Vol. 59, No. 5INFECTION AND IMMUNITY, May 1991, p. 1716-17220019-9567/91/051716-07$02.00/0Copyright © 1991, American Society for Microbiology

Molecular Cloning, Expression, and Sequence of the Pilin Genefrom Nontypeable Haemophilus influenzae M37

TREY COLEMAN, SUSAN GRASS, AND ROBERT MUNSON, JR.*Edward Mallinckrodt Department ofPediatrics and Department of Molecular Microbiology, Washington UniversitySchool of Medicine, and Division of Infectious Diseases, St. Louis Children's Hospital, St. Louis, Missouri 63110

Received 22 October 1990/Accepted 25 February 1991

Nontypeable Haemophilus influenzae M37 adheres to human buccal epithelial cells and exhibits mannose-resistant hemagglutination of human erythrocytes. An isogenic variant of this strain which was deficient inhemagglutination was isolated. A protein with an apparent molecular weight of 22,000 was present in thesodium dodecyl sulfate-polyacrylamide gel profile of sarcosyl-insoluble proteins from the hemagglutination-proficient strain but was absent from the profile of the isogenic hemagglutination-deficient variant. Amonoclonal antibody which reacts with the hemagglutination-proficient isolate but not with the hemaggluti-nation-deficient isolate has been characterized. This monoclonal antibody was employed in an affinity columnfor purification of the protein as well as to screen a genomic library for recombinant clones expressing the gene.Several clones which contained overlapping genomic fragments were identified by reaction with the monoclonalantibody. The gene for the 22-kDa protein was subcloned and sequenced. The gene for the type b pilin fromH. influenzae type b strain MinnA was also cloned and sequenced. The DNA sequence of the strain MinnA genewas identical to that reported previously for two other type b strains. The DNA sequence of the strain M37 geneis 77% identical to that of the type b pilin gene, and the derived amino acid sequence is 68% identical to thatof the type b pilin.

Nontypeable Haemophilus influenzae is commonly foundin the nasopharynx of children and is responsible for approx-imately 20% of acute bacterial middle ear infections inchildren (8, 45). This organism also is thought to play a rolein exacerbation of chronic bronchitis and to cause pneumo-nia in the elderly population (33). It is estimated that in thedeveloping world, more than 4 million children under the ageof 5 die of lower respiratory infection each year (21).Although most cases of lower respiratory infection arethought to be caused by viral agents, the majority of thesevere disease and death is thought to be due to bacterialpathogens (5, 27, 32). In four published studies of childrenwith pneumonia in which lung puncture or blood specimenswere cultured, nontypeable H. influenzae, H. influenzaetype b, and Streptococcus pneumoniae were the predomi-nant pathogens identified (4, 38, 46, 47).

Pili in both type b and nontypeable H. influenzae havebeen described. Type b organisms isolated from the blood orcerebrospinal fluid of patients are hemagglutination deficientand do not express pili (13, 35). Strains expressing a hemag-glutination-associated pilus as well as strains not expressingthis pilus have been isolated from the human nasopharynx(10, 24, 35). Variants of type b strains expressing pili can alsobe isolated by enrichment for cells which adhere to humanerythrocytes (13, 35). The cloning and sequencing of thegene for the type b pilus from two strains have been reportedrecently (11, 20, 44).

Pili in nontypeable isolates have also been observed andcharacterized. Several morphologically distinct structureshave been described (1, 2, 6). One of these, the LKP pilus,appears to be similar to the type b pilus. The cloning of theLKP pilin operon from a nontypeable strain has been re-ported (17). Although these pili are thought to be importantcolonization factors and antibody directed against the LKP

* Corresponding author.

pilus is protective in an experimental model of nontypeableHaemophilus otitis media (18), studies to date have beenhampered by the lack of isogenic strains which stablyexpress or do not express pili. Further, no data regarding thestructure of these pili, the molecular basis for phase varia-tion, or the biogenesis of these pili are available. As a firststep toward addressing these questions, we report the clon-ing, expression in Escherichia coli, and primary sequence ofa pilin gene from the nontypeable H. influenzae strain M37.

MATERIALS AND METHODS

Strains. The M37 strain ofH. influenzae, a nasopharyngealisolate, was a gift from J. Gilsdorf (10). Supernatants fromovernight cultures of M37 were tested for reactivity withtyping sera for capsular serotypes a through f by counter-current immunoelectrophoresis (16). No positive reactionswere observed. Southern blot analysis of chromosomalDNA from strain M37 revealed one weakly hybridizingchromosomal EcoRI fragment when probed with plasmidpUO38, a plasmid which contains sequences common to allencapsulated strains of H. influenzae and their nonencapsu-lated derivatives (19). Thus, M37 is not an encapsulatedstrain, nor does it appear to be a capsule-deficient mutant ofan encapsulated strain.A hemagglutination-deficient variant of strain M37 was

isolated by enriching for M37 cells which did not bind tohuman erythrocytes (42). Individual clones were thenscreened for hemagglutinating activity. A clone with nodetectable hemagglutinating activity was saved for furtheranalysis; this clone was designated M37-1. When grown inbroth without shaking, M37-1 cells settle to the bottom of thetube, whereas M37 cells grow as a turbid suspension. Inorder to select a variant which grew like strain M37, wetransferred 100 ,ul from the top of an overnight growthculture of M37-1 into fresh broth and allowed the culture togrow overnight. After several transfers, the overnight cul-

1716

on Septem

ber 22, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

NONTYPEABLE HAEMOPHILUS INFLUENZAE PILIN GENE

tures were evenly turbid. A loop of culture was streaked onchocolate agar, and clones were tested individually forhemagglutinating activity. A hemagglutination-proficient de-rivative designated M37-2 was saved for further analysis.H. influenzae type b strain MinnA was provided by J.

