Mitochondrial adaptations in insulin resistant muscle

van den Broek, N.M.A.

DOI:10.6100/IR684831

Published: 01/01/2010

Document VersionPublisher’s PDF, also known as Version of Record (includes final page, issue and volume numbers)

Please check the document version of this publication:

• A submitted manuscript is the author's version of the article upon submission and before peer-review. There can be important differencesbetween the submitted version and the official published version of record. People interested in the research are advised to contact theauthor for the final version of the publication, or visit the DOI to the publisher's website.• The final author version and the galley proof are versions of the publication after peer review.• The final published version features the final layout of the paper including the volume, issue and page numbers.

Link to publication

General rightsCopyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright ownersand it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights.

• Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal ?

Take down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Download date: 01. Sep. 2018

     

Mitochondrial adaptations in insulin resistant muscle 

   

                                       A catalogue record is available from the Eindhoven University of Technology Library   ISBN: 978‐90‐386‐2299‐6  Printed by: 

     

Mitochondrial adaptations in insulin resistant muscle 

       

PROEFSCHRIFT  

ter verkrijging van de graad van doctor aan de Technische Universiteit Eindhoven, op gezag van de rector magnificus, prof.dr.ir. C.J. van Duijn, voor een 

commissie aangewezen door het College voor Promoties in het openbaar te verdedigen 

op donderdag 16 september 2010 om 16.00 uur 

    

door   

Nicole Martina Adriana van den Broek  

geboren te Tilburg 

Dit proefschrift is goedgekeurd door de promotor: prof.dr. K. Nicolay   Copromotor: dr. J.J. Prompers   

   

   

   

Contents    Chapter 1  General introduction  1 

Chapter 2  Comparison of in vivo post‐exercise phosphocreatine recovery and resting ATP synthesis flux for the assessment of skeletal muscle mitochondrial function 

31 

Chapter 3  Intersubject differences in the effect of acidosis on phosphocreatine recovery kinetics in muscle after exercise are due to differences in proton efflux rates 

53 

Chapter 4  Early or advanced stage type 2 diabetes is not accompanied by in vivo skeletal muscle mitochondrial dysfunction  

77 

Chapter 5  Increased mitochondrial content rescues in vivo muscle oxidative capacity in long‐term high‐fat diet fed rats 

99 

Chapter 6  Carnitine insufficiency in high‐fat diet fed rats does not contribute to lipid‐induced impairment of skeletal muscle mitochondrial function in vivo 

123 

Chapter 7  Summary and future perspectives  147 

  Nederlandse samenvatting Dankwoord List of publications Curriculum Vitae 

157 

 

 

Chapter     Introduction 

Chapter 1 

2 

What was originally termed adult‐onset diabetes is now one of the most dominant diseases 

in the world: type 2 diabetes (T2D). The prevalence of diabetes  is  increasing dramatically. 

The total number of people with diabetes  is projected to rise from 171 million  in 2000 to 

366 million  in 2030  [4]. The majority of all diabetes patients  (90%) suffers  from T2D. The 

most  important  reason  for  the dramatic  increase  in prevalence of  T2D  is  the  expanding 

Western lifestyle, which encompasses the combination of an excessive calorie intake and a 

decreased physical activity, leading to fat accumulation and increased body weight.  

T2D is characterized by insulin resistance (IR), a disorder in which major metabolic tissues, 

in particular  skeletal muscle, are  less  sensitive  for  insulin. A  first attempt of  the body  to 

compensate for the  IR of the tissues  is to  increase  insulin production by the pancreatic ‐cells.  IR  is  progressive  and  therefore  during  the  years  the  need  for  insulin  will  keep 

increasing. After some time the overproduction of insulin will lead to -cell failure, resulting in a diminished insulin secretion and sustained elevated blood glucose levels, a state which 

is called T2D. After several years, T2D can lead to severe life‐threatening complications like 

cardiovascular disease, neuropathy, retinopathy and kidney failure.  

During  the  last  decade  excessive  ectopic  lipid  storage  and  muscle  mitochondrial 

dysfunction have been associated with the pathogenesis of IR and T2D [5]. However, there 

is still no consensus about the underlying mechanisms leading to IR and consequently T2D. 

Therefore further investigation into the etiology of IR and T2D is important to conquer the 

T2D epidemic. 

The present chapter provides an overview of the background of this thesis. First the most 

important cellular events leading to IR and T2D will be explained and the energy‐producing 

organelles, i.e. the mitochondria, will be introduced. Subsequently, different theories about 

the mechanism of fatty acid‐induced IR will be summarized and the methods applied in this 

thesis  for  measuring  muscle  lipids  and  lipid  intermediates  and  muscle  mitochondrial 

function are described. Finally, the outline of the thesis is presented. 

Glucose homeostasis, insulin resistance and type 2 diabetes 

In healthy subjects blood glucose  levels are well controlled. After a meal, glucose  is taken 

up  in  the blood and  transported  to  tissues, where glucose  is used  for energy production. 

Glucose  is  the  most  important  substrate  for  the  brain.  However,  skeletal  muscle  is 

responsible for as much as 70‐80% of postprandial glucose uptake [6]. When blood glucose 

levels rise, e.g. after a meal, the ‐cells of the pancreas respond by producing more insulin. 

Insulin can  stimulate  the  ‘insulin  sensitive’ glucose uptake, by binding  to cell membrane‐

bound insulin receptors, which activates the insulin signaling cascade. Binding of insulin to 

its  receptor  leads  to  autophosphorylation  of  its  ‐subunits  and  the  phosphorylation  of 

Introduction 

3 

tyrosine  residues  in  insulin  receptor substrates  (IRS).  IRS activates phosphatidylinositol‐3‐

kinase (PI3K) through its SH2 domain, thus increasing the intracellular concentration of PIP2 

and PIP. This,  in  turn, activates phosphatidylinositol phosphate‐dependent kinase‐1  (PDK‐

1),  which  subsequently  activates  Akt/PKB.  This  activation  cascade  results  in  the 

translocation  of  the  glucose  transporter  4  (GLUT4)  from  cytoplasmic  vesicles  to  the  cell 

membrane, where GLUT4  facilitates glucose uptake  (reviewed  in  [3]). Besides stimulating 

the uptake of glucose in muscle, insulin also inhibits glucose production in the liver [7]. As a 

result of  those muscle and  liver  responses, blood glucose  levels will  return back  to basal 

values  in  a  relatively  short  time  period.  In  the  muscle,  glucose  can  be  used  for  ATP 

production.  However  during  rest, when  little  energy  is  needed,  glucose  is  converted  to 

glycogen, which  is stored  in the muscle, thus providing an energy reserve that can quickly 

be mobilized to meet a sudden need for glucose. In the case of IR, postprandial glucose  is 

still  cleared  from  the  blood,  but  because  of  the  decreased  sensitivity  of  the  peripheral 

tissues  for  insulin, more  insulin  is  needed  for  a  similar  blood  glucose  lowering  effect. 

Sustained insulin overproduction by pancreatic ‐cells leads to ‐cell failure and decreased insulin production. This results  in  increased basal glucose  levels and  increased duration of 

postprandial  blood  glucose  clearance,  which  is  a  condition  called  T2D.  The  high  blood 

glucose  levels can  irreversibly damage tissues, finally  leading to well known complications 

of  T2D,  e.g.  cardiovascular  disease,  neuropathy,  retinopathy  and  kidney  failure.  The 

dramatic  rise  in  T2D  is  associated  with  the  increased  occurrence  of  obesity  and  the 

decrease of physical activity. However, the primary cause of IR and T2D  is still not known. 

During  the  last decade,  skeletal muscle mitochondrial dysfunction has been proposed  to 

play a key role in the development of IR and T2D [8‐13]. 

Mitochondrial energy production in muscle  

Mitochondria are called the ‘powerhouses’ of the cell. Without them, cells would be unable 

to  extract  significant  amounts  of  energy  from  the  nutrients,  and  as  a  consequence, 

essentially  all  cellular  functions  would  fail  under  high  energy  demand  conditions.  The 

specific structure of the mitochondrion is essential for synthesizing adenosine triphosphate 

(ATP),  the  energy  source  for  cells.  The  organelle  is  surrounded  by  two  lipid  bilayer 

membranes: an outer and an inner membrane. Many foldings of the inner membrane form 

cristae,  in  which  oxidative  enzymes  (NADH  dehydrogenase  (complex  I),  cytochrome  c 

reductase  (complex  III),  and  cytochrome  c  oxidase  (complex  IV)),  contributing  to  the 

electron transport chain (ETC), and the F1F0‐ATP synthase complex (complex V), responsible 

for proton‐driven ATP synthesis, are  located (Figure 1). In addition, the  inner cavity of the 

mitochondrion,  termed  the  matrix,  contains  large  quantities  of  enzymes,  which  are 

involved  in  the oxidation of carbohydrates  (CHO) and  fatty acids  (FAs),  i.e. enzymes  from 

the tricarboxylic acid (TCA) cycle and the ‐oxidation pathway, respectively [14]. 

Chapter 1 

4 

ATP is used throughout the cell to drive almost all energy‐dependent cellular processes, like 

active  transport  of  molecules  and  ions,  the  synthesis  of  macromolecules  and  the 

performance of mechanical work during muscle contractions and other cellular movements 

[14].  ATP  is  therefore  also  called  the  energy  currency  of  the  cell.  ATP  is  a  nucleotide 

composed of an adenine ring and a ribose sugar (adenosine) and three phosphate groups 

(triphosphate).  The phosphate  groups,  starting with  the  group  closest  to  the  ribose,  are 

referred to as the alpha (), beta (), and gamma (γ) phosphates. Two phospho‐anhydride 

bonds (those that connect adjacent phosphates) in ATP are responsible for the high energy 

content of  this molecule.  In  the context of biochemical  reactions,  these anhydride bonds 

are  frequently  referred  to  as  high‐energy  bonds.  Energy  stored  in ATP  is  released  upon 

hydrolysis of the terminal anhydride bond, thereby forming adenosine diphosphate (ADP) 

and inorganic phosphate (Pi).  

Muscle contraction depends on energy supplied by ATP. The concentration of ATP  in  the 

muscle is sufficient to maintain full contraction for only 1 or 2 seconds at most. Therefore, 

the formed ADP has to be rephosphorylated back to ATP immediately, allowing the muscle 

to continue  its contraction. There are several sources of energy for the rephosphorylation 

of ADP. The source of energy that is used to reconstitute ATP within the first few seconds of 

muscle contraction is phosphocreatine (PCr), which carries a high‐energy phosphate bond, 

 

Figure 1. Schematic overview depicting the different components of oxidative phosphorylation, i.e. the electron  transport chain and  the F1F0‐ATP  synthase  in  the  inner mitochondrial membrane. NADH and FADH2 donate their electrons to complex I and II, respectively. Electron transfer through complexes I, III and  IV  is  accompanied  by  the  pumping  of  protons  from  the matrix  into  the  intermembrane  space, leading  to  the  generation  of  an  electrochemical  proton  gradient.  This  gradient  is  used  to  drive  the translocation of protons  through  the F1F0‐ATP  synthase, which goes along with  the  formation of ATP. IMM,  inner  mitochondrial  membrane;  complex  I,  NADH  dehydrogenase;  complex  II,  succinate dehydrogenase; complex III, cytochrome bc1 complex; complex IV, cytochrome c oxidase; F1F0 ATP‐ase, F1F0‐ATP synthase; Q, coenzyme Q; cyt c, cytochrome c. 

Introduction 

5 

with a slightly higher free energy content than those in ATP. Therefore, phosphocreatine is 

instantly cleaved and  the  released energy  is used  to  rephosphorylate ADP  to ATP by  the 

creatine kinase (CK) reaction: 

 

MgADP PCr H MgATP Cr Eq. 1  

 

After  about  five  seconds  of maximal muscle  contraction,  PCr  is  depleted  and  the  next 

source of energy  to  reconstitute ATP  is addressed,  i.e. glycogen. Glycogen has previously 

been stored in large amounts in muscle cells, thereby providing a rapid source of energy for 

the muscle in situations of high‐energy demand, i.e. muscle contractions longer than a few 

seconds. Cleavage of glycogen results in the formation of glucose‐1‐phosphate which, after 

conversion  into  glucose‐6‐phosphate,  can  enter  the  glycolytic  pathway.  Via  glycolysis, 

glucose‐6‐phosphate,  either  formed  from  glycogen  or  from  glucose  directly,  is  rapidly 

broken down to pyruvate, thereby  forming 2 molecules of ATP. Besides the advantage of 

fast ATP production, glycolysis has the ability to produce ATP  in the absence of oxygen by 

producing  lactate.  Unfortunately,  however,  during  anaerobic  glycolysis  so  many  end 

products  accumulate  that  the  muscle  will  lose  its  capability  to  sustain  maximum 

contraction after about one minute.  

The third source of energy is oxidative metabolism. More than 95% of ATP is formed in the 

mitochondria  via  oxidative  phosphorylation,  by  degrading  substrates  like  CHO  and  FA 

aerobically.  Both  substrates  have  to  be  converted  to  the  general  degradation  product 

acetyl  coenzyme  A  (acetyl‐CoA).  Pyruvate,  formed  via  glycolysis,  is  subsequently 

transported  into  the  mitochondria  and  converted  to  acetyl‐CoA  by  the  pyruvate 

dehydrogenase complex. Within the outer mitochondrial membrane, the enzyme fatty acyl‐

CoA synthetase  (ACS) catalyses the  first step  in  intracellular FA metabolism by converting 

FAs  into  fatty  acyl‐CoA’s.  Upon  activation  by  ACS  the  resulting  fatty  acyl‐CoA’s  can  be 

transported across the mitochondrial membrane via the carnitine shuttle, which consists of 

three components: carnitine palmitoyltransferase (CPT) 1 and 2 and carnitine acylcarnitine 

translocase (CACT). CPT1 executes the initial step in this process by catalyzing the reversible 

transesterification  of  long‐chain  acyl‐CoA  with  carnitine.  The  long‐chain  acylcarnitine 

products of CPT1 are then transported across the inner mitochondrial membrane by CACT. 

Finally,  inside  the mitochondrion,  CPT2  regenerates  acyl‐CoA  on  the matrix  side  of  the 

membrane where it can enter the ‐oxidation. Each cycle of the ‐oxidation consists of four reactions,  shortening  the  acyl‐CoA  unit  by  two  carbon  atoms.  Thereby,  every  cycle  one 

nicotinamide adenine dinucleotide (NADH), one flavin adenine dinucleotide (FADH2) and an 

acetyl‐CoA molecule  are  released.  This  process  continues  until  the  entire  acyl  chain  is 

cleaved into acetyl‐CoA units. Acetyl‐CoA, derived from CHO via pyruvate or from FAs, then 

Chapter 1 

6 

enters the next step  in the oxidative process: the TCA cycle. Acetyl‐CoA transfers  its two‐

carbon  acetyl  group  to oxaloacetate  to  form  a  six‐carbon  compound,  i.e.  citrate. Citrate 

then undergoes a series of chemical transformations resulting  in oxaloacetate, to which a 

new acetyl‐CoA can be conjugated to enter the TCA cycle again. During each cycle one ATP, 

two CO2, one FADH2 and three NADH molecules are released. The electron donors, NADH 

and FADH2,  transfer  their electrons  to oxygen, which  is  reduced  to water  in  the ETC. The 

enzymes  that catalyze  these  reactions have  the ability  to  simultaneously create a proton 

gradient  across  the  inner mitochondrial membrane, which  drives  the  F1F0‐ATP  synthase 

complex to form ATP from ADP and Pi: 

 

MgATP H O MgADP P H Eq. 2   

   Figure  2.  Schematic  overview  of  FA  transport  across  the mitochondrial membranes  by  the  carnitine shuttle and the metabolic conversions of FAs and pyruvate to yield ATP. ACS exerts the first step in FA transport by  converting  FAs  into  fatty  acyl‐CoA’s. CPT1  catalyzes  the  reversible  transesterification of long‐chain acyl‐CoA with carnitine. These  long‐chain acylcarnitine species are  then  transported across the  inner mitochondrial membrane by CACT.  Inside the mitochondrion, CPT2 regenerates acyl‐CoA on 

the matrix  side  of  the membrane  where  it  can  enter  the  ‐oxidation, which  generates  acetyl‐CoA. Pyruvate  is  transported  into  the mitochondrial matrix, where  it  is  converted  to  acetyl‐CoA  by  PDH. Acetyl‐CoA can enter the TCA cycle. NADH and FADH2, produced in the TCA cycle, enable ATP production by OXPHOS as explained  in more detail  in Figure 1. OMM, outer mitochondrial membrane; ACS, acyl‐CoA  synthetase;  CPT,  carnitine  palmitoyl  transferase;  CACT,  carnitine‐acylcarnitine  translocase;  PDH, pyruvate dehydrogenase; TCA, tricarboxylic acid cycle; OXPHOS, oxidative phosphorylation.  

Introduction 

7 

Mechanisms of  fatty acid‐induced muscle  insulin  resistance and the role of mitochondrial dysfunction 

T2D and  IR are often associated with hyperlipidemia  (excessively high plasma  triglyceride 

and cholesterol levels) as well as elevated levels of plasma FFA (reviewed in [15‐16]). It has 

been  shown  that  raising  plasma  FFA  levels  by  intravenously  administering  IntralipidTM 

decreases  whole  body  glucose  uptake,  oxidation  and  storage  [17]  and  skeletal muscle 

glucose uptake  [18‐19]. Furthermore,  lowering of plasma FFA has been  shown  to  reduce 

the  severity of  insulin  resistance  [20]. Plasma FFAs  can easily enter  cells where  they are 

either  oxidized  to  generate  energy  in  the  form  of  ATP  or  re‐esterified  for  storage  as 

triglycerides  (TG).  Not  surprisingly,  therefore,  raising  plasma  FFA  levels  results  in 

intramyocellular accumulation of  triglycerides,  the so‐called  intramyocellular  lipids  (IMCL) 

[21], which are correlated to the severity of  IR   [22].  It was shown that  IMCL content  is a 

better  predictor  for  IR  than  plasma  FFA  levels  [23].  However  IMCL  is  probably  not 

interfering with  the  insulin  signaling pathway directly, but  rather  represents  a  surrogate 

marker of a systemic lipid oversupply, which is believed to cause IR. In this chapter several 

hypotheses about the underlying mechanism of lipid‐induced IR are summarized. 

Inhibition of glucose oxidation  

Randle et al. introduced the ‘glucose‐fatty acid cycle’ or ‘Randle cycle’ [2]. In isolated heart 

and  skeletal muscle preparations, Randle et  al. demonstrated  that  the utilization of one 

nutrient  inhibited  the  use  of  the  other  directly  and without  hormonal mediation. Most 

emphasis  was  put  on  the  control  of  glucose  oxidation  by  FAs.  Due  to  an  elevated  FA 

oxidation, the intra‐mitochondrial acetyl‐CoA/CoA ratio increases, resulting in the inhibition 

of PDH, a regulatory enzyme in glucose metabolism. It has been shown that these changes 

lead  to  elevated  citrate  levels  in  the  cytosol,  which  inhibit  PFK‐1  [24],  followed  by  an 

increase  in  glucose‐6‐phosphate,  which  eventually  inhibits  hexokinase  and  therefore 

diminishes glucose uptake,  resulting  in elevated plasma glucose  levels  (Figure 3). Overall, 

Randle  concluded  that  an  increased  FA  availability  leads  to  increased  ‐oxidation  and  a decrease in muscle glucose uptake and oxidation, and can therefore be seen as a possible 

cause for elevated plasma glucose levels and skeletal muscle IR [2].  

Inhibition of glucose transport and mitochondrial dysfunction 

Several years later, the Randle cycle was challenged. A series of MRS studies performed by 

the group of Shulman pointed out that glucose transport was impaired directly by elevated 

FFA, without an increase in glucose‐6‐phosphate levels [25]. In addition, others have shown 

that infusion of lipids induced IR only several hours after it had already decreased glucose 

oxidation, suggesting that the glucose‐fatty acid cycle may not be responsible for IR [26]. As 

Chapter 1 

8 

an alternative  for  the  glucose‐fatty acid  cycle,  Shulman proposed a mechanism  in which 

intramyocellular  lipids  impair glucose uptake by  inhibiting the  insulin signaling cascade [3, 

27]. The proposed mechanism  involves  the  increase  in  intramyocellular  lipid metabolites 

like diacylglycerol (DAG), long‐chain acyl‐CoA’s and ceramides, due to increased delivery of 

lipids  to  muscle  and/or  a  decreased  intracellular  FA  oxidation.  These  metabolites  can 

activate protein kinase C , leading to the phosphorylation of serine/threonine sites on the insulin  receptor  substrate  1,  which  in  turn  interferes  with  the  activation  of 

phosphatidylinositol 3‐kinase, eventually resulting in a diminished glucose transport activity 

(Figure 4). Since  then,  several  studies  in humans, animals and  in  vitro preparations have 

confirmed steps of this mechanism [25, 28‐29].  

 

 

Figure 3. Mechanism of inhibition of glucose utilization by enhanced fatty acid oxidation as described by Randle et al. [2]. An increase in fatty acid availability promotes fatty acid oxidation. This results in elevated acetyl‐CoA  levels, which causes  inhibition of PDH activity and reduced pyruvate oxidation. This leads to increased intramitochondrial and consequently intracellular citrate levels. Citrate in turn inhibits PFK‐1,  leading to accumulation of G‐6‐P,   which  inhibits HK and thereby glucose uptake via GLUT4. LC‐FA,  long‐chain  fatty acid; FAT,  fatty acid  translocase; CD36, cluster of differentiation 36; 

LC‐acyl‐CoA,  long‐chain  acyl‐coenzyme  A;  ‐ox,  ‐oxidation;  TCA,  tricarboxylicacid  cycle;  PDH, pyruvate  dehydrogenase;  PFK‐1,  phosphofructokinase‐1;  F‐6‐P,  fructose‐6‐phosphate;  G‐6‐P, glucose‐6‐phosphate; HK, hexokinase; GLUT4, glucose transporter type 4. 

Introduction 

9 

Furthermore, it was shown that IMCL, assessed by 1H MRS, is a better predictor for IR than 

plasma FFA,  triglyceride and cholesterol  levels, both  in adults and  in children  [23, 30‐33]. 

Further proof for the relation between IR and IMCL came from Pima Indians in whom IMCL 

levels were inversely correlated with insulin action [22]. However, it has to be kept in mind 

that IMCL is probaby not directly affecting insulin sensitivity, but more likely represents the 

accumulation of  lipid  intermediates, e.g. DAG, ceramides and  long‐chain acyl‐CoA’s, which 

can on their turn interfere with the insulin signaling cascade [34]. 

Although many  studies  strongly  suggest  that  lipid  accumulation within muscle  tissue  is 

associated with IR, paradoxical results have been presented [35‐37]. Not only within muscle 

of obese, diabetic subjects, but also within muscle of endurance‐trained,  insulin‐sensitive 

athletes  increased  IMCL  levels  have  been  found.  Therefore,  the  reported  correlations 

between IMCL content and IR do not represent a direct, functional relationship. In addition 

to this finding,  it has been shown that  insulin sensitivity and  IMCL content are dependent 

on muscle  fiber  type.  IMCL  levels  are higher  in  insulin  sensitive oxidative  type  1 muscle 

fibers, compared  to  the  less  insulin sensitive, more glycolytic  type 2  fibers  [37‐39]. These 

findings  together  point  out  that  increased  lipid  content within muscle  does  not  always 

denote  IR  and  that muscle  lipid  content  should  be  evaluated within  a  context  of  other 

markers of metabolic capacity.  

One  such marker  is  the  capacity  for  lipid  oxidation  [40],  or  the  capacity  for  substrate 

oxidation in general [41]. Several human studies have provided evidence for dysfunctional 

muscle mitochondria  in  insulin‐resistant  subjects  by  showing  down‐regulation  of  genes 

encoding  mitochondrial  enzymes  [42‐43],  decreased  mitochondrial  content  and  lower 

mitochondrial respiratory chain activity [44]. Kelly et al. reported a 40% decrease in overall 

ETC  activity  (estimated  using  the  activity  of  rotenone‐sensitive  NADH:oxygen 

oxidoreductase) and smaller, deformed mitochondria in skeletal muscle from T2D patients 

compared  to  muscle  of  healthy  volunteers  [45].  Moreover,  studies  in  which  oxygen 

consumption was determined  in  freshly prepared  isolated mitochondria or permeabilized 

muscle fibers showed decreased ADP‐stimulated respiration in diabetic patients compared 

to  BMI‐matched  controls  [46‐47].  In  vivo  31P MRS measurements  were  also  applied  to 

investigate the correlation between mitochondrial function and IR and/or T2D. Resting ATP 

synthesis flux has been measured by saturation transfer (ST) experiments by the group of 

Shulman [48‐50]. They showed decreased resting ATP synthesis fluxes in muscle of insulin‐

resistant elderly subjects as well as  in  insulin‐resistant offspring of type 2 diabetic parents 

as  compared  to  healthy  controls  [48‐50].  Another  31P  MRS  technique  to  determine 

mitochondrial function is the measurement of PCr recovery after muscle exercise. A slower 

PCr recovery, indicating impaired mitochondrial function, was found in overweight diabetic 

patients  as  compared  to  healthy  overweight  controls  [51].  It  was  hypothesized  that 

inherited or acquired skeletal muscle mitochondrial dysfunction, associated with a reduced 

Chapter 1 

10 

mitochondrial capacity  to oxidize FAs,  leads  to a  lipid overload  in muscle cells  (Figure 4), 

inducing IR as was explained before. 

However,  recently  more  and  more  studies  have  been  reported  in  which  impaired 

mitochondrial dysfunction was not observed  in  insulin‐resistant  subjects or patients with 

type 2 diabetes. PCr recovery rates of early and advanced stage diabetic patients matched 

for  the  level of physical activity were not  significantly different  [52]. Additionally,  results 

from  respiration  measurements  of  permeabilized  fibers  of  T2D  patients  compared  to 

controls  are  in  agreement with  the  previous  results when  normalized  for mitochondrial 

DNA content or citrate synthase activity [53]. In other words, the type 2 diabetes patients 

showed  normal  intrinsic mitochondrial  function,  but  an  impaired  oxidative  capacity  that 

was  entirely  attributed  to  a  lower mitochondrial  content.  Environmental  factors  play  an 

  

 

Figure  4.  Mechanism  of  inhibition  of  glucose  utilization  by  enhanced  fatty  acid  uptake  and/or decreased FA oxidation as proposed by Shulman et al.  [3].  Increased  LC‐FA  supply  in  combination with decreased LC‐FA oxidation leads to an accumulation of lipids and lipid intermediates in muscle. 

These lipid intermediates (e.g. DAG and ceramides) activate PKC, leading to the phosphorylation of serine/threonine  sites  on  the  insulin  receptor  substrate  1,    which  in  turn  interferes  with  the activation of phosphatidylinositol 3‐kinase, eventually resulting in a diminished GLUT4 translocation to the cell membrane and consequently diminished glucose transport. IMCL, intramyocellular lipids; DAG, diacylglycerol; PKC, protein kinase C;  IRS,  insulin receptor substrate; tyr, tyrosine; ser, serine; thr, threonine; PI3K, phosphatidylinositol 3‐kinase (for other abbreviation see legend Figure 3).  

Introduction 

11 

important role in regulating skeletal muscle oxidative capacity, and the lower mitochondrial 

content  in  type  2  diabetes  patients  might  simply  be  the  result  of  a  reduced  habitual 

physical activity level [8, 53‐54]. Furthermore, mitochondrial dysfunction in type 2 diabetes 

might be secondary  to  impaired  insulin signaling  [55‐57] and/or abnormal blood glucose, 

insulin  [58‐59]  and  FFA  [57]  levels.  Therefore,  the  debate  continues  as  to  whether 

mitochondrial dysfunction represents either cause or consequence of IR and/or T2D. 

Incomplete ‐oxidation 

The hypothesis that mitochondrial dysfunction induces a decreased capacity to oxidize FAs, 

which  leads to  lipid overload and consequently IR,  is  losing  impact. A recent study  links IR 

to an increased capacity to oxidize FAs rather than the reverse [1] (Figure 5). However, the 

high  rates  of  ‐oxidation  in  insulin‐resistant  states  are  associated  with  low  rates  of complete fat oxidation [1, 60]. High rates of incomplete ‐oxidation occur when carbon flux through  the ‐oxidation machinery outpaces  the entry of  acetyl‐CoA  into  the  TCA  cycle. 

Most of the evidence for the elevated  incomplete ‐oxidation  in  insulin‐resistant states  is based on  the profiling of acylcarnitines  in muscle, blood and urine. The  vast majority of 

acylcarnitines  is  produced  in  the mitochondria  and  can  therefore,  in  combination  with 

measurements  of  substrate  oxidation  and  mitochondrial  function,  be  interpreted  as  a 

measure  for  (incomplete) ‐oxidation. A  growing number of  studies  reported  a negative 

correlation  between  circulating  and/or  tissue‐associated  acylcarnitines  and  glucose 

tolerance  in  both  animals  [1,61]  and  humans  [62‐65].  Several  even  chain,  FA‐derived 

acylcarnitine  intermediates  were  elevated  in  muscle  of  high‐fat  diet‐fed  rodents,  but 

decreased  after  a  2‐wk  exercise  intervention  that  restored  glucose  tolerance  [60]. 

Furthermore,  in  vitro measurement  of  [14C]‐oleate  catabolism  revealed  disproportionally 

high rates of incomplete relative to complete fat oxidation in isolated muscle mitochondria 

from  high‐fat  diet‐fed  compared  to  lean  rodents  [61].  From  these  studies  it  can  be 

concluded  that an excessive  lipid  load can  lead  to an  increase  in  incomplete ‐oxidation, followed by the accumulation of lipid intermediates (e.g. acylcarnitines). The accumulation 

of  lipid  intermediates  reflects  a  failed  attempt  to  deal  with  the  excess  of  intra‐

mitochondrial acyl‐CoA’s, causing mitochondrial ‘stress’ (Figure 5). The ‘stress’ is suggested 

to induce impairments in mitochondrial function and to activate stress kinases, interfering 

with insulin action [66], both leading to IR. 

 

Chapter 1 

12 

Current status  

Although a  lot of  research has been performed  to  investigate  the  role of skeletal muscle 

mitochondrial dysfunction  in  the development of  IR, still no consensus has been  reached 

about the exact interplay between mitochondrial function, lipotoxicity and IR and/or T2D.  

Aim of the thesis 

The  aim  of  this  thesis  was  to  study  the  timing  and  nature  of  muscle  mitochondrial 

adaptations  during  the  development  of  IR,  by  combining  both  in  vivo  and  in  vitro 

approaches, in order to gain more insight into the etiology of IR and T2D. 

   Figure  5.  Mechanism  of  inhibition  of  glucose  utilization  by  incomplete  fatty  acid  oxidation  as 

described by Koves  et  al.  [1]. High  FA  availability  increases ‐oxidation,  resulting  in  carbon  fluxes through  the ‐oxidation machinery which outpace  the entry of acetyl‐CoA  into  the TCA cycle. This 

results in the accumulation of incompletely oxidized lipid intermediates, which can interfere via PKC with  insulin  signaling  and  glucose  uptake.  CAT,  carnitine  acyltransferase;  CACT,  carnitine‐acylcarnitine  translocase;  the  flash  represents  the generation of  reactive oxygen species  (for other abbreviation see legend Figures 3 and 4).

Introduction 

13 

Measurement of muscle lipids and lipid intermediates 

In  this  thesis,  the  relation  between  IR  and  muscle  lipid  overload  was  studied  by  the 

measurement of IMCL by in vivo 1H MRS and muscle acylcarnitines by in vitro tandem mass 

spectrometry (MS/MS). These measurement procedures are explained in this paragraph. 

IMCL 

As was explained in one of the previous paragraphs, the amount of lipids inside the muscle 

cell,  i.e.  intramyocellular  lipids  (IMCL), are strongly correlated with  the degree of  IR  [22]. 

IMCL is mainly present as liquid droplets in the cytosol of muscle cells. The lipids which are 

present as  subcutaneous or  interstitial adipose  tissue are  referred  to as extramyocellular 

lipids, or EMCL. While EMCL  is metabolically relatively  inert,  there  is substantial evidence 

that  IMCL within  droplets  can  be  rapidly mobilized  and  utilized  for  energy metabolism, 

particularly as they are primarily located immediately adjacent to mitochondria.  

