AGRICULTURAL RESEARCH COMMUNICATION CENTREwww.arccjournals.com/www.legumeresearch.in

Legume Research. 38 (3) 2015: 313-320Print ISSN:0250-5371 / Online ISSN:0976-0571

Molecular characterization of three hypersensitive-induced reaction genes thatrespond to Phytophthora sojae infection in Glycine max L. Merr.Yang Xiang , Min Song1, Minqin Zhang, Shifeng Cao2 and Hongshi Han*

Guizhou Rapeseed Institute,Guizhou Academy of Agricultural Sciences, Guiyang 550 008, P.R.China.Received: 19-08-2015 Accepted: 21-03-2015 DOI: 10.5958/0976-0571.2015.00116.2

ABSTRACTHypersensitive-induced reaction (HIR) proteins, which are members of the proliferation, ion and death (PID) superfamily,have been shown to be involved in the defense responses of several plant species. In this study, three HIR-like genes fromsoybean, designated as GmHIR1, GmHIR3 and GmHIR4, were cloned and characterized. They each contained four intronsand five exons and shared conservative structure of genomic organization. The deduced polypeptide sequences of GmHIRsshare high degrees of similarity with HIR proteins of other species. However, QRT-PCR analysis indicated that the expressionlevels in different tissues were not the identical. The expression of GmHIRs were rapidly induced by Phytophthora sojaeinfection in the resistant genotype, while induction was very weak in the susceptible genotype. In addition, the expression ofthese genes were also repressed by hydrogen peroxide (H2O2) treatment. Promoter analysis indicates that several defense-responsive elements are present in the GmHIR promoter. To our knowledge, this is the first report on molecular cloning andinitial characterization of HIR-like genes in soybean. This study may help elucidate soybean disease resistance, which wouldenhance efforts to control soybean Phytophthora root and stem rot disease.

Key words: Hypersensitive-induced reaction proteins, Soybean, Soybean disease resistance.

*Corresponding author’s e-mail: xiangyangcell@yahoo.com. Yang Xiang and Min Song contributed equally to this work.1Qufu Normal University, College of Life Sciences, Qufu 273165, P.R.China.2The University of Queensland, School of Agriculture and Food Sciences, Gatton Qld 4343, Australia.

INTRODUCTIONPhytophthora root and stem rot of soybean caused

by the oomycete pathogen Phytophthora sojae is a destructivedisease and leads to an annual loss of 1-2 billion US dollarsworldwide (Tyler, 2007). Development of varieties withenhanced and durable resistance against the invadingpathogen is a viable strategy considered by soybean breeders.However, new soybean cultivars lose their resistance due tothe occurrence of new virulent races. Therefore, it is importantto elucidate the molecular mechanism of resistance toPhytophthora and to use soybean cultivars with durableresistance.

It has been reported that hypersensitive response(HR) is an important manifestation of resistance to biotrophicpathogens. HR induces intracellular ion influx, membranedysfunction and the accumulation of reactive oxygen species(Heath 1998; Heath 2000). HR can also induce rapid celldeath surrounding the infection site to restrict the growth ofbiotrophic pathogens (Dangl and Jones 2001; Park 2005).Signaling derived from HR can further activate a series of

signal transduction and defense response pathways, leadingto a local resistance response and systemic-induced resistance.

Hypersensitive induced reaction (HIR) proteins area group of proteins involved in HR, which are involved incell proliferation, ion channel regulation and cell death(Nadimpalli et al. 2000). They belong to the PID(proliferation, ion and death) superfamily with one conservedStomatins/Prohibitins/Flotillins/HflK/C (SPFH) domain (alsoknown as the prohibitin domain or the band 7 domain)(Rostoks et al. 2003).

To date, genes encoding HIRs have been identifiedfrom both dicot and monocot plants such as maize, barley,rice, wheat, tobacco, Arabidopsis, pepper, and legumes. Somemembers have been shown to be involved in defenseresponses. In tobacco, the HIR gene NG1 is involved in theformation of HR-like lesions and induces the expression ofan HR-specific PR2 protein, the PR acidic beta-glucanase(Karrer et al. 1998). The maize ZmHIR3 gene showed highexpression levels in the maize partly dominant lesion mimicmutant Les9 (Nadimpalli et al. 2000). The barley HvHIR3