Gilsdorf and has been described elsewhere (30). E. coli K-12strains X2819 (7) and LE392 were gifts from Roy Curtiss III.E. coli BL21(DE3)/pLysS was a gift from F. William Studier.Strain BL21(DE3) contains a single copy of the T7 RNApolymerase gene under the control of the lac regulatorysystem (41). Plasmid pLysS contains the T7 lysozyme gene.T7 lysozyme binds to the T7 RNA polymerase in vitro, andpLysS stabilizes many toxic T7 expression constructs, pre-sumably by binding and inactivating the low quantities of T7RNA polymerase produced by BL21(DE3) in the absence ofIPTG (isopropyl-,-D-thiogalactopyranoside) (26). E. coliJM101 was obtained from New England BioLabs. PlasmidpCOS2EMBL (36) was obtained from Roy Curtiss III, andplasmid pT7-7 was a gift from Stan Tabor (43). PlasmidpUO38 was a gift from E. Richard Moxon (19). M13mpl8and M13mpl9 were obtained from New England BioLabs.The H. influenzae strains were grown on chocolate agar or

in supplemented brain heart infusion broth as describedpreviously (3). The E. coli strains were grown on L agarplates or L broth supplemented with 50 ,ug of ampicillin perml, 35 ,ug of kanamycin per ml, and/or 25 ,ug of chloram-phenicol per ml as appropriate.

Agglutination. Hemagglutination assays of H. influenzaeand E. coli strains were performed as described previously(35). Briefly, plate-grown cells were suspended in phos-phate-buffered saline (PBS) (pH 7.4) at an Awo of 1.0.Fifty-microliter aliquots of twofold bacterial dilutions wereplaced in U-bottom microtiter wells (Dynatech Laborato-ries, Inc., Chantilly, Va.). An equal volume of a 0.6%suspension of human type 0 erythrocytes in PBS (in someexperiments 2% mannose was present in the PBS) wasadded, and the two volumes were mixed and then incubatedwithout shaking at room temperature. Hemagglutination wasdetermined visually after 1 h. The highest bacterial dilutionwith visible agglutination was reported as the titer.

Direct bacterial agglutination was determined by mixingplate-grown bacterial cells suspended in PBS with dilutionsof monoclonal antibody or PBS. Agglutination was observedwith an indirect light source.Monoclonal antibodies. Mice were immunized with live

M37 cells, and splenic lymphocytes were isolated and fusedto cells of the P3X6344Ag8.6.5.3 murine cell line by theWashington University Hybridoma Center using standardprocedures. Hybridoma supernatants were screened by dotblotting for antibodies that recognized strain M37 but notstrain M37-1, the isogenic hemagglutination-deficient vari-ant. Wells containing hybridomas of interest were cloned bylimiting dilution. An immunoglobulin G (IgG) clone and twoIgM clones were isolated from a single fusion.One of the IgM antibodies, designated 3H12, had strong

agglutinating activity for strain M37 but no activity againststrain M37-1. This antibody was employed for affinity puri-fication of the M37 pilin and immunologic screening ofrecombinant libraries. Ascitic fluid was induced by intraperi-toneal immunization of the cell line into pristane-stimulatedmice. Crude ascitic fluid was centrifuged at 12,000 x g for 10min. The supernatant was retained, and ammonium sulfatewas added up to a final concentration of 50%. After over-night incubation at 4°C, the suspension was centrifuged at4,300 x g for 10 min. The pellet was suspended in PBS, andapproximately 20 mg of protein in 1.2 ml was fractionated on

a Sepharose CL-6B column (2 by 60 cm) at room tempera-ture. The fractions were monitored by A280 and an enzyme-linked immunosorbent assay (ELISA). Column fractionswhich were reactive with M37 cell extracts by ELISA werepooled, concentrated with a Centricon-10 microconcentrat-ing unit (Amicon, Danvers, Mass.), and analyzed for immu-noglobulin purity by sodium dodecyl sulfate-polyacrylamidegel electrophoresis (SDS-PAGE).Immunoassays. A colony blot immunoassay was per-

formed by transfer of colonies to nitrocellulose (BA85;Schleicher & Schuell, Inc., Keene, N.H.). For analysis ofrecombinant clones, colonies were transferred to nitrocellu-lose and lysed with chloroform vapor (15). The remainingprotein binding sites were blocked with 2% gelatin in Tris-buffered saline (TBS) (0.02 M Tris-HCl, 0.5 M NaCl [pH7.5]). Twentyfold dilutions of tissue culture supernatants ordilutions of purified monoclonal antibodies were used asprimary antibody; the secondary antibody was goat anti-mouse (IgG + IgM) alkaline phosphatase conjugate diluted1,000-fold with 1% gelatin-TBS-0.5% Tween 20 (Tago Inc.,Burlingame, Calif.). Blots were developed with Nitro BlueTetrazolium and 5-bromo-4-chloro-3-indolylphosphate asdescribed elsewhere (30). A dot blot immunoassay wasperformed similarly, except that sonicates or partially puri-fied proteins were applied directly to nitrocellulose and thechloroform step was omitted.ELISA determinations were made with EIA microtitration

plates (Linbro, McLean, Va.). The wells were coated over-night at 37°C with a sarcosyl-insoluble fraction (3) from M37cells suspended at 1 ,ug/ml in borate-buffered saline (8.76 g ofNaCl per liter, 6.18 g of boric acid per liter, 9.52 g of sodiumborate per liter [pH 8.2]). Unbound protein was removed byaspiration, and the wells were washed three times with0.05% Tween 20-PBS. Monoclonal antibody (3H12) or frac-tions from the Sepharose column were diluted in 0.5%bovine serum albumin-PBS and incubated with bound anti-gen at 37°C for 1 h. The monoclonal antibody solution wasremoved, the wells were washed, and secondary antibodydiluted 1,000-fold in 0.05% Tween 20-PBS was added.Incubation was continued for 1 h at 37°C. The secondaryantibody was subsequently removed, the wells werewashed, and the bound antigen-antibody complexes weredeveloped with p-nitrophenyl phosphate (1 mg/ml) dissolvedin 10% diethanolamine. After 30 to 90 min of incubation atroom temperature, the A405 was determined.