IMCL  levels  have  been  determined  using  a  variety  of  techniques  including  biochemical 

extraction  [22,  67],  Oil  red  O  histochemical  staining  [36,  68]  and  electron  microscopy 

morphometry  [69] of needle biopsy  samples and magnetic  resonance  imaging  (MRI) and 

computed  tomography  (CT)  [70].  Disadvantages  of  these  techniques  are  that  they  are 

invasive or unable to differentiate between IMCL and EMCL or both. Localized 1H MRS has 

proven to be a valuable tool for determining IMCL, because 1H MRS is uniquely capable of 

separately detecting  IMCL  and  EMCL non‐invasively  and without  the use of  any harmful 

radiation [71]. The  IMCL/EMCL peak separation depends on the orientation of the muscle 

with respect to the magnetic field and amounts to a maximum of circa 0.2 ppm when the 

muscle  is parallel  to  the magnetic  field.  In  this  case  the CH2 protons of  IMCL  and  EMCL 

resonate around 1.28 and 1.47 ppm, respectively (Figure 6). This chemical shift difference 

has been shown to originate from bulk magnetic susceptibility (BMS) effects, that are due 

to the layered ordering of EMCL depots along the main muscle axis, while IMCL is organized 

in spherical droplets in the cytosol of the muscle cell [71].  

Figure 6. Localized 1H

 MR spectrum 

measured  in  tibialis  anterior muscle  from a Wistar  rat  fed with a  high‐fat  diet  for  2.5  weeks, showing  peaks  of  total  creatine (tCr),  extramyocellular  lipids (EMCL)  and  intramyocellular  lipids (IMCL). 

 

Chapter 1 

14 

Thus,  1H MRS  based  IMCL measurements  are  very  useful  for  the  determination  of  IMCL 

levels in longitudinal studies in both humans and animal models during the development of 

IR and T2D. 

Acylcarnitines 

The  first step  for  the use of FAs as a substrate  for ATP production  in  the mitochondria  is 

their  transport  into  the  mitochondria.  A  step  required  for  transport  across  the 

mitochondrial membrane  is  the  formation  of  acylcarnitine  esters  from  long‐chain  acyl‐

CoA’s  by  CPT1.  Besides  fulfilling  an  important  role  in mitochondrial  import  of  FAs,  the 

binding  to  carnitine  is also essential  for  the efflux of excess  intra‐mitochondrial acyl‐CoA 

into  the  cytosol,  and  from  the  cytosol  into  the  bloodstream.  Acylcarnitines  represent 

byproducts  of  substrate  catabolism  and  are  formed  from  their  respective  acyl‐CoA 

intermediates  by  a  family  of  carnitine  acyltransferases  that  reside  principally  in  the 

mitochondria. Most even chain species reflect  incomplete FA oxidation, odd chain species 

stem primarily from amino acid catabolism, whereas acetylcarnitine is derived from acetyl‐

CoA, the universal degradation product of all metabolic substrates. 

Blood acylcarnitine profile analysis  is the current standard for the diagnosis of ‐oxidation disorders  at  the  metabolite  level  [72‐73].    Furthermore,  recently  muscle  acylcarnitine 

accumulation was related to IR [1, 66, 74]. The acylcarnitine accumulation as was observed 

in  insulin‐resistant skeletal muscle was suggested  to  reflect a  failed attempt  to deal with 

the  excess  of  intra‐mitochondrial  acyl‐CoA’s,  causing  mitochondrial  stress.  The 

accumulation  of  metabolic  by‐products  (e.g.  acylcarnitines)  would  then  activate  stress 

kinases  or  other  signals,  interfering  with  insulin  action  [66].  However,  how  and  if 

acylcarnitines directly affect  insulin‐mediated glucose uptake  is currently not known. The 

finding  that  carnitine  supplementation  improved  glucose  tolerance  while  increasing 

circulating  acylcarnitines  and  leaving  muscle  acylcarnitines  unaffected  favors  the 

interpretation  that  production  and  efflux  of  these metabolites  is  beneficial  rather  than 

detrimental. However,  the exact physiological  relevance of changes  in muscle, blood and 

urine acylcarnitine  levels  in  IR and as a  result of  carnitine  supplementation  is  still under 

debate.  

By means of tandem MS/MS  it  is possible to analyze 36  independent acylcarnitine species 

ranging  in  size  from  2  to  22  carbons  in  muscle,  blood  and  urine  [75].  Important  for 

analyzing acylcarnitine levels is to consider that steady‐state acylcarnitine concentrations in 

tissues and blood represent the net balance between production, consumption, import and 

export, and therefore do not directly provide  information about  fluxes through  individual 

metabolic pathways. 

Introduction 

15 

Measurement of muscle mitochondrial function 

Data  to  support  the  proposed  role  of  skeletal muscle mitochondrial  dysfunction  in  the 

development of  IR and T2D have been obtained with various  in vitro methods,  including 

measurements  of  oxidative  enzyme  activities  [39,  44,  76‐78],  mRNA  and/or  protein 

expression  of  oxidative  phosphorylation  genes  [42‐43,  78‐80]  as  well  as  mitochondrial 

content,  morphology  and  respiration  [44,  47,  77,  80].  Furthermore,  in  vivo  magnetic 

resonance  spectroscopy  (MRS) measurements  of  basal mitochondrial  ATP  synthesis  flux 

[48‐49, 81] and PCr [11] and ADP [82] recovery kinetics also point towards a potential role 

for mitochondrial dysfunction in the etiology of insulin resistance and/or type 2 diabetes. In 

this  thesis  in vitro high‐resolution  respirometry and  in vivo  31P MRS play a dominant  role 

and therefore these techniques are explained in more detail below. 

High‐resolution respirometry 

Levels of dissolved oxygen in solution can be measured polarographically with a Clark‐type 

oxygen electrode. Clark electrodes have gold or platinum cathodes and silver or silver/silver 

chloride  anodes,  which  are  connected  by  a  salt  bridge  and  covered  by  an  oxygen‐

permeable membrane. As oxygen diffuses across  the membrane,  it  is  reduced by a  fixed 

voltage  between  the  cathode  and  anode which  generates  current  in  proportion  to  the 

concentration  of  oxygen  in  solution.  By  calibrating  the  oxygen  electrode  with  known 

oxygen  concentrations,  it  is  possible  to measure  the  rate  of  oxygen  consumption  in  a 

 

Figure 7. Typical example of time‐dependent changes in oxygen concentration during a high‐resolution 

respiration measurement  on  a  suspension  of  isolated mitochondria,  isolated  from  tibialis  anterior 

muscle of a Wistar rat. The dark line represents the oxygen concentration in the respiratory chamber, 

the  lighter  line represents the slope of the dark  line. First,  isolated mitochondria were  injected  in the 

hermetically closed respiratory chambers (mit). After some time, glucose (gl), hexokinase (hk) and ATP 

were added,  inducing maximal respiration or state 3 respiration. When the oxygen consumption rate 

reached a steady state, state 4 was  induced by adding carboxyatractyloside. Finally, after addition of 

carbonylcyanide‐3‐chlorophenylhydrazone  (CCCP),  the  maximal  oxygen  consumption  rate  in  the 

uncoupled state (state U) was determined.

Chapter 1 

16 

medium containing actively  respiring mitochondria. Since  reduction of oxygen  is a critical 

step in the process of mitochondrial electron transport and ATP synthesis, measurement of 

mitochondrial  oxygen  consumption  provides  a  convenient  way  to  assess mitochondrial 

function  [83]. Oxygen  consumption  can be measured  in permeabilized muscle  fibers and 

isolated mitochondria. The  latter approach has been used  in  the studies described  in this 

thesis.   

Measuring  respiration  in  isolated  mitochondria  practically  means  that  together  with  a 

respiration medium, an aliquot of  suspension with  isolated mitochondria  is added  to  the 

closed metabolic  chamber.  The mitochondria  are  brought  into  defined  “states”  by  the 

sequential  addition  of  substrates  or  inhibitors.  Since  the mitochondria  consume  oxygen, 

the oxygen concentration drops. This change of oxygen concentration  is  recorded by  the 

oxygen sensor in the chamber. From the rate of decline in the oxygen concentration (taking 

into account correction for oxygen diffusion) the respiration rate can be computed for the 

mitochondria  in different states (see Figure 7). State 3, state 4 and state uncoupled (state 

U)  are  frequently  used  to  define  mitochondrial  respiration.  State  3  respiration  is  the 

maximal respiration, reached when saturating levels of ADP are added to the mitochondria 

supplemented with  oxidizible  substrate  and  excess  Pi.  State  4  respiration  is  induced  by 

addition  of  carboxyatractyloside,  which  inhibits  the  exchange  of mitochondrial  ATP  for 

extra‐mitochondrial ADP by adenine nucleotide translocase and this way effectively blocks 

ATP synthesis. The residual oxygen consumption in the absence of ADP phosphorylation is 

attributable  to  proton  leak  across  the  inner  mitochondrial  membrane.  Thus, 

carboxyatractyloside inhibited respiration serves as an indicator of the degree of uncoupled 

respiration  or  proton  leak  under  these  conditions.  The  respiratory  control  ratio  (RCR), 

which is calculated by dividing state 3 by state 4 respiration, indicates the tightness of the 

coupling  between  respiration  and  ADP  phosphorylation.  Stepwise  titration  of  the 

protonophore  carbonylcyanide‐3‐chlorophenylhydrazone  (CCCP)  induces  an  uncoupled 

state by dissipating  the proton gradient across  the  inner mitochondrial membrane  (state 

U).  Under  these  conditions, mitochondrial  oxidative  capacity  can  be  determined  in  the 

absence of the potential control exerted by ATP synthase, adenine nucleotide translocase, 

or phosphate transporters. 

By using different  combinations of oxidizible  substrates  it  is possible  to quantify  specific 

substrate oxidation capacity in isolated mitochondria. Oxidation of TCA cycle intermediates 

such as pyruvate plus malate  leads to  formation of NADH, which can donate electrons to 

ETC  complex  I.  In  turn  oxidation  of  another  TCA  cycle  intermediate  succinate  leads  to 

formation  of  FADH2, which  bypasses  complex  I  and  donates  electrons  to  complex  II.  By 

using fatty acid substrates such as palmitoyl‐L‐carnitine or palmitoyl‐CoA plus L‐carnitine in 

combination with malate one can assess the capacity of ‐oxidation. The measured oxygen 

consumption  rate  is  expressed  per  milligram  mitochondrial  protein  and  is  used  as  a 

measure for the intrinsic mitochondrial function. 

Introduction 

17 

In vivo 31P MRS 

31P MRS  offers  a  non‐invasive  approach  of  recording  concentrations  of  phosphorylated 

metabolites and  intracellular pH.    31P MRS has widely been used  to study skeletal muscle 

metabolism  in  living  mammalian  tissues,  and  is  also  one  of  the  major  types  of 

measurement methods used in this thesis. 31P MR spectra of skeletal muscle typically show 

five major resonances: an inorganic phosphate (Pi) peak, a phosphocreatine (PCr) peak and 

three ATP peaks,  from  the ,  and  phosphate groups of ATP  (Figure 8).  In some cases 

also  peaks  from  phosphomonoesters  (PME)  and  phosphodiesters  (PDE)  are  visible. 

Additionally, metabolic  information can be derived  indirectly from the 31P MR spectra,  i.e. 

the intracellular pH and the free concentration of ADP. Tissue pH can be deduced from the 

chemical  shift of  the Pi peak  [84], which actually originates  from both H2PO4‐ and HPO4

2‐. 

However, as these compounds are  in rapid chemical exchange, a single peak  is observed, 

with  a  chemical  shift  dependent  on  the  ratio  of  the  H2PO4‐  and  HPO4

2‐  concentrations, 

which in this way serves as an indicator of intracellular pH. Free levels of ADP in the cell can 

be calculated indirectly by use of the CK equilibrium (Eq. 1) [85]). The concentration of ADP 

in healthy, resting or moderately active muscle is typically in the tens of micromolar range, 

which  is  too  low  to allow direct detection with  31P MRS. The knowledge of ADP  levels  is 

relevant, because ADP is an important regulator of the mitochondrial ATP synthesis flux.  

 31P MR spectra of resting skeletal muscle are relatively constant, even  in diseased states, 

and to assess impairments in mitochondrial energy production one needs to perturb either 

the chemical or the magnetic equilibrium. Most important 31P MR techniques in studies on 

the  role  of  mitochondrial  function  in  IR  and  T2D,  including  those  in  this  thesis,  are 

saturation transfer (ST) MRS, to measure (resting) creatine kinase and ATP synthesis fluxes, 

and the dynamic measurement of post‐exercise recovery of PCr. 

Figure  8. 31P  MR  spectrum 

measured  in  resting  tibialis anterior  muscle  of  a  Wistar  rat, showing  the  peaks  of  inorganic phosphate  (Pi),  phosphocreatine 

(PCr)  and  the  three  (,    and  ) phosphate groups in ATP. 

 

Chapter 1 

18 

Saturation transfer 

Magnetization  transfer  experiments  allow  to determine  fluxes between  compounds  that 

are in chemical exchange, as long as the system is in a metabolic steady state. One variant 

of  the  magnetization  transfer  technique  relies  on  the  selective  saturation  of  the 

magnetization  of  one  of  the  reactants  with  a  long,  frequency‐selective  RF  pulse,  i.e.  a 

saturation  transfer  (ST) experiment. Due  to  the  chemical exchange of  the  reactants,  this 

results  in  a  decrease  of  magnetization  of  the  exchange  partner. With  equation  3  the 

exchange rate constant kAB between reactants A and can be determined. 

 

1,

, Eq. 3  

 

M’A and M0A are  the magnitudes of magnetization of compound A, when compound B  is 

selectively  saturated and when  compound B  is not  saturated,  respectively. The apparent 

longitudinal  relaxation  time  of  compound  A  (T1A’)  can  be  determined  from  an  inversion 

recovery  experiment  with  saturation  of  B  prior  to  and  during  the  inversion  time.  To 

calculate the flux from compound A to B, kAB has to be multiplied by the concentration of 

compound A. 

One of the chemical exchange processes most‐studied using ST, concerns the flux through 

the creatine kinase (CK) reaction [86]. CK catalyzes a phosphate exchange reaction, in which 

a phosphate moiety  is exchanged between the  position of ATP to PCr and vice versa. As was described earlier  in this chapter, the CK reaction  is of high metabolic relevance, since 

PCr  is  an  important  energy  buffer  for  keeping  ATP  levels  constant.  The  CK  flux  can  be 

determined by complete saturation of  the ‐ATP  resonance and  the quantification of  the reduction  in  the  signal  intensity of PCr. Measurements of CK  flux  in  skeletal muscle as a 

function of workload have shown that CK kinetics is rather insensitive to alterations in ATP 

demand and that CK flux greatly exceeds maximal ATP turnover rates [87‐88]. 

31P ST MRS has also been used to measure the mitochondrial ATP synthesis flux  in rodent 

and human muscle, under resting conditions [48‐50, 89‐92]. Instead of the signal  intensity 

of  PCr,  the magnetization  of  Pi  has  to  be  quantified  to  calculate  the ATP  synthesis  flux. 

Assuming that the muscle ATP synthesis flux, as measured by 31P ST MRS, is predominantly 

reflecting oxidative ATP synthesis by the F1F0‐ATP synthase in the mitochondria, muscle ATP 

synthesis flux has been taken as a measure for mitochondrial function. Studies have shown 

decreased  resting ATP synthesis  fluxes  in skeletal muscle of  insulin‐resistant subjects and 

insulin‐resistant animal models. 

Introduction 

19 

However, the interpretation of 31P ST MRS data, particularly at rest, is not straightforward. 

The  lower ATP  synthesis  flux  in  resting muscle of  insulin‐resistant  subjects  could actually 

reflect a normal  regulatory  response  to a  lower energy demand, e.g. caused by  impaired 

insulin signaling, rather than an impairment of intrinsic mitochondrial function [55‐56, 93]. 

In order to  interpret the ST data  in terms of mitochondrial function  it  is necessary to take 

the error signals,  i.e. the concentrations of ADP and Pi,  into account. Moreover, the Pi  

ATP fluxes obtained from 31P ST measurements are comprised of both mitochondrial F1F0‐

ATP synthesis  flux and  flux  through other Pi  ATP pathways,  in particular  the  reactions 

catalyzed by  the glycolytic enzymes glyceraldehyde‐3‐phosphate dehydrogenase  (GAPDH) 

and phosphoglycerate kinase (PGK) [88, 92, 94‐95]. Although the net glycolytic contribution 

to the production of ATP (via GAPDH and PGK) versus that of oxidative phosphorylation  is 

small [96], these enzymes catalyze a coupled near‐equilibrium reaction, and consequently, 

exchange  between  Pi  and  ATP  may  greatly  exceed  the  net  glycolytic  flux  [92].  The 

interpretation  of  resting  ATP  synthesis  flux  as  a measure  for mitochondrial  function  is 

therefore relatively complicated. In order to create better conditions for detecting a defect 

in mitochondrial oxidative phosphorylation,  the ST experiment would need  to be done  in 

exercising muscle [88]. 

Post‐exercise PCr recovery 31P MRS  provides  the  opportunity  of  acquiring  data  during  skeletal muscle  exercise  and 

recovery  in a non‐invasive manner and with a time resolution of seconds. Figure 9 shows 

the concentrations of PCr, Pi and ATP derived from a time series of 31P MR spectra acquired 

during  rest,  exercise  and  subsequent  recovery  in  rat  tibialis  anterior  (TA) muscle. When 

muscle contraction starts, an  immediate decrease  in PCr concentration and  increase  in Pi 

concentration can be observed (Figure 9), whereas ATP remains constant, although ATP  is 

used  for  the muscle  contractions.  After  the muscle  contractions  stop,  the  PCr  buffer  is 

restored  and  Pi  levels  normalize.  The  ATP  used  for  resynthesis  of  PCr  is  originating 

predominantly from oxidative phosphorylation in the mitochondria [97‐98]. Because the CK 

reaction  is much  faster  than  the ATP  synthase  reaction  [87‐88],  the  rate of PCr  recovery 

mirrors  the  rate  of  oxidative  ATP  synthesis  and  therefore  the  oxidative  capacity  of  the 

mitochondria. A short PCr recovery time constant, corresponding to a fast recovery, reflects 

a  high  oxidative  capacity, while  slow  recovery  kinetics may  indicate  impaired  oxidative 

capacity.  PCr  recovery  is  determined  by  mitochondrial  content,  intrinsic  mitochondrial 

function and other  factors  like the supply of oxygen and substrates  [99‐100]. This  implies 

that additional  (in vitro) measurements are necessary  to  identify  the origin of changes  in 

oxidative capacity measured with PCr recovery. 

One of the first who proved that PCr recovery kinetics provides information about oxidative 

ATP  synthesis  was  Mahler  et  al.,  who  reported  that  post‐exercise  PCr  resynthesis  is 

inversely  proportional  to  the  rate  of  oxygen  consumption  [101].  This  finding  was 

Chapter 1 

20 

strengthened  by  the  observation  that  the  PCr  concentration  does  not  restore  during 

ischemic  recovery  [97‐98].  Furthermore,  the  correlations  of  post‐exercise  PCr  recovery 

kinetics with  citrate  synthase  activity  [102],  succinate  dehydrogenase  activity  and  peak 

oxygen  consumption  (VO2peak)  [103]  are  additional  findings  demonstrating  that  post‐

exercise PCr resynthesis changes reflects aerobic metabolism. 

An important complication in interpreting post‐exercise PCr recovery data is that strenuous 

exercise‐induced  acidosis  negatively  affects  PCr  resynthesis  [104‐114].  Therefore  it  has 

been  recommended  to avoid  low end‐exercise pH  values, which  is difficult  to achieve  in 

combination with a significant PCr depletion. Other strategies to deal with the acidification 

problem  is  to  aim  at  similar  end‐exercise  pH  values within  different  groups  or  applying 

general correction factors for the influence of pH [106, 109, 111].  

Several  MR  compatible  exercise  set‐ups  have  been  built  for  humans,  most  often  for 

voluntary  arm  or  leg  exercise.  In  anaesthetized  animals, muscle  contractions  are usually 

induced by electrical stimulation. As an alternative to the invasive, direct nerve‐stimulation 

method,  a minimally  invasive  electrical  stimulation method  was  developed  that  allows 

longitudinal studies in rats [115]. By subcutaneously implanting electrodes along the nerve 

trajectory of  the N. Peroneus Communis, highly specific dorsal  flexor muscle contractions 

can be induced. This procedure was also used in the present thesis. 

 

Figure 9. Peak concentrations of phosphocreatine (black), inorganic phosphate (light gray) and ATP (dark gray), as measured using 

31P MRS during a 3‐min rest, 2‐min electrical stimulation and 10‐min recovery 

protocol in rat tibialis anterior muscle. Time resolution was 20 seconds. 

 

Introduction 

21 

Outline of this thesis 

Although a  lot of  research has been performed  to  investigate  the  role of skeletal muscle 

mitochondrial function and lipid accumulation in the development of IR, still no consensus 

is reached about the exact mechanism(s) leading to IR. The aim of this thesis was to study 

the timing and nature of muscle mitochondrial adaptations during the development of  IR, 

by using both in vivo and in vitro measurement techniques. 31P MRS plays an important role 

in  these studies. The  first part of  this  thesis deals with methodological aspects of  the  31P 

MRS techniques, whereas the second part describes research on mitochondrial adaptations 

in both patients with T2D and animal models of IR. 

Both  31P MRS PCr  recovery  after muscle  contraction  and  resting ATP  synthesis  flux have 

been  used  to  determine mitochondrial  function  in  vivo.  However  these methods  have 

provided ambiguous  results. Therefore, PCr  recovery and  resting ATP  synthesis  flux were 

compared  in a rat model of known mitochondrial dysfunction  in order  to establish which 

method  is most  appropriate  to  assess  in  vivo  skeletal muscle mitochondrial  function  in 

chapter 2. Mitochondrial dysfunction was  induced in rats by daily subcutaneous injections 

with diphenyleneiodonium  (DPI), which  irreversibly  inhibits  complex  I  (NADH‐ubiquinone 

reductase) of the respiratory chain. 31P MRS PCr recovery after exercise is applied in every 

chapter of this thesis as a measure for in vivo muscle oxidative capacity. However, cytosolic 

pH  has  a  strong  influence  on  the  kinetics  of  PCr  recovery  and  thereby  complicates  the 

interpretation  of  PCr  recovery  data.  It  has  been  suggested  that  PCr  recovery  should  be 

normalized for end‐exercise pH. However a general correction can only be applied if there 

are  no  intersubject  differences  in  the  pH  dependence  of  PCr  recovery.  In  chapter  3 we 

investigated  the  pH  dependence  of  PCr  recovery  on  a  subject‐by‐subject  basis  in  vastus 

lateralis muscle of healthy humans. Furthermore, we determined the relation between the 

pH dependence of PCr recovery and the kinetics of proton efflux at the start of recovery.  

To get more insight  in the role of muscle mitochondrial dysfunction and  lipotoxicity  in the 

etiology of  IR and T2D, we performed  three studies  in which we determined muscle  lipid 

content and mitochondrial function.  In a cross‐sectional study, described  in chapter 4, we 

examined  in  vivo  skeletal muscle mitochondrial  function  in early and advanced  stages of 

T2D  in  human  subjects.  Long‐standing,  insulin‐treated  type  2  diabetes  patients,  subjects 

with impaired fasting glucose, impaired glucose tolerance and/or recently diagnosed type 2 

diabetes, and healthy, normoglycaemic  controls, matched  for age and body  composition 

and with low habitual physical activity levels were studied. In vivo mitochondrial function of 

the vastus lateralis muscle was evaluated from post‐exercise PCr recovery kinetics using 31P 

MRS. IMCL content was assessed in the same muscle using single‐voxel 1H MRS. Chapter 5 

describes a longitudinal study with the aim to gain more insight into the timing and nature 

of mitochondrial adaptations during the development of high‐fat diet‐induced  IR  in a well 

known rodent model of IR. Adult Wistar rats were fed a high‐fat diet or normal chow for 2.5 

and 25 wk. IMCL was measured with in vivo 1H MRS and acylcarnitine levels were quantified 

Chapter 1 

22 

in vitro using tandem MS/MS. Muscle oxidative capacity was assessed in TA muscle in vivo 

using 31P MRS PCr recovery and in vitro by measuring mitochondrial DNA copy number and 

oxygen  consumption  in  isolated  mitochondria.  Currently,  it  is  not  clear  whether 

mitochondrial dysfunction is (1) a cause of  lipid accumulation due to a decreased capacity 

to oxidize FAs or (2) a consequence of the accumulation of lipid intermediates as a result of 

increased  incomplete  FA  oxidation.  Carnitine  is  known  to  stimulate  FA  oxidation  and 

export.  The  aim  of  the  study  described  in  chapter  6  was  to  test  the  hypothesis  that 

carnitine  supplementation  reduces  high‐fat  diet‐induced  lipotoxicity,  improves  in  vivo 

muscle mitochondrial  function  and  ameliorates  insulin  resistance. Wistar  rats were  fed 

either normal chow or a high‐fat diet for 15 wk and one group of high‐fat diet fed rats was 

supplemented with  L‐carnitine  during  the  last  8 wk. Muscle mitochondrial  function was 

measured  in vivo by  31P MRS  (PCr  recovery and  resting ATP synthase and creatine kinase 

fluxes) and in vitro by high‐resolution respirometry. Muscle lipid levels were determined by 1H MRS (IMCL) and tandem mass spectrometry (acylcarnitines). 

Chapter 7 provides  a  summary with  the main outcomes of  the  studies described  in  this 

thesis.  The  results  are  compared  to  the  current  hypotheses  and  future  perspectives  for 

research in the field of muscle mitochondrial function in relation to the development of IR 

are discussed. 

 

Introduction 

23 

References 1.  Koves, T.R., J.R. Ussher, R.C. Noland, D. Slentz, M. Mosedale, O. Ilkayeva, J. Bain, R. Stevens, J.R. Dyck, 

C.B.  Newgard,  G.D.  Lopaschuk,  and  D.M. Muoio. Mitochondrial  overload  and  incomplete  fatty  acid oxidation contribute to skeletal muscle insulin resistance. Cell Metab, 2008. 7(1): 45‐56. 

2.  Randle, P.J., P.B. Garland, C.N. Hales, and E.A. Newsholme. The glucose fatty‐acid cycle. Its role in insulin sensitivity and the metabolic disturbances of diabetes mellitus. Lancet, 1963. 1(7285): 785‐9. 

3.  Shulman, G.I. Cellular mechanisms of insulin resistance. J Clin Invest, 2000. 106(2): 171‐6. 4.  Wild, S., G. Roglic, A. Green, R. Sicree, and H. King. Global prevalence of diabetes: estimates for the year 

2000 and projections for 2030. Diabetes Care, 2004. 27(5): 1047‐53. 5.  Goodpaster, B.H. and D.E. Kelley. Skeletal muscle  triglyceride: marker or mediator of obesity‐induced 

insulin resistance in type 2 diabetes mellitus? Curr Diab Rep, 2002. 2(3): 216‐22. 6.  DeFronzo, R.A., R. Gunnarsson, O. Bjorkman, M. Olsson, and J. Wahren. Effects of  insulin on peripheral 

and  splanchnic  glucose metabolism  in  noninsulin‐dependent  (type  II)  diabetes mellitus.  J  Clin  Invest, 1985. 76(1): 149‐55. 

7.  Weickert, M.O. and A.F. Pfeiffer. Signalling mechanisms  linking hepatic glucose and  lipid metabolism. Diabetologia, 2006. 49(8): 1732‐41. 

8.  Rabol, R., R. Boushel, and F. Dela. Mitochondrial oxidative  function and  type 2 diabetes. Appl Physiol Nutr Metab, 2006. 31(6): 675‐83. 

9.  Morino, K., K.F. Petersen, and G.I. Shulman. Molecular mechanisms of insulin resistance in humans and their potential links with mitochondrial dysfunction. Diabetes, 2006. 55 Suppl 2: S9‐S15. 

10.  Sreekumar, R. and K.S. Nair. Skeletal muscle mitochondrial dysfunction & diabetes.  Indian  J Med Res, 2007. 125(3): 399‐410. 

11.  Schrauwen‐Hinderling,  V.B.,  M.  Roden,  M.E.  Kooi,  M.K.  Hesselink,  and  P.  Schrauwen.  Muscular mitochondrial dysfunction and  type 2 diabetes mellitus. Curr Opin Clin Nutr Metab Care, 2007. 10(6): 698‐703. 

12.  Szendroedi, J. and M. Roden. Mitochondrial fitness and insulin sensitivity in humans. Diabetologia, 2008. 51(12): 2155‐67. 

13.  Holloszy, J.O. Skeletal muscle "mitochondrial deficiency" does not mediate  insulin resistance. Am J Clin Nutr, 2009. 89(1): 463S‐6S. 

14.  Guyton,  A.C.  and  J.E.  Hall,  Textbook  of  Medical  Physiology  10th  ed.  2000,  Philadelphia:  Saunders company. 

15.  Kraegen, E.W. and G.J. Cooney. Free fatty acids and skeletal muscle insulin resistance. Curr Opin Lipidol, 2008. 19(3): 235‐41. 

16.  Randle, P.J. Regulatory interactions between lipids and carbohydrates: the glucose fatty acid cycle after 35 years. Diabetes Metab Rev, 1998. 14(4): 263‐83. 

17.  Boden, G., X. Chen,  J. Ruiz,  J.V. White, and L. Rossetti. Mechanisms of  fatty acid‐induced  inhibition of glucose uptake. J Clin Invest, 1994. 93(6): 2438‐46. 

18.  Walker, M., G.R. Fulcher, C. Catalano, G. Petranyi, H. Orskov, and K.G. Alberti. Physiological  levels of plasma non‐esterified  fatty acids  impair  forearm glucose uptake  in normal man. Clin Sci  (Lond), 1990. 79(2): 167‐74. 

19.  Nuutila, P., V.A. Koivisto, J. Knuuti, U. Ruotsalainen, M. Teras, M. Haaparanta, J. Bergman, O. Solin, L.M. Voipio‐Pulkki, U. Wegelius, and et al. Glucose‐free fatty acid cycle operates in human heart and skeletal muscle in vivo. J Clin Invest, 1992. 89(6): 1767‐74. 

20.  Santomauro, A.T., G. Boden, M.E. Silva, D.M. Rocha, R.F. Santos, M.J. Ursich, P.G. Strassmann, and B.L. Wajchenberg.  Overnight  lowering  of  free  fatty  acids  with  Acipimox  improves  insulin  resistance  and glucose tolerance in obese diabetic and nondiabetic subjects. Diabetes, 1999. 48(9): 1836‐41. 

21.  Boden, G., B. Lebed, M. Schatz, C. Homko, and S. Lemieux. Effects of acute changes of plasma free fatty acids on  intramyocellular  fat content and  insulin  resistance  in healthy subjects. Diabetes, 2001. 50(7): 1612‐7. 

22.  Pan, D.A., S. Lillioja, A.D. Kriketos, M.R. Milner, L.A. Baur, C. Bogardus, A.B.  Jenkins, and L.H. Storlien. Skeletal muscle triglyceride levels are inversely related to insulin action. Diabetes, 1997. 46(6): 983‐8. 

23.  Krssak, M.,  K.  Falk  Petersen,  A.  Dresner,  L.  DiPietro,  S.M.  Vogel,  D.L.  Rothman, M.  Roden,  and  G.I. Shulman.  Intramyocellular  lipid  concentrations are  correlated with  insulin  sensitivity  in humans: a 1H NMR spectroscopy study. Diabetologia, 1999. 42(1): 113‐6. 

24.  Garland,  P.B.,  P.J.  Randle,  and  E.A.  Newsholme.  Citrate  as  an  Intermediary  in  the  Inhibition  of Phosphofructokinase  in  Rat  Heart  Muscle  by  Fatty  Acids,  Ketone  Bodies,  Pyruvate,  Diabetes,  and Starvation. Nature, 1963. 200: 169‐70. 

25.  Petersen, K.F. and G.I. Shulman. New insights into the pathogenesis of insulin resistance in humans using magnetic resonance spectroscopy. Obesity (Silver Spring), 2006. 14 Suppl 1: 34S‐40S. 

Chapter 1 

24 

26.  Boden, G., F. Jadali, J. White, Y. Liang, M. Mozzoli, X. Chen, E. Coleman, and C. Smith. Effects of fat on insulin‐stimulated carbohydrate metabolism in normal men. J Clin Invest, 1991. 88(3): 960‐6. 

27.  Dresner, A., D. Laurent, M. Marcucci, M.E. Griffin, S. Dufour, G.W. Cline, L.A. Slezak, D.K. Andersen, R.S. Hundal, D.L. Rothman, K.F. Petersen, and G.I. Shulman. Effects of free fatty acids on glucose transport and IRS‐1‐associated phosphatidylinositol 3‐kinase activity. J Clin Invest, 1999. 103(2): 253‐9. 

28.  Yu,  C.,  Y.  Chen,  G.W.  Cline,  D.  Zhang,  H.  Zong,  Y. Wang,  R.  Bergeron,  J.K.  Kim,  S.W.  Cushman,  G.J. Cooney,  B. Atcheson, M.F. White,  E.W.  Kraegen,  and G.I.  Shulman. Mechanism  by which  fatty  acids inhibit  insulin activation of  insulin receptor substrate‐1  (IRS‐1)‐associated phosphatidylinositol 3‐kinase activity in muscle. J Biol Chem, 2002. 277(52): 50230‐6. 