314 LEGUME RESEARCH

gene exhibited a 35-fold increased expression level in mutantswith a spontaneous HR phenotype, such as lesion mimicmutants (Rostoks et al. 2003). The wheat TaHIR1 and TaHIR3genes showed a significantly higher expression level in plantsinfected with the stripe rust pathogen (Yu et al. 2008; Zhanget al. 2009). They play positive roles in resistance to the striperust fungus via inducing HR and regulating defense-relatedgenes (Duan et al. 2013). Overexpression of the rice OsHIR1gene in Arabidopsis was shown to enhance resistance to P.syringae pv. tomato DC3000 (Pst DC3000) (Zhou et al.2010). Qi et al. (2011) confirmed that Arabidopsis AtHIRproteins are components of RPS2 in both Arabidopsis andN. benthamiana and that these proteins quantitativelycontribute to RPS2-mediated ETI.

In this study, three full-length soybean HIR genes(designated as GmHIR1, GmHIR3 and GmHIR4) were clonedfrom the hypocotyl tissue of soybean cultivar Williams82inoculated with Phytophthora sojae PNJ1 and the genesequences were compared with those of genes showing highhomology in other plant systems. The expression of GmHIR1,GmHIR3 and GmHIR4 was measured temporally and spatiallyin soybean tissues to explore the relationship betweenGmHIRs and disease resistance.

MATERIALS AND METHODSPlant materials and treatments: Two soybean cultivars,Williams82 and Williams, were used in the experiments.Seedlings were grown on a commercially available 3:1mixture of vermiculite and peat moss under controlledconditions (600 µmol photons m-2 s-1, 16 h light/8 h dark perday at 25 ± 3°C, 60% relative humidity). All tissues (includingroots, stems, leaves, flowers, young siliques and immatureseeds) were collected from Williams82 at the 15th day post-anthesis.

For chemical treatment, the roots were submergedin a solution containing 100 µM H2O2, while the control wassubmerged in water. Leaves were harvested after treatments.

Physiological race Phytophthora sojae (PNJ1)originally isolated from diseased tissues of soybean and soilsamples in Nanjing, China (Wu et al. 2009). Soybeanhypocotyl inoculation with PNJ1 followed the proceduresdescribed by Burnham et al. (2003) with minor modifications.Briefly, mycelia from 7-d old V8 cultures were inoculatedinto an incision in the hypocotyls of seedlings when thecotyledons were fully open. The seedlings were then placedin a misting chamber (90% relative humidity) at 25°C with a16:8 h light:dark cycle. The control plants were woundedbut not inoculated with the mycelia. The hypocotyl sectionsamples were collected from 10 mm below and above the

incision after inoculation. All experiments were performedin triplicate. Samples were frozen in liquid nitrogen andstored at -80°C prior to RNA extraction.

Identification of HIR genes in soybean: Eighteen plant HIRprotein sequences were downloaded from the GenBankdatabase, including Capsicum annuum CaHIR1 (AAS98165),Pennisetum ciliare PcHIR (AF325721_1), Carica papayaCpHIR (ABS01349), Cucumis sativus CsHIR (AAQ72788),barley HvHIR1 (AAN17457), HvHIR2 (AAN17455),HvHIR3 (AAN17464), HvHIR4 (AAN17454), Lotusjaponicas LjHIR (BAD86819), rice OsHIR1 (AF374475),OsHIR4 (BAD68458), maize ZmHIR1 (NP_001105623),ZmHIR2 (NP_001104971), ZmHIR3 (NP_001104972),wheat TaHIR1 (ABQ12768), TaHIR2 (ADX99259), TaHIR3(ACI25443) and TaHIR4 (ACN18279). These HIR proteinsequences were used as queries to search soybean ESTsequences (1, 461, 624 ESTs, the 190th release of GenBank,2012) using the tBlastN algorithm. The homologous ESTswere retrieved using 95% identity and an E-value of <1e-10.Vector and adaptor contaminations were then removed usingthe VecScreen program (http://www.ncbi.nlm.nih.gov/VecScreen/VecScreen.html). The ESTs were assembled withCAP3 software (Huang and Madan, 1999) using theparameters of 40-bp overlap and 95% identity percentage.