Purification and N-terminal analysis of M37 pilin. M37 cellsfrom eight confluent 13.5-cm-diameter chocolate agar plateswere scraped into PBS (pH 7.4) and heated at 65°C for 60min. Cells were removed by centrifugation at 12,000 x g for10 min. The supernatant from heat-treated M37 cells wasmixed with an IgM (3H12)-Sepharose 4B affinity matrix(volume, 0.4 ml) previously equilibrated with 10 mM KPO4buffer (pH 8.0), and the mixture was rocked overnight at4°C. The mixture was poured into a 10-ml plastic column andwashed with 5 ml of 10 mM KPO4 buffer (pH 8.0). Boundproteins were eluted with 1 ml of 100 mM triethylamine (pH11.5) and quickly neutralized with 0.05 ml of 1 M KPO4buffer (pH 6.8). Proteins with apparent molecular weights of22,000 and 24,000 were eluted under these conditions.The triethylamine eluate was fractionated on a modified

Laemmli SDS-11% polyacrylamide gel, electrotransferredto a polyvinylidene difluoride (PVDF) membrane (25), andstained with Coomassie brilliant blue R. The 22- and 24-kDaproteins were cut from the PVDF membrane, and theirN-terminal sequences were determined by the ProteinChemistry Laboratory at Washington University. Sequence

VOL. 59, 1991 1717

on Septem

ber 22, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

1718 COLEMAN ET AL.

analysis was performed by automated Edman degradationwith a 477A Applied Biosystems protein sequencer.

Molecular cloning. Genomic DNA from strain M37 wasisolated as described elsewhere (37). Sau3A partial digests ofM37 chromosomal DNA were fractionated by preparativeagarose electrophoresis; DNA fragments >20 kb long wereisolated and ligated into BamHI-digested pCOS2EMBL. Theligation mixture was packaged in vitro with Gigapack (Strat-agene) and transduced into E. coli X2819. Kanamycin-resis-tant clones were screened for reactivity with monoclonalantibody 3H12 by colony blot analysis. Plasmid DNA wasisolated from eight immunoreactive clones and analyzed byrestriction analysis on 0.7% agarose gels.The sequence of the pilin gene of H. influenzae type b

strain 770235f+b° was reported by van Ham et al. (44). Weprepared oligonucleotide primers 5' and 3' to the reportedtype b pilin gene such that sequences between nucleotides 20and 831 (numbering of van Ham et al.) would be amplified. Afragment of approximately 800 bp was amplified from theDNA of immunoreactive cosmid clones as well as fromgenomic DNA of strains M37 and MinnA when these prim-ers were used in a polymerase chain reaction (PCR) (Gene-Amp; Perkin Elmer Cetus, Norwalk, Conn.). The sequenceof the 5' oligonucleotide employed for amplification is5'AACGAATTCTGCTGTTTATTAAGGCTTTAG. The se-quence of the complementary 3' oligonucleotide is 5'AGCTGGATCCTTGTAGGGTGGGCGTAAGCC. The 5' oligo-nucleotide contains an EcoRI site and the complementary 3'oligonucleotide contains a BamHI site to facilitate subclon-ing.The cosmid clone designated pRSM774 was chosen for

further analysis. The amplified 800-bp fragment from twoindependent PCRs employing plasmid DNA from pRSM774as a template was cloned into the replicative form ofM13mpl8 and M13mpl9 as described elsewhere (28). Theligation mixtures were transformed into E. coli JM101, andthe DNA sequence was determined in both directions withSequenase (U.S. Biochemicals) as described elsewhere (28).Similarly, the pilin gene from H. influenzae type b strainMinnA was cloned from genomic DNA and sequenced.Sequence comparisons were performed with the Universityof Wisconsin Genetics Computer Group GAP program,which employs the Needleman and Wunsch algorithm (34).

In order to express the M37 pilin gene in E. coli, theEcoRI-to-BamHI fragment containing the pilin gene wascloned from the replicative form of one of the M13 clonesinto the bacteriophage T7 expression plasmid pT7-7. Theligation mixture was transformed into E. coli JM101, and therecombinants were screened by restriction analysis of plas-mid minipreparations. One plasmid containing the M37 pilingene was designated pRSM865. To obtain high-level expres-sion of the M37 pilin, pRSM865 was transformed into E. coliBL21(DE3)/pLysS. Expression of the M37 pilin gene prod-uct under the control of the +10 promoter was achieved byinduction of T7 RNA polymerase synthesis by the additionof IPTG (41).

Restriction and ligation conditions were those suggestedby the manufacturers. Other methods used were describedpreviously (23, 37).

Southern blotting. Genomic DNA from M37 and M37-1and DNA from cosmid clones reactive with monoclonalantibody 3H12 were digested with PstI, separated on 0.7%agarose gels, and transferred to PhotoGene nylon mem-branes according to the manufacturer's protocol (PhotoGeneNucleic Acid Detection System; Bethesda Research Labo-ratories Life Technologies, Inc., Gaithersburg, Md.). A

biotinylated DNA probe containing the pilin gene was pre-pared. Plasmid DNA from pRSM865 was digested withEcoRI and BamHI, and the fragment containing the pilingene was isolated. Nick translation of the pilin gene withbiotin-ATP was performed according to instructions pro-vided by the manufacturer (BioNick Labeling System; Be-thesda Research Laboratories Life Technologies). The biot-inylated probe was hybridized to blotted DNA overnight at42°C and washed at 650C in 0.1x SSC (lx SSC is 0.15 MNaCl plus 0.015 M sodium citrate)-1% SDS for 1.5 h, and theblot was developed according to the manufacturer's instruc-tions (PhotoGene DNA Hybridization Detection; BethesdaResearch Laboratories Life Technologies).

