL37 carrying plas-

mids pKP402 (hokAC), pKP408 (hokBK12) or pKP406

(hokCECOR24) before and after the addition of rifampicin

to growing cells. The RNA samples were analysed by

Northern blotting. Figure 6A shows that the hokAC locus

encodes a stable mRNA of <362 nucleotides (nts). This

size of full-length hokAC RNAs is in accordance with the

tac and fbi sequences in Fig. 5. The long half-life of

the full-length mRNA is consistent with the proposal that

the tac and the fbi elements mediate a 58 to 38 long-range

interaction, as described for the hok mRNA of R1 (see

later). After the addition of rifampicin, a processed hokAC

mRNA species of <330 nt slowly appeared. The difference

in sizes of the two mRNAs is consistent with a 38 exonucleo-

lytical removal of the 32 nts in the 38 end of the full-length

hokAC mRNA that encodes the fbi element. Thus, by

inference, the processing pattern indicates mRNA 38

processing as previously described for the plasmid-

encoded hok-homologous mRNAs (Gerdes et al., 1990b;

Nielsen et al., 1991; Thisted et al., 1994b; Franch and

Gerdes, 1996). The 58 end of the hokAC mRNA was deter-

mined by primer extension analysis and is consistent with

this inference (data not shown). The 58 end is located

downstream of the ÿ10 and ÿ35 promoter sequences

and the tac element is located in the very 58 end of the

mRNA, as in the case of hok mRNA of R1. A putative

RNase III cleavage product of the mRNA±antisense

RNA duplex is also indicated in Fig. 6A.

The hokBK12 and hokCECOR24 mRNAs exhibited similar

processing patterns as those described above for hokAC

mRNA (Fig. 6B and C). Both mRNAs were stable and

were slowly processed to slightly shortened versions, the

sizes of which are consistent with 38 exonucleolytical

removal of the fbi encoding sequences. However, the 38

truncated hokBK12 mRNA appeared less abundant than

the truncated hokAC and hokCECOR24 mRNAs, indicating

that it is less stable (Fig. 6B). The 58 ends of the hokBK12

and hokCECOR24 were determined by primer extension

(not shown). In both cases, ÿ10 and ÿ35 promoter ele-

ments are located at appropriate positions in the DNA.


Fig. 6. Stability and processing patterns of the hok-like mRNAsshown by Northern analyses. Parts A, B and C show the hokAC,hokBK12 and hokCECOR24 mRNAs respectively. Cells were grown inLB medium to an OD450 of <0.5 and rifampicin was added to a®nal concentration of 300 mg mlÿ1 (at time 0). Cell samples for totalRNA preparation were withdrawn at the intervals indicated (in min).Samples were loaded in the following order: lane 1, radioactivelylabelled RNA markers with lengths of 351 and 276 nts; lanes 2and 3, total RNA from NWL37/pOU82DBgl II; lanes 4±7(9) totalRNA from: A, NWL37/pKP402 (pOU82DBgl II� hokAC system);B, NWL37/pKP408 (pOU82DBgl II� hokBK12 system); and C,NWL37/pKP406 (pOU82DBgl II� hokCECOR24 system). Thepositions of full-length (FL) and truncated (TR) mRNAs, and anRNase III cleavage product are indicated.


Also, in both cases, tac elements that are complementary

to putative 38 fbi elements are located at the very 58 ends

of the mRNAs, thus indicating a long-range 58 to 38 inter-

action in these mRNAs as well (see Fig. 5).

The chromosome-encoded Sok-like antisense RNAs

are relatively unstable

Using Northern analysis, we detected antisense RNAs

encoded by the chromosomally encoded loci hokAC,

hokBK12 and hokCECOR24 (Fig. 7). SokAC RNA was

estimated to be 52 nt, SokBK12 RNA to be 53 nt, and

SokCECOR24 RNA to be 55 nt. The 58 ends of the antisense

RNAs were determined using primer extension, and the

nucleotide complementary to the ®rst nucleotide of each

antisense RNA is indicated in Fig. 5. In all cases, the 58

ends correspond well with ÿ10 and ÿ35 promoter sequ-

ences in the DNA sequences. Thus, the hokAC, hokBK12

and hokCECOR24 loci encode antisense RNAs that are

homologous to Sok-RNA of plasmid R1. SokCECOR24 is

identical to the Sof-RNA from E. coli K-12 previously

described by Poulsen et al. (1991).

The secondary structures of the three new antisense

RNAs are very similar to that of Sok-RNA from plasmid

R1. In all cases, the RNAs consist of a 58 single-stranded

leader of 10±12 nts and an energy-rich stem±loop that

keeps the 58 parts of the molecules in single-stranded con-

formations. The single-stranded 58 ends are complemen-

tary to the loops of the potential target stem±loops of

the cognate mRNAs (e.g. see Fig. 5).

The metabolic stabilities of the antisense RNAs were

also measured. Estimates from the Northern blots in Fig.