Bioinformatic analysis: Signal peptides were predicted usingthe WoLF PSORT website (http://psort.nibb.ac.jp/).Conserved motifs were analyzed using MEME4.6.1 (http://meme.nbcr.net). Putative N-myristoylation sites werepredicted using ScanProsite (De Castro et al. 2006) and CSS-Palm 2.0 (Ren et al. 2008). Transmembrane domains werepredicted using TopPred (Claros et al. 1994). The genomicsequences of GmHIR genes were extracted from the genomicsequences (http://www.phytozome.net/). The exons andintrons were determined using the Gene Structure DisplayServer (GSDS) tool (http:// gsds.cbi.pku.edu.cn/).

Protein sequence alignments were performed withMacVector 10.0 (Accelrys, Oxford, USA). A phylogenetictree was constructed using neighbor-joining (NJ) algorithms.Bootstrapping was performed 1000 times to obtain supportvalues for each branch.

Cis-element of GmHIR genes were predicted usingPLACE 26.0 (http: //www.dna.affrc.go.jp/PLACE/index.html; Lescot et al. 2002) with 2,000-bp sequenceupstream of the full-length cDNAs or predicted CDSextracted from the genomic sequences (http://www.phytozome.net/).

RNA extraction, cDNA synthesis, RT-PCR and qRT-PCR:Total RNA was extracted using the Trizol reagent (Invitrogen,USA) and subjected to RNase-free DNase I (Promega, USA)

Volume 38 Issue 3, 2015 315

TABLE 1: Primer sequences used in this study

Gene Primer sequences (5’-3’) PCR Reaction GmHIR1 TTGCGTTTCTCTGCCTAAAAGG/GTTCAAACAAAAGAAGCATTTCCTG RT-PCR CAGCGTGCTTGCTTTCTCTGAG/CAGGACCGTGAGGTATGAACACAG QRT-PCR GmHIR3 CCTCTTGCGTTGTTTCGGAG/CGCTATAGCTTCA AACATACTCCC RT-PCR GGAAAACAACTTGCTGGTCATCT/AAACATAGGCTTGAATTTGGGTCT QRT-PCR GmHIR4 GCAAAGGAAGGATGGGGAAC/CAGAGAGAGATATACTTTCTAAGGC RT-PCR ATGTGACTCGTGCTAT TGTTCCG/GCGTTAGTGCCTTCTACCTTGTG QRT-PCR GmEF-1a TGGAATGGTGGTGACTTTTGC/GGTCATCCTTTGAGTTTGAGGC QRT-PCR GmPR1a TGCTAATCAACGCAAAGGTGACTG/GCAGGCACTCTCCTCCAACAC AAG QRT-PCR

digestion and purification, followed by quantification usingan Ultrospec 2100 pro (Amersham Pharmacia, England).First-strand cDNA was synthesized using M-MLV reversetranscriptase (Promega, USA) and oligo (dT15) primers,according to the standard protocol.

RT-PCR was performed in a 25 µL mixturecontaining ~5 ng template, 5 pmol of each primer, 5 nmol ofeach dNTP, 37.3 nmol MgCl2, 0.5 U rTaq DNA polymerase(Takara, Japan) and 1× PCR buffer. The thermal cycle profilewas 94°C for 3 min, 30 cycles at 94°C for 20 s, 60°C for30s and 72°C for 1.2 min, followed by 72°C for 5 min.

Quantitative real-time PCR (qRT-PCR) wasconducted using SYBR-Green PCR Mastermix (Toyoba,Japan) on a Bio-Rad iCYCLER iQ5 System (Bio-Rad, USA).Gene expression was quantified the comparative method2-ct method as previously described (Livak and Schmittgen,2001). Primer sequences are listed in Table 1.

RESULTS AND DISCUSSIONSoybean GmHIR1, GmHIR3 and GmHIR4 encodeproteins containing SPFH domain: To identify the soybeanHIR genes, we searched publicly accessible soybean ESTdatabases using the tBLASTn protocol with eighteen plantHIR protein sequences as queries. Deduced amino acidsequences of three contigs are homologous to highlyconserved HIRs found in diverse organisms. They werenamed as GmHIR1 (JN083835.1), GmHIR3 (N083834.1) andGmHIR4 (N083833.1), as which showing highest identityto OsHIR1(90%), CpHIR(91%) and OsHIR4 (82%),respectively. The cDNAs with full ORF were cloned fromthe hypocotyl tissue of soybean cv. Williams82 inoculatedwith P. sojae PNJ1 by RT-PCR. Proteins coding by GmHIR1,GmHIR3 and GmHIR4 contain 286, 284 and 292 amino acidsresidues, respectively (Fig 1). The predicted molecular masseswere 31.6, 31.4 and 32.6 kD, with theoretical pIs of 5.13,8.13 and 5.04, respectively. All three proteins contain aconserved SPFH domain, a putative N-myristoylation motifand putative transmembrane domain in similar positions asin the HIRs from other plant HIR proteins (Fig 1). They each

contained four introns and five exons and shared conservativestructure of genomic organization (Fig. 2A).