29.  Holland, W.L.,  J.T. Brozinick, L.P. Wang, E.D. Hawkins, K.M. Sargent, Y.  Liu, K. Narra, K.L. Hoehn, T.A. Knotts,  A.  Siesky,  D.H.  Nelson,  S.K.  Karathanasis,  G.K.  Fontenot, M.J.  Birnbaum,  and  S.A.  Summers. Inhibition of ceramide synthesis ameliorates glucocorticoid‐, saturated‐fat‐, and obesity‐induced  insulin resistance. Cell Metab, 2007. 5(3): 167‐79. 

30.  Dobbins, R.L., L.S. Szczepaniak, B. Bentley, V. Esser, J. Myhill, and J.D. McGarry. Prolonged  inhibition of muscle  carnitine  palmitoyltransferase‐1  promotes  intramyocellular  lipid  accumulation  and  insulin resistance in rats. Diabetes, 2001. 50(1): 123‐30. 

31.  Kuhlmann,  J., C. Neumann‐Haefelin, U. Belz,  J. Kalisch, H.P.  Juretschke, M.  Stein, E. Kleinschmidt, W. Kramer,  and  A.W.  Herling.  Intramyocellular  lipid  and  insulin  resistance:  a  longitudinal  in  vivo  1H‐spectroscopic study in Zucker diabetic fatty rats. Diabetes, 2003. 52(1): 138‐44. 

32.  Perseghin, G., P. Scifo, F. De Cobelli, E. Pagliato, A. Battezzati, C. Arcelloni, A. Vanzulli, G. Testolin, G. Pozza, A. Del Maschio, and L. Luzi. Intramyocellular triglyceride content is a determinant of in vivo insulin resistance  in humans: a  1H‐13C nuclear magnetic  resonance  spectroscopy assessment  in offspring of type 2 diabetic parents. Diabetes, 1999. 48(8): 1600‐6. 

33.  Szczepaniak, L.S., E.E. Babcock, F. Schick, R.L. Dobbins, A. Garg, D.K. Burns, J.D. McGarry, and D.T. Stein. Measurement  of  intracellular  triglyceride  stores  by  H  spectroscopy:  validation  in  vivo.  Am  J  Physiol, 1999. 276(5 Pt 1): E977‐89. 

34.  Hulver, M.W., J.R. Berggren, R.N. Cortright, R.W. Dudek, R.P. Thompson, W.J. Pories, K.G. MacDonald, G.W. Cline, G.I. Shulman, G.L. Dohm, and J.A. Houmard. Skeletal muscle  lipid metabolism with obesity. Am J Physiol Endocrinol Metab, 2003. 284(4): E741‐7. 

35.  van  Loon,  L.J.  and B.H. Goodpaster.  Increased  intramuscular  lipid  storage  in  the  insulin‐resistant and endurance‐trained state. Pflugers Arch, 2006. 451(5): 606‐16. 

36.  Goodpaster, B.H., J. He, S. Watkins, and D.E. Kelley. Skeletal muscle lipid content and insulin resistance: evidence for a paradox in endurance‐trained athletes. J Clin Endocrinol Metab, 2001. 86(12): 5755‐61. 

37.  van  Loon,  L.J., R. Koopman, R. Manders, W.  van der Weegen, G.P.  van Kranenburg, and H.A. Keizer. Intramyocellular lipid content in type 2 diabetes patients compared with overweight sedentary men and highly trained endurance athletes. Am J Physiol Endocrinol Metab, 2004. 287(3): E558‐65. 

38.  van Loon, L.J., R. Koopman, J.H. Stegen, A.J. Wagenmakers, H.A. Keizer, and W.H. Saris. Intramyocellular lipids form an important substrate source during moderate intensity exercise in endurance‐trained males in a fasted state. J Physiol, 2003. 553(Pt 2): 611‐25. 

39.  He, J., S. Watkins, and D.E. Kelley. Skeletal muscle lipid content and oxidative enzyme activity in relation to muscle fiber type in type 2 diabetes and obesity. Diabetes, 2001. 50(4): 817‐23. 

40.  Savage,  D.B.,  K.F.  Petersen,  and  G.I.  Shulman.  Disordered  lipid metabolism  and  the  pathogenesis  of insulin resistance. Physiol Rev, 2007. 87(2): 507‐20. 

41.  Simoneau, J.A., J.H. Veerkamp, L.P. Turcotte, and D.E. Kelley. Markers of capacity to utilize fatty acids in human  skeletal muscle:  relation  to  insulin  resistance and obesity and effects of weight  loss.  FASEB  J, 1999. 13(14): 2051‐60. 

42.  Mootha, V.K., C.M. Lindgren, K.F. Eriksson, A. Subramanian, S. Sihag, J. Lehar, P. Puigserver, E. Carlsson, M. Ridderstrale, E. Laurila, N. Houstis, M.J. Daly, N. Patterson,  J.P. Mesirov, T.R. Golub, P. Tamayo, B. Spiegelman,  E.S.  Lander,  J.N. Hirschhorn, D.  Altshuler,  and  L.C. Groop.  PGC‐1alpha‐responsive  genes involved  in oxidative phosphorylation are  coordinately downregulated  in human diabetes. Nat Genet, 2003. 34(3): 267‐73. 

43.  Patti, M.E., A.J. Butte, S. Crunkhorn, K. Cusi, R. Berria, S. Kashyap, Y. Miyazaki, I. Kohane, M. Costello, R. Saccone, E.J. Landaker, A.B. Goldfine, E. Mun, R. DeFronzo, J. Finlayson, C.R. Kahn, and L.J. Mandarino. Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: Potential role of PGC1 and NRF1. Proc Natl Acad Sci U S A, 2003. 100(14): 8466‐71. 

44.  Ritov,  V.B.,  E.V.  Menshikova,  J.  He,  R.E.  Ferrell,  B.H.  Goodpaster,  and  D.E.  Kelley.  Deficiency  of subsarcolemmal mitochondria in obesity and type 2 diabetes. Diabetes, 2005. 54(1): 8‐14. 

45.  Kelley, D.E., B.H. Goodpaster, and L. Storlien. Muscle triglyceride and insulin resistance. Annu Rev Nutr, 2002. 22: 325‐46. 

Introduction 

25 

46.  Phielix, E., V.B. Schrauwen‐Hinderling, M. Mensink, E. Lenaers, R. Meex, J. Hoeks, M.E. Kooi, E. Moonen‐Kornips,  J.P.  Sels, M.K.  Hesselink,  and  P.  Schrauwen.  Lower  intrinsic  ADP‐stimulated  mitochondrial respiration  underlies  in  vivo  mitochondrial  dysfunction  in  muscle  of  male  type  2  diabetic  patients. Diabetes, 2008. 57(11): 2943‐9. 

47.  Mogensen,  M.,  K.  Sahlin,  M.  Fernstrom,  D.  Glintborg,  B.F.  Vind,  H.  Beck‐Nielsen,  and  K.  Hojlund. Mitochondrial  respiration  is  decreased  in  skeletal muscle  of  patients with  type  2  diabetes. Diabetes, 2007. 56(6): 1592‐9. 

48.  Petersen, K.F., S. Dufour, D. Befroy, R. Garcia, and G.I. Shulman.  Impaired mitochondrial activity  in the insulin‐resistant offspring of patients with type 2 diabetes. N Engl J Med, 2004. 350(7): 664‐71. 

49.  Petersen, K.F., D. Befroy, S. Dufour, J. Dziura, C. Ariyan, D.L. Rothman, L. DiPietro, G.W. Cline, and G.I. Shulman. Mitochondrial  dysfunction  in  the  elderly:  possible  role  in  insulin  resistance.  Science,  2003. 300(5622): 1140‐2. 

50.  Petersen, K.F., S. Dufour, and G.I. Shulman. Decreased  insulin‐stimulated ATP synthesis and phosphate transport in muscle of insulin‐resistant offspring of type 2 diabetic parents. PLoS Med, 2005. 2(9): e233. 

51.  Schrauwen‐Hinderling, V.B., M.E. Kooi, M.K. Hesselink, J.A. Jeneson, W.H. Backes, C.J. van Echteld, J.M. van Engelshoven, M. Mensink, and P. Schrauwen.  Impaired  in vivo mitochondrial  function but  similar intramyocellular  lipid  content  in  patients  with  type  2  diabetes  mellitus  and  BMI‐matched  control subjects. Diabetologia, 2007. 50(1): 113‐20. 

52.  De Feyter, H.M., N.M. van den Broek, S.F. Praet, K. Nicolay, L.J. van Loon, and  J.J. Prompers. Early or advanced stage type 2 diabetes is not accompanied by in vivo skeletal muscle mitochondrial dysfunction. Eur J Endocrinol, 2008. 158(5): 643‐53. 

53.  Boushel, R., E. Gnaiger, P. Schjerling, M. Skovbro, R. Kraunsoe, and F. Dela. Patients with type 2 diabetes have normal mitochondrial function in skeletal muscle. Diabetologia, 2007. 50(4): 790‐6. 

54.  Hawley, J.A. and S.J. Lessard. Mitochondrial function: use it or lose it. Diabetologia, 2007. 50(4): 699‐702. 55.  Short, K.R., K.S. Nair, and C.S. Stump.  Impaired mitochondrial activity and  insulin‐resistant offspring of 

patients with type 2 diabetes. N Engl J Med, 2004. 350(23): 2419‐21; author reply 2419‐21. 56.  Wagenmakers, A.J. Insulin resistance  in the offspring of parents with type 2 diabetes. PLoS Med, 2005. 

2(9): e289. 57.  Brehm, A., M. Krssak, A.I. Schmid, P. Nowotny, W. Waldhausl, and M. Roden. Increased lipid availability 

impairs insulin‐stimulated ATP synthesis in human skeletal muscle. Diabetes, 2006. 55(1): 136‐40. 58.  Sreekumar, R., P. Halvatsiotis, J.C. Schimke, and K.S. Nair. Gene expression profile  in skeletal muscle of 

type 2 diabetes and the effect of insulin treatment. Diabetes, 2002. 51(6): 1913‐20. 59.  Asmann, Y.W., C.S. Stump, K.R. Short, J.M. Coenen‐Schimke, Z. Guo, M.L. Bigelow, and K.S. Nair. Skeletal 

muscle mitochondrial functions, mitochondrial DNA copy numbers, and gene transcript profiles in type 2 diabetic and nondiabetic subjects at equal levels of low or high insulin and euglycemia. Diabetes, 2006. 55(12): 3309‐19. 

60.  Koves, T.R., P. Li,  J. An, T. Akimoto, D. Slentz, O.  Ilkayeva, G.L. Dohm, Z. Yan, C.B. Newgard, and D.M. Muoio.  Peroxisome  proliferator‐activated  receptor‐gamma  co‐activator  1alpha‐mediated  metabolic remodeling  of  skeletal  myocytes  mimics  exercise  training  and  reverses  lipid‐induced  mitochondrial inefficiency. J Biol Chem, 2005. 280(39): 33588‐98. 

61.  Noland, R.C., T.R. Koves, S.E. Seiler, H. Lum, R.M. Lust, O. Ilkayeva, R.D. Stevens, F.G. Hegardt, and D.M. Muoio.  Carnitine  insufficiency  caused  by  aging  and  overnutrition  compromises  mitochondrial performance and metabolic control. J Biol Chem, 2009. 284(34): 22840‐52. 

62.  Adams, S.H., C.L. Hoppel, K.H. Lok, L. Zhao, S.W. Wong, P.E. Minkler, D.H. Hwang,  J.W. Newman, and W.T. Garvey. Plasma acylcarnitine profiles suggest  incomplete  long‐chain fatty acid beta‐oxidation and altered tricarboxylic acid cycle activity in type 2 diabetic African‐American women. J Nutr, 2009. 139(6): 1073‐81. 

63.  Huffman,  K.M.,  S.H.  Shah,  R.D.  Stevens,  J.R.  Bain,  M.  Muehlbauer,  C.A.  Slentz,  C.J.  Tanner,  M. Kuchibhatla, J.A. Houmard, C.B. Newgard, and W.E. Kraus. Relationships between circulating metabolic intermediates and insulin action in overweight to obese, inactive men and women. Diabetes Care, 2009. 32(9): 1678‐83. 

64.  Lien, L.F., A.M. Haqq, M. Arlotto, C.A. Slentz, M.J. Muehlbauer, R.L. McMahon, J. Rochon, D. Gallup, J.R. Bain, O.  Ilkayeva, B.R. Wenner, R.D. Stevens, D.S. Millington, D.M. Muoio, M.D. Butler, C.B. Newgard, and L.P. Svetkey. The STEDMAN project: biophysical, biochemical and metabolic effects of a behavioral weight loss intervention during weight loss, maintenance, and regain. OMICS, 2009. 13(1): 21‐35. 

65.  Newgard,  C.B.,  J.  An,  J.R.  Bain, M.J. Muehlbauer,  R.D.  Stevens,  L.F.  Lien,  A.M.  Haqq,  S.H.  Shah, M. Arlotto,  C.A.  Slentz,  J.  Rochon, D. Gallup, O.  Ilkayeva,  B.R. Wenner, W.S.  Yancy,  Jr., H.  Eisenson, G. Musante,  R.S.  Surwit,  D.S. Millington, M.D.  Butler,  and  L.P.  Svetkey.  A  branched‐chain  amino  acid‐related  metabolic  signature  that  differentiates  obese  and  lean  humans  and  contributes  to  insulin resistance. Cell Metab, 2009. 9(4): 311‐26. 

Chapter 1 

26 

66.  Muoio, D.M.  and  T.R.  Koves.  Lipid‐induced metabolic  dysfunction  in  skeletal muscle. Novartis  Found Symp, 2007. 286: 24‐38; discussion 38‐46, 162‐3, 196‐203. 

67.  Guo, Z., P. Mishra, and S. Macura. Sampling  the  intramyocellular  triglycerides  from  skeletal muscle.  J Lipid Res, 2001. 42(7): 1041‐8. 

68.  Koopman, R., G.  Schaart, and M.K. Hesselink. Optimisation of oil  red O  staining permits  combination with immunofluorescence and automated quantification of lipids. Histochem Cell Biol, 2001. 116(1): 63‐8. 

69.  Levin, K., H. Daa Schroeder, F.P. Alford, and H. Beck‐Nielsen. Morphometric documentation of abnormal intramyocellular fat storage and reduced glycogen in obese patients with Type II diabetes. Diabetologia, 2001. 44(7): 824‐33. 

70.  Goodpaster, B.H., D.E. Kelley, F.L. Thaete, J. He, and R. Ross. Skeletal muscle attenuation determined by computed tomography is associated with skeletal muscle lipid content. J Appl Physiol, 2000. 89(1): 104‐10. 

71.  Boesch, C. and R. Kreis. Dipolar coupling and ordering effects observed in magnetic resonance spectra of skeletal muscle. NMR Biomed, 2001. 14(2): 140‐8. 

72.  Bartlett, K., S.J. Eaton, and M. Pourfarzam. New developments in neonatal screening. Arch Dis Child Fetal Neonatal Ed, 1997. 77(2): F151‐4. 

73.  Bartlett, K. and M. Pourfarzam. Tandem mass  spectrometry‐‐the potential.  J  Inherit Metab Dis, 1999. 22(4): 568‐71. 

74.  An,  J.,  D.M.  Muoio,  M.  Shiota,  Y.  Fujimoto,  G.W.  Cline,  G.I.  Shulman,  T.R.  Koves,  R.  Stevens,  D. Millington, and C.B. Newgard. Hepatic expression of malonyl‐CoA decarboxylase  reverses muscle,  liver and whole‐animal insulin resistance. Nat Med, 2004. 10(3): 268‐74. 

75.  van Vlies, N.,  L.  Tian, H. Overmars, A.H. Bootsma, W. Kulik, R.J. Wanders, P.A. Wood,  and  F.M. Vaz. Characterization  of  carnitine  and  fatty  acid metabolism  in  the  long‐chain  acyl‐CoA  dehydrogenase‐deficient mouse. Biochem J, 2005. 387(Pt 1): 185‐93. 

76.  Simoneau, J.A. and D.E. Kelley. Altered glycolytic and oxidative capacities of skeletal muscle contribute to insulin resistance in NIDDM. J Appl Physiol, 1997. 83(1): 166‐71. 

77.  Kelley,  D.E.,  J.  He,  E.V. Menshikova,  and  V.B.  Ritov.  Dysfunction  of mitochondria  in  human  skeletal muscle in type 2 diabetes. Diabetes, 2002. 51(10): 2944‐50. 

78.  Heilbronn,  L.K.,  S.K.  Gan,  N.  Turner,  L.V.  Campbell,  and  D.J.  Chisholm.  Markers  of  mitochondrial biogenesis  and  metabolism  are  lower  in  overweight  and  obese  insulin‐resistant  subjects.  J  Clin Endocrinol Metab, 2007. 92(4): 1467‐73. 

79.  Hojlund,  K.,  K. Wrzesinski,  P.M.  Larsen,  S.J.  Fey,  P.  Roepstorff,  A.  Handberg,  F.  Dela,  J.  Vinten,  J.G. McCormack, C. Reynet, and H. Beck‐Nielsen. Proteome analysis reveals phosphorylation of ATP synthase beta ‐subunit in human skeletal muscle and proteins with potential roles in type 2 diabetes. J Biol Chem, 2003. 278(12): 10436‐42. 

80.  Morino, K., K.F. Petersen, S. Dufour, D. Befroy, J. Frattini, N. Shatzkes, S. Neschen, M.F. White, S. Bilz, S. Sono,  M.  Pypaert,  and  G.I.  Shulman.  Reduced  mitochondrial  density  and  increased  IRS‐1  serine phosphorylation  in muscle of  insulin‐resistant offspring of  type 2 diabetic parents.  J Clin  Invest, 2005. 115(12): 3587‐93. 

81.  Szendroedi,  J.,  A.I.  Schmid, M.  Chmelik,  C.  Toth,  A.  Brehm, M.  Krssak,  P.  Nowotny, M. Wolzt, W. Waldhausl, and M. Roden. Muscle mitochondrial ATP synthesis and glucose transport/phosphorylation in type 2 diabetes. PLoS Med, 2007. 4(5): e154. 

82.  Sirikul,  B.,  B.A.  Gower,  G.R.  Hunter,  D.E.  Larson‐Meyer,  and  B.R.  Newcomer.  Relationship  between insulin sensitivity and  in vivo mitochondrial function  in skeletal muscle. Am J Physiol Endocrinol Metab, 2006. 291(4): E724‐8. 

83.  Lanza,  I.R.  and  K.S. Nair.  Functional  assessment  of  isolated mitochondria  in  vitro. Methods  Enzymol, 2009. 457: 349‐72. 

84.  Moon, R.B. and J.H. Richards. Determination of intracellular pH by 31P magnetic resonance. J Biol Chem, 1973. 248(20): 7276‐8. 

85.  Lawson, J.W. and R.L. Veech. Effects of pH and free Mg2+ on the Keq of the creatine kinase reaction and other phosphate hydrolyses and phosphate transfer reactions. J Biol Chem, 1979. 254(14): 6528‐37. 

86.  Wallimann, T., M. Wyss, D. Brdiczka, K. Nicolay, and H.M. Eppenberger. Intracellular compartmentation, structure  and  function  of  creatine  kinase  isoenzymes  in  tissues  with  high  and  fluctuating  energy demands: the 'phosphocreatine circuit' for cellular energy homeostasis. Biochem J, 1992. 281 ( Pt 1): 21‐40. 

87.  Shoubridge, E.A., J.L. Bland, and G.K. Radda. Regulation of creatine kinase during steady‐state isometric twitch contraction in rat skeletal muscle. Biochim Biophys Acta, 1984. 805(1): 72‐8. 

Introduction 

27 

88.  Brindle,  K.M.,  M.J.  Blackledge,  R.A.  Challiss,  and  G.K.  Radda.  31P  NMR  magnetization‐transfer measurements of ATP turnover during steady‐state  isometric muscle contraction  in the rat hind  limb  in vivo. Biochemistry, 1989. 28(11): 4887‐93. 

89.  Laurent, D., B. Yerby, R. Deacon, and  J. Gao. Diet‐induced modulation of mitochondrial activity  in  rat muscle. Am J Physiol Endocrinol Metab, 2007. 293(5): E1169‐77. 

90.  Trenell,  M.I.,  K.G.  Hollingsworth,  E.L.  Lim,  and  R.  Taylor.  Increased  Daily  Walking  Improves  Lipid Oxidation Without Changes  in Mitochondrial Function  in Type 2 Diabetes. Diabetes Care, 2008. 31(8): 1644‐1649. 

91.  Yerby,  B.,  R.  Deacon,  V.  Beaulieu,  J.  Liang,  J.  Gao,  and  D.  Laurent.  Insulin‐stimulated mitochondrial adenosine triphosphate synthesis  is blunted  in skeletal muscles of high‐fat‐fed rats. Metabolism, 2008. 57(11): 1584‐90. 

92.  Brindle, K.M. and G.K. Radda. 31P‐NMR saturation transfer measurements of exchange between Pi and ATP  in  the  reactions  catalysed  by  glyceraldehyde‐3‐phosphate  dehydrogenase  and  phosphoglycerate kinase in vitro. Biochim Biophys Acta, 1987. 928(1): 45‐55. 

93.  Kemp, G.J. The interpretation of abnormal 31P magnetic resonance saturation transfer measurements of Pi/ATP exchange in insulin‐resistant skeletal muscle. Am J Physiol Endocrinol Metab, 2008. 294(3): E640‐642. 

94.  Campbell‐Burk,  S.L.,  K.A.  Jones,  and  R.G.  Shulman.  31P  NMR  saturation‐transfer  measurements  in Saccharomyces  cerevisiae:  characterization  of  phosphate  exchange  reactions  by  iodoacetate  and antimycin A inhibition. Biochemistry, 1987. 26(23): 7483‐92. 

95.  Kingsley‐Hickman,  P.B.,  E.Y.  Sako,  P. Mohanakrishnan,  P.M.  Robitaille,  A.H.  From,  J.E.  Foker,  and  K. Ugurbil.  31P  NMR  studies  of  ATP  synthesis  and  hydrolysis  kinetics  in  the  intact  myocardium. Biochemistry, 1987. 26(23): 7501‐10. 

96.  Hood, D.A., J. Gorski, and R.L. Terjung. Oxygen cost of twitch and tetanic  isometric contractions of rat skeletal muscle. Am J Physiol, 1986. 250(4 Pt 1): E449‐56. 

97.  Taylor, D.J., P.J. Bore, P. Styles, D.G. Gadian, and G.K. Radda. Bioenergetics of  intact human muscle. A 31P nuclear magnetic resonance study. Mol Biol Med, 1983. 1(1): 77‐94. 

98.  Quistorff, B., L. Johansen, and K. Sahlin. Absence of phosphocreatine resynthesis  in human calf muscle during ischaemic recovery. Biochem J, 1993. 291 ( Pt 3): 681‐6. 

99.  van den Broek, N.M., H.M. De Feyter, L. de Graaf, K. Nicolay, and J.J. Prompers. Intersubject differences in  the  effect  of  acidosis  on  phosphocreatine  recovery  kinetics  in  muscle  after  exercise  are  due  to differences in proton efflux rates. Am J Physiol Cell Physiol, 2007. 293(1): C228‐37. 

100.  Haseler, L.J., A.P. Lin, and R.S. Richardson. Skeletal muscle oxidative metabolism  in sedentary humans: 31P‐MRS assessment of O2 supply and demand limitations. J Appl Physiol, 2004. 97(3): 1077‐81. 

101.  Mahler,  M.  The  relationship  between  initial  creatine  phosphate  breakdown  and  recovery  oxygen consumption for a single  isometric tetanus of the frog sartorius muscle at 20 degrees C. J Gen Physiol, 1979. 73(2): 159‐74. 

102.  Larson‐Meyer,  D.E.,  B.R.  Newcomer,  G.R.  Hunter,  D.R.  Joanisse,  R.L. Weinsier,  and M.M.  Bamman. Relation between  in  vivo and  in  vitro measurements of  skeletal muscle oxidative metabolism. Muscle Nerve, 2001. 24(12): 1665‐76. 

103.  Praet,  S.F.,  H.M.  De  Feyter,  R.A.  Jonkers,  K.  Nicolay,  C.  van  Pul,  H.  Kuipers,  L.J.  van  Loon,  and  J.J. Prompers. 31P MR spectroscopy and  in vitro markers of oxidative capacity  in type 2 diabetes patients. Magma, 2006. 19(6): 321‐31. 

104.  Argov, Z., N. De Stefano, and D.L. Arnold. ADP  recovery after a brief  ischemic exercise  in normal and diseased human muscle‐‐a 31P MRS study. NMR Biomed, 1996. 9(4): 165‐72. 

105.  Arnold, D.L., P.M. Matthews, and G.K. Radda. Metabolic recovery after exercise and the assessment of mitochondrial function in vivo in human skeletal muscle by means of 31P NMR. Magn Reson Med, 1984. 1(3): 307‐15. 

106.  Bendahan, D., S. Confort‐Gouny, G. Kozak‐Reiss, and P.J. Cozzone. Heterogeneity of metabolic response to muscular  exercise  in  humans.  New  criteria  of  invariance  defined  by  in  vivo  phosphorus‐31  NMR spectroscopy. FEBS Lett, 1990. 272(1‐2): 155‐8. 

107.  Boska, M.D.,  J.A. Nelson, N.  Sripathi,  Pipinos,  II, A.D.  Shepard,  and  K.M. Welch.  31P MRS  studies  of exercising human muscle at high temporal resolution. Magn Reson Med, 1999. 41(6): 1145‐51. 

108.  Iotti, S., R. Lodi, C. Frassineti, P. Zaniol, and B. Barbiroli. In vivo assessment of mitochondrial functionality in human gastrocnemius muscle by 31P MRS. The role of pH  in the evaluation of phosphocreatine and inorganic phosphate recoveries from exercise. NMR Biomed, 1993. 6(4): 248‐53. 

109.  Lodi, R., G.J. Kemp, S. Iotti, G.K. Radda, and B. Barbiroli. Influence of cytosolic pH on in vivo assessment of human muscle mitochondrial  respiration by phosphorus magnetic  resonance  spectroscopy. Magma, 1997. 5(2): 165‐71. 

Chapter 1 

28 

110.  McCully, K.K., S. Iotti, K. Kendrick, Z. Wang, J.D. Posner, J. Leigh, Jr., and B. Chance. Simultaneous in vivo measurements  of HbO2  saturation  and  PCr  kinetics  after  exercise  in  normal  humans.  J Appl  Physiol, 1994. 77(1): 5‐10. 

111.  Roussel, M., D. Bendahan, J.P. Mattei, Y. Le Fur, and P.J. Cozzone. 31P magnetic resonance spectroscopy study  of  phosphocreatine  recovery  kinetics  in  skeletal  muscle:  the  issue  of  intersubject  variability. Biochim Biophys Acta, 2000. 1457(1‐2): 18‐26. 

112.  Takahashi, H., M.  Inaki, K.  Fujimoto,  S. Katsuta,  I. Anno, M. Niitsu, and Y.  Itai. Control of  the  rate of phosphocreatine  resynthesis after exercise  in  trained and untrained human quadriceps muscles. Eur  J Appl Physiol Occup Physiol, 1995. 71(5): 396‐404. 

113.  Taylor, D.J., P. Styles, P.M. Matthews, D.A. Arnold, D.G. Gadian, P. Bore, and G.K. Radda. Energetics of human muscle: exercise‐induced ATP depletion. Magn Reson Med, 1986. 3(1): 44‐54. 

114.  Walter, G., K. Vandenborne, K.K. McCully, and J.S. Leigh. Noninvasive measurement of phosphocreatine recovery kinetics in single human muscles. Am J Physiol, 1997. 272(2 Pt 1): C525‐34. 

115.  De Feyter, H.M., E. Lenaers, S.M. Houten, P. Schrauwen, M.K. Hesselink, R.J. Wanders, K. Nicolay, and J.J.  Prompers.  Increased  intramyocellular  lipid  content  but  normal  skeletal  muscle  mitochondrial oxidative capacity throughout the pathogenesis of type 2 diabetes. FASEB J, 2008. 22(11): 3947‐55. 

  

 

 

 

29 

 

30 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Adapted from 

N. M. A. van den Broek, J. Ciapaite, K. Nicolay, J. J. Prompers. 

Comparison of in vivo post‐exercise phosphocreatine recovery and resting ATP synthesis flux 

for the assessment of skeletal muscle mitochondrial function. 

Am J Physiol Cell Physiol, in press. 

Chapter     Comparison of in vivo post‐exercise 

phosphocreatine recovery and resting ATP 

synthesis flux for the assessment of  

skeletal muscle mitochondrial function 

Chapter 2 

32 

Abstract 31P  magnetic  resonance  spectroscopy  (MRS)  has  been  used  to  assess  skeletal  muscle 

mitochondrial  function  in  vivo  by  measuring  (1)  phosphocreatine  (PCr)  recovery  after 

exercise  or  (2)  resting ATP  synthesis  flux with  saturation  transfer  (ST).  In  this  study, we 

compared both parameters  in a  rat model of mitochondrial dysfunction with  the aim of 

establishing  the  most  appropriate  method  for  the  assessment  of  in  vivo  muscle 

mitochondrial function. Mitochondrial dysfunction was induced in adult Wistar rats by daily 

subcutaneous  injections with  the  complex  I  inhibitor diphenyleneiodonium  (DPI)  for  two 

weeks.  In  vivo  31P MRS measurements were  supplemented by  in  vitro measurements of 

oxygen  consumption  in  isolated  mitochondria.  Two  weeks  of  DPI  treatment  induced 

mitochondrial dysfunction, as evidenced by a 20%  lower maximal ADP‐stimulated oxygen 

consumption  rate  in  isolated mitochondria  from DPI‐treated  rats oxidizing pyruvate plus 

malate.  This was paralleled by  a  46% decrease  in  in  vivo  oxidative  capacity, determined 

from post‐exercise PCr recovery. Interestingly, no significant difference in resting, ST‐based 

ATP synthesis flux was observed between DPI‐treated rats and controls. These results show 

that  PCr  recovery  after  exercise  has  a  more  direct  relationship  with  skeletal  muscle 

mitochondrial function than the ATP synthesis flux measured with 31P ST MRS in the resting 

state. 

 

Assessment of in vivo muscle mitochondrial function 

33 

Introduction 

Mitochondria play a pivotal  role  in many cellular processes,  the most  important  function 

being  the  production  of  energy  in  the  form  of ATP  through  a  process  termed  oxidative 

phosphorylation.  The  last  decade,  mitochondria  gained  interest  in  the  field  of  insulin 

resistance (IR) and type 2 diabetes (T2D) [1‐6]. Based on the  in vivo observation that ATP 

synthesis flux in resting skeletal muscle is lower in insulin‐resistant subjects and offspring of 

T2D  patients  compared  to  healthy  controls  [7‐8],  it  has  been  hypothesized  that  skeletal 

muscle mitochondrial dysfunction is a predisposing factor for IR and/or T2D. The proposed 

mechanism  links  muscle  mitochondrial  dysfunction  to  impaired  fatty  acid  metabolism, 

which  subsequently  leads  to  the  accumulation  of  intramyocellular  lipids  and  lipid 

intermediates  (e.g. diacylglycerol and  ceramides)  that  interfere with  the  insulin  signaling 

cascade [9]. 

The role of skeletal muscle mitochondrial dysfunction in the development of IR and/or T2D 

has been investigated using a variety of techniques [7‐8, 10‐22]. In vitro methodologies, like 

the  determination  of  gene  expression  levels,  enzyme  activities,  mitochondrial  content, 

morphology  and  respiration,  provide  specific  information  on  different  aspects  of 

mitochondrial energy production, but  the  results  cannot be directly  translated  to  in  vivo 

mitochondrial  function.  31P  magnetic  resonance  spectroscopy  (MRS)  provides  a  non‐

invasive  tool  to monitor  the energetic status of  the cell  in vivo by measuring  intracellular 

phosphorous  containing  metabolites,  i.e.  phosphocreatine  (PCr),  ATP  and  inorganic 

phosphate  (Pi). 31P MR  spectra of  resting  skeletal muscle are  relatively  constant, even  in 

diseased states, and to assess  impairments  in mitochondrial energy production one needs 

to perturb either the chemical or the magnetic equilibrium as described below.  

The  resting  Pi   ATP  flux  (VATP)  can  be  determined  by  saturating  the  ‐ATP  peak  and monitoring  the  effect  of  this  perturbation  on  the  Pi  magnetization  in  a  so‐called  31P 

saturation transfer (ST) experiment [23‐24]. Assuming that VATP is predominantly reflecting 

oxidative ATP synthesis by  the F1F0‐ATPase  in  the mitochondria, VATP has been  taken as a 

measure  for mitochondrial  function  [8, 19]. However,  the  interpretation of  31P ST data  is 

not  straightforward.  The  lower ATP  synthesis  rates  in  resting muscle  of  insulin‐resistant 

subjects  [7‐8]  could  actually  reflect  a  normal  regulatory  response  to  a  lower  energy 

demand  caused  by  impaired  insulin  signaling,  rather  than  an  impairment  of  intrinsic 

mitochondrial  function  [25‐28].  Moreover,  the  Pi    ATP  fluxes  obtained  from  31P  ST 

measurements are comprised of both ATP synthase flux and glycolytic exchange flux, with 

the  latter  contributing  by  as much  as  80%  at  rest  [24,  26,  29‐31].  Therefore,  decreased 

resting VATP does not necessarily reflect a mitochondrial defect. 