7 show that SokAC, SokBK12 and SokCECOR24 are charac-

terized by half-lives of 5, 4 and 3 min respectively.

None of the chromosomally encoded loci mediate PSK

The preceding sections show that the new, chromoso-

mally encoded loci contain all of the regulatory elements

as previously described for the hok system of plasmid R1.

Therefore, we investigated the possibility that the chromo-

somal loci might mediate plasmid stabilization by PSK.

To this end, we used the unstably inherited R1 cloning

vector pOU82 as a test plasmid and bacterial host strains

that do not themselves produce the inhibitory antisense

RNAs (see Table 1 for an explanation). Plasmids pKP110

(hokAC), pKP302 (hokBK12) and pKP208 (hokCECOR24)

are pOU82 derivatives carrying the chromosomal loci.

Included as controls were pOU82 without any PSK system

and pTT820, which carries hok/sok of R1. As seen from

Table 1, the hok/sok system stabilized pOU82 <100-

fold, as described previously. However, none of the chro-

mosomally encoded loci stabilized pOU82 in any of the

strains tested, thus indicating that the loci do not mediate

PSK.

The plasmid-encoded hok-homologous genes are

induced by the addition of the transcriptional inhibitor

rifampicin (Gerdes et al., 1990a). This is because addition

of the drug leads to depletion of the antisense RNA, and


Fig. 7. Stability and processing patterns of the antisense RNAsshown by Northern blotting. Parts A, B and C show the SokAC,SokBK12 and SokCECOR24 antisense RNAs respectively. Cells weregrown in LB medium to an OD450 of <0.5. At time 0, rifampicinwas added to a ®nal concentration of 300 mg mlÿ1. Cell samplesfor total RNA preparation were taken at the intervals indicated(in min). Samples were loaded in the following order: lane 1,radioactively labelled RNA markers of 63 and 33 nts; lanes 2 and3, total RNA from NWL37/pOU82DBgl II; lanes 4±7(9) total RNAfrom: A, NWL37/pKP402 (pOU82DBgl II� hokAC system); B,NWL37/pKP408 (pOU82DBgl II� hokBK12 system); and C, NWL37/pKP406 (pOU82DBgl II� hokCECOR24 system). The positions ofthe antisense RNAs and possible RNase E cleavage products aremarked.


thus to the accumulation of the truncated, translatable

mRNA. We knew from the data in Fig. 6 that addition of

rifampicin leads to accumulation of the truncated, pre-

sumed active mRNAs of the chromosomal loci. Therefore,

we added rifampicin to growing cells of the strains listed in

Table 1, and we inspected the cells for induction of Hok. All

cultures of strains carrying the pTT820 control plasmid

(carrying hok/sok ) exhibited the Hok-induced changes in

cell morphology, whereas none of the other strains carry-

ing plasmids with the chromosomal loci exhibited this phe-

notype. This result indicates that the chromosomal genes

are not inducible by rifampicin. This result is consistent

with the observed lack of PSK.

Translation in vitro of truncated hokAC and hokCECOR24

mRNAs

The lack of PSK and the missing induction by rifampicin

were puzzling because the chromosomal loci contain all

known regulatory elements present in the hok/sok system

of plasmid R1, and they produce the truncated, presumed

active mRNAs after decay of the antisense RNAs. There-

fore, we synthesized the truncated hokAC and hokCECOR24

mRNAs in vitro and tested whether they could be trans-

lated. Truncated hok mRNA was included as a positive

control. As seen from Fig. 8, the hokAC and hokCECOR24

mRNAs were translated at a signi®cantly lower rate than

that of hok mRNA. We cannot exclude that the low trans-

lation rates were due to misfolding of the RNAs. However,

in vitro binding assays between the hokAC and hokCECOR24

mRNAs and their cognate antisense RNAs showed that

the truncated RNAs bound the antisense RNAs at rates

similar to those described for the truncated hok mRNA

(data not shown). Furthermore, in vitro processing of the

mRNAs resulted in degradation patterns similar to those

seen in vivo, indicating that the mRNAs folded correctly

in vitro. Thus, our results indicate that the lack of PSK

in the case of the chromosomal hok homologues may be

explained by reduced translation rates of the truncated

mRNAs.