Phylogenetic analysis using the deduced amino acidsequences of GmHIRs and eighteen plant HIRs was inferredon the basis of the multiple sequence alignment (Fig. 2B).The neighbor-joining tree clearly divided into three majorclades. GmHIR1 fell into clade I and is clearly closest tobarley, maize and wheat HIR1/2. GmHIR3 was grouped intoclade II and is most closely related to CpHIR. GmHIR4 wasgrouped into clade III and was paired with orthologousOsHIR4 (Fig 2B). The GmHIR proteins exhibited highidentity (from 54% to 90% identity) to homologs from dicotsand monocots, and HIR proteins from monocotyledon anddicotyledon species formed distinct clusters, indicating thatdiversification of plant HIR proteins might have occurredafter the divergence of monocotyledons and dicotyledons.

Tissue distribution of GmHIRs: To identify in which tissuesthe GmHIR genes may be acting, quantitative RT-PCRanalysis was performed to examine the mRNA distributionof GmHIRs among six major tissues (roots, stems, leaves,flowers, young siliques and immature seeds). GmHIR1 wasmainly expressed in roots and leaves and weakly expressedin the other tissues (Fig. 3). GmHIR3 was primarily expressedin roots while GmHIR4 was expressed at higher level in roots,leaves and immature seeds than in other tissues (Fig 3).Although there was a conservative exon-intron structure, threeGmHIR genes exhibited differential expression patterns,which points to a diversity of gene function.

Expression patterns of GmHIRs after pathogen infectionand H2O2 treatment: Soybean cultivars Williams andWilliams82 showed remarkably different symptoms afterinoculation with PNJ1. Williams exhibited large, water-soaked lesions and macerated, collapsed tissues, whileWilliams82 exhibited only slightly water-soaked lesions,indicating the relatively high tolerance of this line to P. Sojae(Fig. 4A). The fungal infection induced GmHIRs expressionin both lines. However, the levels of induced gene expressionwere different in Williams82 vs. Williams (Fig. 4B). In the

AAG

316 LEGUME RESEARCH

N-myristoylation site Putative transmembrane domain

FIG 1: Sequence alignment of GmHIR homologs in plants. Dark shading indicates conserved residues; black lined boxes indicate theputative N-myristoylation site or putative transmembrane domain.

Volume 38 Issue 3, 2015 317

GmHIR1 GmHIR3 GmHIR4

A

LiHIR

GmHIR1 TaHIR2 HvHIR2 ZmHIR2

PcHIR TaHIR1 HvHIR1 ZmHIR1

OsHIR1

GmHIR4 OsHIR4 TaHIR4 HvHIR4

ZmHIR3 HvHIR3

GmHIR3

CsHIR

CpHIR

TaHIR3

CaHIR

III

II

I

B

FIG 2: Genomic structure of GmHIR genes and phylogeneticanalysis. (A) Intron-exon organization of GmHIR genes. Exon(s)are shown in black boxes, and spaces between the black boxes

correspond to introns. (B) Phylogenetic analysis of HIR proteinsfrom soybean and other plant species. Arothron meleagris ATP-synt_A was used as the outgroup. The tree shows the three major

phylogenetic subfamilies (numbered I to III and marked withdifferent alternating backgrounds to make subfamily

identification easier) with high predictive value. Hv, Hordeumvulgare; Os, Oryza sativa; Zm, Zea mays; Ta, Triticum aestivum;At, Arabidopsis thaliana; Pc, Pennisetum ciliare; Ca, Capsicum

annuum; Cs, Cucumis sativus; Cp, Carica papaya; Lj, Lotusjaponicus.

GmHIR1

GmHIR3

GmHIR4

FIG 3: Patterns of GmHIR expression in different tissues ofWilliams82 determined by quantitative real-time PCR. Error barsrepresent the standard deviation from three replicate experiments.