Analytical methods. Preparation and analysis of sonicextracts, envelope fractions, and sarcosyl-insoluble frac-tions were performed as described previously (31). SDS-PAGE was performed on 11% polyacrylamide gels asdescribed by Lugtenberg and coworkers (22). Protein con-centrations were determined by the bicinchoninic acidmethod (39) according to the manufacturer's instructions(Pierce Chemical Co., Rockford, Ill.).

RESULTS AND DISCUSSION

The M37 strain described by Gilsdorf and Ferrieri (10) waschosen for study, as it was hemagglutination positive andwas adherent to buccal epithelial cells. The hemagglutinationtiter of M37 cells was 1/32. After enrichment for cells whichdid not bind human erythrocytes, clones were tested forhemagglutination activity. A clone designated M37-1 had nodetectable hemagglutination activity. M37-2 was a spontane-ous variant of M37-1 which had regained hemagglutinationactivity. Sarcosyl-insoluble preparations of all three strainswere analyzed by SDS-PAGE. A protein with an apparentmolecular weight of 22,000 was observed in preparationsfrom strains M37 and M37-2 but was not observed inpreparations from M37-1 (Fig. 1). This protein was presumedto be the pilin.

Purification of the pilin from H. influenzae A02 by shear-ing, differential pH of extraction buffers, and ammoniumsulfate precipitation has been described elsewhere (14). Incontrast, we observed that the hemagglutination titer ofM37was only slightly affected by prolonged shearing. Stull et al.(42) reported that the hemagglutination capacity of threestrains of H. influenzae type b was lost by heating cells to60°C, and heat shock has been employed to strip coloniza-tion factor antigens (40) from the E. coli cell surface. Thehemagglutinating activity of the M37 cells was lost byheating and was accompanied by the release of a number ofproteins into the supernatant.An IgM monoclonal antibody designated 3H12 was char-

acterized. Monoclonal antibody 3H12 was reactive in dotblots with M37 cells but not with M37-1 cells, MinnA cells,or cells of a hemagglutination-proficient variant of MinnA.Similarly, M37 cells were strongly agglutinated by 3H12,whereas the other strains were not agglutinated by thisantibody. Two additional monoclonal antibodies that dem-onstrated the same specificity for M37 and M37-1 cells wereisolated and characterized; these antibodies were notstrongly agglutinating. None of the antibodies were reactivewith proteins from strain M37 in Western immunoblots.An antigen reactive with monoclonal antibody 3H12 was

released into the heat shock supernatant. Proteins withapparent molecular weights of 22,000 and 24,000 were thenpurified from the heat shock supernatant by affinity chroma-tography over monoclonal antibody 3H12 coupled to Seph-

INFECT. IMMUN.

on Septem

ber 22, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

NONTYPEABLE HAEMOPHILUS INFLUENZAE PILIN GENE

GTTTATATTAATCTTTTGCCTTATTTATAAGGCACAAACCTCTTTATGGAGCAATTTATT 60

M37 ATGAAAAAAACACTTCTTGGTAGCTTAATTTTATTAGCATTTGCGACGAATGCTMetLysLysThrLeuLeuGlySerLeuIleLeuLeuAlaPheAlaThrAsnAla

Hib ................................... GC......... GGA ... TGCAGGCG............................................. Gly... ValGlnAla

M37

Hib

43K- _

30K- _ 4_ _4mb ammo

M37

Hib

GCTAATCCTCAAGTAAGTGCTGAAACCTCAGGTAAAGTTACTTTTTTCGGTAAGGTTGTT 174AlaAsnProGlnValSerAlaGluThrSerGlyLysValThrPhePheGlyLysValVal 20

G.TA.T.A.A.......A.T.T.AspIleAsnThr .......................................

GluAsnThrCysGlnValSerThrGlyAsnArgAspMetSerValValLeuAsnAspVal............ AA .... ACC AA T..A.............Lys Lys GluHisLysAsnLeu

23440

M37 GGTAAAAATAGTTTAAGCACTAAAGGAAACACTGCAATGCCTACACCATTTACGATTAAA 294GlyLysAsnSerLeuSerThrLysGlyAsnThrAlaMetProThrProPheThrIleLys 60

Hib .........C...TCT.. T.. T. A.G..C.........................Val.Thr20.1K- -

M37 TTACAAAATTGTAACGCTAATAGGGCAACTGGTACTGCAAATAATGCTAATAAAGTTGGGLeuGlnAsnCysAsnAlaAsnArgAlaThrGlyThrAlaAsnAsnAlaAsnLysValGly

Hib ............ ..C.A.C. C A A.

............ AspProThrThr Asn.Lys14.4K -

35480

1 2 3 4FIG. 1. Coomassie blue-stained SDS-11% polyacrylamide gel of

sarcosyl-insoluble preparations of H. influenzae strains and a mono-clonal antibody 3H12 affinity-purified preparation from strain M37.Lanes 1, 2, and 3 contain 20 ,ug of sarcosyl-insoluble preparationsfrom strains M37, M37-1, and M37-2, respectively. Lane 4 contains3 jig of affinity-purified protein. The molecular weight standards arefrom Pharmacia and are indicated in thousands (K). The sampleswere treated at 100°C for 5 min prior to application to the gel.

