Proc. Nati. Acad. Sci. USAVol. 87, pp. 5968-5972, August 1990Genetics

Molecular cloning and DNA sequence analysis of a diphtheriatox iron-dependent regulatory element (dtxR) fromCorynebacterium diphtheriaeJESSICA BOYD, MANISH N. OZA, AND JOHN R. MURPHY

Evans Department of Clinical Research and Department of Medicine, The University Hospital, Boston University Medical Center, Boston, MA 02118

Communicated by A. M. Pappenheimer, Jr., May 21, 1990

ABSTRACT Although the structural gene for diphtheriatoxin, tox, is carried by a family of closely related corynebac-teriophages, the regulation of lox expression is controfle, to alarge extent, by its bacterial host Corynebacleium diphtheriae.Optimal yields oftox gene products are obtained only when ironbecomes the growth-rate-limiting substrate. Previous studiessuggest that regulation oftox expression Is mediated through aniron-binding aporepressor. To facilitate molecular cloning ofthe tox regulatory element from genomic libraries of C. diph-theriae, we constructed a tox promoter/operator (toxPO)-acZtranscriptional fusion in Escherichia coli strain DH5a. Wereport the molecular cloning and nucleic acid sequence of adiphtheria tox iron-dependent regulatory element, dxR, anddemonstrate that expression of f-galactosidase from thetoxPO-4acZ fusion is regulated by dlxR-encoded protein in aniron-sensitive manner. In addition, we show that expression ofthe toxPO-acZ fusion is not affected by the E. coUl iron-regulatory protein Fur and that the dlxR protein does notinhibit expression offur-regulated outer-membrane proteins.

Diphtheria toxin is synthesized by Corynebacterium diph-theriae lysogenic for one of a family ofcorynebacteriophagesthat carries the structural gene for the toxin, tox (1, 2).Optimal yields of tox gene products have long been known tobe obtained only from C. diphtheriae grown under conditionswhere iron becomes the growth-rate-limiting substrate (3, 4).In 1936, Pappenheimer and Johnson (5) showed that addingiron in low concentration to the growth medium inhibited theproduction of diphtheria toxin. Both biochemical and geneticevidence support the hypothesis that the corynebacterio-phage tox gene is regulated by a corynebacterial-determinediron-binding repressor as postulated by Murphy et al. (6-12).This model predicted an aporepressor that in the presence ofiron forms a complex; this complex then binds to the toxoperator and blocks transcription. Under conditions of ironlimitation, the iron-repressor complex dissociates, dere-pressing the tox gene.The nucleic acid base sequence of tox revealed a 9-base-

pair (bp) inverted repeat that overlaps the " -10" region ofthe promoter (13). Because many operators exhibit dyadsymmetry and are positioned near their respective promot-ers, this region was designated the putative tox operator.We here describe the genetic construction of an Esche-

richia coli host strain that carries a chromosomal diphtheriatox promoter/operator (toxPO)-lacZ transcriptional fusion insingle copy. Because this strain constitutively expressesj-galactosidase and is phenotypically blue on 5-bromo-4-chloro-3-indolyl /3-D-galactoside (X-Gal)-containing agar me-dium, we have used it to screen genomic libraries of nontox-inogenic nonlysogenic C. diphtheriae for determinants thatrepress lacZ expression. We report the molecular cloning and

deduced amino acid sequence (25,316 molecular weight) of adiphtheria tox iron-dependent regulatory element, dtxR.* Weshow that this factor acts as a negative controlling element forthe toxPO-lacZ transcriptional fusion in an iron-dependentfashion.The putative tox operator locus was found to bear striking

homology to Fur (ferric-uptake regulator)-binding sites in theE. coli chromosome (14-17). Fur has been well characterized(18, 19) and shown to complex with iron, functioning as aglobal negative controlling element. Under iron-limiting con-ditions, Fur releases bound iron and dissociates from itsDNA-binding sites, allowing transcription of several iron-sensitive genes. Although dtxR from C. diphtheriae has 66%homology to E. coli fur, we have not seen fur-mediatedrepression of 3-galactosidase expression from the toxPO-lacZtranscriptional fusion described here. In addition, we havebeen unable to detect DtxR-mediated repression of iron-regulated outer-membrane proteins in fur strains of E. coli.