As an alternative to the resting state ST experiment described above, the metabolic steady 

state of the muscle, i.e. the chemical equilibrium, can be disturbed during exercise. During 

recovery from exercise, the PCr pool is replenished purely through oxidative ATP synthesis 

Chapter 2 

34 

[32‐34]. Because the creatine kinase reaction is much faster than oxidative ATP production 

[35],  the measurement of PCr recovery using dynamic  31P MRS after exercise provides an 

alternative method to determine the rate of oxidative ATP synthesis. The PCr recovery rate 

constant (kPCr) thus reflects in vivo muscle mitochondrial oxidative capacity, i.e. the maximal 

capacity  for  oxidative ATP  production, which  is  typically  one  order  of magnitude  higher 

than the ATP synthesis rate at rest. Therefore, the post‐exercise PCr recovery rate constant 

might be a more suitable measure  for  in vivo mitochondrial  function as compared  to  the 

resting ATP synthesis flux.  

In  this  study, we  compared  in  vivo  31P MRS  post‐exercise  PCr  recovery  and  resting  ATP 

synthesis flux in a rat model of mitochondrial dysfunction with the aim of establishing the 

most  appropriate method  for  the  assessment  of  in  vivo  skeletal muscle mitochondrial 

function. Mitochondrial  dysfunction  was  induced  by  daily  subcutaneous  injections  with 

diphenyleneiodonium  (DPI),  which  irreversibly  inhibits  complex  I  (NADH‐ubiquinone 

reductase) of the respiratory chain [36‐39]. In vivo measurements were supplemented by in 

vitro measurements of oxygen consumption  in isolated mitochondria to confirm inhibition 

of complex I and to compare in vivo and in vitro measurements of mitochondrial function. 

Materials and Methods 

Animals 

Adult male Wistar rats  (364 ± 18 g, 14 weeks old, n = 16, Charles River Laboratories, The 

Netherlands) were housed in pairs at 20°C and 50% humidity, with a 12‐h  light‐dark cycle. 

Rats were given ad libitum access to water and normal chow (9.2% calories from fat, 67.2% 

calories from carbohydrates, 23.6% calories from proteins (R/M‐H diet, Ssniff Spezialdiäten 

GmbH, Soest, Germany)). Diphenyleneiodonium sulphate (DPI, Toronto Research Chemicals 

inc., North York, Ontario (ON), Canada) was dissolved in a warm 5% (w/v) glucose solution 

(1.3 mg/ml) and was injected daily subcutaneously at 1 mg/kg body weight for 11 ± 2 days 

(n = 8) [39]. Control animals received similar volumes of subcutaneously injected 5% (w/v) 

glucose solution (n = 8).  

The day after in vivo MRS measurements, rats were sacrificed by incising the inferior vena 

cava under anesthesia. Immediately thereafter, half of one tibialis anterior (TA) was freeze 

clamped using liquid nitrogen‐cooled tongs [40] and stored at ‐80°C for ATP determination. 

The  other  part  of  the  TA  was  frozen  in  liquid  nitrogen  and  stored  at  ‐80°C  for  the 

determination of mitochondrial DNA (mtDNA) content. The second TA muscle (fresh) was 

used for  isolation of mitochondria. Animal handling conformed to the rules of the Animal 

Ethics Committee of Maastricht University.  

Assessment of in vivo muscle mitochondrial function 

35 

31P magnetic resonance spectroscopy  

All magnetic resonance spectroscopy (MRS) measurements were performed on a 6.3 Tesla 

horizontal  Bruker  MR  system  (Bruker,  Ettlingen,  Germany),  14  days  after  the  start  of 

treatment. Animals were anaesthetized using  isoflurane (Forene®) (1‐2%) with medical air 

(0.6  L/min)  and  body  temperature was maintained  at  35.5  ±  0.5C  using  heating  pads. Respiration was monitored  using  a  pressure  sensor  registering  thorax movement  (Rapid 

Biomedical, Rimpar, Germany). 

Resting  ATP  synthesis  flux  (VATP)  and  the  post‐exercise  PCr  recovery  rate  constant  (kPCr) 

were measured in the TA by in vivo 31P MRS. 31P MRS was applied using a combination of a 

circular  1H  surface  coil  (40 mm)  for making MR  images  and  localized  shimming  and  an 

ellipsoid  31P MRS surface coil  (10/18 mm), positioned over  the TA as described previously 

[41]. 31P MR spectra were acquired applying an adiabatic excitation pulse with a flip angle 

of 90. A fully relaxed (TR = 25 s, 32 averages) spectrum was measured at rest, followed by 

the ST experiment  in  resting TA muscle  to determine VATP. Two spectra  (TR = 10.4 s, 128 

averages)  were  acquired  for  each  saturation  transfer  experiment:  A  spectrum  with 

frequency‐selective saturation of the ‐ATP peak yielding the steady state Pi magnetization 

in the presence of saturation (M’) and a reference spectrum with saturation at a downfield 

frequency, equidistant from Pi, yielding the equilibrium Pi magnetization (M0), both with a 

saturation pulse  length of 10  s. The apparent  longitudinal  relaxation  time of Pi  (T1’) was 

determined by performing an 8‐point  inversion recovery experiment with an adiabatic full 

passage  pulse  for  inversion  and  with  ‐ATP  saturation  prior  to  (10  s)  and  during  the inversion delay (inversion times = 0.01, 1, 2, 4, 6.5, 9.5, 13 and 17 s, 32 averages). The total 

duration of the ST and inversion recovery experiments was about 2 hours.  

After the ST experiments, time series of 31P MR spectra (TR = 5 s, 4 averages) before, during 

and  after  muscle  contractions  were  acquired.  Muscle  contractions  were  induced  by 

electrical stimulation of the TA, via subcutaneously  implanted electrodes positioned along 

the  distal N.  Peroneus  Communis  [41].  The  stimulation  protocol  consisted  of  a  series  of 

stimulation pulses, applied every second, for a duration of 2 min. Stimulation pulse length 

was 100 ms, frequency was 80 Hz and stimulation voltage varied between 2.5 and 4 Volt. 

Recovery was followed for 15 minutes. Three to four time series were measured for each 

rat. 

31P MR  spectra were  fit  in  the  time  domain  by  using  an  advanced magnetic  resonance 

(AMARES) nonlinear  least squares algorithm  in the  jMRUI software package (jMRUI V2.1). 

PCr and Pi peaks were fit to Lorentzian line shapes, whereas ‐, ‐, and ‐ATP signals were fit with Gaussian  line shapes. Besides the cytosolic Pi signal a second, smaller Pi peak was 

observed in the spectra at a frequency ~0.3 ppm downfield from the cytosolic Pi resonance. 

The two Pi signals were separately fitted and the line widths were constrained with respect 

to the  line width of the PCr signal. For the dynamic MRS spectra, the two Pi signals could 

Chapter 2 

36 

not be distinguished and a single Pi peak was fit to a Gaussian line shape. Concentrations of 

PCr and Pi were determined  relative  to  the ATP concentration, which was determined  in 

vitro from freeze clamped tissue as described below. ADP concentrations were calculated 

using  the  creatine  kinase  equilibrium  [42]  and  intracellular  pH was  calculated  from  the 

chemical shift difference between PCr and the cytosolic Pi resonance [34]. 

The T1’ relaxation time of Pi was determined by fitting the inversion recovery data with a 3‐

parameter  mono‐exponential  function  using  Origin  (OriginPro  7.5  SR0,  OriginLab 

Corporation, Northampton, MA, USA). The Pi  ATP exchange rate constant ( ) was 

calculated from the T1’ of Pi and the fractional reduction of Pi magnetization upon selective 

saturation  of  ‐ATP  according  to:    =  1 / .  VATP  was  then  calculated  by 

multiplying   with the Pi concentration at rest, as determined from the fully relaxed 

spectrum. The  intrinsic T1 of Pi was  calculated as  1/ . The data of PCr 

recovery were fit to a mono‐exponential function using Matlab (version 7.04, Mathworks, 

Natick, MA, USA)  yielding  a  rate  constant,  kPCr.  Results  from  two  time  series with  end‐

stimulation pH values higher than 6.92 [43] were averaged.  

TA muscle cross‐sectional area  in the midbelly region of the muscle was determined from 

the MR images using Mathematica (version 7.0, Wolfram Research, Champaign, IL, USA). 

Determination of ATP concentration 

Freeze  clamped  TA  muscle  was  powdered  in  liquid  nitrogen,  mixed  with  3.25  ml/g 

perchloric  acid  (6%  w/v)  and  homogenized  for  30  s  using  an  Ultra‐Turrax®  high‐

performance  disperser  (IKA®  Werke  GmbH  &  Co.  KG,  Staufen,  Germany).  Next,  the 

homogenate was neutralized with 5 M K2CO3 to pH 7.4 and centrifuged at 3000 g for 10 min 

at 4C. ATP concentration in the supernatant was determined spectrophotometrically using 

the hexokinase/glucose‐6‐phosphate dehydrogenase coupled assay as described in detail in 

[44]. 

Isolation of mitochondria 

Mitochondria were isolated from one whole TA muscle through a differential centrifugation 

procedure as previously described [45]. Briefly, TA muscle was excised, washed  in  ice cold 

0.9% KCl, freed of connective and adipose tissue, weighed and minced with scissors  in  ice 

cold medium A (5 ml for 1 g tissue) containing 150 mM sucrose, 75 mM KCl, 50 mM MOPS, 

1 mM KH2PO4, 5 mM MgCl2, 1 mM EGTA, 0.4 mg/ml bacterial proteinase type XXIV, pH 7.4. 

Next, 20 ml of medium B containing 250 mM sucrose, 0.1 mM EGTA and 20 mM MOPS, 2 

mg/ml BSA, pH 7.4 was added and  the mixture was homogenized using Potter‐Elvehjem 

Assessment of in vivo muscle mitochondrial function 

37 

homogenizer.  The  homogenate was  centrifuged  at  800  g  for  10 min,  4C.  The  resulting supernatant was centrifuged at 10000 g for 10 min, 4C. The pellet was resuspended in 15 ml of  fresh  ice cold medium B and centrifuged at 10000 g  for 10 min, 4C. Mitochondrial 

pellet was resuspended in 100 l of medium B. Protein content was determined using BCA 

protein assay kit (Pierce, Thermo Fisher Scientific Inc., Rockford, IL, USA). 

Measurement of oxygen consumption 

Oxygen  consumption  rate  was measured  at  37  °C  using  a  two‐channel  high‐resolution 

Oroboros oxygraph‐2  k  (Oroboros,  Innsbruck, Austria). Maximal ADP‐stimulated  (state 3) 

oxygen consumption rate was determined in the assay medium containing 110 mM KCl, 20 

mM Tris, 2.3 mM MgCl2, 5 mM KH2PO4, 50 mM creatine, 4.4 U/ml creatine phosphokinase, 

1 mM  ATP,  1 mg/ml  BSA,  pH  7.3.  All measurements were  performed  in  1 ml  of  assay 

medium  containing  0.15  mg/ml  of  mitochondrial  protein.  To  assess  NADH‐  (through 

complex  I)  and  FADH2‐driven  (through  complex  II)  oxygen  consumption,  5 mM  pyruvate 

plus 5 mM malate and 5 mM succinate plus 1 µM rotenone was used, respectively. Oxygen 

consumption  in  resting  state  (state  4)  was  determined  after  addition  of  1.25  M 

carboxyatractyloside.  The  signals  from  the  oxygen  electrode  were  recorded  at  0.5  s 

intervals. Data acquisition and analysis was performed using Oxygraph‐2k‐DatLab software 

version 4.2 (Oroboros, Innsbruck, Austria). 

Determination of the relative mitochondrial copy number 

Genomic DNA was isolated from a 25 mg transversal slice of mid‐belly TA using GenElute™ 

Mammalian  Genomic  DNA  Miniprep  Kit  (Sigma‐Aldrich,  Zwijndrecht,  The  Netherlands). 

Mitochondrial  DNA  (mtDNA)  content  relative  to  peroxisome  proliferator‐activated 

receptor‐ coactivator 1 (PGC‐1) gene was measured using real‐time PCR as described in 

[46]. Primers for mtDNA were: forward primer – 5’‐ACACCAAAAGGACGAACCTG‐3’, reverse 

primer  ‐  5’‐ATGGGGAAGAAGCCCTAGAA‐3’,  and  for  PGC‐1:  forward  primer  –  5’‐

ATGAATGCAGCGGTCTTAGC‐3’,  reverse  primer  –  5’‐AACAATGGCAGGGTTTGTTC‐3’.  The 

relative mtDNA copy number was calculated using Ct method as described in [47]. 

Statistical analysis 

Data are presented as means ± SD. The  listed n values  represent  the number of animals 

used  for  a  particular  experiment.  Statistical  significance  of  the  differences was  assessed 

using unpaired Student’s t‐tests in SPSS 16.0 statistical package (SPSS Inc., Chicago, IL, USA). 

Level of statistical significance was set at p < 0.05. 

Chapter 2 

38 

Results 

Animal model 

Daily DPI treatment resulted in a decreased food intake (22.1 ± 1.0 and 10.8 ± 2.9 g/day for 

control and DPI‐treated rats, respectively; p < 0.001) and a lower body weight (BW) at the 

end  of  the  DPI  treatment  (375  ±  24  and  330  ±  21  g  for  control  and  DPI‐treated  rats, 

respectively; p = 0.001). In parallel with the 12% lower BW, TA muscle cross‐sectional area 

was 10% smaller in DPI‐treated rats compared to controls at the end of the treatment (0.43 

± 0.03 and 0.38 ± 0.03 cm2 for control and DPI‐treated rats, respectively; p = 0.01). 

Mitochondrial characteristics in vitro  

To assess the effect of DPI on the  intrinsic  in vitro mitochondrial  function we determined 

oxygen  consumption  rates  in  mitochondria  isolated  from  the  TA  muscle  (results  are 

summarized in Table 1). Maximal ADP‐stimulated (state 3) oxygen consumption rate in the 

isolated mitochondria oxidizing pyruvate plus malate was 20% lower (p < 0.001) in the DPI‐

treated group  compared  to  controls. The effect of DPI  treatment on  succinate oxidation 

was  less  pronounced;  oxygen  consumption  rate  in  state  3  was  12%  lower  (p  =  0.03) 

compared to controls. For both substrates oxygen consumption rates in the absence of ATP 

synthesis (state 4) were similar in DPI‐treated and control groups.  

The effect of chronic inhibition of intrinsic mitochondrial function by DPI on mitochondrial 

biogenesis was assessed by determining mtDNA  copy number  in TA muscle. The  relative 

mtDNA  copy number was not  significantly different  in  the  TA muscle of  control  (2200 ± 

323) and DPI‐treated (2190 ± 369) rats. 

Table 1. Oxygen consumption rates in isolated TA mitochondria oxidizing different substrates in different 

metabolic states. 

  Pyruvate plus malate Succinate plus rotenone 

  Control DPI Control DPI 

   State 3 (nmol O2min

‐1∙mg protein

‐1) 408 ± 21 326 ± 38*  349 ± 28 308 ± 37* 

State 4 (nmol O2min‐1∙mg protein

‐1)  19 ± 3 20 ± 4 55 ± 12 52 ± 8 

Data  are  from  n  =  7  control  and  n  =  8  DPI‐treated  animals  and  are  expressed  as means  ±  SD.  DPI, 

diphenyleneiodonium‐treated  rats;  State  3,  maximal  ADP‐stimulated  oxygen  consumption;  State  4, 

oxygen consumption in the absence of ATP synthesis. *p < 0.05 when compared to control group. 

Assessment of in vivo muscle mitochondrial function 

39 

Muscle ATP concentration 

ATP concentrations in TA muscle were 12.5 ± 3.2 mM for control rats (n = 5) and 11.0 ± 2.5 

mM for DPI‐treated rats (n = 7) and were not significantly different (p = 0.4). Because DPI 

treatment had no significant effect on the muscle ATP concentration, the average value for 

both groups combined (11.6 ± 2.8 mM) was taken as a reference for the in vivo MRS data 

analysis. 

In vivo 31P MRS 

Concentrations  of  PCr,  Pi  and  ADP  and  the  intracellular  pH  obtained  from  the  31P MR 

spectra  recorded  in  resting TA muscle are  summarized  in Table 2. DPI  treatment had no 

significant effect on any of these parameters. 

Table 2. Metabolite concentrations and pH in TA measured by in vivo 31P MRS.

  Rest  End stimulation

  Control  DPI Control DPI 

   pH  7.19 ± 0.02 7.21 ± 0.02 7.07 ± 0.06 7.01 ± 0.06 

[PCr] (mM) 

47.5 ± 2.8 48.8 ± 2.9 22.8 ± 2.7 20.9 ± 1.2 

[Pi] (mM)  3.0 ± 0.4  3.0 ± 0.8 28.6 ± 3.5 31.9 ± 2.8 

[ADP] (μM)  13.4 ± 0.6 13.9 ± 0.4 84.8 ± 10.2 89.5 ± 16.7 

Data are from n = 8 animals for each group and are expressed as means ± SD. PCr, phosphocreatine; Pi, 

inorganic phosphate. 

Figure  1.  Example  of 31P  saturation  transfer 

spectra  (saturation  pulse  length  =  10  s,  TR  = 

10.4 s, 128 averages) with saturation on ‐ATP (black)  and  with  saturation  at  a  downfield 

frequency,  equidistant  from  Pi  (grey), 

measured in TA muscle of a DPI‐treated rat. 

 

Chapter 2 

40 

Figure  1  shows  a  representative  example  of  a  31P  ST  spectrum measured  in  resting  TA 

muscle with frequency‐selective saturation of the ‐ATP peak (black) and the corresponding reference  spectrum with  saturation  at  a downfield  frequency  equidistant  from Pi  (grey). 

From the 31P ST spectra, the ratio of Pi magnetization with and without saturation of ‐ATP ( ’/ ) was determined and this ratio was not significantly different between the groups 

(Table 3). The apparent T1 (T1’) of Pi in case of saturation of ‐ATP was determined from an 

8‐point  inversion  recovery  experiment  and  a  representative  example  of  Pi  inversion 

recovery data and the corresponding mono‐exponential fit  is shown  in Figure 2. T1’ values 

of Pi were similar for control and DPI‐treated animals (Table 3). The exchange rate constant 

  determined  from  T1’  and  ’/ ,  VATP  determined  from    and  the  Pi 

concentration, and the intrinsic T1 of Pi were also not significantly different between control 

and DPI‐treated animals (Table 3 and Figure 3A). 

Figure  2.  Pi  amplitudes  obtained 

from  an  inversion  recovery 

experiment  with  inversion  times  of 

0.01, 1, 2, 4, 6.5, 9.5, 13 and 17 s and 

with saturation of  the ‐ATP peak. A mono‐exponential  3‐paramenter 

function  (dark  line)  was  fit  to  the 

actual  data  (filled  circles)  to 

determine  T1’, which was  3.75  s  for 

this example. 

Table 3. Parameters determined from 31P saturation transfer MRS.

  Control DPI

’/   0.73 ± 0.06 0.67 ± 0.08

 (s)  3.87 ± 0.37 3.76 ± 0.79

 (s)  5.38 ± 0.79 5.69 ± 1.33

 (s‐1)  0.07 ± 0.02 0.09 ± 0.04

VATP (μmol/g/min)  8.33 ± 1.53 10.45 ± 2.82

Data  are  from  n  =  7  control  and  n  =  8  DPI‐treated  animals  and  are  expressed  as means  ±  SD. M’, 

magnetization  of  Pi with  saturation  of  ‐ATP; M0, magnetization  of  Pi with  saturation  at  a  downfield 

frequency, equidistant  from Pi;  , apparent  longitudinal relaxation time of Pi with saturation of ‐ATP; 

, intrinsic longitudinal relaxation time of Pi;  , exchange rate constant; VATP, resting ATP synthesis 

flux. 

Assessment of in vivo muscle mitochondrial function 

41 

Dynamic  31P MRS measurements during and after  recovery  from electrical  stimulation of 

the  TA  were  performed  to  determine  the  rate  of  PCr  recovery  after  stimulation. 

Concentrations of PCr, Pi and ADP and  the  intracellular pH at  the end of  the  stimulation 

were  not  significantly  different  between  groups  (Table  2).  PCr  concentrations  during 

recovery were fitted with a mono‐exponential function (Figure 4) yielding kPCr. kPCr was 46% 

lower in DPI‐treated animals as compared to control rats (Figure 3B, p < 0.001). There was 

no relationship between VATP and kPCr (R2 = 0.15, p = 0.15). 

Discussion 

In  this  study, we  compared  in  vivo  31P MRS  post‐exercise  PCr  recovery  and  resting  ATP 

synthesis flux in a rat model of mitochondrial dysfunction to establish the most appropriate 

method  for  assessment of  in  vivo  skeletal muscle mitochondrial  function.  Two weeks of 

treatment  with  the  complex  I  inhibitor  DPI  induced  mitochondrial  dysfunction,  as 

evidenced  by  a  20%  lower  oxygen  consumption  rate  in  isolated mitochondria  from DPI‐

treated rats oxidizing pyruvate plus malate. This was paralleled by a 46% decrease in in vivo 

oxidative capacity, determined from post‐exercise PCr recovery. Interestingly, no significant 

difference  in  resting ST‐based ATP  synthesis  flux was observed between DPI‐treated  rats 

and controls. 

DPI  is  a  non‐specific  irreversible  inhibitor  of  flavoenzymes,  which  causes  covalent 

phenylation of either the flavin or the adjacent amino acid and heme groups of the proteins 

due  to  reduction of DPI  to  its diphenyleneiodonyl  radical  form during electron  transport 

through  the  flavin  moieties  of  the  enzymes  [48].  The  effects  of  DPI  on  mitochondrial 

function have been studied extensively  in vitro  [37, 49‐50]. The acute  inhibitory effect of 

DPI  in  submitochondrial  particles  and  isolated mitochondria  prepared  from  different  rat 

tissues  is  primarily  related  to  irreversible  inhibition  of  the  respiratory  chain  complex  I, 

which  contains  flavin  adenine dinucleotide  as  the  enzyme  cofactor  [37,  49].  It has been 

shown  that DPI also decreases  succinate  state 3 oxidation  in  isolated  rat  skeletal muscle 

mitochondria,  suggesting  additional  inhibition  of  respiratory  chain  complex  II  [51]. 

Figure  3.  (A)  Resting  ATP  synthesis  flux 

(VATP; data are from n = 7 control and n = 

8  DPI‐treated  animals)  measured  by 31P 

saturation  transfer  MRS  and  (B)  PCr 

recovery rate constant (kPCr; n = 8 for both 

groups) measured with dynamic 31P MRS 

after  muscle  stimulation.  Open  bars 

represent  control  animals,  filled  bars 

represent  DPI‐treated  rats.  *p  <  0.05 

compared to controls. 

Chapter 2 

42 

However, the observation that this inhibition is dependent on the chloride concentration in 

the assay medium indicates a different potency or mechanism of action of DPI on complex 

II  [52], which may be  related  to  the  fact  that  complex  I  and  II  contain  a different  flavin 

cofactor (i.e. complex  II contains flavin mononucleotide). Furthermore,  it has been shown 

that  the  transport of  respiratory  substrates  into  the mitochondrial matrix  in  isolated  rat 

liver mitochondria is not affected by DPI [50, 53]. 

One may expect that the irreversible modifications of the respiratory chain complexes I and 

II observed in vitro also occur in vivo in animals chronically treated with DPI. Indeed, it has 

been  shown  that  state  3  oxygen  consumption,  driven  by  oxidation  of  various  NADH‐

delivering  substrates,  was  significantly  decreased  in  mitochondria  isolated  from 

gastrocnemius and soleus muscles of rats after 14 days of daily DPI treatment compared to 

healthy controls [38]. This effect could be fully explained by specific inhibition of complex I 

activity. In agreement, we found that DPI treatment of similar duration as in [38] results in 

a significant and comparable decrease in pyruvate plus malate‐driven oxygen consumption 

in state 3 in mitochondria isolated from TA muscle. In addition, we observed a small (12%) 

but  significant  decrease  in  the  succinate‐driven  oxygen  consumption  in  state  3.  The 

available published data on the effects of in vivo DPI treatment on succinate‐driven state 3 

oxygen consumption in isolated skeletal muscle mitochondria are scarce and contradictory. 

Cooper  et  al.  found  no  significant  impairment  of  succinate‐driven  state  3  oxygen 

 

Figure 4. Representative examples of relative PCr concentrations during rest, muscle stimulation and recovery  (time  resolution = 20  s)  for a  control animal  (open  symbols) and a DPI‐treated  rat  (filled symbols). PCr concentrations are expressed as a percentage of the resting PCr concentration (left y‐axis  is  for  the  control  rat,  right  y‐axis  for  the DPI‐treated  rat). Mono‐exponential  functions  (dark lines) were fit to the recovery data and the PCr recovery rate constants were 0.61 and 0.31 min

‐1 for 

the control and DPI‐treated animal, respectively. 

Assessment of in vivo muscle mitochondrial function 

43 

consumption  in  isolated skeletal muscle mitochondria [38], while Hayes et al. reported an 

80% decrease  in state 3 succinate oxidation  in skeletal muscle mitochondria  isolated from 

DPI‐treated  animals  compared  to  controls  [51].  The  different  results  are  likely  due  to 

differences in the concentration of chloride in the assay medium, which affects the potency 

of DPI to inhibit succinate‐driven state 3 oxygen consumption (see above) [52]. Because of 

the  low  intracellular chloride concentration, the most  important mode of action of DPI  in 

vivo is probably inhibition of complex I. 

In  the present  study, mtDNA  copy number  in TA muscle was  similar  for DPI‐treated and 

control rats, indicating that DPI treatment did not affect mitochondrial biogenesis. This is in 

agreement with Cooper et al. who showed similar activities of citrate synthase and other 

TCA cycle enzymes in the muscle of DPI‐treated animals compared to healthy controls [38]. 

The  observation  that  DPI  treatment  does  not  cause  compensatory  stimulation  of 

mitochondrial  biogenesis  simplifies  the  interpretation  of  the  in  vivo  determined  PCr 

recovery rate constant kPCr. It  implies that the decrease  in kPCr  in TA muscle of DPI‐treated 

animals  results  from  impaired  intrinsic  mitochondrial  function  rather  than  decreased 

mitochondrial  number. However,  the  discrepancy  in  the magnitude  of  the  effect  of DPI 

observed  on  the  in  vivo  determined  kPCr  (46%  decrease)  and  the  in  vitro mitochondrial 

function (20% decrease of state 3 oxygen consumption with pyruvate plus malate and 12% 

decrease of  state 3 oxygen  consumption with  succinate plus malate)  suggests  that other 

factors  than  inhibition of  the  respiratory chain complex  I and complex  II may additionally 

affect PCr recovery  in vivo. For example,  inhibition of  the creatine kinase reaction by DPI 

could  slow  down  the  recovery  of  PCr  in  vivo.  However,  from  our  31P  ST  data  no  such 

inhibitory  effect  was  observed  for  the  PCr   ATP  flux  (data  not  shown),  which  is  in 

agreement  with  observations  in  a  previous  study  [51].  Alternatively,  a  lowered muscle 

tissue perfusion could be responsible for a slower PCr recovery by reducing the availability 

of oxygen and  substrate. DPI has been  shown  to  inhibit endothelial nitric oxide  synthase 

(eNOS), an enzyme involved in vascular vasodilation [54]. Inhibition of eNOS lowers muscle 

blood  flow  during  recovery  from  exercise  in  humans  [55‐56]  and  therefore  we  cannot 

exclude that a lower muscle perfusion in DPI‐treated animals may have affected kPCr. 

In  contrast  to  the  oxygen  consumption  in  isolated  mitochondria  and  the  in  vivo  PCr 

recovery,  resting  ST‐based  ATP  synthesis  flux,  VATP, was  not  affected  by  DPI  treatment. 

Mitochondrial ATP synthesis is a demand driven process regulated by several error signals. 

Most investigated is the feedback control loop involving changes in the extra‐mitochondrial 

concentrations of the ATP hydrolysis products ADP [57‐59] and, to a lesser extent, Pi [59]. In 

order to interpret ATP synthesis flux data in terms of mitochondrial function, it is essential 

to take the error signals,  i.e. concentrations of ADP and Pi,  into account [26]. A  lower ATP 

synthesis flux in combination with low error signals simply represents a lower ATP demand. 

On  the other hand, a  lower ATP  synthesis  flux  in  combination with normal or high error 

signals  would  indeed  imply  mitochondrial  dysfunction  or  a  decrease  in  the  density  of 

mitochondria. In our study, DPI‐treated rats had both normal resting ATP synthesis flux and 

Chapter 2 

44 

a  normal  resting  Pi  concentration, whereas  the ADP  concentration was  slightly,  but  not 

significantly  elevated with  respect  to  controls.  These  results  imply  that  the  resting  ATP 

demand was not affected by  treatment with DPI. The slightly  increased ADP  level  in DPI‐

treated  rats  suggests  that  a  higher  error  signal was  needed  to maintain  a  normal  ATP 

synthesis  flux.  Alternatively,  another,  yet  unidentified  error  signal  might  have  been 

increased in DPI‐treated rats in order to match the normal ATP demand. 

Another factor which complicates the interpretation of 31P MRS ST data is that the Pi  ATP 

flux obtained from 31P MRS ST measurements is comprised of both mitochondrial F1F0‐ATP 

synthase  flux  and  flux  through  other  Pi    ATP  pathways,  in  particular  the  reactions 

catalyzed by  the glycolytic enzymes glyceraldehyde‐3‐phosphate dehydrogenase  (GAPDH) 

and  phosphoglycerate  kinase  (PGK).  Although  the  net  glycolytic  contribution  to  the 

production of ATP  (via GAPDH and PGK) versus that of oxidative phosphorylation  is small 

[60],  these  enzymes  catalyze  a  coupled  near‐equilibrium  reaction,  and  consequently, 

exchange between Pi and ATP may greatly exceed the net glycolytic flux [29]. Experimental 

proof  for glycolytic exchange between Pi and ATP  came  from  31P MRS ST experiments  in 

yeast. Pi  ATP exchange was inhibited in yeast by iodoacetate, an irreversible inhibitor of 

GAPDH [30], whereas in anaerobic yeast cells overexpressing PGK, Pi  ATP exchange was 

increased [61]. 31P MRS ST experiments performed on perfused rat hearts showed that the 

glycolytic exchange  reaction  contributes  significantly  to  the measured Pi  ATP  flux and 

that only when glycolytic activity was  inhibited, the measured Pi  ATP rates displayed a 

linear  dependence  on  oxygen  consumption  and  thus  represent  mitochondrial  F1F0‐ATP 

synthase flux [31]. For rat skeletal muscle, values for resting ATP turnover from 31P MRS ST 

experiments  are  about  5  times  higher  as  compared  to  figures  derived  from  oxygen 

consumption  rates, whereas  in human muscle  the difference  is even  larger  (reviewed  in 

[26]). This indicates that the contribution of glycolytic exchange flux to the measured Pi  

ATP flux from 31P MRS ST experiments in resting skeletal muscle can be as much as 80%. Up 

to  this  point,  it  has  been  assumed  that  the mitochondrial  F1F0‐ATP  synthase  flux, which 

constitutes  only  a  small  part  of  the  total  Pi    ATP  flux  measured,  is  unidirectional. 

However,  it has been shown that at  low rates of respiration (e.g. resting muscle) the F1F0‐

ATP synthase reaction  is near to equilibrium and that mitochondrial exchange between Pi 

and ATP  can make a  significant  contribution  to  the measured Pi  ATP  flux  [62]. Taken 

together, if there would have been an effect of DPI on the rate of net resting mitochondrial 

ATP  production,  this  effect might  not  be measurable  due  to  the  large  contribution  of 

glycolytic  exchange  flux  and  possibly  also  a  significant  contribution  of  mitochondrial 

exchange flux to the total measured Pi  ATP flux. In order to create better conditions for 

detecting a defect  in skeletal muscle mitochondrial oxidative phosphorylation, 31P MRS ST 

experiments would need  to be performed during  steady‐state muscle  contraction, when 

the F1F0‐ATP synthase  reaction  is  largely unidirectional and  the  flux  through  the F1F0‐ATP 

synthase  is  much  larger  than  the  glycolytic  exchange  flux  [24].  However,  it  is  very 

challenging  to maintain  steady‐state muscle  contractions  during  the  lengthy  31P MRS  ST 

Assessment of in vivo muscle mitochondrial function 

45 

experiments and this might in particular be a problem in patient groups. Moreover, in such 

an  experiment  it  is  crucial  to  achieve  similar  relative workloads  in  different  subjects  or 

animals. 