Discussion

We show here that E. coli K-12 codes for ®ve hok-homo-

logous genes. Previously, it was shown that hokCK12

and hokDK12 encode active Hok-like cytotoxins (Gerdes

et al., 1986b; Poulsen et al., 1989). The ®ndings described

here con®rm that HokCK12 is a cytotoxin and that HokAK12

and HokBK12 can be added to the list. Curiously, three

of the ®ve loci were inactivated by IS elements. Thus,

hokAK12 contains an IS150 element just upstream of the

toxin gene, and hokCK12 and hokEK12 contain IS186 ele-

ments 22 and 21 bp downstream of the toxin genes respec-

tively. A sixth hok-homologous locus in E. coli B, denoted

hokX, contains an IS186 element also 21 bp downstream

of the toxin gene. The IS elements are located such that

they interrupt the stable, toxin-encoding mRNAs, and they


Fig. 8. In vitro translation of truncated hokR1, hokAC andhokCECOR24 mRNAs. The mRNAs indicated above the lanes weretranslated in an S30 extract containing 35S-methionine. Sampleswere withdrawn at 5 and 20 min after initiation of the reactions andanalysed by SDS±PAGE. The positions of the Hok, HokAC andHokCECOR24 proteins are indicated. Relative translation frequencies(lower line) were normalized to LacZ(a) (internal standard). Theamount of Hok protein detected after 5 min was set to 1. `C'denotes a control reaction without exogenously added mRNA.

Table 1. Test of plasmid stabilization (via PSK) for hokAC, hokBK12, hokCECOR24.

Loss rate per cellPlasmid Toxin system Strain used to assay PSK per generation Folds of stabilization

pOU82 None CSH50a 1 ´ 10ÿ2 1pTT820 hok/sok CSH50 1 ´ 10ÿ4 100pKP110 hokAC CSH50 1 ´ 10ÿ2 1pOU82 None S. typhimuriumb 1 ´ 10ÿ2 1pTT820 hok/sok S. typhimurium 1 ´ 10ÿ4 100pKP302 hokBK12 S. typhimurium 1 ´ 10ÿ2 1pOU82 None NWL35c 1 ´ 10ÿ2 1pTT820 hok/sok NWL35 1 ´ 10ÿ4 100pKP208 hokCECOR24 NWL35 1 ´ 10ÿ2 1

a. The E. coli K-12 strain used was CSH50, which does not produce the SokA antisense RNA from its chromosome.b. S. typhimurium does not produce SokB antisense RNA from its chromosome.c. NWL35 is an E. coli K-12 strain from which the sokC (sof ) gene was deleted (Poulsen et al., 1992).


thereby prevent the appropriate expression of the toxins

(see below).

Subtraction of the DNA sequences of the IS elements

from the E. coli contigs revealed that the chromosomal

loci specify most or all of the regulatory components, as

previously described for hok/sok of R1 (Gerdes et al.,

1997). These components include tac and fbi elements

located in the mRNA 58 and 38 ends, respectively, antisense

RNAs that repress translation of their cognate mRNAs, and

antisense RNA target stem±loops required for translation

and for antisense RNA binding. Of the six known plasmid-

encoded hok-like loci, none appears to be inactivated. The

reason for this difference between the chromosome- and

plasmid-encoded loci can only be speculated upon, but

indicates that the chromosome-encoded loci have a pre-

ponderance to suffer from inactivation by mutation. More-

over, the hok loci seem to attract IS186.

To investigate this problem further, we decided to search

for chromosome loci devoid of IS elements. To this end, we

screened collections of wild-type E. coli strains for hokA and

hokC loci of sizes compatible with the lack of linked IS ele-

ments. We found that E. coli C and ECOR24 encode loci

devoid of the IS150 and IS186 elements respectively.

The nucleotide sequences of the hokAC and hokCECOR24

mRNAs revealed two loci with all of the regulatory ele-

ments, as previously described for hok/sok of R1 (Fig. 5).

Northern analyses of the mRNAs encoded by hokAC,

hokBK12 and hokCECOR24 showed in all cases stable

mRNAs that are slowly processed to truncated versions,

which are also very stable (except for the truncated

hokBK12 mRNA; see Fig. 6). This processing pattern is

similar to that of the plasmid-encoded hok-homologous

loci (Gerdes et al., 1990b; Nielsen et al., 1991; Thisted

et al., 1994b; Franch and Gerdes, 1996). This suggests

that the processing removes the fbi elements in the mRNA

38 ends. This conjecture was supported by the by primer

extension analyses, which showed that the mRNA 58

ends were not processed after the addition of rifampicin

(data not shown).

The intact hokAC, hokBK12 and hokCECOR24 loci all

encode small regulatory antisense RNAs that are com-

plementary to the mRNA leader regions (Fig. 7). In all

cases, the antisense RNAs contain single-stranded 58

ends followed by a stem±loop structure, and their second-

ary structures are thus very similar to that of Sok-RNA of

R1. The antisense RNAs are in all cases more unstable

than their cognate mRNAs. This differential RNA decay

is the basis for the PSK mechanism (i.e. the onset of hok

translation in plasmid-free cells). Therefore, we tested the

ability of the chromosomally encoded loci to mediate plas-

mid stabilization by PSK (Table 1). However, none of the

chromosomal loci mediated plasmid stabilization, thus

indicating that the PSK mechanism is not operational in

any of them. Because in all cases the full-length RNAs

are processed to the presumed active, 38-truncated

RNAs, this observation was not expected. However, the

low translation rates of the truncated RNAs (Fig. 8) yield

an explanation for the absence of the PSK phenotype.