MATERIALS AND METHODSBacterial Strains, Plasmids, and Coliphage. The bacterial

strains, plasmids, and coliphage A used are listed in Table 1.Media. E. coli strains were grown in Luria broth (10 g of

tryptone, 10 g of NaCl, and 5 g of yeast extract per liter) orlambda broth (10 g of tryptone and 10 g of NaCl per liter). Asnoted, medium was supplemented with ampicillin (100 ,ug/ml), kanamycin (35 ug/ml), X-gal (40 ,ug/ml), or the ironchelator 2,2'-dipyridyl (200-300 ILM). C. diphtheriae strainswere grown in low-iron C-Y medium as described (26).

Nucleic Acids. Oligonucleotides were synthesized by usingcyanoethyl phosphoramidite chemistry on an Applied Bio-systems 380A DNA synthesizer. After synthesis oligonucle-otides were purified by Nensorb Prep cartridges (New En-gland Nuclear) as directed by the manufacturer. To hybridizecomplementary strands, equimolar concentrations of eachstrand in 100 mM NaCl were heated to 900C for 10 min andallowed to cool to room temperature.Chromosomal DNA was extracted and purified from C.

diphtheriae essentially as described by Pappenheimer andMurphy (27). Plasmid DNA was extracted by the alkalinelysis method and purified by ethidium bromide/cesium chlo-ride isopynic centrifugation (28). Restriction enzymes werefrom Bethesda Research Laboratories and used according tothe manufacturer's directions. Restriction endonucleasefragments were electrophoresed in 0.7% agarose gels in TBE(50 mM Tris/50 mM boric acid/0.5 mM EDTA, pH 8.0).

Nucleic acid sequencing was performed on both strands ofplasmid DNA according to the method of Sanger et al. (29) asmodified by Kraft et al. (30) using Sequenase (United StatesBiochemical). Oligonucleotide primers were synthesized as

Abbreviations: toxPO, tox promoter/operator; ORF, open readingframe; X-Gal, 5-bromo-4-chloro-3-indolyl sequences f3-D-galacto-side; dtxR, diphtheria tox iron-dependent regulatory element.*The sequence reported in this paper has been deposited in theGenBank data base (accession no. M34239).

5968

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Oct

ober

28,

202

0

Proc. Natl. Acad. Sci. USA 87 (1990) 5969

Table 1. Bacterial strains, plasmids, and coliphage A usedin this study

ReferenceStrain Genotype or source

E. coliNK7047 F- A- AlacX74 rpsL galOP308 Ref. 20DH1 F- A- recAl endAl gyrA96 Ref. 21

thil hsdRI7 (rk-, mk+)supE44 relAI

DH5a F- (480d lacZ AM15) A BRL(lacZYA-argF) U169 recAlendAI hsdRJ7 (rk-, mk+)supE44 thil gyrA relAI

DH5a: As DH5a but lysogenic for This workARStoxPO ARS45 (toxPO/IacZYA, kanR)

SM796 F- A- araD139 A(araABC-leu) Ref. 167696 galE galK AlacX74 rpsLthi phoA /Pvu II phoR

SBC7% As SM796 but fur::Tn5 Ref. 16PlasmidpABN203 fur+ Ref. 22pRS551 cryptic lacZ kanR ampR Ref. 20pRS551toxPO This workpHH2500 This workpVV1500 This workpHP900 This workpSH1400 This workpVN1200 This workpRS551toxPO- This workVN1200

pRS55ltoxPO- This workFur

ColiphageARS45 lacZ' bla' Ref. 20ARS45toxPO toxPO-lacZ kanR This work

C. diphtheriaeC7(-) Ref. 23PW8(-) Ref. 241030(-) Ref. 25

BRL, Bethesda Research Laboratories.

described. Southern blot hybridization was done as describedby Ausubel et al. (28) on Nytran filter paper (Schleicher &Schuell). Colony blot hybridization was performed as de-scribed by Gergen et al. (31). The DNA probe for bothtechniques was the 1.5-kilobase (kb) Pvu II fragment fromplasmid pHH2500, which was 32P-labeled by using the ran-dom primers kit (8187SA, Bethesda Research Laboratories).

fi-Galactosidase Assay. (3-Galactosidase was measured asdescribed by Miller (32). Briefly, 0.5 ml of an overnightculture at A6w jm of -1.0 was lysed by adding 10 ,ul of lysismix (toluene/0.02 M MnSO4/10%o SDS/2-mercaptoethanol1:1:1:5) according to the modification of Putnam and Koch(33). Ten micrograms of lysate was transferred to 1.0 ml of Zbuffer at 28°C. The reaction was initiated by adding 200 1,u ofo-nitrophenyl f3-D-galactoside (ONPG) (4 mg/ml). After in-cubation for 30 min-3 hr, the reaction was stopped by adding0.5 ml of 1 M sodium carbonate. Absorbance was measuredat 420 and 550 nm, and ,3-galactosidase units were calculatedaccording to Miller (32).