Most 31P MRS ST studies investigating the role of skeletal muscle mitochondrial function in 

the  development  of  insulin  resistance  and  T2D  lack  a  proper  discussion  about  the  error 

signals,  i.e.  the  concentrations of Pi and ADP. The  lower VATP  in  insulin‐resistant  subjects 

and animal models and patients with type 2 diabetes [7‐8, 19, 63‐65] might be explained by 

a  lower Pi concentration [8], caused by reduced sarcolemmal Pi uptake  in  insulin‐resistant 

muscle  [66],  rather  than  a  decrease  in  the  Pi   ATP  exchange  rate  constant  . 

Furthermore, it has been shown that hyperinsulinemia decreases the intracellular pH [67], 

resulting in a lower ADP concentration and therefore a lower error signal for oxidative ATP 

synthesis.  In  addition,  all  31P MRS  ST  studies  investigating  the  role  of  skeletal  muscle 

mitochondrial  function  in  the  development  of  IR  and  T2D  were  performed  in  resting 

skeletal muscle [7‐8, 19, 63‐65, 68]. As was explained in the previous paragraph, in resting 

skeletal muscle the contribution of F1F0‐ATP synthesis flux to the total measured Pi  ATP 

flux  will  be  relatively  low,  which  further  complicates  the  interpretation  of  these 

measurements.  In  a  recent  study, measurements  of  both  PCr  recovery  and  resting  ATP 

synthesis  flux were performed  in  type 2 diabetes patients and healthy controls  [68]. The 

half  times  of  PCr  recovery  were  not  different  between  groups  and  also  resting  ATP 

synthesis  flux  was  not  impaired  in  the  patients  with  type  2  diabetes  as  compared  to 

controls, while concentrations of Pi and ADP were similar for both groups. In addition, half 

times of PCr  recovery were not  significantly  correlated with  resting ATP  synthesis  fluxes, 

which  is  in agreement with  the  results of  the present  study.  It  should be noted  that  the 

animal model that we used in this study is a model of mitochondrial dysfunction, but that it 

does  not  represent  a model  for  insulin  resistance  of  T2D. On  the  contrary,  it  has  been 

shown that DPI can induce hypoglycemia [50, 52]. 

In  conclusion,  the  rate  constant  of  PCr  recovery measured with  dynamic  31P MRS  after 

exercise provides a more sensitive measure of skeletal muscle mitochondrial function than 

the ATP synthesis flux determined with 31P saturation transfer in the resting state. The ATP 

synthesis flux itself represents the ATP demand of the muscle and in order to interpret the 

data  in  terms of mitochondrial  function  it  is necessary  to  take  the errors  signals,  i.e.  the 

concentrations of ADP and Pi,  into account. Moreover, the Pi  ATP flux obtained from a 31P saturation transfer experiment in the resting state is dominated by glycolytic exchange 

flux.  In  order  to  detect  a  defect  in mitochondrial  oxidative  phosphorylation  the  latter 

experiment would need to be done in exercising muscle. 

Chapter 2 

46 

Acknowledgements 

The authors thank Joep van Lier for his support in fitting the 31P MR spectra and dr. Jeroen 

Jeneson for stimulating discussions.  

The work  of  J.C.  is  financed  by  the Netherlands  Consortium  for  Systems  Biology  (NCSB) 

which  is  part  of  the  Netherlands  Genomics  Initiative  /  Netherlands  Organisation  for 

Scientific Research.  J.J.P.  is supported by a VIDI grant  from  the Netherlands Organisation 

for Scientific Research (VIDI grant number 700.58.421). 

Assessment of in vivo muscle mitochondrial function 

47 

References 1.  Rabol, R., R. Boushel, and F. Dela. Mitochondrial oxidative  function and  type 2 diabetes. Appl Physiol 

Nutr Metab, 2006. 31(6): 675‐83. 2.  Morino, K., K.F. Petersen, and G.I. Shulman. Molecular mechanisms of insulin resistance in humans and 

their potential links with mitochondrial dysfunction. Diabetes, 2006. 55 Suppl 2: S9‐S15. 3.  Sreekumar, R. and K.S. Nair. Skeletal muscle mitochondrial dysfunction & diabetes.  Indian  J Med Res, 

2007. 125(3): 399‐410. 4.  Schrauwen‐Hinderling,  V.B.,  M.  Roden,  M.E.  Kooi,  M.K.  Hesselink,  and  P.  Schrauwen.  Muscular 

mitochondrial dysfunction and  type 2 diabetes mellitus. Curr Opin Clin Nutr Metab Care, 2007. 10(6): 698‐703. 

5.  Szendroedi, J. and M. Roden. Mitochondrial fitness and insulin sensitivity in humans. Diabetologia, 2008. 51(12): 2155‐67. 

6.  Holloszy, J.O. Skeletal muscle "mitochondrial deficiency" does not mediate  insulin resistance. Am J Clin Nutr, 2009. 89(1): 463S‐6S. 

7.  Petersen, K.F., D. Befroy, S. Dufour, J. Dziura, C. Ariyan, D.L. Rothman, L. DiPietro, G.W. Cline, and G.I. Shulman. Mitochondrial  dysfunction  in  the  elderly:  possible  role  in  insulin  resistance.  Science,  2003. 300(5622): 1140‐2. 

8.  Petersen, K.F., S. Dufour, D. Befroy, R. Garcia, and G.I. Shulman.  Impaired mitochondrial activity  in the insulin‐resistant offspring of patients with type 2 diabetes. N Engl J Med, 2004. 350(7): 664‐71. 

9.  Yu,  C.,  Y.  Chen,  G.W.  Cline,  D.  Zhang,  H.  Zong,  Y. Wang,  R.  Bergeron,  J.K.  Kim,  S.W.  Cushman,  G.J. Cooney,  B. Atcheson, M.F. White,  E.W.  Kraegen,  and G.I.  Shulman. Mechanism  by which  fatty  acids inhibit  insulin activation of  insulin receptor substrate‐1  (IRS‐1)‐associated phosphatidylinositol 3‐kinase activity in muscle. J Biol Chem, 2002. 277(52): 50230‐6. 

10.  Mootha, V.K., C.M. Lindgren, K.F. Eriksson, A. Subramanian, S. Sihag, J. Lehar, P. Puigserver, E. Carlsson, M. Ridderstrale, E. Laurila, N. Houstis, M.J. Daly, N. Patterson,  J.P. Mesirov, T.R. Golub, P. Tamayo, B. Spiegelman,  E.S.  Lander,  J.N. Hirschhorn, D.  Altshuler,  and  L.C. Groop.  PGC‐1alpha‐responsive  genes involved  in oxidative phosphorylation are  coordinately downregulated  in human diabetes. Nat Genet, 2003. 34(3): 267‐73. 

11.  Patti, M.E., A.J. Butte, S. Crunkhorn, K. Cusi, R. Berria, S. Kashyap, Y. Miyazaki, I. Kohane, M. Costello, R. Saccone, E.J. Landaker, A.B. Goldfine, E. Mun, R. DeFronzo, J. Finlayson, C.R. Kahn, and L.J. Mandarino. Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: Potential role of PGC1 and NRF1. Proc Natl Acad Sci U S A, 2003. 100(14): 8466‐71. 

12.  Ritov,  V.B.,  E.V.  Menshikova,  J.  He,  R.E.  Ferrell,  B.H.  Goodpaster,  and  D.E.  Kelley.  Deficiency  of subsarcolemmal mitochondria in obesity and type 2 diabetes. Diabetes, 2005. 54(1): 8‐14. 

13.  He, J., S. Watkins, and D.E. Kelley. Skeletal muscle lipid content and oxidative enzyme activity in relation to muscle fiber type in type 2 diabetes and obesity. Diabetes, 2001. 50(4): 817‐23. 

14.  Heilbronn,  L.K.,  S.K.  Gan,  N.  Turner,  L.V.  Campbell,  and  D.J.  Chisholm.  Markers  of  mitochondrial biogenesis  and  metabolism  are  lower  in  overweight  and  obese  insulin‐resistant  subjects.  J  Clin Endocrinol Metab, 2007. 92(4): 1467‐73. 

15.  Hojlund,  K.,  K. Wrzesinski,  P.M.  Larsen,  S.J.  Fey,  P.  Roepstorff,  A.  Handberg,  F.  Dela,  J.  Vinten,  J.G. McCormack, C. Reynet, and H. Beck‐Nielsen. Proteome analysis reveals phosphorylation of ATP synthase beta ‐subunit in human skeletal muscle and proteins with potential roles in type 2 diabetes. J Biol Chem, 2003. 278(12): 10436‐42. 

16.  Kelley,  D.E.,  J.  He,  E.V. Menshikova,  and  V.B.  Ritov.  Dysfunction  of mitochondria  in  human  skeletal muscle in type 2 diabetes. Diabetes, 2002. 51(10): 2944‐50. 

17.  Mogensen,  M.,  K.  Sahlin,  M.  Fernstrom,  D.  Glintborg,  B.F.  Vind,  H.  Beck‐Nielsen,  and  K.  Hojlund. Mitochondrial  respiration  is  decreased  in  skeletal muscle  of  patients with  type  2  diabetes. Diabetes, 2007. 56(6): 1592‐9. 

18.  Morino, K., K.F. Petersen, S. Dufour, D. Befroy, J. Frattini, N. Shatzkes, S. Neschen, M.F. White, S. Bilz, S. Sono,  M.  Pypaert,  and  G.I.  Shulman.  Reduced  mitochondrial  density  and  increased  IRS‐1  serine phosphorylation  in muscle of  insulin‐resistant offspring of  type 2 diabetic parents.  J Clin  Invest, 2005. 115(12): 3587‐93. 

19.  Petersen, K.F., S. Dufour, and G.I. Shulman. Decreased  insulin‐stimulated ATP synthesis and phosphate transport in muscle of insulin‐resistant offspring of type 2 diabetic parents. PLoS Med, 2005. 2(9): e233. 

20.  Simoneau, J.A. and D.E. Kelley. Altered glycolytic and oxidative capacities of skeletal muscle contribute to insulin resistance in NIDDM. J Appl Physiol, 1997. 83(1): 166‐71. 

21.  De Feyter, H.M., N.M. van den Broek, S.F. Praet, K. Nicolay, L.J. van Loon, and  J.J. Prompers. Early or advanced stage type 2 diabetes is not accompanied by in vivo skeletal muscle mitochondrial dysfunction. Eur J Endocrinol, 2008. 158(5): 643‐53. 

Chapter 2 

48 

22.  Schrauwen‐Hinderling, V.B., M.E. Kooi, M.K. Hesselink, J.A. Jeneson, W.H. Backes, C.J. van Echteld, J.M. van Engelshoven, M. Mensink, and P. Schrauwen.  Impaired  in vivo mitochondrial  function but  similar intramyocellular  lipid  content  in  patients  with  type  2  diabetes  mellitus  and  BMI‐matched  control subjects. Diabetologia, 2007. 50(1): 113‐20. 

23.  Brown, T.R., K. Ugurbil, and R.G. Shulman. 31P nuclear magnetic  resonance measurements of ATPase kinetics in aerobic Escherichia coli cells. Proc Natl Acad Sci U S A, 1977. 74(12): 5551‐3. 

24.  Brindle,  K.M.,  M.J.  Blackledge,  R.A.  Challiss,  and  G.K.  Radda.  31P  NMR  magnetization‐transfer measurements of ATP turnover during steady‐state  isometric muscle contraction  in the rat hind  limb  in vivo. Biochemistry, 1989. 28(11): 4887‐93. 

25.  Brehm, A., M. Krssak, A.I. Schmid, P. Nowotny, W. Waldhausl, and M. Roden. Increased lipid availability impairs insulin‐stimulated ATP synthesis in human skeletal muscle. Diabetes, 2006. 55(1): 136‐40. 

26.  Kemp, G.J. The interpretation of abnormal 31P magnetic resonance saturation transfer measurements of Pi/ATP exchange in insulin‐resistant skeletal muscle. Am J Physiol Endocrinol Metab, 2008. 294(3): E640‐642. 

27.  Short, K.R., K.S. Nair, and C.S. Stump.  Impaired mitochondrial activity and  insulin‐resistant offspring of patients with type 2 diabetes. N Engl J Med, 2004. 350(23): 2419‐21; author reply 2419‐21. 

28.  Wagenmakers, A.J. Insulin resistance  in the offspring of parents with type 2 diabetes. PLoS Med, 2005. 2(9): e289. 

29.  Brindle, K.M. and G.K. Radda. 31P‐NMR saturation transfer measurements of exchange between Pi and ATP  in  the  reactions  catalysed  by  glyceraldehyde‐3‐phosphate  dehydrogenase  and  phosphoglycerate kinase in vitro. Biochim Biophys Acta, 1987. 928(1): 45‐55. 

30.  Campbell‐Burk,  S.L.,  K.A.  Jones,  and  R.G.  Shulman.  31P  NMR  saturation‐transfer  measurements  in Saccharomyces  cerevisiae:  characterization  of  phosphate  exchange  reactions  by  iodoacetate  and antimycin A inhibition. Biochemistry, 1987. 26(23): 7483‐92. 

31.  Kingsley‐Hickman,  P.B.,  E.Y.  Sako,  P. Mohanakrishnan,  P.M.  Robitaille,  A.H.  From,  J.E.  Foker,  and  K. Ugurbil.  31P  NMR  studies  of  ATP  synthesis  and  hydrolysis  kinetics  in  the  intact  myocardium. Biochemistry, 1987. 26(23): 7501‐10. 

32.  Quistorff, B., L. Johansen, and K. Sahlin. Absence of phosphocreatine resynthesis  in human calf muscle during ischaemic recovery. Biochem J, 1993. 291 ( Pt 3): 681‐6. 

33.  Sahlin, K.  Intracellular pH and energy metabolism  in skeletal muscle of man. With special reference to exercise. Acta Physiol Scand Suppl, 1978. 455: 1‐56. 

34.  Taylor, D.J., P.J. Bore, P. Styles, D.G. Gadian, and G.K. Radda. Bioenergetics of  intact human muscle. A 31P nuclear magnetic resonance study. Mol Biol Med, 1983. 1(1): 77‐94. 

35.  Vicini, P. and M.J. Kushmerick. Cellular energetics analysis by a mathematical model of energy balance: estimation of parameters in human skeletal muscle. Am J Physiol Cell Physiol, 2000. 279(1): C213‐24. 

36.  Majander, A., M. Finel, and M. Wikstrom. Diphenyleneiodonium inhibits reduction of iron‐sulfur clusters in the mitochondrial NADH‐ubiquinone oxidoreductase (Complex  I). J Biol Chem, 1994. 269(33): 21037‐42. 

37.  Ragan,  C.I.  and  D.P.  Bloxham.  Specific  labelling  of  a  constituent  polypeptide  of  bovine  heart mitochondrial  reduced  nicotinamide‐adenine  dinucleotide‐ubiquinone  reductase  by  the  inhibitor diphenyleneiodonium. Biochem J, 1977. 163(3): 605‐15. 

38.  Cooper,  J.,  R.  Petty,  D.  Hayes,  J.  Morgan‐Hughes,  and  J.  Clark.  Chronic  administration  of  the  oral hypoglycaemic  agent  diphenyleneiodonium  to  rats.  An  animal  model  of  impaired  oxidative phosphorylation (mitochondrial myopathy). Biochemical Pharmacology, 1988. 37(4): 687‐694. 

39.  Cooper,  J.M.,  R.K.  Petty,  D.J.  Hayes,  R.A.  Challiss,  M.J.  Brosnan,  E.A.  Shoubridge,  G.K.  Radda,  J.A. Morgan‐Hughes,  and  J.B.  Clark.  An  animal  model  of  mitochondrial  myopathy:  a  biochemical  and physiological  investigation  of  rats  treated  in  vivo  with  the  NADH‐CoQ  reductase  inhibitor, diphenyleneiodonium. J Neurol Sci, 1988. 83(2‐3): 335‐47. 

40.  Palladino, G.W., J.J. Wood, and H.J. Proctor. Modified freeze clamp technique for tissue assay. J Surg Res, 1980. 28(2): 188‐90. 

41.  De Feyter, H.M., E. Lenaers, S.M. Houten, P. Schrauwen, M.K. Hesselink, R.J. Wanders, K. Nicolay, and J.J.  Prompers.  Increased  intramyocellular  lipid  content  but  normal  skeletal  muscle  mitochondrial oxidative capacity throughout the pathogenesis of type 2 diabetes. FASEB J, 2008. 22(11): 3947‐55. 

42.  Lawson, J.W. and R.L. Veech. Effects of pH and free Mg2+ on the Keq of the creatine kinase reaction and other phosphate hydrolyses and phosphate transfer reactions. J Biol Chem, 1979. 254(14): 6528‐37. 

43.  van den Broek, N.M., H.M. De Feyter, L. de Graaf, K. Nicolay, and J.J. Prompers. Intersubject differences in  the  effect  of  acidosis  on  phosphocreatine  recovery  kinetics  in  muscle  after  exercise  are  due  to differences in proton efflux rates. Am J Physiol Cell Physiol, 2007. 293(1): C228‐37. 

44.  Trautschold,  I., W. Lamprecht, and G. Schweitzer, Nucleotides, Coenzymes and  related  compounds,  in Methods of enzymatic analysis, H. Bergmeyer, Editor. 1985, , Wiley‐VCH. 

Assessment of in vivo muscle mitochondrial function 

49 

45.  van den Broek, N.M., J. Ciapaite, H.M. De Feyter, S.M. Houten, R.J. Wanders, J.A. Jeneson, K. Nicolay, and  J.J. Prompers.  Increased mitochondrial  content  rescues  in  vivo muscle oxidative  capacity  in  long‐term high‐fat‐diet‐fed rats. FASEB J, 2010. 24(5): 1354‐64. 

46.  Ciapaite,  J.,  S.J. Bakker, G. Van Eikenhorst, M.J. Wagner, T. Teerlink, C.G.  Schalkwijk, M.  Fodor, D.M. Ouwens, M. Diamant, R.J. Heine, H.V. Westerhoff, and K. Krab. Functioning of oxidative phosphorylation in liver mitochondria of high‐fat diet fed rats. Biochim Biophys Acta, 2007. 1772(3): 307‐16. 

47.  Szuhai, K., J. Ouweland, R. Dirks, M. Lemaitre, J. Truffert, G. Janssen, H. Tanke, E. Holme, J. Maassen, and A.  Raap.  Simultaneous  A8344G  heteroplasmy  and mitochondrial  DNA  copy  number  quantification  in myoclonus epilepsy and  ragged‐red  fibers  (MERRF)  syndrome by a multiplex molecular beacon based real‐time fluorescence PCR. Nucleic Acids Res, 2001. 29(3): E13. 

48.  O'Donnell, V.B., G.C.  Smith,  and O.T.  Jones.  Involvement  of  phenyl  radicals  in  iodonium  inhibition  of flavoenzymes. Mol Pharmacol, 1994. 46(4): 778‐85. 

49.  Gatley, S.J. and S.A. Sherratt. The effects of diphenyleneiodonium on mitochondrial reactions. Relation of binding  of  diphenylene[125I]iodonium  to mitochondria  to  the  extent  of  inhibition  of  oxygen  uptake. Biochem J, 1976. 158(2): 307‐15. 

50.  Holland,  P.C.  and  H.S.  Sherratt.  Biochemical  effects  of  the  hypoglycaemic  compound diphenyleneiodonnium. Catalysis of anion‐hydroxyl ion exchange across the inner membrane of rat liver mitochondria and effects on oxygen uptake. Biochem J, 1972. 129(1): 39‐54. 

51.  Hayes,  D.J.,  E.  Byrne,  E.A.  Shoubridge,  J.A. Morgan‐Hughes,  and  J.B.  Clark.  Experimentally  induced defects of mitochondrial metabolism in rat skeletal muscle. Biological effects of the NADH: coenzyme Q reductase inhibitor diphenyleneiodonium. Biochem J, 1985. 229(1): 109‐17. 

52.  Holland, P.C., M.G. Clark, D.P. Bloxham, and H.A. Lardy. Mechanism of action of the hypoglycemic agent diphenyleneiodonium. J Biol Chem, 1973. 248(17): 6050‐6. 

53.  Gatley,  S.J.  and  H.S.  Sherratt.  The  effects  of  diphenyleneiodonium  and  of  2,4‐dichlorodiphenyleneiodonium on mitochondrial reactions. Mechanism of the inhibition of oxygen uptake as a consequence of the catalysis of the chloride/hydroxyl‐ion exchange. Biochem J, 1976. 158(2): 317‐26. 

54.  Stuehr, D.J., O.A. Fasehun, N.S. Kwon, S.S. Gross,  J.A. Gonzalez, R. Levi, and C.F. Nathan.  Inhibition of macrophage and endothelial cell nitric oxide synthase by diphenyleneiodonium and its analogs. FASEB J, 1991. 5(1): 98‐103. 

55.  Clifford, P.S.  and  Y. Hellsten. Vasodilatory mechanisms  in  contracting  skeletal muscle.  J Appl Physiol, 2004. 97(1): 393‐403. 

56.  Saltin, B., G. Radegran, M.D. Koskolou, and R.C. Roach. Skeletal muscle blood  flow  in humans and  its regulation during exercise. Acta Physiol Scand, 1998. 162(3): 421‐36. 

57.  Jeneson, J.A., J.P. Schmitz, N.M. van den Broek, N.A. van Riel, P.A. Hilbers, K. Nicolay, and J.J. Prompers. Magnitude and control of mitochondrial sensitivity to ADP. Am J Physiol Endocrinol Metab, 2009. 297(3): E774‐84. 

58.  Kemp, G.J.  Interactions of mitochondrial ATP  synthesis and  the  creatine kinase equilibrium  in  skeletal muscle. J Theor Biol, 1994. 170(3): 239‐46. 

59.  Wu, F., J.A. Jeneson, and D.A. Beard. Oxidative ATP synthesis in skeletal muscle is controlled by substrate feedback. Am J Physiol Cell Physiol, 2007. 292(1): C115‐24. 

60.  Hood, D.A., J. Gorski, and R.L. Terjung. Oxygen cost of twitch and tetanic  isometric contractions of rat skeletal muscle. Am J Physiol, 1986. 250(4 Pt 1): E449‐56. 

61.  Brindle, K.M. 31P NMR magnetization‐transfer measurements of flux between inorganic phosphate and adenosine 5'‐triphosphate  in yeast  cells genetically modified  to overproduce phosphoglycerate kinase. Biochemistry, 1988. 27(16): 6187‐96. 

62.  Sheldon, J.G., S.P. Williams, A.M. Fulton, and K.M. Brindle. 31P NMR magnetization transfer study of the control of ATP turnover in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A, 1996. 93(13): 6399‐404. 

63.  Laurent, D., B. Yerby, R. Deacon, and  J. Gao. Diet‐induced modulation of mitochondrial activity  in  rat muscle. Am J Physiol Endocrinol Metab, 2007. 293(5): E1169‐77. 

64.  Szendroedi,  J.,  A.I.  Schmid, M.  Chmelik,  C.  Toth,  A.  Brehm, M.  Krssak,  P.  Nowotny, M. Wolzt, W. Waldhausl, and M. Roden. Muscle mitochondrial ATP synthesis and glucose transport/phosphorylation in type 2 diabetes. PLoS Med, 2007. 4(5): e154. 

65.  Yerby,  B.,  R.  Deacon,  V.  Beaulieu,  J.  Liang,  J.  Gao,  and  D.  Laurent.  Insulin‐stimulated mitochondrial adenosine triphosphate synthesis  is blunted  in skeletal muscles of high‐fat‐fed rats. Metabolism, 2008. 57(11): 1584‐90. 

66.  Polgreen, K.E., G.J. Kemp, B. Leighton, and G.K. Radda. Modulation of Pi transport in skeletal muscle by insulin and IGF‐1. Biochim Biophys Acta, 1994. 1223(2): 279‐84. 

Chapter 2 

50 

67.  Taylor, D.J., S.W. Coppack, T.A. Cadoux‐Hudson, G.J. Kemp, G.K. Radda, K.N. Frayn, and L.L. Ng. Effect of insulin on  intracellular pH and phosphate metabolism  in human skeletal muscle  in vivo. Clin Sci (Lond), 1991. 81(1): 123‐8. 

68.  Trenell,  M.I.,  K.G.  Hollingsworth,  E.L.  Lim,  and  R.  Taylor.  Increased  Daily  Walking  Improves  Lipid Oxidation Without Changes  in Mitochondrial Function  in Type 2 Diabetes. Diabetes Care, 2008. 31(8): 1644‐1649. 

  

  

 

 

51 

 

52 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Adapted from 

N. M. A. van den Broek, H. M. M. L. De Feyter, L. de Graaf, K. Nicolay and J. J. Prompers. 

Intersubject differences in the effect of acidosis on phosphocreatine recovery kinetics in 

muscle after exercise are due to differences in proton efflux rates.  

Am J Physiol Cell Physiol, 2007. 293(1):C228‐37.  

Used with permission from The Am Physiol Soc.DOI: 10.1152/ajpcell.00023.2007. 

Chapter     Intersubject differences in the effect of acidosis 

on phosphocreatine recovery kinetics  

in muscle after exercise are due to  

differences in proton efflux rates 

Chapter 3 

54 

Abstract 31P magnetic resonance spectroscopy provides the possibility to obtain bio‐energetic data 

during skeletal muscle exercise and recovery. The time constant of phosphocreatine (PCr) 

recovery  (PCr) has been used as a measure of mitochondrial  function. However, cytosolic 

pH has a strong influence on the kinetics of PCr recovery and it has been suggested that PCr should be normalized for end‐exercise pH. A general correction can only be applied if there 

are  no  intersubject  differences  in  the  pH  dependence  of  PCr. We  investigated  the  pH 

dependence of PCr on a subject‐by‐subject basis. Furthermore, we determined the kinetics 

of proton efflux at the start of recovery. Intracellular acidosis slowed PCr recovery and the 

pH dependence of PCr differed among subjects, ranging from ‐33.0 to ‐75.3 s per pH unit. 

The slope of the relation between PCr and end‐exercise pH was positively correlated with both  the proton efflux  rate and  the apparent proton efflux  rate constant,  indicating  that 

subjects with a smaller pH dependence of PCr have a higher proton efflux rate. Our study implies that simply correcting PCr for end‐exercise pH  is not adequate,  in particular when comparing patients and controls, as certain disorders are characterized by altered proton 

efflux from muscle fibers. 

Effect of acidosis on PCr recovery related to proton efflux 

55 

Introduction 31P magnetic resonance spectroscopy (MRS) provides the possibility to obtain bio‐energetic 

data during skeletal muscle exercise and recovery in a non‐invasive manner and with a time 

resolution of a  few seconds. This has made a major contribution to our understanding of 

energy metabolism,  its  control and  the way  in which  it  can be affected  in disease  [1‐7]. 

During  recovery  from  exercise,  phosphocreatine  (PCr)  is  resynthesized  purely  as  a 

consequence  of  oxidative  ATP  synthesis  [8‐10]  and  therefore measurement  of  the  time 

constant  of  PCr  recovery  (PCr)  provides  information  about mitochondrial  function.  This 

technology was  very  recently  applied  to  study  in  vivo mitochondrial  function  in patients 

with type 2 diabetes [11]. 

Several studies have shown that cytosolic pH has a strong  influence on the kinetics of PCr 

recovery [1, 12‐21]. The slower PCr recovery in the presence of intracellular acidosis could 

reflect  a  decreased mitochondrial  respiration  at  low  pH.  However,  there  are  conflicting 

data about  the effects of  low pH on  respiratory  rates,  ranging  from  inhibition  [22‐24], a 

very small or no significant effect  [19, 25‐29]  to even an  increased effectiveness  [30‐31]. 

PCr  recovery  in  the presence of  intracellular  acidosis  could  also be  slowed down due  to 

factors  downstream  of  oxidative  phosphorylation,  i.e.  increased  ATP  consumption  by 

cellular  ion  pumps  [21,  32‐34]  and/or  a  pH‐dependent  shift  in  the  creatine  kinase 

equilibrium [35‐36]. 

As an alternative  to  PCr,  the  time  constant of ADP  recovery  (ADP)  can be used  to assess oxidative capacity. The concentration of ADP  is  the principal error  signal  in  the  feedback 

loop  controlling mitochondrial oxidation  and  therefore ADP  recovery  is one of  the most 

sensitive MRS indices of mitochondrial function [37]. Finally, the maximum aerobic capacity 

(Qmax), which can be calculated from the 31P MRS recovery data, provides a parameter for 

mitochondrial function. Both ADP [1‐2, 17‐18, 20] and Qmax [18‐19, 21] have been shown to 

be independent of end‐exercise pH. A drawback of the use of these parameters compared 

to  PCr  is  that  they are  indirectly derived  from  the PCr  recovery data, using a number of 

assumptions. 

It  has  been  suggested  that  PCr  can  be  normalized  for  end‐exercise  pH  [13,  18,  21]. 

However,  a  general  correction  for  pH  can  only  be  applied  if  there  are  no  intersubject 

differences  in  the  pH  dependence  of  PCr  recovery  kinetics.  In  previous  studies,  data  of 

different subjects have been grouped to investigate the effect of pH on PCr recovery [1, 12‐

21]. We investigated the effect of acidosis on PCr in the M. vastus lateralis on a subject‐by‐

subject  basis.  To  this  end,  each  subject  performed  10‐13  exercise  protocols  of  different 

intensity  to  reach  different  levels  of  acidification.  Furthermore,  we  studied  the  pH 

dependence of ADP and Qmax and we determined the kinetics of proton efflux at the start of 

recovery to obtain a measure of the rate of pH recovery. 

Chapter 3 

56 

Materials and Methods 

Subjects 

Four male and two female healthy subjects participated  in this study. The nature and the 

risks  of  the  experimental  procedures were  explained  to  the  subjects  and  all  gave  their 

written  informed  consent  to  participate  in  the  study, which was  approved  by  the  local 

Medical  Ethical Committee of  the Máxima Medical Center, Veldhoven,  The Netherlands. 

Subjects varied  in age (mean age: 31 ± 12 years; five subjects  in the range of 20‐33 years 

and one subject of 53 years), body mass index (BMI) (mean BMI: 21.1 ± 1.8 kg/cm2; range: 

17.9‐22.6) and daily activity level, i.e. level of activities during daily living, work and leisure 

time (e.g. sports). However, none of the subjects was highly trained. 

31P Magnetic resonance spectroscopy 

31P MRS of the M. vastus lateralis was performed by using a 1.5‐Tesla whole‐body scanner 

(Gyroscan  S15/ACS,  Philips  Medical  Systems,  Best,  The  Netherlands).  Subjects  were 

measured  in a  supine position. After collecting  transversal and  sagittal  scout  images,  the 

magnetic  field  homogeneity was  optimized  by  localized  shimming  on  the  proton  signal 

using the body coil. The 31P signals were collected using a 6‐cm diameter surface coil placed 

over the M. vastus lateralis. From the dimension of the coil and the size and geometry of a 

typical upper leg, it was estimated that the majority of the signal in the unlocalized 31P MRS 

measurements originated from the M. vastus  lateralis, with minimal contaminations from 

the adjacent M. rectus femoris and underlying M. vastus  intermedius. Data were acquired 

following  a  90  adiabatic  excitation  pulse with  a  sweep width  of  2  kHz  and  1024  data points. Spectra were acquired using a repetition time of 3 s during a rest‐exercise‐recovery 

protocol (2 scans/spectrum yielding a time resolution of 6 s, total of 150 spectra/15 min). 

The  first 20  spectra  (2 min) were measured at  rest, after which  the  subjects  started  the 

exercise (see below). The duration of the exercise varied per subject, but never exceeded 9 

min, so that at least 4 min of recovery were recorded. 

Exercise protocol inside magnet 

All  subjects  performed  a  single  leg  extension  exercise  in  the  supine  position  inside  the 

magnet, which has been shown  to be  limited  to  the  four muscles of  the quadriceps  [38]. 

The  exercise  was  conducted  by  rhythmically  lifting  a  lever  (resting  on  the  lower  leg, 

proximal of the foot) connected to an ergometer. The upper leg was supported with the hip 

joint  in  a  30 degrees  ante  flexed position  and  immobilized with  two  3  cm wide Velcro© 

straps.  One  contraction  was  performed  every  1.5  s  acoustically  guided  by  a  digital 

metronome. The  initial workload varied per subject and ranged between 7.5 and 12.5 W. 

Effect of acidosis on PCr recovery related to proton efflux 

57 

This  level was maintained  for  the  first min and  the workload was  then  increased by 5 W 

each min. To achieve different  levels of metabolic activation, and hence different degrees 

of cytosolic acidification, subjects performed exercises of different durations. Each subject 

performed 10‐13 different protocols during 4‐9 different sessions  in a  randomized order, 

with at  least 15 min  rest between different protocols within one session. The position of 

the 31P surface coil was marked on the leg during the first session and the coil was placed at 

the same location during the next sessions. 