The alignment of all of the chromosome- and plasmid-

encoded hok-homologous mRNAs is shown in Fig. 5. As

may be seen, the chromosomal homologues encode all

of the regulatory elements as previously described for

hok mRNA, including the complementary fbi and tac ele-

ments, tac activator stem±loops, antisense RNA target

stem±loops, and mok-homologous reading frames.

Furthermore, the mRNAs encode putative metastable

structures at their very 58 ends, thus indicating similar fold-

ing pathways in all cases (see Fig. 2; Gerdes et al., 1997).

The alternative (i.e. mutually exclusive) secondary struc-

tures are supported by a large number of coupled covaria-

tions (Gultyaev et al., 1997).

It is surprising that E. coli K-12 codes for ®ve hok-homo-

logous loci, and their function can only be guessed upon.

Kobayashi's group has suggested that genes mediating

PSK may function as sel®sh genetic elements just as

transposons and viruses, and that their PSK phenotype

help their persistence and spreading (Kusano et al., 1995;

Naito et al., 1995; Kobayashi, 1998). Furthermore, chromo-

somal restriction modi®cation genes were shown to protect

linked DNA from replacement, through homologous recom-

bination, by invading foreign DNA (Y. Nakayama, N. Handa

and I. Kobayashi, personal communication). They argued

that the PSK genes may thus confer an evolutionary

advantage to the host genome.

Experimental procedures

Enzymes and chemicals

Antibiotics and chemicals were added at the following concen-trations: 30 mg mlÿ1 and 100 mg mlÿ1 ampicillin when the copynumber of the plasmids was less than and more than 8respectively; 300 mg mlÿ1 rifampicin; 2 mM IPTG. All enzymeswere purchased from Boehringer Mannheim unless statedotherwise. The growth medium used was Luria±Bertanibroth (Bertani, 1951).

Bacterial strains and plasmids

Bacterial strains and plasmids are listed in Table 2. All plasmidsare described below. Primers used in the PCR reactions arealso described below.

Plasmids used. Plasmid pOU82 is derived from the mini-R1`runaway replication' vectors originally developed by Larsenet al. (1984). In addition to the bla gene conferring ampicillinresistance, pOU82 contains the lacZYA genes fused to thedeoP2 promoter. Thus, cells containing pOU82 give rise toblue colonies on Xgal (5-bromo-4-chloro-3-indolyl-b-D-galacto-side) indicator plates. Furthermore, pOU82 contains unique,



juxtaposed EcoRI and BamHI restriction sites for the insertionof DNA fragments (Gerdes et al., 1985).

Plasmid pRBJ200 is isogenic to pOU82 except for the clon-ing region, in which the deoP2 promoter was replaced withpromoterless multiple cloning sites (mcs), such that the plas-mid can be used as a transcriptional lacZ fusion vector (Jensenet al., 1995)

Plasmid pTT820 is a pOU82 derivative carrying the hok/sok locus on a 580 bp EcoRI±BamHI fragment (Nielsen etal., 1991).

Plasmids constructed. All hokA , hokB and hokC coordi-nates refer to the sequence from the C, K-12 and ECOR24strains respectively. For all genes, the base pair coding forthe very ®rst nucleotide at the 58 end of the mRNA was set to�1 (see Fig. 5).

Plasmids pKP101 and pKP110. pKP101 and pKP110 arepOU82 derivatives that contain the hokA locus from E. coli C(strain 1055) on EcoRI±BamHI fragments. The fragment inpKP101 (ÿ114 to �466) was generated with primers KP26(CCCGGATCCGCAACCTTTAATAATCTTCTG) and KP24

(CCCGAATTCCTAAGATCCCTGCCATTTG), and pKP110(ÿ294 to �466) was generated with primers KP11 (CCC-GGATCCTTTCTTCGATAAAGTGATGG) and KP24.

Plasmids pKP201 and pKP208. pKP201 and pKP208 arepOU82 derivatives that contain the hokC locus from ECOR24on EcoRI±BamHI fragments. The fragment in pKP201 (ÿ225to �400) was generated with primers KP29 (CCCGGATCC-GAGGGATTAATTAGGAAAAG) and KP30 (CCCGAATTC-AAAAGCCTGCCCGTGGGC), and pKP208 (ÿ640 to �400)was generated with primers KP9 (CCCGGATCCCATCAG-CGCGTCATTTATCC) and KP30.

Plasmids pKP301 and pKP302. pKP301 and pKP302 arepOU82 derivatives that contain the hokB locus from E. coliK-12 (MG1655) on EcoRI±BamHI fragments. The fragmentin pKP301 (ÿ74 to �451) was generated with primers KP40(CCCGGATCCAAATTCTGGAAAACAGCACG) and KP43(CCCGAATTCGGGATCTCACACTGTACG), and pKP302(ÿ1090 to �451) was generated with primers KP39 (CCC-GGATCCGTCGAACAGTCCCTACTG) and KP43.