Preparation of Outer Membranes. Outer-membrane pro-teins were prepared from cells grown in Luria broth asdescribed by Hantke (34), electrophoresed on 0.1% SDS/10% polyacrylamide gels according to the method ofLaemmli(35), and stained with Coomassie blue.

RESULTSGenetic Construction oftoxPO-lacZ Transcriptional Fusion.

To develop an E. coli host strain to screen genomic libraries

of nontoxinogenic nonlysogenic C. diphtheriae for the puta-tive diphtheria tox repressor, we constructed a transcrip-tional fusion between toxPO and lacZ. Each strand of the65-bp diphtheria toxin regulatory region (-80 to -15) up-stream of the tox translational start signal was synthesized invitro (Fig. 1A) and modified to contain one-half EcoRI andone-half BamHI ends to facilitate vectorial cloning intoEcoRI and BamHI sites ofthe promoter probe vector pRS551(Fig. 1B). Plasmid pRS551 carries a cryptic lac operon andgenes that confer resistance to both kanamycin (kan) andampicillin (bla) (20). After ligation and transformation, re-combinant E. coli that carried the toxPO-lacZ transcriptionalfusion were selected by a blue-colony phenotype on agarmedium supplemented with ampicillin and X-gal. Severalclones were isolated, minilysates were then prepared, andplasmid DNA was sequenced to insure that toxPO wasinserted in single copy and in the correct orientation. Oneclone was selected, and the recombinant plasmid was des-ignated pRS55ltoxPO (Fig. 1B). As shown in Table 2, E. coliSM796(pRS55ltoxPO) was found to express moderate levelsof ,3-galactosidase.To introduce a single copy of the toxPO-lacZ transcrip-

tional fusion into the E. coli chromosome, the recA+ NK7049strain was transformed with plasmid pRS55ltoxPO and sub-sequently infected with coliphage ARS45. Because thiscoliphage carries a partial deletion of the flanking bla (bla')and lacZ (lacZ'), the toxPO-lacZ transcriptional fusion andthe kanamycin resistance gene are transferred frompRS55ltoxPO to ARS45 by homologous recombination.High-titer phage lysates were prepared and screened for lac+recombinant plaques on lawns of NK7049 on X-Gal-supplemented agar medium. Because the kan gene frompRS55ltoxPO is also transferred to the recombinant phage,lac+ lysogens were subsequently isolated and colony-

_ "-35" . _-10"

i BauHII EcoRI

B

toxPO

1/2 EcoRI 1/2B8mHI

FIG. 1. (A) Sequence of the synthetic oligonucleotides encodingthe -80 to -15 region upstream of the tox translational initiationsignal that carries toxPO. The inverted arrows indicate the putativetox operator region. The tox promoter is indicated by "-10" and"-35." (B) Plasmids used in the construction of the diphtheriatoxPO-lacZ transcriptional fusion.

Genetics: Boyd et al.

A

Dow

nloa

ded

by g

uest

on

Oct

ober

28,

202

0

Proc. Natl. Acad. Sci. USA 87 (1990)

Table 2. Expression of f-galactosidase by E. coli strains

P-galactosidase, units*

No 2,2'-DipyridylE. coli strain addition (300 uM)

fur+SM796 4 83SM796(pRS551toxPO) 3,184 3,067SM796(pRS551toxPO-Fur) 3,402 2,708SM796(pRS551toxPO-VN1200) 73 2,682DH1 11,159 10,617DH1(pVN1200) 10,419 12,727

furSBC7% 7 36SBC796(pRS551toxPO) 3,427 4,613SBC796(pRS551toxPO-Fur) 3,320 3,190SBC796(pRS551toxPO-VN1200) 68 2,771

*Average of four independent experiments.