The  reproducibility  of  the  31P MRS measurements was  determined  in  one  subject.  This 

subject performed  10  times  the  same protocol during  5 different  sessions.  In one other 

subject, it was tested whether the position of the 31P surface coil on the M. vastus lateralis, 

when varied  in  the proximal and distal direction,  influenced  the  31P MRS measurements. 

For  this  purpose,  the  subject  performed  5  times  the  same  protocol,  with  a  maximal 

difference of 15 cm of the position of the 31P surface coil in the proximo‐distal direction. 

Data analysis 

Spectra  were  fitted  in  the  time  domain  by  using  a  nonlinear  least  squares  algorithm 

(AMARES)  in  the  jMRUI  software  package  [39].  PCr,  Pi  and  ATP  signals  were  fitted  to 

Lorentzian  line shapes. The  three ATP peaks were  fitted as  two doublets and one  triplet, 

with equal amplitudes and line widths and prior knowledge for the J‐coupling constant (17 

Hz). For the time series, the PCr line width during recovery was constrained to the average 

PCr  line width during recovery  (excluding the  first 10 data points), obtained  from a prior, 

unconstrained fit. 

Absolute  concentrations  of  the  phosphorylated  metabolites  were  calculated  after 

correction for partial saturation and assuming that [ATP] is 8.2 mM at rest [12]. Intracellular 

pH was calculated from the chemical shift difference between the Pi and PCr resonances (; measured in parts per million) using the following formula [9]: 

 

6.753.27

5.63 . 1 

 

The  free  cytosolic  ADP  concentration  ([ADP]) was  calculated  from  pH  and  [PCr]  using  a 

creatine kinase equilibrium constant  (Keq) of 1.66×109 M‐1  [35] and assuming  that 15% of 

the total creatine is unphosphorylated at rest [33], using the equation: 

 

Chapter 3 

58 

. 2 

  

Recoveries  of  PCr  and  ADP  were  fitted  to  mono‐exponential  functions  using  Matlab 

(version  6.1,  Mathworks,  Natick,  Massachusetts,  USA).  Results  are  expressed  as  the 

metabolite’s time constant of recovery, i.e. PCr and ADP. 

Calculation  of  the  initial  rate  of  PCr  recovery  (VPCr) was  based  on  the  PCr  recovery  rate 

(1/PCr) and the difference between the resting and end‐exercise PCr concentrations (PCr) [40]: 

 

1· ∆ . 3 

 

The  calculation  of  the maximum  aerobic  capacity  (Qmax) was  either  based  on  the  ADP‐

control model  [41],  in which VPCr has  a hyperbolic dependence on  the end‐exercise ADP 

concentration ([ADP]end) according to Michaelis‐Menten kinetics with a Km of 30 M [40]: 

 

· 1 . 4 

 

or on a linear approximation of the ADP‐control model 

 

1

. 5 

 

which  is  equivalent  to  the  non‐equilibrium  thermodynamic  control  model  [37,  42]. 

However, this approximation is only valid when pH changes are small. 

Effect of acidosis on PCr recovery related to proton efflux 

59 

The proton efflux rate at the start of recovery was calculated as described by Kemp et al. 

[43‐44] from the changes in the PCr concentration and pH during the first 12 s of recovery 

according to 

 

. 6 

 

where    is  the  amount  of  protons  consumed  per mole  of  PCr  hydrolysis  ( 1/ 1

10 .   [45]),  m  is  the  amount  of  protons  produced  per  mole  of  oxidative  ATP 

synthesis  ( 0.16/ 1 10 .   [46])  and    is  the  cytosolic  buffering  capacity  (20 slykes (i.e. mmol l‐1 pH‐1) plus the calculated contribution of Pi, which is given by 2.3 · ·

1  [47]). The apparent efflux rate constant was calculated as  / Δ , where 

pH  is defined as   [37]. Both the proton efflux rate E and the apparent efflux 

rate  constant  at  the  start of  recovery depend on  the end‐exercise pH  (pHend)  [44] and 

therefore only  the data sets with a pHend between 6.6 and 6.8 were used  to calculate an 

average value  for E and   for each subject. These data sets with  rather  low pHend values 

were chosen for two reasons: (1) they had a greater PCr depletion and therefore a  larger 

PCr resynthesis rate and proton production rate at the start of recovery and (2) they had a 

greater increase in Pi and therefore a better visible Pi peak at the start of recovery, which is 

important for an accurate and precise pH determination. 

Figure 1. Typical M. vastus  lateralis 31P 

MR  spectra  for  one  subject  at  rest 

(panel A, number of scans = 60), at the 

end  of  exercise  (panel  B,  number  of 

scans  =  2)  and  at  15  and  93  s  of 

recovery (panels C and D, respectively, 

number  of  scans  =  2).  Spectra  were 

processed with 5 Hz line broadening. Pi 

indicates  inorganic  phosphate;  PDE, 

phosphodiesters;  PCr,  phospho‐

creatine;  and  ,    and    indicate  the three  phosphate  groups  of  ATP.  For 

this  subject  the  PCr  depletion  at  the 

end of exercise (panel b) was 65% and 

the  corresponding  pHend  was  6.93. 

Note that the Pi signal is not discernible 

in the spectrum in panel d. 

Chapter 3 

60 

Statistics 

All data are expressed as means ± standard deviation  (SD). Reproducibility  is  reported as 

the  coefficient  of  variation  · 100 .  Linear  regression  analyses  were 

performed  using  the  SPSS  14.0  software  package  (SPSS  Inc,  Chicago,  IL,  USA).  Level  of 

statistical significance was set at p < 0.05.  

Results  

Reproducibility 

Figure 1 shows typical examples of 31P MR spectra from a subject’s vastus lateralis muscle 

at rest, at the end of exercise and at two time points during recovery. For the same data 

set, PCr and ADP concentrations are plotted as a function of time in Figure 2. At the end of 

recovery, both PCr and ADP concentrations are  identical to the resting condition. Figure 2 

also illustrates the mono‐exponential fits of the PCr and ADP recoveries. The reproducibility 

of the determination of 31P MRS parameters for mitochondrial function,  i.e. PCr, ADP, VPCr, 

Qmax‐ADP and Qmax‐lin, was determined  in one subject and  the results are shown  in Table 1. 

Table 1. Reproducibility of 31P MRS recovery parameters. 

    PCr (s)  ADP (s)  VPCr (mM/s)  Qmax‐ADP 

(mM/s) 

Qmax‐lin 

(mM/s) 

     all  mean  29.4 11.8 0.86 1.17 1.38 

(n = 10)  SD  3.3 0.8 0.09 0.10 0.14 

  CV (%)  11.3 6.7 10.7 8.4 10.4 

     

pHend > 6.9  mean  27.9 12.2 0.88 1.18 1.43 

(n = 7)  SD  1.9 0.5 0.09 0.09 0.12 

  CV (%)  6.9 4.0 9.8 7.9 8.4 

PCr,  phosphocreatine  (PCr)  recovery  time  constant;  ADP,  adenosine  diphosphate  (ADP)  recovery  time 

constant;  VPCr,  initial  rate  of  PCr  recovery  based  on  the  PCr  recovery  rate  (1/PCr)  and  the  difference between  the  resting  and  end‐exercise  PCr  concentrations;  Qmax‐ADP,  maximum  rate  of  oxidative  ATP 

synthesis calculated according  to  the ADP‐control model,  i.e. based on VPCr  related  to end‐exercise ADP 

concentration and an assumed Km of 30 μM; Qmax‐lin, maximum rate of oxidative ATP synthesis calculated 

by  a  linear  approximation  of  the  ADP‐control  model.  Coefficient  of  variation  (CV)  was  calculated  as 

/ · 100. The upper 3 rows are the results from all 10 data sets. The lower 3 rows are the results 

from the 7 data sets with an end‐exercise pH (pHend) higher than 6.9. 

Effect of acidosis on PCr recovery related to proton efflux 

61 

When  including all 10 measurements, the CV ranged  from 6.7%  for ADP to 11.3%  for PCr. However, even though the exercise protocol was  identical for all 10 measurements, there 

was still some variation  in pHend. For 7 of the 10 data sets pHend ranged between 6.91 and 

6.96 (mean pHend: 6.93 ± 0.02), while for 3 data sets pHend was lower than 6.9, i.e. 6.87, 6.84 

and 6.81,  respectively. When only  the 7 data sets with pHend above 6.9 were considered, 

the CV for PCr became 6.9%, which is comparable to other studies [19, 34]. No systematic 

differences were observed for the two measurements performed during one session. 

In one other subject,  it was tested whether the position of the  31P surface coil on the M. 

vastus  lateralis, when varied  in  the proximal and distal direction,  influenced  the  31P MRS 

measurements.  For  the  5  measurements,  with  a  maximal  difference  of  15  cm  of  the 

position of the 31P surface coil in the proximo‐distal direction, the CVs for PCr and ADP were 4.5 and 3.0%, respectively. Therefore,  it can be concluded that within a certain range the 

exact positioning of  the  31P surface coil does not affect  the parameters  for mitochondrial 

function  and  that  regional  variations  in  fiber  type  composition  in  the  proximo‐distal 

direction of the M. vastus lateralis are probably small. 

End‐exercise status 

To achieve different levels of metabolic activation, and hence different degrees of cytosolic 

acidification,  subjects  performed  10‐13  exercises  of  different  durations.  For  all 

measurements, homeostasis of ATP was maintained throughout the exercise protocol.  

 

Figure 2. PCr  (panel A) and ADP  (panel B)  concentrations during  rest, exercise and  recovery obtained 

from the data set that was also used in Figure 1 with a time resolution of 6 s. The recoveries of PCr and 

ADP (starting at t = 0) were fitted to mono‐exponential functions (solid lines). The time constants for PCr 

and ADP recovery were 26.9 and 11.8 s, respectively. 

Chapter 3 

62 

 

Figure  3.  PCr,  [ADP]end,  PCr,  ADP,  VPCr,  Qmax‐ADP  and  Qmax‐lin  plotted  as  a  function  of  pHend  for  three 

subjects. Linear regression analysis results (solid lines) are shown for significant correlations (p < 0.05). 

Effect of acidosis on PCr recovery related to proton efflux 

63 

None  of  the  subjects  showed  a  split  Pi  peak  during  exercise  or  recovery  and  therefore 

acidosis was not extremely heterogeneous  in  the measured muscle  tissue. The  ranges of 

pHend, PCr and [ADP]end reached for each subject are summarized in Table 2. The smallest 

range in pHend values was obtained for subject 4 and covered 0.3 pH units, while the largest 

range was obtained  for  subject 2  and  covered 0.6 pH units.  For  subject  5, one protocol 

resulted  in a rather  low [ADP]end of 25 M. For all other measurements, [ADP]end was well 

above the accepted Km value of 30 M for oxidative ATP synthesis. In the two top rows of 

Figure 3, PCr and  [ADP]end are plotted as a  function of pHend,  from which  it can be seen 

that PCr was negatively correlated with pHend for all three subjects, whereas [ADP]end was 

not significantly correlated with pHend. 

Table 2. Ranges of pHend, PCr and [ADP]end reached at the end of exercise. 

subject  pHend PCr (mM)  [ADP]end (M) 

 1  6.56 ‐ 7.02 13.6 ‐ 28.1 48.2 ‐ 143.4 

2  6.41 ‐ 6.99 17.2 ‐ 33.2 55.3 ‐ 123.2 

3  6.53 ‐ 7.02 17.3 ‐ 34.5 39.5 ‐ 174.2 

4  6.65 ‐ 6.96 17.4 ‐ 33.7 45.9 ‐ 128.3 

5  6.50 ‐ 6.95  9.8 ‐ 29.9 25.1 ‐ 149.1 

6  6.63 ‐ 7.01 21.1 ‐ 39.1 59.6 ‐ 192.3 

pHend,  intracellular muscle  pH  at  the  end  of  exercise; PCr,  difference  between  the  resting  and  end‐exercise PCr concentrations; [ADP]end, ADP concentration at the end of exercise. 

Table 3. Averages of 31P MRS recovery parameters for the different exercise protocols. 

subject  PCr (s)  ADP (s)  VPCr (mM/s) Qmax‐ADP (mM/s) Qmax‐lin (mM/s) 

     1  32.7 ± 6.3  11.1 ± 2.5 0.71 ± 0.12 0.96 ± 0.08 1.10 ± 0.22 

2  38.4 ± 10.8  10.4 ± 1.3 0.70 ± 0.09 0.97 ± 0.14 1.06 ± 0.29 

3  44.4 ± 12.0  12.3 ± 1.4 0.60 ± 0.11 0.83 ± 0.16 0.94 ± 0.31 

4  37.9 ± 6.0  12.6 ± 1.7 0.66 ± 0.07 0.90 ± 0.07 1.00 ± 0.15 

5  35.0 ± 4.9  13.0 ± 2.1 0.68 ± 0.15 0.97 ± 0.13 1.12 ± 0.18 

6  51.0 ± 9.6  16.1 ± 2.5 0.56 ± 0.05 0.76 ± 0.07 0.86 ± 0.18 

Data are presented as means ± SD.

Chapter 3 

64 

Recovery 

Recoveries of PCr and ADP could be satisfactorily described by mono‐exponential functions, 

also  at  low  pHend  values  (average  R2  values  for  the mono‐exponential  fits were  0.971  ± 

0.025  and  0.915  ±  0.063  for  PCr  and ADP  recovery  data,  respectively).  Table  3  lists  the 

average values for PCr, ADP, VPCr, Qmax‐ADP and Qmax‐lin for all subjects. For each subject, there 

was a strong negative linear relationship between PCr and pHend. The third row of Figure 3 

shows the correlation between PCr and pHend for three of the subjects. Around pHend 7, PCr was very similar for these three subjects, but at lower pHend values PCr differed. Therefore, the pH dependence of PCr differed, with  subject 1  showing  the weakest pH dependence and subject 3 showing  the strongest pH dependence. The  results of  the  linear  regression 

analyses  for all subjects are shown  in Table 4. The slope of the relation between PCr and 

Table 4. Correlation of 31P MRS recovery parameters with end‐exercise pH. 

 subject 1 

(n = 10) 

subject 2 

(n = 12) 

subject 3 

(n = 13) 

subject 4 

(n = 12) 

subject 5 

(n = 13) 

subject 6 

(n = 11) 

grouped 

data     

(n = 71) 

PCr  R  ‐0.99* ‐0.98* ‐0.94* ‐0.87* ‐0.85* ‐0.94*  ‐0.74* 

  slope (s/U)  ‐42.9  ‐57.9 ‐75.3 ‐56.2 ‐33.0 ‐62.9   ‐54.1  

  PCr at pH 7 (s)  25.3  22.8 26.4 26.8 28.7 39.6 28.6 

       

ADP  R  0.86* 0.40 0.53 0.78* 0.13 0.89*  0.41* 

  slope (s/U)  14.8  2.9 4.9 14.2 2.3 15. 8   8.0  

       

VPCr  R  0.13  0.74* 0.55 ‐0.26 0.06 0.47 0.24* 

  slope (mM/s/U)  0.11  0.36 0.41 ‐0.20 0.07 0.16   0.20  

       

Qmax‐ADP  R  0.52  0.88* 0.83* 0.40 0.14 0.79*  0.47* 

  slope (mM/s/U)  0.30  0.67 0.86 0.31 0.14 0.37   0.46  

       

Qmax‐lin  R  0.96* 0.97* 0.92* 0.85* 0.85* 0.95*  0.83* 

  slope (mM/s/U)  1.45  1.56 1.88 1.41 1.24 1.18   1.41  

R, correlation coefficient determined from a linear regression analysis, *p < 0.01; slope is representing the 

steepness of the correlation; U, pH unit; PCr at pH 7 was obtained  from the  linear relation between PCr and end‐exercise pH. 

Effect of acidosis on PCr recovery related to proton efflux 

65 

pHend ranged  from  ‐33.0 to  ‐75.3 s per pH unit. For  five of  the six subjects, PCr at pHend 7 

calculated  from  the  linear  relation between PCr at pHend was very  similar. Only  the older 

subject, subject 6, had a longer PCr at pHend 7. 

The post‐exercise ADP recovery was faster than the PCr recovery (Table 3). For subjects 1‐5, 

ADP was again very similar, while subject 6 had a longer ADP (Table 3). In the fourth row of Figure 3, ADP is plotted against pHend for three of the subjects. For subjects 2, 3 and 5, ADP did not depend on pHend (Table 4). However, for subjects 1, 4 and 6, ADP was significantly positively correlated with pHend (Table 4). 

VPCr is a measure of the actual mitochondrial ATP synthesis rate and according to the ADP‐

control model [41], VPCr has a hyperbolic dependence on [ADP]end (Eq. [4]). For all but one 

measurement, [ADP]end was well above the accepted Km value of 30 M for oxidative ATP 

synthesis and  therefore differences  in  [ADP]end will not have a  large effect on VPCr. From 

Figure 3, it can be seen that PCr and PCr vary in the same direction as a function of pHend. 

As a consequence, for five of the subjects, VPCr was independent of pHend (Table 4). Only for 

subject  2,  a  significant  positive  correlation  between VPCr  and  pHend was  found  (Figure  3, 

Table 4). 

The average values of Qmax‐ADP were smaller than the average values of Qmax‐lin (Table 3). In 

accordance with the longer PCr (at pH 7) and ADP, subject 6 also showed smaller values for 

Qmax‐ADP and Qmax‐lin  compared  to  the other  subjects  (Table 3). Qmax‐ADP  showed  significant 

positive correlations with pHend for three of the six subjects  (Figure 3, Table 4). These are 

the subjects with the largest correlation coefficients for VPCr versus pHend. For each subject, 

there was a strong positive linear relationship between Qmax‐lin and pHend (Figure 3, Table 4). 

 

Figure 4. Correlations between the slope of the relation between PCr and pHend and (panel A) the proton 

efflux rate E (R = 0.91, p = 0.03) and (panel B) the apparent efflux rate constant  (R = 0.96, p = 0.01) for five of the six subjects. 

Chapter 3 

66 

For subject 5, the proton efflux rate E and the apparent efflux rate constant  could not be determined. For the other five subjects, the mean total cytosolic buffering capacity  at the start  of  recovery  amounted  35  ±  1  slykes,  the mean  proton  efflux  rate  E  was  16  ±  3 

mM/min and the mean apparent efflux rate constant  was 38 ± 6 mM/(min ∙ pH unit). In 

Figures 4a and 4b, the slope of the relation between PCr and pHend is plotted against E and 

, respectively. The slope of the relation between PCr and pHend was positively correlated 

with both E (R = 0.91, p = 0.03) and  (R = 0.96, p = 0.01). 

Discussion 

Several studies have shown that cytosolic pH has a strong  influence on the kinetics of PCr 

recovery [1, 12‐21]. In order to establish a relationship between e.g. PCr and pHend, one or a 

few  data  points  of  different  subjects  have  generally  been  grouped.  However,  this 

procedure  will  not  reveal  intersubject  differences  in  the  pH  dependence  of  PCr  and, moreover, the effect of pH on PCr recovery might be exaggerated by a systematic bias. We 

investigated  the  effect  of  acidosis  on  PCr  recovery  on  a  subject‐by‐subject  basis  by 

collecting 10‐13 data  sets per  subject, using protocols of different  intensity and duration 

resulting  in different degrees of  cytosolic acidification. We  showed  that  for each  subject 

there is a strong negative linear relationship between PCr and pHend, but that the slopes are 

different for different subjects, ranging from ‐33.0 to ‐75.3 s per pH unit. This implies that 

no general formula can be applied to correct PCr for differences in pHend. Qualitatively and 

quantitatively,  the  results obtained when  the data of  the different  subjects are grouped 

(Table  4;  last  column)  are  in  good  agreement with  data  from  the  literature  on  the  pH 

dependence of PCr  recovery kinetics measured  in different muscle  types,  revealing  linear 

relationships between PCr and pHend (or the minimum pH reached during recovery; pHmin) 

with slopes ranging from roughly ‐20 to ‐90 s per pH unit [14, 16‐21]. 

The slower PCr recovery  in the presence of  intracellular acidosis could reflect a decreased 

mitochondrial  respiration  at  low  pH.  The mechanisms  by which  protons  affect  oxidative 

phosphorylation  include (1) a direct effect on the mitochondria,  i.e. a decreased oxidative 

capacity  at  low  pH,  or  (2)  an  indirect  effect,  because  a  low  pH  decreases  the  ADP 

concentration through the constraints set by the creatine kinase (CK) equilibrium resulting 

in a lower signal for mitochondrial ATP supply. There are conflicting data about the effects 

of low pH on respiratory rates. Hypercapnic acidosis has been found to reduce the aerobic 

capacity of perfused cat  soleus muscle by a  factor of  three  [22]. However,  it  is not clear 

whether this change was caused by acidosis per se or by some other effect of hypercapnic 

perfusion. Moreover,  it has been shown that  in skinned fibers from rat soleus muscle the 

rate  of  respiration  is  impaired  by  lactic  acidosis  and  elevated  concentrations  of  Pi  [23]. 

Jubrias et al. showed that intracellular acidosis inhibits oxidative phosphorylation in vivo in 

Effect of acidosis on PCr recovery related to proton efflux 

67 

hand  and  lower  limb  muscle  and  their  results  suggest  that  pH  has  a  direct  effect  on 

mitochondrial  function,  because  oxidative  flux  did  not  increase  during  exercise  that 

generated acidosis despite a  significant  rise  in  [ADP]  [24].  In  contrast,  in vitro  studies on 

isolated mitochondria  suggest  that  the effect of acidosis on oxidative phosphorylation  is 

very small [25‐27, 29] and not significant  in the range pH 6.5‐7.5 [25]. Likewise, an  in vivo 

study of electrically stimulated rabbit muscle showed that CO2‐induced acidosis (to pH 6.7) 

did  not  decrease  the  maximum  aerobic  capacity  [28].  Moreover,  in  human  medial 

gastrocnemius muscle aerobic ATP synthesis rates were not lowered by acidosis [19]. Other 

reports have suggested that mitochondrial respiration is even more effective at low pH [30‐

31]. 

PCr  recovery  in  the presence of  intracellular  acidosis  could  also be  slowed down due  to 

factors downstream of oxidative phosphorylation, consistent with the observation that the 

recovery  of  oxyhemoglobin  saturation  measured  by  near‐infrared  spectroscopy  is  not 

affected by acidosis [15]. Ion pumping reactions also require ATP and therefore not all the 

ATP that  is synthesized oxidatively during recovery  is available for the CK reaction. At  low 

pH the amount of ATP that is shuttled to cellular ion pumps might be increased [21, 34] in 

order to reestablish pH homeostasis. It has been reported that  ion pumping reactions can 

consume about 43% of  the  total ATP produced  [32‐33]. The slow PCr recovery at  low pH 

has also been attributed to a pH‐dependent shift in the CK equilibrium. The CK equilibrium 

constant (Keq) depends on proton and metal ion concentrations [35]. Iotti et al. showed that 

at  the end of muscular exercise, Keq can  increase even more  than  threefold compared  to 

rest,  due  to  a  decrease  in  pH  and  an  increase  in  the  free  Mg2+  concentration  [36]. 

Therefore,  net  PCr  resynthesis  throughout  recovery  behaves  as  a  function  of  both 

intracellular pH and net ATP flux [1, 19]. This was confirmed by a model for ATP production 

(according to the ADP‐control model; see Eq. [4]) and pH recovery, which reproduced the 

main features of recovery from exercise, including the feature that PCr recovery is slowed 

when the pH is low [48]. Finally, with the incremental exercise protocol that we used, part 

of  the  pH  dependence  of  PCr  recovery  could  originate  from  selective  fiber  type 

recruitment,  i.e.  recruitment of mainly oxidative  type 1  fibers  (with short PCr) during  the low exercise  intensities with a high pHend and recruitment of relatively more type 2 fibers 

(with long PCr) during the higher exercise intensities with a low pHend. 

The  observed  intersubject  differences  in  the  pH  dependence  of  PCr  are  likely  to  reflect differences  in  the  rate  of  pH  recovery. Unfortunately,  the  recovery  of  pH  could  not  be 

investigated, because  the Pi peak consistently disappeared within  the noise after about 1 

min of recovery (Fig. 1d) and for the exercises at higher intensities was not fully recovered 

by the end of the time series. This phenomenon has been reported before in the literature 

[9, 14, 17, 20, 34, 49] and has been attributed to sequestering of Pi inside the mitochondria 

where it becomes “NMR‐invisible” [1, 50], or trapping of Pi into the glycogenolytic pathway 

during exercise leading to phosphomonoester (PME) production [51]. The recovery of pH is 

Chapter 3 

68 

much slower than PCr recovery [1, 17, 19, 52] and therefore  it was attempted to  increase 

the  signal‐to‐noise  ratio of  the Pi peak by  the  summation of  spectra during  the  recovery 

phase. However, even when 4 spectra were added, yielding a time resolution of 24 s, the 

position of the Pi peak could not be accurately determined. 

The  recovery  of  cytosolic  pH  to  the  resting  value  is  a  function  of  net  proton  efflux  [9]. 

Several mechanisms  are  responsible  for proton efflux,  such  as  sodium/proton exchange, 

sodium‐dependent chloride/bicarbonate exchange, efflux of undissociated  lactic acid, and 

outward proton/lactate cotransport. The change in proton concentration in the cell can be 

calculated from the change in pH multiplied by the cytosolic buffer capacity and equals the 

proton efflux rate minus the rate of proton generation by PCr resynthesis and aerobic ATP 

production  [43].  We  calculated  proton  efflux  rates  E  and  apparent  proton  efflux  rate 

constants  at the start of recovery. Both E and  are pH dependent [44] and therefore only the data sets with a pHend between 6.6 and 6.8 were used to calculate an average value for 

E and  for each subject. The mean values that we found for the total cytosolic buffering 

capacity , E and  correspond with values reported by Kemp et al., calculated for a similar 

pHend range with exactly the same formulas [44]. The slope of the relation between PCr and pHend was positively correlated with both E (R = 0.91, p = 0.03) and  (R = 0.96, p = 0.01), indicating  that subjects with a smaller pH dependence of PCr have a higher proton efflux rate, most likely as a result of a better blood flow due to e.g. an increased capillary density 

possibly related to the subject’s fiber type composition. Higher proton efflux rates will lead 

to faster pH recovery and therefore the observed correlations support our hypothesis that 

the  intersubject differences  in the pH dependence of PCr are related to differences  in the rate of pH recovery. 

To  overcome  the  problems  of  pH  determination  during  recovery  associated  with  the 

transient loss of Pi signal, Chen et al. modeled the pH recovery based on the CK equilibrium 

by considering  the  transition  from exercise  to recovery as a step  function  input  [53]. The 

entire  pH  recovery was  characterized  by  calculating  the  time  required  for  pH  recovery 

(tpHrec) and a strong linear correlation was observed between tpHrec and the half‐time of PCr 

recovery in normal subjects (average pHend ~ 6.7). This strong correlation corroborates the 

link between the PCr recovery rate and the overall pH recovery rate. Moreover, the  large 

variation  in  tpHrec within normal  subjects  (tpHrec  ranged  from about 2‐18 min)  implies  that 

differences  in  the  pH  dependence  of  PCr  can  be  significant,  as we  demonstrated  in  the 

present study. Certain disorders, e.g. hypertension and mitochondrial myopathy  [43] and 

dermatomyositis  and  polymyositis  [54],  are  associated  with  altered  proton  efflux  from 

muscle  fibers, which will affect  the  rate of pH  recovery. Therefore, when  comparing PCr 

recovery measurements between patients and controls, differences  in proton efflux rates 

or rates of pH recovery should be considered, as these might lead to systematic changes of 

PCr, in particular when pHend is low. 

Effect of acidosis on PCr recovery related to proton efflux 

69 

As  an  alternative  to  PCr,  the  kinetics  of  ADP  recovery  can  be  used  to  assess  oxidative capacity.  As  [ADP]  is  the  principal  error  signal  in  the  feedback  loop  controlling 

mitochondrial  oxidation,  ADP  recovery  is  one  of  the  most  sensitive  MRS  indices  of 

mitochondrial function [37]. It has been shown that in contrast to PCr, ADP is independent of end‐exercise pH [1‐2, 17‐18, 20], which was confirmed by a theoretical model [48]. We 

investigated  the  pH  dependence  of  ADP  for  each  subject.  For  3  subjects  ADP  was  not significantly  correlated  with  pHend,  while  for  the  3  other  subjects  ADP  was  positively correlated with pHend,  i.e. ADP  recovery became  faster at  low pH. This phenomenon was 

also  observed  by  Larson‐Meyer  et  al.  [34],  but  we  doubt  that  it  has  any  physiological 

meaning.  It has been  reported  that  the  recovery of ADP  is not always mono‐exponential 

and  that  [ADP]  can  decrease  below  the  resting  concentration  during  the  second min  of 

recovery  [17].  The  size  and  duration  of  this  so‐called  ADP  undershoot  was  found  to 

correlate with pHmin [17]. We also observed an ADP undershoot  in some of our data sets. 

However,  it was  difficult  to  quantify  this  effect,  as  the  undershoot  occurs  in  the  period 

during which the Pi peak becomes invisible, resulting in a less reliable pH estimation. When 

the ADP recovery data with an undershoot are fitted with a mono‐exponential function, the 

time constant will be underestimated  [55] and  this could explain  the positive correlation 

between ADP and pHend. Furthermore, it was assumed that the CK equilibrium constant was 

not  affected  by  the  different metabolic  conditions  present  after  exercise  and  therefore 

changes in pH and the free Mg2+ concentration [56], in particular for the exercises at higher 

intensities, are sources of error for the [ADP] calculation which might lead to deviations in 

ADP. 

VPCr  is a measure of  the actual mitochondrial ATP  synthesis  rate and  therefore does not 

represent  an  absolute  measure  of  oxidative  capacity.  Still,  a  number  of  studies  have 

reported that VPCr is independent of pH [18‐19, 21]. This is a consequence of [ADP]end being 

either similar for different degrees of acidification [21] or well above the accepted Km value 

of 30 M for oxidative ATP synthesis [18‐19]. The  latter was also the case for most of our 

measurements  and  for  five  of  the  subjects  VPCr was  independent  of  pHend.  VPCr  can  be 

calculated from the product of 1/PCr and PCr (Eq. [3]) [18, 21, 40], like in our study, or VPCr 

can be measured directly from the first data points (typically 10‐14 s) [19‐20, 34]. Boska et 

al. applied both methods and  found good correlations between calculated and measured 

VPCr  in  controls  (R  =  0.753)  and  patients with  peripheral  vascular  occlusive  disease  (R  = 

0.646) [20]. However, Walter et al. observed that at low pH (pHend 6.45) the calculated VPCr 

was  about  two  times  smaller  than  the measured  VPCr  [19].  Under  conditions  in  which 

intracellular pH is decreased, any model that relies on PCr is no longer valid and VPCr should 

be measured directly from the initial phase of recovery. However, this method is extremely 

sensitive to sampling rate and signal‐to‐noise values [19]. Moreover, it has been shown that 

VPCr measured from the first 10 s of recovery is underestimated by up to 56% and that a 1‐2 

s time window is needed for the determination of VPCr, requiring very high time‐resolution 31P MRS data [57]. The fact that VPCr calculated from PCr was still  independent of pHend  in 

Chapter 3 

70 

five of our subjects results from the fact that 1/PCr and PCr vary in opposite directions as a function of pHend (Fig. 3). For the sixth subject changes in these two quantities apparently 

did not compensate each other completely. 

In the literature, Qmax‐ADP has been found to be independent of pH [18, 21], although in the 

study of Walter et al. only Qmax‐ADP based on the measured VPCr was pH independent [19]. In 

our study, Qmax‐ADP was based on the calculated VPCr and [ADP]end (Eq. [4]). Although VPCr and 

[ADP]end  were  not  significantly  correlated  with  pHend  (except  for  one  subject),  these 

parameters  tend  to vary  in opposite directions as a  function of pHend  (Fig. 3),  resulting  in 

significant positive correlations between Qmax‐ADP and pHend for three of the six subjects. For 

each subject, there was a strong positive linear relationship between Qmax‐lin and pHend. Qmax‐

lin was calculated as  the  inverse of PCr multiplied by  [PCr]rest  (Eq.  [5]). Within one subject, 

[PCr]rest was more or  less constant within the time span of the study and therefore Qmax‐lin 

was equivalent to the inverse of PCr, showing an equally strong relationship with pHend. The 

slopes of  the  relation between Qmax‐ADP and pHend were much smaller  than  for Qmax‐lin and 

thus at  low pH the error  is smaller for Qmax‐ADP. However,  in accordance with Walter et al. 

[19], our data show that none of the models that rely on PCr are reliable to predict Qmax in 

the presence of intracellular acidosis [19]. 