St, stem; R, root; L, leaf; F, flower; YS, young silique; IS,immature seed.

resistant genotype, the increase in gene expression wassignificantly faster and stronger, while expression was veryweak in the susceptible genotype. The three GmHIRs showedsimilar expression patterns. Expression of GmHIR1 increasedsteadily in beginning 3 h after infection and peaked atapproximately 24 h. The expression of GmHIR3 wasdramatically upregulated as early as 6 hpi, reaching a maximal

level 48 h after inoculation. The level of accumulation of theGmHIR4 transcript followed similar kinetics to those ofGmHIR3; the transcript levels peaked 48 h after infection. Inaddition, the consistently induced expression of the SAresponse marker gene PR1a suggests that systemic-acquiredresistance was activated by P. sojae infection (Fig. 4B). Theupregulated expression of GmHIRs induced by pathogeninfection suggests that GmHIRs might be involved in diseaseresistance.

The reactive oxygen intermediates is a proximalresponse that is likely to be required for HR (Heath, 1998).Therefore, we investigated the effects of 100 µM H2O2 onthe expression of GmHIRs. Time-course analysis showed thatGmHIRs were significantly repressed by H2O2 (Fig. 4C).Expression of GmHIR1 was downregulated 1 h after treatmentand reached a valley at 4 h. As the treatment proceeded, the

318 LEGUME RESEARCH

A

GmPR1a GmHIR4

GmHIR1 GmHIR3 B

C

Path

ogen

-inoc

ulat

ed

Un-

treat

ed

Williams82 Williams

GmHIR1 GmHIR3 GmHIR4

FIG 4: Symptoms of soybean 24 h postinoculation and GmHIR responses to pathogen infection and H2O2 treatment. (A) Phenotypesof the resistant line Williams82 and the susceptible line Williams inoculated with P. sojae PNJ1 24 hours postinoculation. The above

panel illustrates an untreated seedling, while the under panel shows the lesions after pathogen infection. (B) Relative expression levelsof GmHIRs in hypocotyls at different time intervals after inoculation with P. sojae PNJ1. ‘0’ represents wounded seedlings not

inoculated with mycelia. Error bars represent the standard deviation from three replicate experiments. (C) Expression of GmHIRs aftertreatment with 100 µM H2O2 determined by quantitative real-time PCR. ‘0’ represents water treatment. Error bars represent the

standard deviation from three replicate experiments.

transcript volume tended to increase. The levels of GmHIR3and GmHIR4 transcript accumulation followed similarkinetics to those of GmHIR1. Heath (1998, 2000)demonstrated that elicitors of HR cause intracellular ioninflux, membrane dysfunction and the accumulation ofreactive oxygen species. It is therefore not surprising that thenegative feedback regulation of H2O2 might explain whyGmHIRs were significantly repressed by H2O2.

The promoter region of the GmHIR genes wasanalyzed using the Plant CARE database. Five types ofdefense-related cis-elements, including putative W-BOX,GT1-motif, OSE2, consensus GT1 and WRKY71OS (Yu

et al. 2001; Park et al. 2004; Vieweg et al. 2004; Buchel etal. 1999; Eulgem et al. 1999), were identified in promotersof the three GmHIRs. GmHIR1 and GmHIR4 containedelicitor-responsive elements WBOXNTCHN48 and ElRE,respectively (Yamamoto et al. 2004; Rushuton et al. 1996).However, the promoter regions of GmHIR3 contained bothof these elicitor-responsive elements. The putative multitypedefense-responsive elements identified in the promoters ofthe GmHIR genes also point to the pathogen-responsivefunction of GmHIRs.

In summary, the identification of GmHIRs increasesour understanding of the resistance of soybean against

Volume 38 Issue 3, 2015 319

phytophthora root and stem rot disease resulting from P. sojaeinfection and provides gene candidates for fighting thisdisastrous disease.

ACKNOWLEDGMENTSWe are grateful to Dr. Jinming Zhao of Nanjing

Agriculture University for providing physiological race P.sojae (PNJ1), and to M. Xiaochun Bian for his technical

assistance in pathogen inoculation. This study was supportedby the NSFC program (31360344), the Agricultural Scientific& technological research projects of Guizhou province (No.NY[2013]3009), the Grand science & technology specialproject of Guizhou province (no. [2013]6005) andEngineering Technology Research Center Fund of GuizhouProvince (No. 20124006).