purified on kanamycin-supplemented agar medium. One suchclone was selected at random, a phage lysate was prepared,and the recombinant phage was designated ARS45toxPO(lac+, kanR, amps).Molecular Cloning of dErR. Chromosomal DNA was iso-

lated from the nontoxigenic, nonlysogenic C7 strain of C.diphtheriae, digested with HindIII, and after electrophoresison agarose gels, 1- to 12-kb fragments were isolated. Chro-mosomal fragments were then ligated into HindIII-digestedpUC18 and transformed into E. coli DH5a:ARS45toxPO.Transformants were selected on agar medium supplementedwith ampicillin and X-gal and screened for a white-colonyphenotype. From >18,000 transformants screened, 71 whiteand light blue colonies were isolated and colony purified forfurther analysis. Plasmid DNA from 20 random clones wasretransformed into E. coli DH5a:ARS45toxPO, and 16 werefound to retain their white phenotype on X-gal-containingmedium. Restriction endonuclease digestion analysis ofminilysate DNA with HindIlI revealed that all 16 plasmidscontained inserts with a common 2.5-kb segment (data notshown). One isolate was selected, and the recombinantplasmid was designated pHH2500. Fig. 2 shows a partialrestriction endonuclease map of the 2.5-kb insert ofpHH2500.By using a 32P-labeled 1.5-kb Pvu II fragment of pHH2500

as a probe for colony blot analysis, we found that alltransformants retaining a white phenotype on X-gal agarmedium contained DNA that hybridized to the probe understringent conditions. Moreover, we found by Southern blotanalysis that HindIII digests of chromosomal DNA from C.diphtheriae strains C7(-), PW8(-), and 1030(-) also con-

PLASAO

poHH/25

ORF _ / _ 2 _ 3PHENOTYPE

1/D ON X-GAL

i00 1 I W

p VV/500

pHP900 i IpSH/400

p VN/200 -HI

w

B

B

w

FIG. 2. Partial restriction endonuclease digestion map of the2.5-kb HindIll chromosomal fragment ofC. diphtheriae that encodesdtxR. Relative positions and direction of transcription ofORF1-3 areshown. Plasmids that carry subclones of the 2.5-kb insert and theirrespective phenotype inE. coli DH5a:ARS45toxPO transformants onX-gal medium are listed. W, white; B, blue.

tained a single band that hybridized with the 1.5-kb probe(data not shown).DNA sequence analysis of the 2.5-kb HindIII insert re-

vealed three nonoverlapping open reading frames (ORF1-3)(Fig. 2). To localize the putative diphtheria tox regulatoryelement, we subcloned restriction fragments into pUC18 andthen transformed E. coli DH5a:ARS45toxPO with the deriv-ative plasmids. As shown in Fig. 2, only those plasmids thatcarried ORF2 conferred a white-colony phenotype. Thus, theputative tox regulatory element was positioned on a 1.2-kbPvu II-Nar I fragment of pHH2500. This segment carries the678-bp ORF2, which is predicted to encode a 25,316-Daprotein. The nucleic acid and deduced amino acid sequence

of this ORF is shown in Fig. 3.DtxR Is an Iron-Dependent Regulatory Element. Because

the heterologous diphtheria tox promoter is relatively weak inrecombinant strains ofE. coli and the level ofP-galactosidaseexpressed in the DHSa:ARS45toxPO lysogen is low, werecloned the 1.2-kb Pvu II-Nar I segment of pHH2500 thatencodes ORF2 into plasmid pRS55ltoxPO. Recombinant E.coli carrying plasmid pRS55ltoxPO-VN1200 was used tostudy the effect ofthe putative tox regulatory element on lacZexpression.

-230 -220 -210 -200 -190 -180CAATAAAGCGTTTGCTTAGATATGCCTACCAATAAAGACATAAACGCCTATTAAAAGCAA

-170 -160 -150 -140 -130 -120TCTTTAGATTAGGCGTTATAATTAAAGTCTCATCGAAAAACGCGCTGCGGGACTACAACG

-110 -100 -90 -80 -70 -60CAACAAGAAAACTATTCCATATTTTTCACGCTACAATTCGTTGTAGATTGATAGGAATTG

-50 -40 -30 -20 -10 1ATCACCAGCACACAACAGTCTCCATGGCACTATAAGGAAAGAGGCTTACAATGAAGGAC

MetLysAsp

10 20 30 40 50 60TTAGTCGATACCACAGAGATGTACTTGCGTACTATCTATGAGCTGGAAGAAGAGGGAGTCLeuValAspThrThrGluMetTyrLeuArgThrIleTyrGluLeuGluGluGluGlyVal

70 80 90 100 110 120ACCCCTCTTCGCGCTAGGATCGCTGAGCGTCTGGAACAATCTGGACCTACAGTTAGCCAAThrProLeuArgAlaArgIleAlaGluArgLeuGluGlnSerGlyProThrValSerGln

130 140 150 160 170 180ACCGTTGCCCGTATGGAGCGCGATGGACTTGTCGTTGTCGCCTCAGACCGCAGTCTACAAThrValAlaArgMetGluArgAspGlyLeuValValValAlaSerAspArgSerLeuGln