Plasmids pKP402, pKP406 and pKP408 were generated by


Table 2. Bacterial strains, plasmids used and constructed.

Strain/plasmid Relevant characteristicsa Reference/source and coordinates of hok inserts

StrainsCSH50 DSokA, Dlac Miller (1972)NWL35 DSokA, DhokC/SokC, Dlac Poulsen et al. (1989)NWL37 HokR Poulsen et al. (1992)MG1655 K-12 wt, hokB/sokB � Jensen (1993)C1055 E. coli C, hokA/sokA� Laboratory collectionECOR 24 WT E. coli, hokC/sokC� Ochman and Selander, 1984KP1274 S. typhimurium, rÿ, m� Laboratory stock

Plasmids usedpOU82 Mini R1 replicon, bla, deoP2-lacZYA Gerdes et al. (1985)pRBJ200 MiniR1 replicon, bla, mcs-lacZYA Jensen et al., 1995pTTQ19 pUC replicon, Ptac-mcs, rrnBT1T2, lacI q, bla Stark 1987pTT820 hok/sok system in pOU82 Nielsen et al. (1991)Litmus 28 High copy number probe vector New England Biolabs

Plasmids constructedpKP40 PA1/04/03 inserted in pRBJ200 This workpKP219 lacZYA replaced by lacI q in pKP40 This workpKP101 hokAC: ÿ114 to �466, in pOU82 This workpKP110 hokAC: ÿ294 to �466, in pOU82 This workpKP201 hokCECOR24: ÿ225 to �400, in pOU82 This workpKP208 hokCECOR24: ÿ640 to �400 in pOU82 This workpKP301 hokBK12: ÿ74 to �451, in pOU82 This workpKP302 hokBK12: ÿ1090 to �451, in pOU82 This workpKP402 DBglII of pKP110 This workpKP406 DBglII of pKP208 This workpKP408 DBglII of pKP302 This workpKP501 hokAC: ÿ9 to �368, in Litmus 28 This workpKP502 hokAC: �138 to �368, in Litmus 28 This workpKP507 hokCECOR24: ÿ9 to �370, in Litmus 28 This workpKP508 hokCECOR24: �136 to �370, in Litmus 28 This workpKP511 hokBK12: �131 to �364, in Litmus 28 This workpKP512 hokBK12: ÿ74 to �101, in Litmus 28 This workpKP602 hokAC: �138 to �368, in pKP219 This workpKP608 hokCECOR24: �136 to �370, in pKP219 This workpKP611 hokBK12: �147 to �451, in pKP219 This workpKP612 hokAK12: �138 to �368, in pKP219 This workpKP613 hokCK12: �136 to �370, in pKP219 This work

a. The coordinates refer to the mRNA sequences in Fig. 5.


deleting a 248 bp Bgl II fragment carrying the copB gene fromplasmids pKP110, pKP208 and pKP302 respectively. Dele-tion of copB increases the plasmid copy number eightfold.

Plasmid pKP40 is a pRBJ200 derivative carrying thePA1/04/03 promoter from pUHE24 (ÿ46 to �21) and was con-structed using the PCR primers KP4 (CCCCCCCTGATCAA-GATCTCCCGGGCAAAAAGAGTGTTGACTTGTG) and KP5(CCCCGGATCCAATTGTTATCCGCTCACAAT), digested withBcl I and BamHI and ligated into the BamHI site ofpRBJ200. In pKP40, the PA1/O4/O3 promoter reads intothe mcs and from thereon into the lacZ gene.

Plasmid pKP219 is a pKP40 derivative with the 5 kbp Stu I±EcoRI lacZYA fragment replaced by the 2 kbp SspI±EcoRIlacI q fragment from pTTQ19 (Stark, 1987). Thus, pKP219 isa useful expression vector that carries lacI q and a lacI regu-lated promoter.

Plasmid pKP602 (�138 to �368) and pKP612 (�138 to�368) are pKP219 derivatives that carry the hokA genesfrom E. coli C (C1055) and K-12 (MG1655) cloned onBamHI±EcoRI fragments using PCR primers KP12 (CCC-GGATCCAGGAGGCTGGGAATGCCGCAG) and KP18 (CCC-GAATTCAAATTTGGGTGCAATGAGAATGC). Thus, uponaddition of IPTG to growing cells, plasmids pKP602 andpKP612 express the HokA proteins of E. coli C and K-12respectively.

Plasmids pKP608 (�136 to �370) and pKP613 (�136 to�370) are pKP219 derivatives that carry the hokC genesfrom E. coli ECOR24 and K-12 (MG1655) cloned on BamHI±EcoRI fragments using primers KP14 (CCCGGATCCAGGA-GAAGAGAGCAATGAAGCAG) and KP17 (CCCGAATTCA-AAATAGGGTGCGTTGAAG).