arose. The two proteins were separated by SDS-PAGE andelectrotransferred to PVDF paper. The bands were cut fromthe PVDF paper and subjected to automated Edman degra-dation. The first amino acid from both proteins was indeter-minate. Amino acids 2 through 17 were identified for the24-kDa protein. The sequence was NPQVSAETSGKVTFFG. Amino acids 2 through 8 were determined for the22-kDa protein and were identical to those found in the24-kDa protein. Thus, it is likely that the 22-kDa protein is aproteolytic fragment of the 24-kDa protein, although it ispossible that the one of the proteins is derived from the otherby posttranslational modification. The N-terminal sequencehas homology to the type b pilin as well as homology to otherpilins, as has been previously reported (11).A genomic library of H. influenzae M37 was prepared in

the cosmid vector pCOS2EMBL and propagated in E. coliK-12 strain X2819. Eight clones which were recognized bymonoclonal antibody 3H12 were further characterized.Seven of these clones were not identical; however, restric-tion analysis indicated that they contained overlapping ge-nomic fragments. Since the N-terminal sequences of the22-kDa protein and the type b pilin were similar, we rea-

soned that we might be able to subclone the M37 gene fromthe cosmids by using the PCR. Primers homologous to the 5'upstream and 3' downstream region of the H. influenzae typeb pilin gene (44) were generated. A DNA fragment ofapproximately 800 bp was obtained from the PCR employinggenomic DNA from the type b strain MinnA, M37 genomicDNA, M37-1 genomic DNA, and cosmid DNA from severalimmunoreactive clones.The M37 pilin gene derived from two independent PCRs

was cloned into M13mpl8 and M13mpl9, and both cloneswere sequenced. The sequences were identical, indicating

M37

HibIleTyrPheTyrSerTrpAsnAsnThrAspLysAspAsnAsnPheThrLeuLysAsnGluC. A GTA.A.

Leu Lys Val Glu

414100

M37 AAAATCGCAAACGATTACGCAACTAAGGTTAATATTCACATTATCGAACrcTATCOCACA 474LysMe tAlaAsnAspTyrAlaThrLysValAsnIleGlnI leMe tGluAlaAspGlyThr 120

Hib C.. CTA.GGCA....... T. . AC.. AG.A ... .T...

GlnThrThrAla Asn........... Leu SerAsn

M37 AACCAAATTGAAGTTGTAGGCAAATCAGTAGATGATTACTCACAAAAACAACAsnGlnIleGluValValGlyLysSerValAspAspPheThrHisLysAsnAsn

Hib ..GGCG TC A..G..T...GA.ACG..A. .TG..T.CG..T..TAATGGA

LysAla ... Ser GluThrGlu Met.. ThrAsnAsnAsnGly

M37 GGATCTACAAATTCAAGTGCAGTAACTAAAGATCATATTTCAGGCAAAACCACTTTAGATGlySerThrAsnSerSerAlaValThrLysAspHisIleSerGlyLysThrThrLeuAsp

HIB .T.G.ATT CCA. CCCACCC. T A.GT. .ACAA.. ACC

ValAlaLeu ... GlnThrHisProAsnAsnAla.Ser Gln Thr

M37 AATACTAAATCTGAATACGATCTTCATTTTATCGCCCAATATTACGCAACAGATGCAGCAAsnThrLysSerGluTyrAspLeuHisPheIleAlaGlnTyrTyrAlaThrAspAlaAla

Hib .C.GG ..CTAA CTTCC. .... A. .AA....

ThrGlyThrAsn LeuPro.AsnLys

M37 ACTGCTGGTAAAGTACAATCTTCTGTTAATTTCCAAATTGCTTACGAATAATTCCTAATGThrAlaGlyLysValGlnSerSerValAsnPheGlnIleAlaTyrGlu

Hib .C C..A...G...C.C.A.

...........................Asp.

M37 TAATGCAAGAGAAACTAAGCCCTCGTGTTTATTATATCCCGCGTGHib ............................................

528138

588158

648178

708194

753

FIG. 2. Comparative nucleotide and derived amino acid se-

quences of the type b and M37 pilin. Hib is the H. influenzae type bsequence from strain MinnA; M37 is the sequence from nontypeablestrain M37. The underlined residues correspond to those determinedby Edman degradation.

that no PCR errors had occurred. The sequence of the M37gene is shown in Fig. 2. The chemically determined residuesfrom the affinity-purified 24-kDa protein were identical toresidues 2 to 17 of the derived sequence. The protein has an

18-amino-acid leader peptide which is typical of the leaderpeptides identified for other Haemophilus surface proteinsas well as the leader peptides of other prokaryotic secretedproteins (48). The molecular weight of the mature protein, as

determined from the derived amino sequence, is 21,077.The sequence of the type b gene from strain MinnA was

also determined. It is identical to that reported by van Hamet al. (44) as well as to the sequence determined by Gilsdorfet al. for the gene from strain M43 (A02) (11). The sequenceof the gene from strain A02 determined by Langermann andWright (20) differs by a single nucleotide, resulting in a single

94K- _

67K- _

114-1

VOL. 59, 1991 1719

on Septem

ber 22, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

1720 COLEMAN ET AL.

D000

zuJ

X _kb

EL_co X CO)

*0

23.1 -

9.4 - "ol., _ -

6.6 -

4.4 -

2.3-2.00-

2

FIG. 3. Southern blot analysis. Genomic DNA from strains M37and M37-1 (lanes 1 and 2, respectively) was digested with PstI andprobed with the M37 pilin gene. Biotinylated A HindIll standards(Bethesda Research Laboratories) were employed as size markers.

amino acid change. The nucleic acid and derived amino acidsequences of the type b MinnA and M37 pilins were com-

pared. The nucleic acid sequences coding for the matureprotein were 77% identical. The derived amino acid se-

quences were 68% identical and 77% similar. Similarity wasas defined by Dayhoff and normalized by Gribskov andBurgess (12). The conserved cysteines and the penultimatetyrosine observed in the type b pilin and other pilins areconserved in the M37 pilin (residues 24, 64, and 193,respectively). One interesting feature of the sequence com-

parison is the region surrounding the signal peptide cleavagesite. In contrast to the 18-amino-acid leader peptide in theM37 pilin, the type b pilin has a 20-amino-acid leaderpeptide. The sequence immediately surrounding the cleav-age site differs between the two pilins, while the sequencessurrounding this stretch of residues are nearly identical. Itwill be of interest to determine whether the two pilins can beassembled into a common pilus and whether the putativechaperones will recognize the pilin from the heterologousstrain.