190 200 210 220 230 240ATGACACCGACAGGCCGCACTTTAGCGACTGCAGTTATGCGTAAACATCGCTTAGCTGAGMetThrProThrGlyArgThrLeuAlaThrAlaValMetArgLysHisArgLeuAlaGlu

250 260 270 280 290 300CGCCTTCTTACCGATATCATTGGTCTAGATATCAATAAAGTTCACGATGAAGCCTGCCGCArgLeuLeuThrAspIleIleGlyLeuAspIleAsnLysValHisAspGluAlaCysArg

310 320 330 340 350 360TGGGAACACGTTATGAGTGACGAAGTTGAACGCAGGCTCGTGAAAGTATTGAAAGATGTCTrpGluHisValMetSerAspGluValGluArgArgLeuValLysValLeuLysAspVal

370 380 390 400 410 420AGTCGGTCCCCCTTCGGAAACCCAATTCCAGGTCTCGACGAACTCGGCGTAGGCAATTCTSerArgSerProPheGlyAsnProIleProGlyLeuAspGluLeuGlyValGlyAsnSer

430 440 450 460 470 480GACGCGGCAGCCCCCGGAACTCGCGTTATTGACGCTGCCACCAGCATGCCCCGCAAAGTAAspAlaAlaAlaProGlyThrArgValIleAspAlaAlaThrSerMetProArgLysVal

490 500 510 520 530 540CGCATTGTTCAGATTAACGAAATCTTTCAAGTTGAAACGGATCAGTTTACACAGCTCCTCArgIleValGlnIleAsnGluIlePheGlnValGluThrAspGlnPheThrGlnLeuLeu

550 560 570 580 590 600GATGCTGACATCCGTGTTGGATCAGAAGTCGAAATTGTAGATAGAGACGGCCACATCACGAspAlaAspIleArgValGlySerGluValGluIleValAspArgAspGlyHisIleThr

610 620 630 640 650 660TTGAGCCACAATGGAAAAGATGTCGAACTCCTCGATGATCTGGCTCACACTATTCGTATCLeuSerHisAsnGlyLysAspValGluLeuLeuAspAspLeuAlaHisThrIleArgIle

670 680 690 700GAAGAACTCTAAATACTAAAGGCGGCAAATTAGATGAAACTGluGluLeu!!!

FIG. 3. Nucleotide and deduced amino acid sequence of the dtxRgene from C. diphtheriae. The putative -35 and -10 regions of dtxRpromoter are designated (*), and the ribosome-binding site is under-lined.

5970 Genetics: Boyd et aL

Dow

nloa

ded

by g

uest

on

Oct

ober

28,

202

0

Proc. Natl. Acad. Sci. USA 87 (1990) 5971

That the regulation of diphtheria tox expression in C.diphtheriae is mediated by the extracellular iron concentra-tion is well known (4). Because 2,2'-dipyridyl can chelateextracellular iron and derepress iron-sensitive genes in E.coli(36, 37), we examined the effect of this agent on E. coli(pRS55ltoxPO and pRS551toxPO-VN1200).As shown in Table 2, moderate levels of P-galactosidase

are expressed by E. coli SM796 (pRS55ltoxPO), both in thepresence and absence of the iron chelator dipyridyl. Inmarked contrast, however, the presence of dtxR on plasmidpRS55ltoxPO reduces the level of /3-galactosidase expres-sion to almost background levels in iron-rich LB medium.Moreover, the addition of dipyridyl to the growth medium ofE. coli (pRS551toxPO-VN1200) results in a derepression ofthe toxPO-lacZ transcriptional fusion and results in theexpression of -3-galactosidase.Because Tai and Holmes (14) have reported that the E. coli

iron-dependent regulatory factor Fur partially regulates thediphtheria tox promoter, we subcloned the fur gene (1.2-kbAcc I-Bgl I fragment) from pABN203 to form pRS551toxPO-Fur in an attempt to confirm and extend their observations.As shown in Table 2, the presence offur does not affect theexpression of 3-galactosidase from the toxPO-4acZ fusion ineither thefur' (SM796) orfur- (SBC796) E. coli background.Fur has been shown to regulate the expression of several