Plasmid pKP611 is a pKP219 derivative that carries thehokB gene from E. coli K-12 (MG1655) in which nucleotides�147 to �451 is fused to the strong SDparA translational initia-tion signal by using the PCR primers KP58 (CCCGGATCC-ATAAGGAGTTTTATAAATGAAGCACAACCCTCTGGT; theunderlined sequence is ÿ16 to ÿ1 of parA with the startcodon as�1) and KP43 (CCCGAATTCGGGATCTCACACTG-TACG) and cloned in the BamHI±EcoRI sites of pKP219.

Plasmids used for in vitro generation of single-stranded RNAprobes. Plasmid Litmus28 (New England Biolabs) is a highcopy number cloning vector that contains opposing T7 RNApolymerase promoters adjacent to the mcs, such that a DNAfragment inserted into the mcs can be transcribed by T7 RNApolymerase.

Plasmids pKP502 and pKP508 are Litmus28 derivativesthat contain the BamHI±EcoRI fragments from pKP602 andpKP608, encoding the hokA and hokC genes respectively.

Plasmid pKP511 (�131 to �364) is a Litmus28 derivativethat contain the hokB gene of E. coli K-12 (MG1655) on aBamHI±EcoRI fragment generated by using PCR primersKP41 (CCCGGATCCGGCAAGGAGAAAGGCTATG) andKP42 (CCCGAATTCGTAAAAGGGGTGCCATGAG).

The pKP502, pKP508 and pKP511 plasmids were linear-ized with BamHI before being used as templates for in vitrotranscription by T7 RNA polymerase, generating single-stranded run-off RNA probes complementary to their respec-tive mRNAs.

Plasmid pKP501 (ÿ9 to �368) is a Litmus28 derivativecarrying the hokA gene from E. coli C (C1055) on a

BamHI±EcoRI fragment using PCR primers KP16 (CCC-GGATCCAATAGCGGCGGGTGCTTGAG) and KP18.

Plasmid pKP507 (ÿ9 to �370) is a Litmus28 derivativecarrying the hokC gene from ECOR24 on an BamHI±EcoRIfragment using PCR primers KP16 and KP17.

Plasmid pKP512 (ÿ74 to �101) is a Litmus28 derivativecarrying the hokB gene of E. coli K-12 (MG1655) between theBamHI±EcoRV sites. The PCR fragment was generated usingprimers KP40 and KP47 (TTGCTAGGTTCATTCGTTGG).

The plasmid pKP501 was linearized with EcoRI and Dra III,pKP507 with EcoRI and EcoNI and pKP512 with EcoRIbefore being used as templates for in vitro transcription byT7 RNA polymerase, generating single-stranded run-off RNAprobes complementary to their respective antisense RNAs.

Genetic methods

Test for induction of Hok expression by inhibition of transcrip-tion was accomplished by looking for `ghost cells' in a phase-contrast microscope before and after the addition of rifampicinto exponentially growing cells. The toxicity of the cloned hokgenes was tested by restreaking colonies on LA plates bothwith and without 2 mM IPTG in the plates, and by the additionof IPTG to a ®nal concentration of 2 mM to an exponentiallygrowing culture. The cultures were followed by taking samplesfor microscopy and by determinations of viable counts. Plasmidstability tests were carried out according to Dam and Gerdes(1994). See Table 1 for the strains used.

Northern transfer analysis

Preparation of total RNA and Northern transfer analysis wasperformed essentially as described by Gerdes et al., 1990b.Cells carrying one of the R1 copB (DBglII ) copy-up plasmidswere grown exponentially at 358C. At OD450� 0.5, rifampicinwas added to a ®nal concentration of 300 mg mlÿ1. For sizefractionation, 10 mg of total RNA was loaded in each laneof a 5.5% (for mRNA) or 10% (for antisense RNA) low bis-acrylamide, polyacrylamide gel containing 8 M urea. The32P-labelled RNA probes used were generated by phage T7RNA polymerase (Promega) with the linearized plasmids,described above, as templates.

Synthesis of in vitro RNA

The in vitro T7-RNA polymerase synthesis and puri®cation ofuniformly 3H- or 32P-labelled mRNA and antisense RNA wereperformed as described by Thisted et al. (1994a). The follow-ing PCR primers were used to generate DNA templates fortruncated mRNAs of hokR1, hokAC and hokCECOR24: T7-1DG�T7-3N, KP48�KP50 and KP51�KP53 respectively.The sequence of the primers, with the T7-RNA promoter under-lined, is: T7-1DG (CGGGATCCTGTAATACGACTCACTAT-AGGCGCTTGAGGCTTTCTCCTCATG), KP48 (TGTAATA-CGACTCACTATAGGGTGCTTGAGACTGTTTGTC), KP51(TGTAATACGACTCACTATAGGGTGCTTGAGGCTGTCT-GT), T7-3N (AAGGCGGGCCTGCGCCCGCCTCCAGG),KP50 (GGCGGGAATAACTTCCCGC) and KP53 (GGCG-GGGATCACTCCCCG).