Total genomic DNA from M37 and M37-1 cells andplasmid DNA from the immunoreactive cosmid clones were

digested with PstI and probed with the M37 pilin gene. A4.2-kb PstI restriction fragment hybridized strongly to thepilin probe (Fig. 3). Two less intensely hybridizing bands ofabout 9.4 and 4.4 kb were also observed. The pilin probehybridized to a single 4.2-kb PstI fragment in pRSM781 andthe other immunoreactive clones (data not shown). To ruleout the possibility that the 9.4- and 4.4-kb hybridizingfragments observed in the chromosomal digests were due tohybridization with plasmid pT7-7 sequences rather than pilinsequences, we probed PstI-digested chromosomal DNAfrom strains M37, M37-1, and MinnA with nick-translatedpT7-7. The plasmid-related sequences (P-lactamase gene)from strain MinnA were readily visualized; no hybridizationwas observed with the M37 or M37-1 DNA. Thus, M37 DNAcontains a single strongly hybridizing fragment and twoweakly hybridizing fragments. Previous studies have pro-posed that type b H. influenzae has a single pilin gene; the

100 bp

FIG. 4. Partial restriction map of pRSM865. A BamHI-to-EcoRIfragment containing the M37 pilin gene was cloned into the multiplecloning site of the T7 expression vector pT7-7. The pilin gene isshown as the solid box. Upstream and downstream Haemophilusseqeunces are shown as open boxes, and plasmid sequences areshown as lines. The position and direction of transcription of the T7promoter are designated by the arrow. The BamHI and EcoRI siteswere created by the PCR amplification and are not present in theHaemophilus genomic DNA.

significance of the weaker hybridization signals in the M37DNA remains to be established. In type b strains, nochromosomal DNA rearrangements have been correlatedwith the expression or lack of expression of the type b pilus.Similarly, we observed no changes in the size of the PstIfragment containing the pilin gene in strains M37 and M37-1.The M37 pilin gene was digested with BamHI and EcoRI

from the replicative form of M13mpl8 and cloned into thebacteriophage T7 expression vector pT7-7. A plasmid des-ignated pRSM865 had the correct restriction map. A partialrestriction map of pRSM865 is shown in Fig. 4. In this T7expression system, T7 RNA polymerase synthesis is in-duced by addition of IPTG to the medium; transcription ofgenes cloned downstream of T7 410 promoter ensues. A22-kDa protein was observed in extracts of cells afterinduction of BL21(DE3)/pLysS/pRSM865 cultures withIPTG (Fig. 5). An increase in a protein with an apparentmolecular mass of 24 kDa is also observed, although theinterpretation of the gel is complicated by a protein with thesame apparent molecular mass in cells which do not harborthe plasmid. Sonicates of IPTG-induced BL21(DE3)/pLysS/pRSM865 cells were reactive with monoclonal antibody3H12. Extracts prepared from uninduced cells or fromBL21(DE3)/pLysS cells did not contain the 22-kDa proteinand were not reactive with monoclonal antibody 3H12.These data indicate that monoclonal antibody 3H12 reactswith an epitope present on the pilin protein and not with anepitope present on a protein whose expression is coregulatedwith expression of the pilin gene. The data further indicatethat the recombinant pilin folds in E. coli such that the 3H12epitope is expressed. This folding occurs in the absence ofthe other gene products of the Haemophilus pilin operon.

Gilsdorf and coworkers (9) recently reported that thehemagglutination-associated pili from 11 nontypeable H.influenzae isolates were reactive with an antiserum preparedagainst denatured type b pilin or against a synthetic peptidecorresponding to residues 5 through 17 of the type b pilin,indicating that the nontypeable and type b pili share commonepitopes. Gilsdorf and coworkers also reported that antiserawhich recognized conformational epitopes on type b piliwere reactive with only 1 of the 11 piliated nontypeablestrains. Our results with strain M37 are consistent with theseobservations. The M37 pilin and type b pilin are highlyconserved; however, the conformational epitope recognizedby 3H12 is not present in MinnA pili.Van Ham and coworkers (44) and Brinton and coworkers

(17) report that the Haemophilus pilin is assembled and thatrecombinant clones express a hemagglutination-positive

INFECT. IMMUN.

Amoodow

Amm"W. AD

on Septem

ber 22, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

NONTYPEABLE HAEMOPHILUS INFLUENZAE PILIN GENE

94K-"OD

67K-7K - -

43K- -

30K- -

20.1K--

14.4K- 355V2 3 4 5

FIG. 5. Coomassie blue-stained SDS-11% polyacrylamide geldemonstrating expression of the recombinant M37 pilin in thebacteriophage T7 expression system. Lane 1 contains 2 ,ug ofaffinity-purified protein from strain M37. Lanes 2 and 3 contain 30,ug of sonic extract from BL21(DE3)/pLysS/pRSM865 (induced anduninduced, respectively). Similarly, lanes 4 and 5 contain extractsfrom induced and uninduced BL21(DE3)/pLysS, respectively. Themolecular weight standards are from Pharmacia and are indicated inthousands (K). The samples were treated at 100°C for 5 min prior toapplication to the gel.

phenotype in E. coli. Our cosmid clones in E. coli K-12strain X2819 and a subset of these clones in strain LE392were assayed for their ability to mediate mannose-resistanthemagglutination. None of the immunoreactive clones wereable to hemagglutinate erythrocytes. We were, however,able to detect monoclonal antibody 3H12-reactive protein onthe surface of E. coli cells containing the cosmid clones.When we subcloned Sau3A partial digests of DNA from theimmunologically reactive cosmid pRSM774 into pUC18, twoof seven immunologically reactive subclones exhibited man-nose-resistant hemagglutination activity (data not shown).These data suggest that the inability of the cosmid clones tomediate hemagglutination is due to the quantitative level ofexpression of the M37 pilin operon and that a higher level ofexpression can be accomplished by increasing the copynumber of the cloned genes. Further analysis of these clonesand the generation of isogenic mutants of H. influenzaewhich are stably pilin positive or pilin negative will beimportant in understanding the role of these pili in pathogen-esis and immunity.