outer-membrane proteins in E. coli (34). A shown in Fig. 4,plasmid pRS551toxPO-Fur inhibits expression of iron-regulated outer-membrane proteins in thefur- SBC796 back-ground (lane H); however, the presence ofcloned dtxR in thisstrain has no detectable effect on the expression of theseouter-membrane proteins (lane I). Even though the putativetox operator shares sequence homology with fur operators(14), the results presented here strongly suggest that theregulatory action of Fur and DtxR are restricted to theirrespective target sequences.To demonstrate that the wild-type lac operon is not affected

by the dtxR gene product, pVN1200 was transformed into E.coli DH1. As shown in Table 2, after induction with isopropyl(-D-thiogalactoside, equivalent levels of .-galactosidase areexpressed by both DH1 and DH1 (pVN1200) strains.Because the expression of 3-galactosidase from

pRS55ltoxPO plasmid is constitutive and appears to benegatively controlled in an iron-dependent manner in E. coli(pRS551toxPO-VN1200), we conclude that the putative toxregulatory factor cloned from a genomic library of nontoxi-nogenic nonlysogenic C. diphtheriae is a diphtheria toxtranscriptional regulatory factor and have designated it dtxR(diphtheria tox regulatory element). Although these resultsdo not rigorously prove that dtxR is the gene encoding thediphtheria tox regulatory element in C. diphtheriae, the

A B C D E F G H I

9 768- _~~~~~~JW _ I-ROMP

68-

4 3 w__

FIG. 4. SDS/polyacrylamide gel analysis of outer-membraneproteins ftom fur' (SM79) and fur (SBC79) strains of E. coli.Lanes: A, Mr markers; B, SM796; C, SM7% (pRS551toxPO); D,SMte7% (frStomfur+PO(F7r) En f-SM7 (RSBC796)stoxnsPo-VN1.)oF,SBC7%; G, SBC796 (pRS55ltoxPO); H, SBC7% (pRS551toxPO-Fur); I, SBC796 (pRS55ltoxPO-VN1200). IROMP, iron-regulatedouter-membrane proteins.

iron-dependent regulation of toxPO in E. coli by cloned dtxRis consistent with this interpretation.

Characterization of dtXR. We have conducted a computersearch using the EMBL 21 and Swiss-Prot (PC/GENE databanks release 3.0) 13 databases for both nucleic acid andprotein sequences that may share homology with dtxR. WhiledtxR has been found to be unique in these databases, we havefound that dtxR shares 66% nucleic acid and 25% amino acidhomology with E. coli fur. Inspection of the upstream non-coding region revealed a putative promoter and a ribosome-binding site for dtxR (Fig. 3). The sequence of the putativedtxR promoter in C. diphtheriae is similar to that described(13) for the corynebacteriophage tox gene. In addition, anal-ysis ofthe amino acid sequence ofDtxR has revealed a regionthat bears some homology to the helix-turn-helix motif forDNA-binding proteins (36). This region extends from Val-174to His-201 and, according to the method ofGamier et al. (37),has a predicted a-helix turn a-helix secondary structure.

DISCUSSIONWe have screened a genomic library of nontoxinogenicnonlysogenic C. diphtheriae for factors that may be directlyengaged in the regulation of diphtheria tox expression. Tofacilitate screening, we have constructed an E. colai hoststrain that carries a single genomic copy of a transcriptionalfusion between the diphtheria tox regulatory region and lacZ,toxPO-lacZ. We show that expression of 0-galactosidasefrom the toxPO-lacZ fusion is constitutive (Table 2). Fromover 18,000 recombinant E. coli DH5a screened, we isolated71 clones in which the 3-galactosidase expression fromtoxPO-lacZ was suppressed. Of these, -75% retained theirwhite-colony phenotype on X-gal-containing medium uponretransformation of their respective plasmid DNA into lyso-gens of E. co/i:ARS45toxPO. It is of interest to note that allrecombinant plasmids that conferred a white-colony pheno-type in this strain were found to carry an insert with acommon 2.5-kb HindIII segment.

Subcloning of restriction fragments has identified a 1.2-kbregion essential for the repression of f-galactosidase expres-sion from the toxPO-lacZ transcriptional fusion. Nucleic acidsequence analysis has shown that the 1.2-kb insert carries asingle ORF that is predicted to encode a 25,316-Da protein.The presence ofthis DNA fragment on plasmid pRS551toxPOreduces the level of f3-galactosidase expression from thetoxPO-lacZ fusion to almost background levels. The 1.2-kbPvu II-Nar I fragment, however, has no effect on the levels of(-galactosidase expressed from the wild-type lac promoter instrain DH1 (pVN1200).Because the regulation of diphtheria tox gene products in