REFERENCESBuchel, A.S., Brederode, F.T., Bol, J.F. and Linthorst, H.J. (1999). Mutation of GT-1 binding sites in the Pr-1A promoter

influences the level of inducible gene expression in vivo. Plant Mol. Biol., 40: 387-396.Burnham, K.D., Dorrance, A.E., Francis, D.M., Fioritto, R.J. and Martin, S.K.S. (2003). Rps8, a new locus in soybean for

resistance to Phytophthora sojae. Crop science., 43: 101-105.Claros, M.G. and von Heijne, G. (1994). TopPred II: an improved software for membrane protein structure predictions.

Comput. Appl. Biosci.,10: 685-686.de Castro, E., Sigrist, C.J., Gattiker, A., Bulliard, V., Langendijk-Genevaux, P.S., Gasteiger, E., Bairoch, A. and Hulo, N.

(2006). ScanProsite: detection of PROSITE signature matches and ProRule-associated functional and structuralresidues in proteins. Nucl. Acids. Res., 34: W362-W365.

Dangl, J.L. and Jones, J.D.G. (2001). Plant pathogens and integrated defense responses to infection. Nature., 411: 826-833.de los Reyes, B.G., Morsy, M., Gibbons, J., Varma, T.S., Antoine, W., McGrath, J.M., Halgren, R. and Redus, M. (2003).

A snapshot of the low temperature stress transcriptome of developing rice seedlings (Oryza sativa L.) via ESTsfrom subtracted cDNA library. Theor. Appl. Genet., 107: 1071-1082.

Duan, YH., Guo, J., Shi, X., Guan, X., Liu, F., Bai, P., Huang, L. and Kang, Z. (2013). Wheat hypersensitive-inducedreaction genes TaHIR1 and TaHIR3 are involved in response to stripe rust fungus infection and abiotic stresses.Plant Cell Rep., 32: 273-283.

Eulgem, T., Rushton, P.J., Schmelzer, E., Hahlbrock, K. and Somssich, I.E. (1999). Early nuclear events in plant defencesignalling: rapid gene activation by WRKY transcription factors. EMBO J., 18: 4689-4699.

Heath, M.C. (1998). Apoptosis, programmed cell death and the hypersensitive response. Eur. J. Plant Pathol., 104:117-124.

Heath, M.C. (2000). Hypersensitive response-related death. Plant Mol. Biol. 44: 321-334.Huang, X. and Madan, A. (1999). CAP3:A DNA sequence assembly program. Genome Res., 9: 868-877.Jones, J.D. and Dangl, J.L. (2006). The plant immune system. Nature., 444: 323-329.Jung, H.W. and Hwang, B.K. (2007). The leucine-rich repeat (LRR) protein, CaLRR1, interacts with the hypersensitive

induced reaction (HIR) protein, CaHIR1, and suppresses cell death induced by the CaHIR1 protein. Mol. PlantPathol., 8: 503-514.

Karrer, E.E., Beachy, R.N. and Holt, C.A. (1998). Cloning of tobacco genes that elicit the hypersensitive response. PlantMol. Biol., 36: 681-690.

Kim, M.S., Kim, Y.C. and Cho, B.H. (2004). Gene expression analysis in cucumber leaves primed by root colonization with pseudomonaschlororaphis O6 upon challenge-inoculation with Corynespora cassiicola. Plant biol. (Stuttg.)., 6: 105-108.

Krüger, J., Thomas, C.M., Golstein, C., Dixon, M.S., Smoker, M., Tang, S.J., Mulder, L. and Jones, J.D. (2002). A tomato cysteineprotease required for Cf-2-dependent disease resistance and suppression of autonecrosis. Science., 296: 744-747.

Lescot, M., Dehais, P., Thijs, G., Marchal, K., Moreau, Y., Van de Peer, Y., Rouze, P. and Rombauts, S. (2002). Plant CARE,a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences.Nucleic Acid Res., 30: 325-327.

Livak, K.J. and Schmittgen, T.D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the2-CT method. Methods., 25: 402-408.

Nadimpalli, R., Yalpani, N., Johal, G.S. and Simmons, C.R. (2000). Prohibitins, stomatins, and plant disease response genescompose a protein superfamily that controls cell proliferation, ion channel regulation, and death. J. Biol. Chem.,275: 29579-29586.