ACKNOWLEDGMENTS

We thank Hope Wuellner for expert technical assistance andShirley Hanna of the Washington University Hybridoma Center forthe hybridoma fusion and cloning.

This study was supported by U.S. Public Health Service grantRO1 Al 17572 from the National Institutes of Health. Trey Colemanis supported by NIH training grant A107163.

REFERENCES1. Apicella, M. A., M. Shero, K. C. Dudas, R. R. Stack, W. Klohs,

L. J. LaScolea, T. F. Murphy, and J. M. Mylotte. 1984.

Fimbriation of Haemophilus species isolated from the respira-tory tract of adults. J. Infect. Dis. 150:40-43.

2. Bakaletz, L. O., B. M. Tallan, T. Hoepf, T. F. DeMaria, H. G.Birck, and D. J. Limn. 1988. Frequency of fimbriation of non-typeable Haemophilus influenzae and its ability to adhere tochinchilla and human respiratory epithelium. Infect. Immun.56:331-335.

3. Barenkamp, S. J., R. S. Munson, Jr., and D. M. Granoff. 1981.Subtyping isolates of Haemophilus influenzae type b by outer-membrane protein profiles. J. Infect. Dis. 143:668-676.

4. Barker, J., M. Gratten, I. Riley, D. Lehmann, J. Montgomery,M. Kajoi, H. Gratten, D. Smith, T. F. D. C. Marshall, and M. P.Alpers. 1989. Pneumonia in children in the Eastern Highlands ofPapua New Guinea: a bacteriologic study of patients selected bystandard clinical criteria. J. Infect. Dis. 159:348-352.

5. Berman, S., and K. McIntosh. 1985. Selective primary healthcare: strategies for control of disease in the developing world.XXI. Acute respiratory infections. Rev. Infect. Dis. 7:674-691.

6. Brinton, C. C., Jr., M. J. Carter, D. B. Derber, S. Kar, J. A.Kramarik, A. C.-C. To, S. C.-M. To, and S. W. Wood. 1989.Design and development of pilus vaccines for Haemophilusinfluenzae diseases. Pediatr. Infect. Dis. J. 8:S54-S61.

7. Clark-Curtiss, J. E., W. R. Jacobs, M. A. Docherty, L. R.Ritchie, and R. Curtiss III. 1985. Molecular analysis ofDNA andconstruction of genomic libraries of Mycobacterium leprae. J.Bacteriol. 161:1093-1102.

8. Giebink, G. S. 1989. The microbiology of otitis media. Pediatr.Infect. Dis. J. 8:S18-S20.

9. Gilsdorf, J. R., H. Y. Chang, K. W. McCrea, and L. J. Forney.1990. Comparison of epitopes on pili and pilins of type b andnon-typeable H. influenzae. Pediatr. Res. 27:170A.

10. Gilsdorf, J. R., and P. Ferrieri. 1984. Adherence of Haemoph-ilus influenzae to human epithelial cells. Scand. J. Infect. Dis.16:271-278.

11. Gilsdorf, J. R., C. F. Marrs, K. W. McCrea, and L. J. Forney.1990. Cloning, expression, and sequence analysis of the Hae-mophilus influenzae type b strain M43p+ pilin gene. Infect.Immun. 58:1065-1072.

12. Gribskov, M., and R. R. Burgess. 1986. Sigma factors from E.coli, B. subtilis, phage SPOl, and phage T4 are homologousproteins. Nucleic Acids Res. 14:6745-6763.

13. Guerina, N. G., S. Langermann, H. W. Clegg, T. W. Kessler,D. A. Goldmann, and J. R. Gilsdorf. 1982. Adherence of piliatedHaemcphilus influenzae type b to human oropharyngeal cells. J.Infect. Dis. 146:564.

14. Guerina, N. G., S. Langermann, G. K. Schoolnhk, T. W. Kessler,and D. A. Goldmann. 1985. Purification and characterization ofHaemophilus influenzae pili, and their structural and serologicalrelatedness to Escherichia coli P and mannose-sensitive pili. J.Exp. Med. 161:145-159.

15. Helfman, D. M., J. R. Feramisco, J. C. Fiddes, G. P. Thomas,and S. H. Hughes. 1983. Identification of clones that encodechicken tropomyosin by direct immunological screening of acDNA expression library. Proc. Natl. Acad. Sci. USA 80:31-35.

16. Himmelreich, C. A., S. J. Barenkamp, and G. A. Storch. 1985.Comparison of methods for serotyping isolates of Haemophilusinfluenzae. J. Clin. Microbiol. 21:158-160.

17. Kar, S., S. C.-M. To, and C. C. Brinton, Jr. 1990. Cloning andexpression in Escherichia coli of LKP pilus genes from anontypeable Haemophilus influenzae strain. Infect. Immun.58:903-908.

18. Karasic, R. B., D. J. Beste, S. C.-M. To, W. J. Doyle, S. W.Wood, M. J. Carter, A. C.-C. To, K. Tanpowpong, C. D.Bluestone, and C. C. Brinton, Jr. 1989. Evaluation of pilusvaccines for prevention of experimental otitis media caused bynontypeable Haemophilus influenzae. Pediatr. Infect. Dis. J.8:S62-S65.

19. Kroll, J. S., and E. R. Moxon. 1988. Capsulation and gene copynumber at the cap locus of Haemophilus influenzae type b. J.Bacteriol. 170:859-864.

20. Langermann, S., and A. Wright. 1990. Molecular analysis of theHaemophilus influenzae type b pilin gene. Mol. Microbiol.4:221-230.

VOL. 59, 1991 1721

on Septem

ber 22, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

1722 COLEMAN ET AL.

21. Leowski, J. 1986. Mortality from acute respiratory infections inchildren under 5 years of age: global estimates. World HealthStat. Q. 39:138-144.

22. Lugtenberg, B., J. Meijers, R. Peters, P. van der Hoek, and L.van Alphen. 1975. Electrophoretic resolution of the major outermembrane protein of Escherichia coli K12 into four bands.FEBS Lett. 58:254-258.

23. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

24. Mason, E. O., Jr., S. L. Kaplan, B. L. Wiedermann, E. P.Norrod, and W. A. Stenback. 1985. Frequency and properties ofnaturally occurring adherent piliated strains of Haemophilusinfluenzae type b. Infect. Immun. 49:98-103.

25. Matsudaira, P. 1987. Sequence from picomole quantities ofproteins electroblotted onto polyvinylidene difluoride mem-branes. J. Biol. Chem. 262:10035-10038.

26. Moffatt, B. A., and F. W. Studier. 1987. T7 lysozyme inhibitstranscription by T7 RNA polymerase. Cell 49:221-227.

27. Monto, A. S. 1989. Acute respiratory infection in children ofdeveloping countries: challenge of the 1990s. Rev. Infect. Dis.11:498-505.

28. Munson, R., Jr., C. Bailey, and S. Grass. 1989. Diversity of theouter membrane protein P2 gene from major clones of Hae-mophilus influenzae type b. Mol. Microbiol. 3:1797-1803.

29. Munson, R., Jr., and S. Grass. 1988. Purification, cloning, andsequence of outer membrane protein P1 of Haemophilus influ-enzae type b. Infect. Immun. 56:2235-2242.

30. Munson, R., Jr., and R. W. Tolan, Jr. 1989. Molecular cloning,expression, and primary sequence of outer membrane proteinP2 of Haemophilus influenzae type b. Infect. Immun. 57:88-94.

31. Munson, R. S., Jr., and D. M. Granoff. 1985. Purification andpartial characterization of outer membrane proteins PS and P6from Haemophilus influenzae type b. Infect. Immun. 49:544-549.

32. Munson, R. S., Jr., M. H. Kabeer, A. A. Lenoir, and D. M.Granoff. 1989. Epidemiology and prospects for prevention ofdisease due to Haemophilus influenzae in developing countries.Rev. Infect. Dis. 11:S588-S597.

33. Murphy, T. F., and M. A. Apicelia. 1987. Nontypeable Hae-mophilus influenzae: a review of clinical aspects, surface anti-gens, and the human immune response to infection. Rev. Infect.Dis. 9:1-15.

34. Needleman, S. B., and C. D. Wunsch. 1970. A general methodapplicable to the search for similarities in the amino acidsequence of two proteins. J. Mol. Biol. 48:443-453.

35. Pichichero, M. E., M. Loeb, P. Anderson, and D. H. Smith. 1982.

Do pili play a role in pathogenicity of Haemophilus influenzaetype b? Lancet ii:960-962.

36. Poustka, A., H.-R. Rackwitz, A.-M. Frischauf, B. Hohn, and H.Lehrach. 1984. Selective isolation of cosmid clones by homolo-gous recombination in Escherichia coli. Proc. Natl. Acad. Sci.USA 81:4129-4133.

37. Silhavy, T. J., M. L. Berman, and L. W. Enquist. 1984.Experiments with gene fusions. Cold Spring Harbor Labora-tory, Cold Spring Harbor, N.Y.

38. Shann, F., S. Germer, D. Hazlett, M. Gratten, V. Linnemann,and R. Payne. 1984. Aetiology of pneumonia in children inGoroka Hospital, Papua New Guinea. Lancet i:537-541.

39. Smith, P. K., R. I. Krohn, G. T. Hermanson, A. K. Mallia, F. H.Gartner, M. D. Provenzano, E. K. Fujimoto, N. M. Goeke, B. J.Olson, and D. C. Klenk. 1985. Measurement of protein usingbicinchoninic acid. Anal. Biochem. 150:76-85.

40. Stirm, S., F. 0rskov, I. 0rskov, and B. Mansa. 1967. Episome-carried surface antigen K88 of Escherichia coli. II. Isolation andchemical analysis. J. Bacteriol. 93:731-739.

41. Studier, F. W., and B. A. Moffatt. 1986. Use of bacteriophage T7RNA polymerase to direct selective high-level expression ofcloned genes. J. Mol. Biol. 189:113-130.

42. Stull, T. L., P. M. Mendelman, J. E. Haas, M. A. Schoenborn,K. D. Mack, and A. L. Smith. 1984. Characterization of Hae-mophilus influenzae type b fimbriae. Infect. Immun. 46:787-796.

43. Tabor, S., and C. C. Richardson. 1985. A bacteriophage T7RNA polymerase/promoter system for controlled exclusiveexpression of specific genes. Proc. Natl. Acad. Sci. USA82:1074-1078.

44. van Ham, S. M., F. R. Mooi, M. G. Sindhunata, W. R. Maris,and L. van Alphen. 1989. Cloning and expression in Escherichiacoli of Haemophilus influenzae fimbrial genes establishes adher-ence to oropharyngeal epithelial cells. EMBO J. 8:3535-3540.

45. Wald, E. R. 1989. Haemophilus influenzae as a cause of acuteotitis media. Pediatr. Infect. Dis. J. 8:S28-S30.

46. Wall, R. A., P. T. Corrah, D. C. W. Mabey, and B. M.Greenwood. 1986. The etiology of lobar pneumonia in theGambia. Bull. W.H.O. 64:553-558.

47. Weinberg, G. A., A. Ghafoor, Z. Ishaq, N. K. Nomani, M.Kabeer, F. Anwar, M. I. Burney, A. W. Qureshi, J. M. Musser,R. K. Selander, and D. M. Granoff. 1989. Clonal analysis ofHaemophilus influenzae isolated from children from Pakistanwith lower respiratory tract infections. J. Infect. Dis. 160:634-643.

48. Wu, H. C. 1986. Proteolytic processing of signal peptides, p.33-59. In A. W. Strauss, I. Boime, and G. Kreil (ed.), Proteincompartmentalization. Springer-Verlag, New York.

INFECT. IMMUN.

on Septem

ber 22, 2020 by guesthttp://iai.asm

.org/D

ownloaded from