lysogenic C. diphtheriae is mediated by extracellular iron (4,5), we examined the effect ofthe iron chelator, 2,2'-dipyridyl,on ,3-galactosidase expression by E. coli strains that carry thetoxPO-lacZ transcriptional fusion and the putative tox reg-ulatory element. We have shown that the addition of dipy-ridyl to the culture medium results in almost completederepression of the toxPO-lacZ operon.Murphy et al. (10) have shown that the action of the

diphtheria tox regulatory factor was mediated at the level oftranscription. In addition, the isolation of both corynebacte-rial (7) and corynebacteriophage (8, 9) mutants in which toxexpression was relatively insensitive to iron suggested thatthe regulation of tox was mediated through a C. diphtheriaeiron-binding negative controlling element (12). The molecularcloning of dtxR from genomic libraries of C. diphtheriae andthe observation that this factor acts as an iron-dependentregulator of the toxPO-lacZ transcriptional fusion are con-sistent with the model for tox regulation proposed by Murphyand Bacha (12).

Genetics: Boyd et al.

Dow

nloa

ded

by g

uest

on

Oct

ober

28,

202

0

Proc. Natl. Acad. Sci. USA 87 (1990)

Recently, Fourel et al. (11) have shown that an iron-bindingprotein, DtoxR, from extracts of C. diphtheriae could spe-cifically bind to the presumptive diphtheria tox operator locusand protect it from DNase I digestion. The putative toxoperator locus is a 27-bp region that contains a 9-bp invertedrepeat sequence separated by 9 bp (13, 38). Whether thisfactor is similar or identical to the corynebacterial factor wehave cloned and sequenced remains to be determined. None-theless, DtxR protein appears to have functional propertiesidentical to those of the iron-binding protein DtoxR.

Tai and Holmes (14) have recently described the construc-tion of a diphtheria tox-galK transcriptional fusion in whichthe tox regulatory region as well as fragment A and a portionof fragment B were cloned upstream from a cryptic galKgene. In recombinant E. coli that carried this fusion, the rateofgalK expression was increased =5-fold under iron-limitingconditions and appeared to be regulated byfur. In the presentstudy, we have used thefur' SM7% strain of E. coli and thecongenicfur- SBC796 strain and have not observed repres-sion of p-galactosidase expression from the toxPO-lacZfusion by Fur. Moreover, we did not observe an inhibitoryeffect of Fur on f3-galactosidase expression, even when furwas recloned on the multicopy pRS551toxPO plasmid.There are several possible explanations for our inability to

confirm the results of Tai and Holmes (14): the geneticconstruct used by these investigators contains additionalsequences that are 5' to the tox regulatory region, and thesesequences are not included in the -15 to -80 oligonucleotideencoding the toxPO region used in the present study. As aresult, additional regulatory sites may be present on thetox-galK construct. Alternatively, galactokinase expressedfrom pTKW1 may have a longer half-life in E. coli underconditions of iron starvation.Because DtxR appears to be an iron-dependent regulatory

element, it was ofinterest to examine the effect ofdtxR on theexpression of E. coli iron-regulated outer-membrane pro-teins. We did not observe repression of Fur-regulated outer-membrane proteins infur- recombinant strains ofE. coli thatcarried dtxR. These data suggest that although Fur and DtxRappear to have similar activities in their respective hosts andthat they bind to similar operator sequences, their regulatoryaction is likely to be restricted to their specific operators.

It is tempting to speculate that DtxR is analogous to Furand functions as a global regulatory element in C. diphthe-riae. Such an element would be anticipated to be directlyinvolved in the control of the corynebacterial high-affinityiron transport system, as well as the regulation of thecorynebacteriophage tox operon. Although the function ofFur in E. coli and DtxR in C. diphtheriae appears similar,comparison of their DNA sequence has shown only 66%nucleic acid and 25% amino acid homology, respectively.

We thank R. W. Simons, J. B. Neilands, and S. B. Calderwood forsupplying bacterial, plasmid, and A phage strains. This work waspartially supported by U.S. Public Health Service Grant AI-21628(J.R.M.) from the National Institute of Allergy and InfectiousDiseases and by an award from the Division of Medical and DentalSciences (GRSA 57-236-0147-9), Boston University School of Med-icine (J.B.).

1. Uchida, T., Gill, D. M. & Pappenheimer, A. M., Jr. (1971)Nature (London) New Biol. 233, 8-11.

2. Buck, G. A., Gross, R. E., Wong, T. P., Lorea, T. & Groman,N. B. (1985) Infect. Immunol. 49, 679-684.

3. Pappenheimer, A. M., Jr. (1955) in Mechanisms ofMicrobialPathogenicity, eds. Howie, J. W. & O'Hea, A. J. (CambridgeUniv. Press, New York).