In  conclusion,  intracellular  acidosis  slowed  PCr  recovery  and  the  pH  dependence  of  PCr differed among subjects, ranging from ‐33.0 to ‐75.3 s per pH unit. The effect of acidosis on 

PCr recovery kinetics after exercise correlated with the kinetics of proton efflux at the start 

of recovery, strongly  indicating that the  intersubject differences  in the pH dependence of 

PCr reflect differences  in the rate of pH recovery. Our study  implies that simply correcting 

PCr  for  end‐exercise  pH  using  a  general  formula  is  not  adequate,  in  particular  when 

comparing patients and controls, as certain disorders are characterized by altered proton 

efflux from muscle fibers. Also, matching for end‐exercise pH is not sufficient when subject 

groups systematically differ  in proton efflux kinetics. Therefore, PCr can only be used as a measure  of  mitochondrial  function  when  end‐exercise  pH  is  close  to  resting  values. 

Avoiding  a decrease  in  intracellular pH  along with  a  sufficient drop  in PCr  to model PCr 

recovery  may  however  be  difficult  in  untrained  subjects  or  patients  [19].  An  exercise 

protocol that progressively increases work, like we used in this study, has been reported to 

be successful  in decreasing PCr without severe acidification as opposed  to sustained‐load 

exercise [19, 24]. Indeed, we obtained data sets with pHend close to 7 with a drop in PCr of 

roughly 50%. Alternatively, one could use an exercise protocol of short duration (9 s) with 

very  rapid  contractions,  which  has  the  advantage  that  it  is  believed  to  simultaneously 

recruit all fibers [19], or a gated protocol in which the acquisition is gated to contractions of 

short duration without significant muscle acidification that are repeated  in a steady state 

for as many times as necessary to obtain the desired signal‐to‐noise ratio [58]. The kinetics 

of  ADP  recovery  is  independent  of  end‐exercise  pH.  Disadvantages  of  using  ADP  as  a measure of mitochondrial  function  are  the  complex  time‐dependent undershoot of ADP 

Effect of acidosis on PCr recovery related to proton efflux 

71 

during recovery and the assumptions that have to be made to calculate [ADP] [17]. Qmax can 

only be used when based on VPCr directly measured  from  the  initial recovery data points. 

However,  the  reproducibility of  the  latter parameter  is much  lower  than  for PCr and ADP [19]. 

Acknowledgements 

We are very grateful  to  Jan van Ooyen and Peter Coolen  for  their  continuing  support  in 

maintaining  the MR  scanner. We  also  like  to  express  our  appreciation  to  the  research 

volunteers who participated in this study. 

Chapter 3 

72 

References 1.  Arnold, D.L., P.M. Matthews, and G.K. Radda. Metabolic recovery after exercise and the assessment of 

mitochondrial function in vivo in human skeletal muscle by means of 31P NMR. Magn Reson Med, 1984. 1(3): 307‐15. 

2.  Arnold,  D.L.,  D.J.  Taylor,  and  G.K.  Radda.  Investigation  of  human  mitochondrial  myopathies  by phosphorus magnetic resonance spectroscopy. Ann Neurol, 1985. 18(2): 189‐96. 

3.  Kemp,  G.J.,  D.J.  Taylor,  C.H.  Thompson,  L.J.  Hands,  B.  Rajagopalan,  P.  Styles,  and  G.K.  Radda. Quantitative analysis by 31P magnetic resonance spectroscopy of abnormal mitochondrial oxidation  in skeletal muscle during recovery from exercise. NMR Biomed, 1993. 6(5): 302‐10. 

4.  Kent‐Braun,  J.A.,  R.G. Miller,  and M.W. Weiner. Magnetic  resonance  spectroscopy  studies  of  human muscle. Radiol Clin North Am, 1994. 32(2): 313‐35. 

5.  Radda, G.K., J. Odoom, G. Kemp, D.J. Taylor, C. Thompson, and P. Styles. Assessment of mitochondrial function and control in normal and diseased states. Biochim Biophys Acta, 1995. 1271(1): 15‐9. 

6.  Mattei, J.P., D. Bendahan, and P. Cozzone. P‐31 magnetic resonance spectroscopy. A tool for diagnostic purposes and pathophysiological insights in muscle diseases. Reumatismo, 2004. 56(1): 9‐14. 

7.  Chance, B.,  J.  Im, S. Nioka, and M. Kushmerick. Skeletal muscle energetics with PNMR: personal views and historic perspectives. NMR Biomed, 2006. 19(7): 904‐26. 

8.  Sahlin, K.  Intracellular pH and energy metabolism  in skeletal muscle of man. With special reference to exercise. Acta Physiol Scand Suppl, 1978. 455: 1‐56. 

9.  Taylor, D.J., P.J. Bore, P. Styles, D.G. Gadian, and G.K. Radda. Bioenergetics of  intact human muscle. A 31P nuclear magnetic resonance study. Mol Biol Med, 1983. 1(1): 77‐94. 

10.  Quistorff, B., L. Johansen, and K. Sahlin. Absence of phosphocreatine resynthesis  in human calf muscle during ischaemic recovery. Biochem J, 1993. 291( Pt 3): 681‐6. 

11.  Schrauwen‐Hinderling, V.B., M.E. Kooi, M.K. Hesselink, J.A. Jeneson, W.H. Backes, C.J. van Echteld, J.M. van Engelshoven, M. Mensink, and P. Schrauwen.  Impaired  in vivo mitochondrial  function but  similar intramyocellular  lipid  content  in  patients  with  type  2  diabetes  mellitus  and  BMI‐matched  control subjects. Diabetologia, 2007. 50(1): 113‐20. 

12.  Taylor, D.J., P. Styles, P.M. Matthews, D.A. Arnold, D.G. Gadian, P. Bore, and G.K. Radda. Energetics of human muscle: exercise‐induced ATP depletion. Magn Reson Med, 1986. 3(1): 44‐54. 

13.  Bendahan, D., S. Confort‐Gouny, G. Kozak‐Reiss, and P.J. Cozzone. Heterogeneity of metabolic response to muscular  exercise  in  humans.  New  criteria  of  invariance  defined  by  in  vivo  phosphorus‐31  NMR spectroscopy. FEBS Lett, 1990. 272(1‐2): 155‐8. 

14.  Iotti, S., R. Lodi, C. Frassineti, P. Zaniol, and B. Barbiroli. In vivo assessment of mitochondrial functionality in human gastrocnemius muscle by 31P MRS. The role of pH  in the evaluation of phosphocreatine and inorganic phosphate recoveries from exercise. NMR Biomed, 1993. 6(4): 248‐53. 

15.  McCully, K.K., S. Iotti, K. Kendrick, Z. Wang, J.D. Posner, J. Leigh, Jr., and B. Chance. Simultaneous in vivo measurements  of HbO2  saturation  and  PCr  kinetics  after  exercise  in  normal  humans.  J Appl  Physiol, 1994. 77(1): 5‐10. 

16.  Takahashi, H., M.  Inaki, K.  Fujimoto,  S. Katsuta,  I. Anno, M. Niitsu, and Y.  Itai. Control of  the  rate of phosphocreatine  resynthesis after exercise  in  trained and untrained human quadriceps muscles. Eur  J Appl Physiol Occup Physiol, 1995. 71(5): 396‐404. 

17.  Argov, Z., N. De Stefano, and D.L. Arnold. ADP  recovery after a brief  ischemic exercise  in normal and diseased human muscle‐‐a 31P MRS study. NMR Biomed, 1996. 9(4): 165‐72. 

18.  Lodi, R., G.J. Kemp, S. Iotti, G.K. Radda, and B. Barbiroli. Influence of cytosolic pH on in vivo assessment of human muscle mitochondrial  respiration by phosphorus magnetic  resonance  spectroscopy. Magma, 1997. 5(2): 165‐71. 

19.  Walter, G., K. Vandenborne, K.K. McCully, and J.S. Leigh. Noninvasive measurement of phosphocreatine recovery kinetics in single human muscles. Am J Physiol, 1997. 272(2 Pt 1): C525‐34. 

20.  Boska, M.D.,  J.A. Nelson, N.  Sripathi,  Pipinos,  II, A.D.  Shepard,  and  K.M. Welch.  31P MRS  studies  of exercising human muscle at high temporal resolution. Magn Reson Med, 1999. 41(6): 1145‐51. 

21.  Roussel, M., D. Bendahan, J.P. Mattei, Y. Le Fur, and P.J. Cozzone. 31P magnetic resonance spectroscopy study  of  phosphocreatine  recovery  kinetics  in  skeletal  muscle:  the  issue  of  intersubject  variability. Biochim Biophys Acta, 2000. 1457(1‐2): 18‐26. 

22.  Harkema, S.J. and R.A. Meyer. Effect of acidosis on control of respiration in skeletal muscle. Am J Physiol, 1997. 272(2 Pt 1): C491‐500. 

23.  Walsh, B., T. Tiivel, M. Tonkonogi, and K. Sahlin. Increased concentrations of P(i) and  lactic acid reduce creatine‐stimulated respiration in muscle fibers. J Appl Physiol, 2002. 92(6): 2273‐6. 

24.  Jubrias,  S.A., G.J.  Crowther,  E.G.  Shankland,  R.K. Gronka,  and  K.E.  Conley.  Acidosis  inhibits  oxidative phosphorylation in contracting human skeletal muscle in vivo. J Physiol, 2003. 553(Pt 2): 589‐99. 

Effect of acidosis on PCr recovery related to proton efflux 

73 

25.  Chance,  B.  and  H.  Conrad.  Acid‐linked  functions  of  intermediates  in  oxidative  phosphorylation.  II. Experimental studies of the effect of pH upon respiratory, phosphorylative and transfer activities of liver and heart mitochondria. J Biol Chem, 1959. 234(6): 1568‐70. 

26.  Tobin,  R.B.,  C.R. Mackerer,  and M.A. Mehlman.  pH  effects  on  oxidative  phosphorylation  of  rat  liver mitochondria. Am J Physiol, 1972. 223(1): 83‐8. 

27.  Mitchelson,  K.R.  and  F.J.  Hird.  Effect  of  pH  and  halothane  on muscle  and  liver mitochondria.  Am  J Physiol, 1973. 225(6): 1393‐8. 

28.  Nioka, S., Z. Argov, G.P. Dobson, R.E. Forster, H.V. Subramanian, R.L. Veech, and B. Chance. Substrate regulation of mitochondrial oxidative phosphorylation in hypercapnic rabbit muscle. J Appl Physiol, 1992. 72(2): 521‐8. 

29.  Willis, W.T.  and M.R.  Jackman. Mitochondrial  function  during  heavy  exercise. Med  Sci  Sports  Exerc, 1994. 26(11): 1347‐53. 

30.  Connett,  R.J.  Analysis  of metabolic  control:  new  insights  using  scaled  creatine  kinase model.  Am  J Physiol, 1988. 254(6 Pt 2): R949‐59. 

31.  Funk, C.I., A. Clark,  Jr., and R.J. Connett. A  simple model of aerobic metabolism: applications  to work transitions in muscle. Am J Physiol, 1990. 258(6 Pt 1): C995‐1005. 

32.  Baker,  A.J.,  R.  Brandes,  T.M.  Schendel,  S.D.  Trocha,  R.G. Miller,  and M.W. Weiner.  Energy  use  by contractile and noncontractile processes  in skeletal muscle estimated by 31P‐NMR. Am J Physiol, 1994. 266(3 Pt 1): C825‐31. 

33.  Boska, M. ATP production rates as a function of force level in the human gastrocnemius/soleus using 31P MRS. Magn Reson Med, 1994. 32(1): 1‐10. 

34.  Larson‐Meyer,  D.E.,  B.R.  Newcomer,  G.R.  Hunter,  H.P.  Hetherington,  and  R.L.  Weinsier.  31P  MRS measurement of mitochondrial function in skeletal muscle: reliability, force‐level sensitivity and relation to whole body maximal oxygen uptake. NMR Biomed, 2000. 13(1): 14‐27. 

35.  Lawson, J.W. and R.L. Veech. Effects of pH and free Mg2+ on the Keq of the creatine kinase reaction and other phosphate hydrolyses and phosphate transfer reactions. J Biol Chem, 1979. 254(14): 6528‐37. 

36.  Iotti, S., C. Frassineti, A. Sabatini, A. Vacca, and B. Barbiroli. Quantitative mathematical expressions for accurate  in  vivo assessment of  cytosolic  [ADP] and DeltaG of ATP hydrolysis  in  the human brain and skeletal muscle. Biochim Biophys Acta, 2005. 1708(2): 164‐77. 

37.  Kemp, G.J. and G.K. Radda. Quantitative interpretation of bioenergetic data from 31P and 1H magnetic resonance spectroscopic studies of skeletal muscle: an analytical review. Magn Reson Q, 1994. 10(1): 43‐63. 

38.  Richardson, R.S., L.R. Frank, and L.J. Haseler. Dynamic knee‐extensor and cycle exercise: functional MRI of muscular activity. Int J Sports Med, 1998. 19(3): 182‐7. 

39.  Vanhamme,  L., A.  van  den Boogaart,  and  S. Van Huffel.  Improved method  for  accurate  and  efficient quantification of MRS data with use of prior knowledge. J Magn Reson, 1997. 129(1): 35‐43. 

40.  Kemp, G.J., C.H. Thompson, P.R. Barnes, and G.K. Radda. Comparisons of ATP turnover in human muscle during  ischemic and aerobic exercise using 31P magnetic  resonance  spectroscopy. Magn Reson Med, 1994. 31(3): 248‐58. 

41.  Chance,  B.,  J.S.  Leigh,  Jr.,  B.J.  Clark,  J. Maris,  J.  Kent,  S.  Nioka,  and  D.  Smith.  Control  of  oxidative metabolism and oxygen delivery  in human skeletal muscle: a steady‐state analysis of the work/energy cost transfer function. Proc Natl Acad Sci U S A, 1985. 82(24): 8384‐8. 

42.  Meyer, R.A. A  linear model of muscle  respiration explains monoexponential phosphocreatine changes. Am J Physiol, 1988. 254(4 Pt 1): C548‐53. 

43.  Kemp, G.J., D.J.  Taylor,  P.  Styles,  and G.K.  Radda.  The  production,  buffering  and  efflux  of  protons  in human skeletal muscle during exercise and recovery. NMR Biomed, 1993. 6(1): 73‐83. 

44.  Kemp, G.J., C.H. Thompson, D.J. Taylor, and G.K. Radda. Proton efflux  in human skeletal muscle during recovery from exercise. Eur J Appl Physiol Occup Physiol, 1997. 76(5): 462‐71. 

45.  Wolfe,  C.L.,  H.F.  Gilbert,  K.M.  Brindle,  and  G.K.  Radda.  Determination  of  buffering  capacity  of  rat myocardium during ischemia. Biochim Biophys Acta, 1988. 971(1): 9‐20. 

46.  Mainwood, G.W. and J.M. Renaud. The effect of acid‐base balance on fatigue of skeletal muscle. Can J Physiol Pharmacol, 1985. 63(5): 403‐16. 

47.  Roos, A. and W.F. Boron. Intracellular pH. Physiol Rev, 1981. 61(2): 296‐434. 48.  Styles, P., G.J. Kemp, and G.K. Radda. A model for metabolic control which reproduces the main features 

of recovery from exercise which are observed by 31P MRS. Proceedings of the 11th Annual Meeting of the Society of Magnetic Resonance in Medicine, Berlin, Germany, , 1992: p. 2702. 

49.  Rossiter,  H.B.,  S.A.  Ward,  F.A.  Howe,  J.M.  Kowalchuk,  J.R.  Griffiths,  and  B.J.  Whipp.  Dynamics  of intramuscular  31P‐MRS  P(i)  peak  splitting  and  the  slow  components  of  PCr  and  O2  uptake  during exercise. J Appl Physiol, 2002. 93(6): 2059‐69. 

Chapter 3 

74 

50.  Iotti, S., R. Funicello, P. Zaniol, and B. Barbiroli. Kinetics of post‐exercise phosphate transport  in human skeletal muscle: an  in vivo 31P‐MR  spectroscopy  study. Biochem Biophys Res Commun, 1991. 176(3): 1204‐9. 

51.  Bendahan, D., S. Confort‐Gouny, G. Kozak‐Reiss, and P.J. Cozzone. Pi trapping in glycogenolytic pathway can explain transient Pi disappearance during recovery from muscular exercise. A 31P NMR study in the human. FEBS Lett, 1990. 269(2): 402‐5. 

52.  Walter, G., K. Vandenborne, M. Elliott, and J.S. Leigh. In vivo ATP synthesis rates in single human muscles during high intensity exercise. J Physiol, 1999. 519 (Pt 3): 901‐10. 

53.  Chen, J.T., T. Taivassalo, Z. Argov, and D.L. Arnold. Modeling in vivo recovery of intracellular pH in muscle to provide a novel  index of proton handling: application  to  the diagnosis of mitochondrial myopathy. Magn Reson Med, 2001. 46(5): 870‐8. 

54.  Cea, G., D. Bendahan, D. Manners, D. Hilton‐Jones, R. Lodi, P. Styles, and D.J. Taylor. Reduced oxidative phosphorylation and proton efflux suggest reduced capillary blood supply in skeletal muscle of patients with dermatomyositis and polymyositis: a quantitative 31P‐magnetic resonance spectroscopy and MRI study. Brain, 2002. 125(Pt 7): 1635‐45. 

55.  Chen,  J.T., Z. Argov, R.E. Kearney, and D.L. Arnold. Fitting cytosolic ADP recovery after exercise with a step response function. Magn Reson Med, 1999. 41(5): 926‐32. 

56.  Iotti, S., C. Frassineti, L. Alderighi, A. Sabatini, A. Vacca, and B. Barbiroli. In vivo (31)P‐MRS assessment of cytosolic [Mg(2+)] in the human skeletal muscle in different metabolic conditions. Magn Reson Imaging, 2000. 18(5): 607‐14. 

57.  Newcomer,  B.R.,  M.D.  Boska,  and  H.P.  Hetherington.  Non‐P(i)  buffer  capacity  and  initial phosphocreatine  breakdown  and  resynthesis  kinetics  of  human  gastrocnemius/soleus muscle  groups using 0.5 s time‐resolved (31)P MRS at 4.1 T. NMR Biomed, 1999. 12(8): 545‐51. 

58.  Slade, J.M., T.F. Towse, M.C. Delano, R.W. Wiseman, and R.A. Meyer. A gated 31P NMR method for the estimation of phosphocreatine recovery time and contractile ATP cost  in human muscle. NMR Biomed, 2006. 19(5): 573‐80. 

  

 

75 

 

76 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Adapted from 

H. M. M. L. De Feyter, N. M. A. van den Broek, S. F. E. Praet, K. Nicolay, L. J. C. van Loon and 

J. J. Prompers. Early or advanced stage type 2 diabetes is not accompanied by in vivo 

skeletal muscle mitochondrial dysfunction. 

Eur J Endocrinol, 2008. 158(5):643‐53.

Chapter     Early or advanced stage type 2 diabetes is 

not accompanied by in vivo skeletal muscle  

mitochondrial dysfunction 

Chapter 4 

78 

Abstract 

Objective:  Several  lines  of  evidence  support  a  potential  role  of  skeletal  muscle 

mitochondrial dysfunction in the pathogenesis of insulin resistance and/or type 2 diabetes. 

However, it remains to be established whether mitochondrial dysfunction represents either 

cause or consequence of the disease. We examined  in vivo skeletal muscle mitochondrial 

function in early and advanced stages of type 2 diabetes, with the aim to gain insight in the 

proposed role of mitochondrial dysfunction in the etiology of insulin resistance and/or type 

2 diabetes. 

Methods:  10  long‐standing,  insulin‐treated  type  2  diabetes  patients,  11  subjects  with 

impaired  fasting  glucose,  impaired  glucose  tolerance  and/or  recently  diagnosed  type  2 

diabetes, and 12 healthy, normoglycaemic controls, matched for age and body composition 

and with low habitual physical activity levels were studied. In vivo mitochondrial function of 

the  vastus  lateralis  muscle  was  evaluated  from  post‐exercise  phosphocreatine  (PCr) 

recovery kinetics using  31P magnetic resonance spectroscopy  (MRS).  Intramyocellular  lipid 

(IMCL) content was assessed in the same muscle using single‐voxel 1H MRS. 

Results:  IMCL  content  tended  to  be  higher  in  type  2  diabetes  patients  compared  to 

normoglycaemic controls (p = 0.06). 31P MRS parameters for mitochondrial function, i.e. PCr 

and ADP  recovery  time constants and maximum aerobic capacity, did not differ between 

groups. 

Conclusions:  The  finding  that  in  vivo  skeletal muscle oxidative  capacity does not differ 

between  long‐standing,  insulin‐treated  type 2 diabetes patients, subjects with early stage 

type  2  diabetes,  and  sedentary,  normoglycaemic  controls  suggests  that  mitochondrial 

dysfunction  does  not  necessarily  represent  either  cause  or  consequence  of  insulin 

resistance and/or type 2 diabetes. 

In vivo mitochondrial function in type 2 diabetes 

79 

Introduction 

Insulin  resistance  is an early event  in  the pathogenesis of  type 2 diabetes. However,  the 

exact  processes  leading  to  insulin  resistance  remain  unresolved.  Previous  studies  have 

reported  a  strong  correlation  between  intramyocellular  lipid  (IMCL)  content  and  insulin 

resistance  [1‐2].  However,  the  proposed  relationship  between  IMCL  accumulation  and 

skeletal muscle insulin resistance is not unambiguous, as it is strongly influenced by training 

status and/or habitual physical activity [3‐4]. Nonetheless, several lines of evidence indicate 

that mitochondrial dysfunction, presumably associated with a reduced capacity to oxidize 

fatty acids, might stimulate IMCL accretion and, as such, contribute to the development of 

skeletal muscle insulin resistance [5]. 

Data  to  support  the  proposed  role  of  skeletal muscle mitochondrial  dysfunction  in  the 

development of insulin resistance and/or type 2 diabetes have been obtained with various 

in  vitro methods,  including measurements  of  oxidative  enzyme  activities  [6‐10], mRNA 

and/or protein expression of OXPHOS (oxidative phosphorylation) genes [10‐14] as well as 

mitochondrial  content,  morphology  and  respiration  [8‐9,  14‐15].  Furthermore,  in  vivo 

magnetic resonance spectroscopy  (MRS) measurements of basal mitochondrial adenosine 

triphosphate  (ATP)  synthesis  rates  [16‐18]  and  post‐exercise  phosphocreatine  (PCr)  [19] 

and adenosine diphosphate (ADP) [20] recovery kinetics also point towards a potential role 

for mitochondrial dysfunction  in the etiology of  insulin resistance and/or type 2 diabetes. 

However,  it was  recently  shown  that  in  vitro mitochondrial  respiration  of  permeabilized 

muscle fibers from biopsies of type 2 diabetes patients and healthy controls did not differ 

between groups when  the data was normalized  for mitochondrial DNA content or citrate 

synthase activity [21]. In other words, the type 2 diabetes patients showed normal intrinsic 

mitochondrial function, but an impaired oxidative capacity that was entirely attributed to a 

lower mitochondrial  content.  Environmental  factors  play  an  important  role  in  regulating 

skeletal muscle oxidative capacity, and the lower mitochondrial content in type 2 diabetes 

patients might  simply  be  the  result  of  a  reduced  habitual  physical  activity  level  [21‐23]. 

Furthermore, mitochondrial dysfunction in type 2 diabetes might be secondary to impaired 

insulin signaling [24‐26] and/or abnormal blood glucose, insulin [27‐28] and free fatty acid 

(FFA) [26] levels. Therefore, the debate continues as to whether mitochondrial dysfunction 

represents either cause or consequence of insulin resistance and/or type 2 diabetes. 

The aim of this study was to assess whether  in vivo mitochondrial  function  is  impaired  in 

the early and/or overt diabetes state. Therefore, we examined in vivo muscle mitochondrial 

function  in 3 groups of subjects representative for different stages  in the development of 

type  2  diabetes:  long‐standing,  insulin‐treated  type  2  diabetes  patients,  subjects  with 

impaired  fasting  glucose,  impaired  glucose  tolerance  and/or  recently  diagnosed  type  2 

diabetes, and healthy, normoglycaemic controls, all matched for age and body composition 

and  with  low  habitual  physical  activity  levels.  In  vivo  mitochondrial  function  was 

determined from post‐exercise PCr recovery kinetics measured with 31P MRS [29‐31]. 

Chapter 4 

80 

Materials and methods 

Subjects 

Ten  long‐standing,  insulin‐treated  type 2 diabetes patients  (Diabetes  group), 11  subjects 

with impaired fasting glucose, impaired glucose tolerance and/or recently diagnosed type 2 

diabetes  (pre‐Diabetes  group)  and  12  healthy,  normoglycaemic  controls  (Control  group) 

were selected to participate in this study. All subjects were male. The diabetes patients had 

been  diagnosed with  type  2  diabetes  for  over  5  years,  established  by  a  fasting  plasma 

glucose concentration larger than or equal to 7.0 mmol/l at the time of diagnosis as defined 

by  the World Health Organisation  (WHO)  [32].  Subjects  in  the Control  and pre‐Diabetes 

groups  had  no  family  history  of  diabetes  and  were  selected  based  on  an  oral  glucose 

tolerance  test  (OGTT)  according  to WHO  criteria  [32].  Control  subjects  showed  normal 

fasting glucose concentrations and normal glucose tolerance (fasting glucose < 6.1 mmol/l 

and  2  h  glucose  <  7.8 mmol/l).  Subjects  in  the  pre‐Diabetes  group  had  either  elevated 

fasting  plasma  glucose  concentrations  (fasting  glucose  ≥  6.1  and  <  7.0 mmol/l,  and  2  h 

glucose < 7.8 mmol/l; n = 5), or  impaired glucose tolerance (fasting glucose < 7.0 mmol/l, 

and 2 h glucose ≥ 7.8 and < 11.1 mmol/l; n = 2), or recently diagnosed type 2 diabetes (< 1 

month; fasting glucose ≥ 7.0 mmol/l or 2 h glucose ≥ 11.1 mmol/l; n = 4). 

All  diabetes  patients  were  on  exogenous  insulin  treatment  and  had  been  on  a  stable 

regimen of diabetes medication over the  last 3 months before being recruited. Out of the 

10 participating diabetes patients, 7 patients were treated with short (Novorapid®, n = 6) or 

rapid  acting  insulin  (Humulin®,  n  =  1)  before  each meal  either  in  combination with NPH 

insulin  (Insulatard®,  n  =  5),  premixed  biphasic  isophane  insulin  (Mixtard  30/70®  in 

combination with metformin, n = 1), or a very long‐acting insulin analogue (insulin glargine, 

n = 1), all administered before bedtime. Two patients were treated with premixed biphasic 

isophane insulin twice a day (Mixtard 30/70®) in combination with metformin. One patient 

used  NPH  insulin  (Humulin  NPH®)  once  a  day  before  breakfast  in  combination  with 

metformin  and  a  sulphonylurea  (glimepiride).  Patients  using  thiazolidinediones  were 

excluded  from participation. None of  the  subjects  in  the pre‐Diabetes  group used blood 

glucose  lowering medication  and  all  showed  glycosylated  haemoglobin  (HbA1c)  contents 

below 6%. Subjects using ‐blockers for less than 6 months and subjects with impaired liver 

function,  renal  failure,  severe  retinopathy or a history of  severe  cardiovascular problems 

were excluded from participation. Subjects with clinical signs of peripheral vascular disease 

(Fontaine stage II or higher) were excluded based on a thorough history taking for signs of 

intermittent  claudication,  as  well  as  a  physical  examination  of  the  peripheral  vascular 

system  (no  arterial bruits over  abdominal  aorta,  iliac  artery  and/or diminished pulses of 

femoral artery, dorsalis pedis and posterior  tibial artery). The nature and  the  risks of  the 

experimental  procedures  were  explained  to  the  subjects  and  all  gave  their  written 

informed  consent  to  participate  in  the  study, which was  approved  by  the  local Medical 

Ethical Committee of the Máxima Medical Center, Veldhoven, The Netherlands. This study 

In vivo mitochondrial function in type 2 diabetes 

81 

is part of a  larger project that studies mitochondrial function  in chronic metabolic disease 

[33‐34]. 

Body composition 

Body mass index (BMI) and waist circumference were measured using an analogue weight 

scale and standard measuring tape. Whole‐body fat free mass (FFM) and truncal fat mass 

were determined using whole‐body dual energy X‐ray absorptiometry (DXA) (Hologic QDR‐

4500 Discovery A, software version 12.3:3, Hologic Inc. Bedford, MA, USA). 

Habitual physical activity level 

Habitual  physical  activity  level  was  assessed  with  the  Tecumseh  and  Minnesota 

Occupational and Leisure Time Activity Questionnaire [35]. The activity level was expressed 

in metabolic  equivalents  (MET), which  is  a  scale  of  the  energy  cost  of  various  physical 

activities in multiples of the resting metabolic rate. 

Whole‐body oxygen uptake capacity 

Maximal  whole‐body  oxygen  uptake  capacity  (VO2peak)  and  maximal  workload  capacity 

(Wmax) were measured during an incremental exercise test until exhaustion, performed on a 

cycle  ergometer  (Medifit  Ergometer, Medifit  systems, Maarn,  The  Netherlands)  using  a 

ramp protocol [36]. Gas exchange measurements were performed continuously (Ergostar II, 

PMS  Professional  Medical  Systems,  Basel,  Switzerland).  Maximal  whole‐body  oxygen 

uptake capacity was defined as the VO2 value remaining unchanged or increasing less than 

1 ml∙min‐1∙kg‐1 for 30 s or more despite an increment in workload [37]. Cardiac function was 

monitored using a 12‐lead electrocardiogram with heart rate being recorded continuously 

(Polar  Electro,  Kempele,  Finland).  The  age‐predicted maximal  heart  rate was  calculated 

according to the prediction model of Gellish et al. [38]. 

Blood sampling and analyses 

Subjects reported at the  laboratory at 8.00 a.m. after an overnight fast. After 5‐10 min of 

supine  rest,  fasting  samples  of  venous  blood  were  collected  from  an  antecubital  vein. 

Subsequently,  a  standard OGTT was  performed  for  all  subjects,  except  for  the  diabetes 

patients, and blood samples were collected 2 h after  ingestion of the glucose  load. Blood 

plasma samples were collected  into EDTA containing  tubes and centrifuged  for 10 min at 

4C. Aliquots of plasma were frozen immediately in liquid nitrogen and stored at ‐80C until 

Chapter 4 

82 

further analyses. Plasma  concentrations of glucose  (Roche, Basel, Switzerland) and NEFA 

(Wako Chemicals, Neuss, Germany) were analyzed with a COBAS semi‐automatic analyzer 

(Roche).  Plasma  insulin  was  determined  in  duplicate  by  radioimmunoassay  (Linco,  St. 

Charles, MO, USA)  for Control  and pre‐Diabetes  groups. Cross  sensitivity of exogenously 

administered insulin with this radioimmunoassay prohibited the detection of endogenously 

produced insulin in the insulin‐treated diabetes patients. Blood HbA1c content was analyzed 

by high‐performance  liquid chromatography  (Bio‐Rad Diamat, Munich, Germany). For  the 

Control and pre‐Diabetes groups,  the homeostasis model assessment  (HOMA)  index  [39] 

was calculated. 

MRS measurements 

MRS  measurements  were  performed  with  a  1.5‐Tesla  whole‐body  scanner  (Gyroscan 

S15/ACS, Philips Medical Systems, Best, The Netherlands) during 2 sessions. On the evening 

before the first MRS session, subjects received a standardized meal (mean ± SD: 41.0±15.1 

kJ per kg body weight, containing 40.7 energy% (En%) fat, 14.6 En% protein, and 44.7 En% 

carbohydrate) after which subjects remained fasted and were allowed to drink water only. 

Subjects  travelled by car or public  transport and  reported at  the  laboratory at 8.30 a.m., 

where  they  received  a  standardized  breakfast.  First,  1H  MRS  measurements  were 

performed  for  the quantification of  IMCL. After a  short break,  the  31P MRS protocol was 

carried  out  to  familiarize  the  subjects  to  the  in‐magnet  exercise  and  to  determine  the 

optimal exercise  intensity  for  the second visit. During the second MRS session, scheduled 

within  one  week,  31P  MRS  measurements  were  performed  to  assess  skeletal  muscle 

mitochondrial function. For the diabetes patients, blood glucose  lowering medication was 

not withdrawn before the MRS measurements. 

1H MRS 

IMCL was measured in the M. vastus lateralis with image‐guided single‐voxel 1H MRS using 

the body  coil  for  transmission and a 8‐cm diameter  surface  coil  for  signal  reception. For 

each subject, 5 voxels with a size of 10×10×15 mm3 were measured at different positions 

within the M. vastus  lateralis. The voxels were carefully placed to avoid subcutaneous fat 

and  visible  interstitial  fat  using  standard  T1‐weighted  images  (Fig.  1A).  Spectra  were 

recorded with a point resolved spectroscopy (PRESS) sequence (repetition time, 1500 ms; 

echo  time, 35 ms;  spectral width, 2000 Hz; number of data points, 2048; 128  averages) 

using  chemical  shift  selective  (CHESS)  saturation  for  water  suppression.  Unsuppressed 

water spectra (32 averages) were recorded from the same voxels and used as an  internal 

reference. 