320 LEGUME RESEARCH

Park, H.C., Kim, M.L., Kang, Y.H., Jeon, J.M., Yoo, J.H., Kim, M.C., Park, C.Y., Jeong, J.C., Moon, B.C., Lee, J.H., Yoon,H.W., Lee, S.H., Chung, W.S., Lim, C.O., Lee, S.Y., Hong, J.C. and Cho, M.J. (2004). Pathogen- and NaCl-inducedexpression of the SCaM-4 promoter is mediated in part by a GT-1 box that interacts with a GT-1-like transcriptionfactor. Plant Physiol., 135: 2150-2161.

Park, J.M. (2005). The hypersensitive response. A cell death during disease resistance. Plant Pathol. J., 21: 99-101.Qi, Y.P., Tsuda, K., Nguyen, L.V., Wang, X., Lin, J., Murphy, A.S., Glazebrook, J., Thordal-Christensen, H. and Katagiri, F.

(2011). Physical association of Arabidopsis Hypersensitive Induced Reaction proteins (HIRs) with the immune receptorRPS2. J. Biol. Chem., 286: 31297-31307.

Ren, J., Wen, L., Gao, X., Jin, C., Xue, Y. and Yao, X. (2008). CSS-Palm 2.0: an updated software for palmitoylation sitesprediction. Protein Eng. Des. Sel., 21: 639-644.

Rostoks, N., Schmierer, D., Kudrna, D. and Kleinhofs, A. (2003). Barley putative hypersensitive induced reaction genes:genetic mapping, sequence analyses and differential expression in disease lesion mimic mutants. Theor. Appl.Genet., 107: 1094-1101.

Rushton, P.J., Torres, J.T., Parniske, M., Wernert, P., Hahlbrock, K. and Somssich, I.E. (1996). Interaction of elicitor-induced DNA-binding proteins with elicitor response elements in the promoters of parsley PR1 genes. EMBO J.,15: 5690-5700.

Sun, S., Zhao, J., Wu, X., Guo, N., Wang, Y., Gai, J. and Xing, H. (2008). Resistance of soybean germplasm to phytophthorain Huaihai Valley. Soybean Science., 27: 465-470.

Tyler, B.M. (2007). Phytophthora sojae: root rot pathogen of soybean and model oomycete. Mol. Plant Pathol., 8: 1-8.Vieweg, M.F., Frühling, M., Quandt, H.J., Heim, U., Bäumlein, H., Pühler, A., Küster, H. and Andreas, M.P. (2004). The

promoter of the Vicia faba L. leghemoglobin gene VfLb29 is specifically activated in the infected cells of rootnodules and in the arbuscule-containing cells of mycorrhizal roots from different legume and nonlegume plants.Mol. Plant Microbe. Interact., 17: 62-69.

Wu, X.L., Zhao, J.M., Wang, Y.L., Sun, S., Guo, N., Tang, Q.H., Wang, Y.C., Gai, J.Y. and Xing, H. (2009). Identificationand isolation of soybean root rot in Nanjing. Journal of Nanjing Agricultural University., 32: 61-64.

Yamamoto, S., Nakano, T., Suzuki, K. and Shinshi, H. (2004). Elicitor-induced activation of transcription via W box-relatedcis-acting elements from a basic chitinase gene by WRKY transcription factors in tobacco. Biochim. Biophys.Acta., 1679: 279-287.

Yu, D., Chen, C. and Chen, Z. (2001). Evidence for an important role of WRKY DNA binding proteins in the regulation ofNPR1 gene expression. Plant Cell., 13: 1527-1540.

Yu, X.M., Yu, X.D., Qu, Z.P., Huang, X.J., Guo, J., Han, Q.M., Zhao, J., Huang, L.L. and Kang, Z.S. (2008). Cloning of aputative hypersensitive induced reaction gene from wheat infected by stripe rust fungus. Gene., 407: 193-198.

Zhang, G., Dong, Y.L., Zhang, Y., Li, Y.M., Wang, X.J., Han, Q.M., Guo, J., Huang, L.L. and Kang, Z.S. (2009). Cloning andcharacterization of a novel hypersensitive-induced reaction gene from wheat infected by Stripe Rust Pathogen. J.Phytopathol., 157: 722-728.

Zhou, L., Cheung, M.Y., Li, M.W., Fu, Y.P., Sun, Z.X., Sun, S.M. and Lam, H.M. (2010). Rice Hypersensitive InducedReaction Protein 1 (OsHIR1) associates with plasma membrane and triggers hypersensitive cell death. BMC PlantBiol., 10: 1-10.