4. Pappenheimer, A. M., Jr. (1977) Annu. Rev. Biochem. 46,69-94.

5. Pappenheimer, A. M., Jr., & Johnson, S. J. (1936) Br. J. Exp.Pathol. 17, 335-341.

6. Murphy, J. R., Pappenheimer, A. M., Jr., & Tayart de Borms,S. (1974) Proc. Natl. Acad. Sci. USA 71, 11-15.

7. Kanei, C., Uchida, T. & Yoneda, M. (1977) Infect. Immunol.18, 203-209.

8. Murphy, J. R., Skiver, J. & McBride, G. (1976) J. Virol. 18,235-244.

9. Welkos, S. & Holmes, R. K. (1981) J. Virol. 37, 936-945.10. Murphy, J. R., Michel, J. L. & Teng, M. (1978) J. Bacteriol.

135, 511-516.11. Fourel, G., Phalipon, A. & Kaczorek, M. (1989) Infect. Immun.

57, 3221-3225.12. Murphy, J. R. & Bacha, P. (1979) in Microbiology 1979 (Amer.

Soc. Microbiol., Washington), pp. 181-186.13. Boyd, J. & Murphy, J. R. (1988) J. Bacteriol. 170, 5949-5952.14. Tai, S.-P. S. & Holmes, R. K. (1988) Infect. Immunol. 56,

2430-2436.15. Calderwood, S. B. & Mekalanos, J. J. (1987) J. Bacteriol. 169,

4759-4764.16. Calderwood, S. B. & Mekalanos, J. J. (1988) J. Bacteriol. 170,

1015-1017.17. de Lorenzo, V., Wee, S., Herro, M. & Neilands, J. B. (1987)

J. Bacteriol. 169, 2624-2630.18. Hantke, K. (1984) Mol. Gen. Genet. 197, 337-341.19. Schaffer, S., Hantke, K. & Braun, V. (1985) Mol. Gen. Genet.

200, 111-113.20. Simons, R. W., Houman, F. & Kleckner, N. (1987) Gene 53,

85-69.21. Hanahan, D. (1983) J. Mol. Biol. 166, 557-580.22. Bagg, A. & Neilands, J. B. (1985) J. Bacteriol. 161, 450-453.23. Barksdale, W. L. & Pappenheimer, A. M., Jr. (1954) J. Bac-

teriol. 67, 220-232.24. Park, W. H. & Williams, A. W. (1896) J. Exp. Med. 1, 164-185.25. Bezjak, V. (1954) Antonie von Leevwenhook 20, 269-272.26. Pappuoli, R., Michel, J. L. & Murphy, J. R. (1983) J. Bacteriol.

153, 1202-1210.27. Pappenheimer, A. M., Jr., & Murphy, J. R. (1983) Lancet i,

923-926.28. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D.,

Seidman, J. G., Smith, J. A. & Struhl, K. (1989) CurrentProtocols in Molecular Biology (Wiley, New York).

29. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Nadl.Acad. Sci. USA 74, 5463-5467.

30. Kraft, R., Tardiff, J., Krauter, K. S. & Leinwand, L. A. (1988)BioTechniques 6, 544-547.

31. Gergen, J. P., Stem, R. H. & Wensink, P. C. (1979) NucleicAcids Res. 7, 2115-2136.

32. Miller, J. H. (1972) Experiments in Molecular Genetics (ColdSpring Harbor Lab., Cold Spring Harbor, NY).

33. Putnam, S. L. & Koch, A. L. (1975) Anal. Chem. 63, 350-360.34. Hantke, K. (1981) Mol. Gen. Genet. 182, 288-292.35. Laemmli, U. K. (1970) Nature (London) 227, 680-685.36. Pabo, C. 0. & Sauer, R. T. (1984) Annu. Rev. Biochem. 53,

293-321.37. Garnier, J., Osguthorpe, D. J. & Robson, B. (1978) J. Mol.

Biol. 120, 97-120.38. Kaczorek, M., Delpeyroux, F., Chenciner, N., Streeck, R. E.,

Murphy, J. R., Boquet, P. & Tiollais, P. (1983) Science 221,855-858.

5972 Genetics: Boyd et al.

Dow

nloa

ded

by g

uest

on

Oct

ober

28,

202

0