Transcript concentration was determined by liquid scintilla-tion counting for 3H-labelled transcripts. After gel puri®cation,



transcripts were dissolved in H2O at 200 nM. The uniformity ofthe transcripts was tested by boil-in experiments.

Translation in S30 extract

The E. coli coupled transcription/translation system (Zubay,1973) was purchased from Promega. Translation reactions ofthe synthesized 3H-labelled mRNAs were performed accordingto Franch et al. (1997).

Acknowledgements

We thank Thomas Franch for stimulating discussions and forhelp with the in vitro translation experiments. This work wassupported by the Danish Biotechnology Programme in theCenter for Interaction, Structure, Function, and Engineeringof Macromolecules (CISFEM).

References

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang,Z., Miller, W., and Lipman, D.J. (1997) Gapped BLAST andPSI-BLAST: a new generation of protein database search pro-grams. Nucleic Acids Res 25: 3389±3402.

Bertani, G. (1951) Studies on lysogenesis. I. The mode ofphage liberation by lysogenic Escherichia coli. J Bacteriol62: 293±300.

Blattner, F.R., Plunkett, III, G., Bloch, C.A., Perna, N.T., Bur-land, V., Riley, M., et al. (1997) The complete genomesequence of Escherichia coli K-12. Science 277: 1453±1474.

Dam, M., and Gerdes, K. (1994) Partitioning of plasmid R1.Ten direct repeats ¯anking the parA promoter constitutea centromere-like partition site parC, that expresses incom-patibility. J Mol Biol 236: 1289±1298.

Fecker, L.F., Beier, H., and Berin, J. (1986) Cloning and char-acterization of a lysine decarboxylase gene from Hafniaalvei. Mol Gen Genet 203: 177±184.

Franch, T., and Gerdes, K. (1996) Programmed cell death inbacteria: translational repression by mRNA end-pairing.Mol Microbiol 21: 1049±1060.

Franch, T., Gultyaev, A.P., and Gerdes, K. (1997) Pro-grammed cell death by hok/sok of plasmid R1: processingat the hok mRNA 38-end triggers structural rearrangementsthat allow translation and antisense RNA binding. J MolBiol 273: 38±51.

Gerdes, K., Larsen, J.E.L., and Molin, S. (1985) Stable inheri-tance of plasmid R1 requires two different loci. J Bacteriol161: 292±298.

Gerdes, K., Rasmussen, P.B., and Molin, S. (1986a) Uniquetype of plasmid maintenance function: Postsegregationalkilling of plasmid-free cells. Proc Natl Acad Sci USA 83:3116±3120.

Gerdes, K., Bech, F.W., Jùrgensen, S.T., Lùbner-Olesen, A.,Rasmussen, P.B., Atlung, T., et al. (1986b) Mechanism ofpostsegregational killing by the hok gene product of theparB system of plasmid R1 and its homology with therelF gene product of the E. coli relB operon. EMBO J 5:2023±2029.

Gerdes, K., Poulsen, L.K., Thisted, T., Nielsen, A.K., Marti-nussen, J., and Andreasen, P.H. (1990a) The hok killer

gene family in Gram-negative bacteria. New Biologist 2:946±956.

Gerdes, K., Thisted, T., and Martinussen, J. (1990b) Mech-anism of post-segregational killing by the hok/sok systemof plasmid R1: sok antisense RNA regulates formation ofa hok mRNA species correlated with killing of plasmid-free cells. Mol Microbiol 4: 1807±1818.

Gerdes, K., Gultyaev, A.P., Franch, T., Pedersen, K., andMikkelsen, N.D. (1997) Antisense RNA-regulated pro-grammed cell death. Annu Rev Genet 31: 1±31.

Gotfredsen, M., and Gerdes, K. (1998) The Escherichia colirelBE genes belong to a new toxin±antitoxin gene family.Mol Microbiol 29: 1065±1076.

Grùnlund, H., and Gerdes, K. (1999) Toxin±antitoxin sys-tems homologous to relBE of Escherichia coli plasmidP307 are ubiquitous in prokaryotes. J Mol Biol 285:1401±1415.

Gultyaev, A.P., Franch, T., and Gerdes, K. (1997) Pro-grammed cell death by hok/sok of plasmid R1: couplednucleotide covariations reveal a phylogenetically conservedfolding pathway in the hok family of mRNAs. J Mol Biol273: 26±37.

Holcik, M., and Iyer, V.N. (1997) Conditionally lethal genesassociated with bacterial plasmids. Microbiology 143:3403±3416.

Jensen, K.F. (1993) The Escherichia coli K-12 `wild types'W3110 and MG1655 have an rph frameshift mutationthat leads to pyrimidine starvation due to low pyrE expres-sion levels. J Bacteriol 175: 3401±3407.

Jensen, R.B., and Gerdes, K. (1995) Programmed cell deathin bacteria: proteic plasmid stabilization systems. MolMicrobiol 17: 205±210.

Jensen, R.B., Grohmann, E., Schwab, H., Diaz-Orejas, R.,and Gerdes, K. (1995) Comparision of ccd of F, parDEof RP4 and parD of R1 using a novel conditional replica-tion control system of plasmid R1. Mol Microbiol 17:211±220.

Kobayashi, I. (1998) Sel®shness and death. Raison d'etre ofrestriction, recombination and mitochondria. Trends Genet14: 368±374.

Kulakauskas, S., Lubys, A., and Ehrlich, S.D. (1995) DNArestriction-modi®cation systems mediate plasmid mainte-nance. J Bacteriol 177: 3451±3454.

Kusano, K., Naito, T., Handa, N., and Kobayashi, I. (1995)Restriction±modi®cation systems as genomic parasites incompetition for speci®c sequences. Proc Natl Acad SciUSA 92: 11095±11099.

Lanzer, M., and Bujard, H. (1988) Promoters largely determinethe ef®ciency of repressor action. Proc Natl Acad Sci USA85: 8973±8977.

Larsen, J.E.L., Gerdes, K., Light, J., and Molin, S. (1984)Low-copy-number plasmid-cloning vectors ampli®able byderepression of an inserted foreign promoter. Gene 28:45±54.

Miller, J. (1972) Experiments in Molecular Genetics. ColdSpring Harbor, NY: Cold Spring, Harbor Laboratory Press.

Naito, T., Kusano, K., and Kobayashi, I. (1995) Sel®sh behav-ior of restriction±modi®cation systems. Science 267: 897±899.

Nielsen, A.K., Thorsted, P., Thisted, T., Wagner, E.G.H., andGerdes, K. (1991) The rifampicin-inducible genes srnB



from F and pnd from R483 are regulated by antisenseRNAs and mediate plasmid maintenance by killing of plas-mid-free segregants. Mol Microbiol 5: 1961±1973.

Ochman, H., and Selander, R.K. (1984) Standard referencestrains of Escherichia coli from natural populations. J Bac-teriol 157: 690±693.

Ostrowski, J., Wu, J.-Y., Rueger, D.C., Miller, B.E., Siegel,L.M., and Kredich, N.M. (1989) Characterization of thecysJIH regions of Salmonella typhimurium and Escherichiacoli B: DNA sequences of cysI and cysH and a model forthe siroheme-Fe4S4 active center of sul®te reductasehemoprotein based on amino acid homology with spinachnitrite. J Biol Chem 264: 15726±15737.

Poulsen, L.K., Larsen, N.W., Molin, S., and Andersen, P.(1989) A family of genes encoding a cell-killing functionmay be conserved in all Gram-negative bacteria. MolMicrobiol 3: 1463±1472.

Poulsen, L.K., Refn, A., Molin, S., and Anderssin, P. (1991)The gef gene from Escherichia coli is regulated at thelevel of translation. Mol Microbiol 5: 1639±1648.

Poulsen, L.K., Larsen, N.W., Molin, S., and Anderssin, P.(1992) Analysis of an Escherichia coli mutant strain resis-tant to the cell-killing function encoded by the gef genefamily. Mol Microbiol 6: 895±905.

Stark, M.J.R. (1987) Multicopy expression vectors carrying

the lac repressor gene for regulated high-level expressionof genes in Escherichia coli. Gene 51: 255±267.

Thisted, T., and Gerdes, K. (1992) Mechanism of post-segre-gational killing by the hok/sok system of plasmid R1. Sokantisense RNA regulates hok gene expression indirectlythrough the overlapping mok gene. J Mol Biol 223: 41±54.

Thisted, T., Sùrensen, N.S., Wagner, E.G.H., and Gerdes, K.(1994a) Mechanism of post-segregational killing: Sok anti-sense RNA interacts with Hok mRNA via its 58-end single-stranded leader and competes with the 38-end of HokmRNA for binding to the mok translational initiation region.EMBO J 13: 1960±1968.

Thisted, T., Nielsen, A.K., and Gerdes, K. (1994b) Mechan-ism of post-segregational killing: translation of Hok SrnBand Pnd mRNA of plasmids R1, F and R483 is activatedby 38-end processing. EMBO J 13: 1950±1959.

Thisted, T., Sùrensen, N.S., and Gerdes, K. (1995) Mechan-ism of post-segregational killing: secondary structure ana-lysis of the entire Hok mRNA from plasmid R1 suggest afold-back structure that prevents translation and antisenseRNA binding. J Mol Biol 247: 859±873.

Yarmolinsky, M.B. (1995) Programmed cell death in bacterialpopulations. Science 267: 836±837.

Zubay, G. (1973) In vitro synthesis of protein in microbial sys-tems. Annu Rev Genet 7: 267±287.



Documents

Molecular Microbiology (1999) 32(5), 1090–1102