In vivo mitochondrial function in type 2 diabetes 

83 

1H MRS data analysis 

All  spectra were  fitted  in  the  time  domain  by  using  a  nonlinear  least  squares  algorithm 

(AMARES)  in the  jMRUI software package [40] without further post‐processing, except for 

manual phasing. The unsuppressed water spectrum was phased and fitted to a Lorentzian 

line shape. The zero‐order phase correction  from  the water spectrum was applied  to  the 

corresponding  water  suppressed  spectrum  and  the  total  creatine  (tCr)  CH3  peak  was 

referenced  to  3.02  ppm.  In  the  water  suppressed  spectrum,  peaks  from 

trimethylammonium  (TMA) and  tCr CH3, extramyocellular  lipid  (EMCL) and  IMCL CH2 and 

EMCL and IMCL CH3 protons (see Fig. 1B) were fitted to Gaussian line shapes. The positions 

and areas of the EMCL and IMCL CH3 peaks were constrained with respect to the positions 

and areas of the EMCL and IMCL CH2 peaks, respectively [41]. To increase the reliability of 

the  fit,  the  linewidth of  the  IMCL CH2 peak  ( ) was constrained with respect  to  the 

linewidth of the water peak ( ) according to 

 

 

Figure 1. (A) Transversal T1‐weighted spin‐echo image of the upper leg of a type 2 diabetes patient with 

voxel  positioning  within  the M.  vastus  lateralis  for  single‐voxel 1H MRS.  The  size  of  the  voxel  was 

10×10×15 mm3. The arrow points at a phantom which was  located  in the centre of the 8‐cm diameter 

surface coil. (B) 1H MR spectrum from the voxel depicted in panel A. The spectrum was processed with 1 

Hz line broadening. Peak annotations: tCr CH2/CH3, CH2/CH3 protons of total creatine; TMA, CH3 protons 

of trimethylammonium groups; EMCL CH2/CH3, CH2/CH3 protons of extramyocellular lipid, IMCL CH2/CH3, 

CH2/CH3 protons of intramyocellular lipid. 

Chapter 4 

84 

0.09 1.02 · . 1 

 

This constraint was derived  from previously recorded data sets with a well resolved  IMCL 

peak  (number  of  data  sets  =  20,  R  =  0.821,  p  <  0.0001).  A  soft  constraint, which was 

empirically determined from previously recorded data sets, was applied to the linewidth of 

the  EMCL  CH2  peak  ( ),  i.e..  3.33 . When  the  resonance 

frequency () of the IMCL CH2 peak could not be accurately fitted (i.e.  ≤ 1.25 ppm or  ≥ 1.31 ppm), the position of the IMCL CH2 peak was constrained with respect to the position 

of the tCr CH3 peak (chemical shift difference = 3.02 – 1.28 ppm). IMCL was expressed as a 

percentage  of  the water  signal measured  in  the  same  voxel without water  suppression. 

IMCL levels determined from different voxels of one subject were averaged. 

31P MRS 31P MRS was performed as described previously  [33].  In  short,  31P  signals were  collected 

using a 6‐cm diameter surface coil placed over the M. vastus lateralis (spectral width, 2000 

Hz; number of data points, 1024). A  fully  relaxed  spectrum was measured at  rest with a 

repetition  time of 30 s and 24 scans. Then, spectra were acquired during a rest‐exercise‐

recovery protocol with a repetition time of 3 s and 2 scans yielding a time resolution of 6 s. 

The  first 20  spectra  (2 min) were measured at  rest, after which  the  subjects  started  the 

exercise. Subjects performed an dynamic  incremental single‐leg extension exercise  in  the 

supine  position  using  a  home‐built MR  compatible  ergometer  [33].  The  duration  of  the 

exercise varied per subject, but never exceeded 8 min, so that at  least 5 min of recovery 

were  recorded.  During  the  first  visit,  subjects  performed  a  test  run  and  exercised  until 

fatigued. During the second session, the duration of the exercise was chosen to deplete PCr 

by about 50%, while aiming to avoid the intracellular pH to drop below 6.8. 

31P MRS data analysis 

The 31P MRS data were analyzed as described previously [33]. In short, spectra were fitted 

in  the  time domain by using a nonlinear  least  squares algorithm  (AMARES)  in  the  jMRUI 

software package [40]. PCr, inorganic phosphate (Pi), ATP and phosphodiester (PDE) signals 

were  fitted  to  Lorentzian  line  shapes.  Absolute  concentrations  of  the  phosphorylated 

metabolites were calculated after correction  for partial saturation and assuming  that  the 

ATP concentration is 8.2 mM at rest [42]. Intracellular pH was calculated from the chemical 

shift  difference  between  the  Pi  and  PCr  resonances  [43].  The  free  cytosolic  ADP 

concentration was  calculated  from  the PCr  concentration and pH using a  creatine kinase 

equilibrium constant  (Keq) of 1.66×109 M‐1  [44]. Recoveries of PCr and ADP were  fitted  to 

In vivo mitochondrial function in type 2 diabetes 

85 

mono‐exponential functions using Matlab (version 7.3., Mathworks, Natick, Massachusetts, 

USA). Results are expressed as the metabolite’s time constant of recovery, i.e. PCr and ADP, which are both measures of mitochondrial  function  [43, 45‐46]. Calculation of  the  initial 

rate of PCr  recovery  (VPCr) was based on  the PCr  recovery  rate  constant  (1/PCr) and  the difference between the resting and end‐exercise PCr concentrations [47]. Calculation of the 

maximum aerobic capacity (Qmax) was based on the ADP‐control model  [48],  in which VPCr 

has  a  hyperbolic  dependence  on  the  end‐exercise  ADP  concentration  according  to 

Michaelis‐Menten kinetics with a Km of 30 M [47]. 

Statistics 

All data are expressed as means ± SD. Statistical analyses were performed using the SPSS 

14.0 software package (SPSS  Inc, Chicago,  IL, USA). An ANOVA test was performed to test 

for  overall  differences  between  the  Control,  pre‐Diabetes  and  Diabetes  groups  and  a 

Bonferroni post‐hoc test was applied for pair‐wise comparisons between the 3 groups. For 

comparisons between 2 groups, differences were determined with an unpaired  t‐test. To 

evaluate  the  relationships  between  variables,  Pearson  correlation  coefficients  were 

calculated. All tests were carried out in a 2‐sided way and the level of significance was set 

at p < 0.05. 

Results  

Subjects’ characteristics 

The subjects’ characteristics are shown in Table 1. Subjects were carefully matched for age 

and BMI. In accordance, FFM and truncal fat mass did not differ between the Control, pre‐

Diabetes and Diabetes groups (p = 0.29 and p = 0.87, respectively). Wmax and VO2peak were 

similar  for  the Control and pre‐Diabetes  groups  (p = 1.00), but  significantly  lower  in  the 

Diabetes  group.  The  latter  was  paralleled  by  a  lower maximal  heart  rate  and  a  lower 

habitual  physical  activity  level,  but  the  physical  activity  levels  were  not  significantly 

different between groups (p = 0.12). Wmax and VO2peak correlated with both maximal heart 

rate  (Pearson’s R between 0.59 and 0.68, p < 0.01) and percentage of  the age‐predicted 

maximal heart rate (Pearson’s R between 0.56 and 0.62, p < 0.01). 

Chapter 4 

86 

 

Table 1. Subjects’ characteristics. Data are expressed as means ± SD. 

  Control pre‐Diabetes Diabetes 

   n  12 11 10 

Age (yrs)  56.5 ± 6.0 58.5 ± 5.0 58.8  ±  7.6 

BMI (kg/m2)  32.9 ± 4.6 32.1 ± 3.2 31.8  ±  4.0 

Body weight (kg)  101.0 ± 14.7 103.9 ± 10.0 95.0  ±  14.4 

FFM (kg)  70.7 ± 7.1 72.4 ± 6.9 67.2  ±  8.4 

Truncal fat mass (kg)  15.5 ± 5.5 16.3 ± 2.9 15.4  ±  4.5 

Wmax (W)  247 ± 42 244 ± 30 156  ±  38*† 

Wmax per kg BW (W/kg)  2.48 ± 0.47 2.39 ± 0.47 1.66  ±  0.36*† 

VO2peak per kg BW (ml∙min‐1∙kg

‐1)  32.3 ± 5.4 33.8 ± 5.9 25.2  ±  3.5*

† 

VO2peak per kg FFM (ml∙min‐1∙kg

‐1)  45.6 ± 6.0 48.5 ± 8.3 35.5  ±  5.2*

† 

HRmax (b/min)  166 ± 13 171 ± 12 140  ±  23*† 

% predicted HRmax  99 ± 8 103 ± 7 84  ±  14*† 

Activity level (MET h∙day‐1)  19.3 ± 7.4 19.5 ± 8.7 13.6  ±  4.3 

Fasting glucose (mmol/l)  5.7 ± 0.2 6.6 ± 0.5 11.0  ±  2.5*† 

Fasting insulin (µU/ml)  16.2 ± 9.1 22.2 ± 9.6 nd 

HOMA index  4.1 ± 2.2 6.5 ± 2.7#

nd 

2‐h glucose (mmol/l)  5.7 ± 1.3 8.4 ± 2.6‡

nd 

2‐h insulin (µU/ml)  74.8 ± 40.5 146.2 ± 64.5‡

nd 

HbA1c (%)  5.3 ± 0.3 5.5 ± 0.2 7.7  ±  1.0*† 

FFA (mmol/l)  0.31 ± 0.10 0.39 ± 0.13 0.46  ±  0.26 

Years with type 2 diabetes  na na 12  ±  7 

Years of insulin therapy  na na 7  ±  8 

BMI, body mass  index; FFM,  fat  free mass; Wmax, maximal workload capacity; Wmax  per  kg  BW, Wmax per kg 

body weight; VO2peak, maximal oxygen uptake per kg body weight or per kg FFM; HRmax, maximal heart rate 

during  the  VO2peak  test;  %  predicted  HRmax,  percentage  of  the  age‐predicted  HRmax;  MET,  metabolic 

equivalents; HOMA, homeostasis model assessment; 2‐h glucose/insulin, glucose/insulin concentration 2 h 

after  ingestion of glucose  load during  the oral glucose  tolerance  test; HbA1c, glycosylated haemoglobin; 

FFA, free fatty acids; na, not applicable; nd, not determined. * Significantly different from Control (ANOVA, 

p  <  0.01). †  Significantly  different  from  pre‐Diabetes  (ANOVA,  p  <  0.01). 

#  Significantly  different  from 

Control (t‐test, p < 0.05). ‡ Significantly different from Control (t‐test, p < 0.01). 

In vivo mitochondrial function in type 2 diabetes 

87 

Fasting plasma glucose and insulin levels were not significantly different for the Control and 

pre‐Diabetes  groups  (p  =  0.39  and  p  =  0.14,  respectively),  but  the  HOMA  index  was 

significantly higher for the pre‐Diabetes group than for the Control group. Also the glucose 

and  insulin  concentrations measured  2  h  after  ingestion  of  the  glucose  load  during  the 

OGTT were significantly higher for the pre‐Diabetes group than for the Control group. HbA1c 

contents were similar  for  the Control and pre‐Diabetes groups  (p = 1.00) and all subjects 

had  HbA1c  contents  below  6%.  Fasting  glucose  concentrations  and  HbA1c  content were 

significantly higher in the Diabetes group (glucose ≥ 8 mmol/l and HbA1c ≥ 6.3%) compared 

to the Control and pre‐Diabetes groups. Diabetes patients had been diagnosed with type 2 

diabetes for 12 ± 7 years and had been on exogenous insulin therapy for 7 ± 8 years. Plasma 

FFA concentrations did not differ between groups (p = 0.16). 

Wmax  and  VO2peak  correlated  negatively  with  both  fasting  plasma  glucose  (Pearson’s  R 

between  ‐0.48 and  ‐0.57, p < 0.01) and HbA1c  (Pearson’s R between  ‐0.58 and  ‐0.70, p < 

0.01). 

IMCL content 

Due  to  excessive  EMCL  contamination  in  the  spectra,  IMCL  content  could  not  be 

determined for 2 subjects in the Control group and 1 subject in the Diabetes group. For all 

other subjects, spectra  from at  least 2 out of  the 5 voxels were quantified.  IMCL content 

tended to be higher for the Diabetes group compared to the Control group (1.3 ± 0.4 (n = 

10), 1.6 ± 0.7 (n = 11) and 2.0 ± 0.7 (n = 9) % of the water signal  in Control, pre‐Diabetes 

and Diabetes groups, respectively, p = 0.06; Fig. 2). 

Figure 2. IMCL content in Control, pre‐Diabetes 

and Diabetes groups. Bars indicate the mean 

values for the 3 groups and filled circles 

represent individual data points. IMCL content 

tended to be higher for the Diabetes group 

compared to the Control group (ANOVA: p = 

0.06). 

 

Chapter 4 

88 

Skeletal muscle mitochondrial function 

Figure 3a and 3b show typical examples of 31P MR spectra from a subject’s vastus lateralis 

muscle at  rest and at  the end of exercise,  respectively. Table 2 summarizes  the baseline, 

end‐exercise  and  recovery  31P MRS  results  for  the  Control,  pre‐Diabetes  and  Diabetes 

groups.  At  rest,  PCr,  Pi,  ADP  and  PDE  concentrations  and  intracellular  pH  were  not 

significantly different for the Control, pre‐Diabetes and Diabetes groups (p = 0.93, p = 0.50, 

p = 0.09, p = 0.42 and p = 0.10, respectively). The end‐exercise status has to be taken into 

account when analysing  the  recovery data. End‐exercise metabolite  concentrations were 

similar for the 3 groups, except for the end‐exercise ADP concentration, which was lower in 

the Diabetes group. However, for all groups the end‐exercise ADP concentration was well 

above  the  accepted  Km  value  of  30  M  for  oxidative  ATP  synthesis.  The  average  PCr 

depletion was 54 ± 10, 56 ± 7 and 46 ± 8% for Control, pre‐Diabetes and Diabetes groups, 

respectively.  For  none  of  the  subjects  did  the  end‐exercise  pH  drop  below  6.75.  The 

average  end‐exercise  pH  was  not  different  for  the  3  groups  (p  =  0.72),  which  is  a 

prerequisite for comparing PCr. 

PCr  and ADP  recoveries  could  be  satisfactorily  described  by mono‐exponential  functions 

(average R2 values for the mono‐exponential fits were 0.96 ± 0.02 and 0.91 ± 0.06 for PCr 

and ADP  recovery  data,  respectively).  Figure  4  illustrates  both  the  raw  data  and mono‐

 

Figure 3. Typical M. vastus lateralis 31P MR spectra for a normoglycaemic control subject at rest (panel A, 

number of scans = 60) and at the end of exercise (panel B, number of scans = 2). Spectra were processed 

with  5  Hz  line  broadening.  Pi  indicates  inorganic  phosphate;  PDE,  phosphodiesters;  PCr, 

phosphocreatine;  and  ,    and    indicate  the  3  phosphate  groups  of  ATP.  For  this  subject  the  PCr depletion at the end of exercise (panel B) was 61% and the corresponding end‐exercise pH was 6.96. 

In vivo mitochondrial function in type 2 diabetes 

89 

exponential  fits of  the PCr and ADP  recoveries  for one subject. Figure 5 shows  the mean 

values  and  the  distribution  of  PCr  and Qmax  for  the  Control,  pre‐Diabetes  and  Diabetes 

groups. The 31P MRS parameters for mitochondrial function, i.e. PCr, ADP and Qmax, did not 

differ between the Control, pre‐Diabetes and Diabetes groups (p = 0.62, p = 0.29 and p = 

0.24, respectively; Table 2). VPCr was significantly lower for the Diabetes group compared to 

the pre‐Diabetes group as a result of the lower end‐exercise ADP concentration. 

All  31P MRS parameters  for mitochondrial  function correlated significantly with both Wmax 

(absolute Pearson’s R between 0.45 and 0.60, p < 0.01) and VO2peak (absolute Pearson’s R 

between 0.35 and 0.59, p < 0.05). However, PCr, ADP and Qmax did not correlate with fasting 

plasma glucose or HbA1c. 

Table 2. 31P MRS parameters during rest, end of exercise and recovery. Data are expressed as means ± SD. 

    Control pre‐Diabetes Diabetes 

         Rest  [PCr] (mM)  37.3 ± 2.3 37.7 ± 2.6 37.2  ±  4.2 

  [Pi] (mM)  4.8 ± 0.6 5.0 ± 0.7 4.7  ±  0.8 

  [ADP] (M)  10.0 ± 0.3 10.4 ± 0.5 10.1  ±  0.4 

  [PDE] (mM)  6.0 ± 0.8 6.0 ± 0.9 5.5  ±  0.9 

  pH  7.06 ± 0.01 7.07 ± 0.02 7.06  ±  0.02 

         

End‐ exercise  [PCr] (mM)  16.9 ± 3.5 16.7 ± 2.8 20.0  ±  4.5 

  [Pi] (mM)  23.3 ± 4.9 24.2 ± 3.5 19.8  ±  4.0 

  [ADP] (M)  68.2 ± 18.2 70.2 ± 11.3 47.0  ±  10.4*† 

  pH  6.91 ± 0.08 6.92 ± 0.07 6.89  ±  0.12 

         

Recovery  PCr (s)  44.5 ± 10.5 41.7 ± 6.2 46.6  ±  16.5 

  ADP (s)  19.1 ± 3.5 16.9 ± 5.0 20.2  ±  6.0 

  VPCr (mM/s)  0.47 ± 0.09 0.51 ± 0.08 0.39  ±  0.09† 

  Qmax (mM/s) 0.69 ± 0.12 0.74 ± 0.11 0.65  ±  0.13 

PCr, phosphocreatine; Pi,  inorganic phosphate; ADP, adenosine diphosphate; PDE, phosphodiesters; pH, 

intracellular muscle pH; PCr, PCr recovery time constant; ADP, ADP recovery time constant; VPCr, initial rate 

of  PCr  recovery; Qmax, maximum  rate  of  oxidative ATP  synthesis.  *  Significantly  different  from  Control 

(ANOVA, p < 0.01). † Significantly different from pre‐Diabetes (ANOVA, p < 0.01). 

Chapter 4 

90 

Discussion 

In  this study,  it was shown  that  in vivo skeletal muscle oxidative capacity, as determined 

from  post‐exercise  PCr  recovery  kinetics  using  31P MRS,  does  not  differ  between  long‐

standing, insulin‐treated type 2 diabetes patients, subjects with early stage type 2 diabetes, 

and healthy, normoglycaemic controls, all matched for age and body composition and with 

low  habitual  physical  activity  levels.  Therefore,  our  results  suggest  that  skeletal muscle 

mitochondrial dysfunction does not necessarily represent either cause or consequence of 

type 2 diabetes. 

Maximal  workload  capacity  and  maximal  whole‐body  oxygen  uptake  capacity  were 

significantly  lower  in type 2 diabetes patients and correlated negatively with both plasma 

glucose  and  blood HbA1c  contents.  The 31P MRS  recovery  parameters,  PCr,  ADP  or Qmax, 

correlated significantly with Wmax and VO2peak, but not with plasma glucose or blood HbA1c 

levels.  Therefore,  Wmax  and  VO2peak  seem  to  represent  markers  of  the  disease  status, 

whereas PCr, ADP and Qmax report only on local muscle mitochondrial function. The Pearson 

correlation  coefficient  for  the  correlation between Qmax and VO2peak per  kg  fat  free mass 

(VO2peak per kg FFM) was 0.47 (R2 = 0.22). Therefore, only 22% of the variance in VO2peak per kg FFM 

can  be  explained  by Qmax. Qmax was measured  locally  in  the M.  vastus  lateralis  during  a 

dynamic single‐leg extension exercise, while whole‐body VO2peak was determined on a cycle 

ergometer. The remaining variance in VO2peak per kg FFM could be accounted for by differences 

in cardiovascular capacity at peak work rates, which are not expected to play a significant 

role during  the  local exercise  in  the MR  scanner. The apparent discrepancy between  the 

 

Figure 4. PCr (A) and ADP (B) recovery curves from the data set that was also used  in Figure 3. Mono‐

exponential functions (dark lines) were fit to the actual data (filled circles) obtained every 6 s. The time 

constants for PCr and ADP recovery were 41.8 and 19.8 s, respectively. 

 

In vivo mitochondrial function in type 2 diabetes 

91 

results for Qmax and VO2peak per kg FFM might therefore be explained by differences  in cardiac 

output. The latter concept seems to be supported by a significant correlation between the 

maximal heart rate and VO2peak per kg FFM (Pearson’s R = 0.64, p < 0.01). 

In the present study,  31P MRS was applied to assess  in vivo skeletal muscle mitochondrial 

function from measurements during recovery from exercise. During recovery from exercise, 

PCr is resynthesized purely as a consequence of oxidative ATP synthesis [43, 45]. Therefore, 

PCr provides  information about mitochondrial function. Recently, Schrauwen‐Hinderling et 

al. applied the same technique to study mitochondrial function in the M. vastus lateralis in 

overweight  type 2 diabetes patients and BMI‐matched  control  subjects  [19]. Contrary  to 

our results, PCr was 45% longer in the type 2 diabetes compared to the control group (i.e. 

39.4 ± 17.5 vs 27.0 ± 3.9  s),  suggestive of  impaired  in vivo mitochondrial  function  in  the 

type 2 diabetes patients. It should be noted that different exercise protocols were chosen 

for  the  31P MRS measurements  in  the  2  studies. We  applied  an  exercise  protocol  that 

progressively  increased work to deplete PCr by about 50% without severe acidification.  In 

the  previous  study,  exercise was  performed with  a  single  load,  until  a  steady  state was 

reached with  an  average  PCr  depletion  of  28%.  The  larger  PCr  depletion  in  the  current 

study was accompanied by a slightly larger drop in pH (change in pH was on average 0.16 in 

this study vs 0.04  in  [19]). Several studies have shown  that PCr recovery  is slowed  in  the 

presence  of  intracellular  acidosis  [30,  49‐50].  However, we  carefully matched  the  end‐

exercise pH for the Control, pre‐Diabetes and Diabetes groups, to allow a direct comparison 

 

Figure 5. PCr (A) and Qmax (B) in Control, pre‐Diabetes and Diabetes groups. Bars indicate the mean values 

for  the 3 groups and  filled  circles  represent  individual data points. PCr and Qmax were not  significantly 

different  between  Control,  pre‐Diabetes  and  Diabetes  groups  (ANOVA:  p  =  0.62  and  p  =  0.24, 

respectively). 

Chapter 4 

92 

of  PCr between groups. As an alternative  to  PCr, both  ADP and Qmax  can also be used  to 

asses  in  vivo  mitochondrial  function  and  these  parameters  have  been  shown  to  be 

independent of pH [30, 50‐53].  In accordance with the PCr data matched for end‐exercise 

pH, ADP and Qmax also did not differ between groups. 

As was suggested in the literature, PCr can be normalized for pH using a correction factor of 

‐46 s per pH unit [49]. Recalculating the values from Schrauwen‐Hinderling et al. to a 0.12 

lower end‐exercise pH  results  in  PCr’s of about 45 and 32  s  for  the  type 2 diabetes and control group, respectively. This implies that the mitochondrial function in our Control, pre‐

Diabetes and Diabetes groups is similar to that of the type 2 diabetes patients in the study 

of  Schrauwen‐Hinderling  et  al.,  but  that  the  controls  in  the  latter  study  show  a  greater 

mitochondrial oxidative capacity. For other  studies  in healthy, elderly  subjects previously 

reported  in  the  literature  [54‐56], average values  for PCr  (recalculated at an end‐exercise pH of 6.9 if necessary) have been shown to range between 43 and 46 s, which is well in line 

with the average PCr in our control group. As such, muscle mitochondrial function in these 

overweight normoglycaemic control subjects does not seem to be substantially impaired. 

As  an  alternative  to  measuring  muscle  oxidative  capacity  from  dynamic  31P  MRS 

experiments after exercise, Petersen et al. applied 31P MRS saturation transfer experiments 

to measure mitochondrial ATP synthesis rates in resting skeletal muscle of healthy, young, 

lean,  insulin‐resistant  offspring  of  type  2  diabetes  patients  and  insulin‐sensitive  control 

subjects matched  for  age,  height, weight  and  physical  activity  [17].  ATP  synthesis  rates 

were  approximately  30%  lower  in  insulin‐resistant  subjects  than  in  controls  and  it was 

concluded  that  the  insulin‐resistant  offspring  might  have  an  inherited  defect  in 

mitochondrial  phosphorylation.  However,  as  commented  by  Short  et  al.  [24]  and 

Wagenmakers [25], the lower ATP synthesis rates in insulin‐resistant subjects could actually 

be caused by the  impaired  insulin signaling,  jeopardizing  insulin‐dependent mitochondrial 

processes, rather than the reverse. This view  is supported by studies that show that high‐

dose  insulin  infusions  increase mRNA  transcript  levels of genes  involved  in mitochondrial 

function,  mitochondrial  protein  synthesis  and  mitochondrial  ATP  production  rates  in 

healthy people, but not in type 2 diabetes patients [28, 57‐58]. In summary, it seems likely 

that the decreased basal ATP synthesis rates in type 2 diabetes patients are a result of the 

decreased  insulin  sensitivity  and  do  not  necessarily  reflect  any  intrinsic  mitochondrial 

defect. 

The diabetes patients  in the current study were on exogenous  insulin treatment for more 

than 5 years and continued their medication during the study. As blood glucose and insulin 

levels can affect measurements of mitochondrial function [27‐28], the higher plasma insulin 

levels  in  the  Diabetes  group  as  a  result  of  exogenous  insulin  treatment  might  be  a 

confounding factor in this study. Despite the insulin treatment, our diabetes patients were 

still hyperglycaemic  (fasting plasma glucose concentration: 11.0 ± 2.5 mmol/l). Therefore, 

In vivo mitochondrial function in type 2 diabetes 

93 

hyperglycaemia might also have affected the measurement of in vivo muscle mitochondrial 

function in the diabetes patients. 

Rabøl et al. recently reviewed the experimental data on mitochondrial dysfunction in type 2 

diabetes and concluded that evidence of an  intrinsic defect  in the mitochondria of type 2 

diabetes patients is far from convincing [23]. Considering that type 2 diabetes patients are 

generally physically  inactive,  the  impairments  in oxidative metabolism  in  type 2 diabetes 

patients  might  simply  be  attributed  to  their  sedentary  lifestyle.  In  this  regard,  it  is 

important  to note  that  in most  studies physical activity has not been  (strictly) controlled 

for. For studies  in which physical activity was taken  into account, the results suggest that 

the abnormalities in oxidative metabolism in type 2 diabetes patients can at least partly be 

attributed to physical inactivity [14, 28, 59‐60]. In accordance, recent data from respiration 

measurements on permeabilized muscle fibers show that when O2 flux is being normalized 

for mitochondrial DNA content or citrate synthase activity, no differences in mitochondrial 

respiration rate are observed between type 2 diabetes patients and healthy controls [21]. 

These  results  imply  that  type  2  diabetes  patients  have  normal  intrinsic  mitochondrial 

function, but an impaired oxidative capacity due to a reduced mitochondrial content, most 

likely secondary to lower habitual physical activity  levels [21‐22]. More recently, Turner et 

al.  examined  markers  of  muscle  mitochondrial  fatty  acid  oxidative  capacity  in  rodent 

models  of  lipid‐induced  insulin  resistance  [61].  Surprisingly,  fatty  acid  oxidative  capacity 

and  protein  expression  of  peroxisome  proliferator‐activated  receptor‐  coactivator  1 (PGC‐1)  and mitochondrial  respiratory  chain  subunits  appeared  to  be  upregulated.  As 

such,  the  authors  concluded  that,  at  least  in  these  rodent models,  high  lipid  availability 

does  not  lead  to  intramuscular  lipid  accumulation  and  insulin  resistance  by  decreasing 

muscle mitochondrial fatty acid oxidative capacity. In accordance, in the present study we 

observed no differences  in  in  vivo muscle mitochondrial  function between  long‐standing 

type  2  diabetes  patients,  subjects  with  early  stage  type  2  diabetes  and  sedentary, 

normoglycaemic controls. 

In  conclusion,  subjects with early  stage  type 2 diabetes as well as  long‐standing,  insulin‐

treated type 2 diabetes patients do not show signs of in vivo skeletal muscle mitochondrial 

dysfunction.  The  latter  implies  that  mitochondrial  dysfunction  does  not  necessarily 

represent  either  cause  or  consequence  of  insulin  resistance  and/or  type  2  diabetes. 

Impairments  in  oxidative metabolism  in  type  2  diabetes  patients  observed  in  previous 

studies are likely to be secondary to a less active lifestyle and/or impaired insulin signaling. 

Acknowledgements 

We are very grateful to Larry de Graaf for his technical assistance with the MR scanner. 

Chapter 4 

94 

References 1.  Pan, D.A., S. Lillioja, A.D. Kriketos, M.R. Milner, L.A. Baur, C. Bogardus, A.B.  Jenkins, and L.H. Storlien. 

Skeletal muscle triglyceride levels are inversely related to insulin action. Diabetes, 1997. 46(6): 983‐8. 2.  Krssak, M.,  K.  Falk  Petersen,  A.  Dresner,  L.  DiPietro,  S.M.  Vogel,  D.L.  Rothman, M.  Roden,  and  G.I. 

Shulman.  Intramyocellular  lipid  concentrations are  correlated with  insulin  sensitivity  in humans: a 1H NMR spectroscopy study. Diabetologia, 1999. 42(1): 113‐6. 

3.  van  Loon,  L.J., R. Koopman, R. Manders, W.  van der Weegen, G.P.  van Kranenburg, and H.A. Keizer. Intramyocellular lipid content in type 2 diabetes patients compared with overweight sedentary men and highly trained endurance athletes. Am J Physiol Endocrinol Metab, 2004. 287(3): E558‐65. 

4.  van  Loon,  L.J.  and B.H. Goodpaster.  Increased  intramuscular  lipid  storage  in  the  insulin‐resistant and endurance‐trained state. Pflugers Arch, 2006. 451(5): 606‐16. 

5.  Morino, K., K.F. Petersen, and G.I. Shulman. Molecular mechanisms of insulin resistance in humans and their potential links with mitochondrial dysfunction. Diabetes, 2006. 55 Suppl 2: S9‐S15. 

6.  Simoneau, J.A. and D.E. Kelley. Altered glycolytic and oxidative capacities of skeletal muscle contribute to insulin resistance in NIDDM. J Appl Physiol, 1997. 83(1): 166‐71. 

7.  He, J., S. Watkins, and D.E. Kelley. Skeletal muscle lipid content and oxidative enzyme activity in relation to muscle fiber type in type 2 diabetes and obesity. Diabetes, 2001. 50(4): 817‐23. 

8.  Kelley,  D.E.,  J.  He,  E.V. Menshikova,  and  V.B.  Ritov.  Dysfunction  of mitochondria  in  human  skeletal muscle in type 2 diabetes. Diabetes, 2002. 51(10): 2944‐50. 

9.  Ritov,  V.B.,  E.V.  Menshikova,  J.  He,  R.E.  Ferrell,  B.H.  Goodpaster,  and  D.E.  Kelley.  Deficiency  of subsarcolemmal mitochondria in obesity and type 2 diabetes. Diabetes, 2005. 54(1): 8‐14. 

10.  Heilbronn,  L.K.,  S.K.  Gan,  N.  Turner,  L.V.  Campbell,  and  D.J.  Chisholm.  Markers  of  mitochondrial biogenesis  and  metabolism  are  lower  in  overweight  and  obese  insulin‐resistant  subjects.  J  Clin Endocrinol Metab, 2007. 92(4): 1467‐73. 

11.  Mootha, V.K., C.M. Lindgren, K.F. Eriksson, A. Subramanian, S. Sihag, J. Lehar, P. Puigserver, E. Carlsson, M. Ridderstrale, E. Laurila, N. Houstis, M.J. Daly, N. Patterson,  J.P. Mesirov, T.R. Golub, P. Tamayo, B. Spiegelman,  E.S.  Lander,  J.N. Hirschhorn, D.  Altshuler,  and  L.C. Groop.  PGC‐1alpha‐responsive  genes involved  in oxidative phosphorylation are  coordinately downregulated  in human diabetes. Nat Genet, 2003. 34(3): 267‐73. 

12.  Patti, M.E., A.J. Butte, S. Crunkhorn, K. Cusi, R. Berria, S. Kashyap, Y. Miyazaki, I. Kohane, M. Costello, R. Saccone, E.J. Landaker, A.B. Goldfine, E. Mun, R. DeFronzo, J. Finlayson, C.R. Kahn, and L.J. Mandarino. Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: Potential role of PGC1 and NRF1. Proc Natl Acad Sci U S A, 2003. 100(14): 8466‐71. 

13.  Hojlund,  K.,  K. Wrzesinski,  P.M.  Larsen,  S.J.  Fey,  P.  Roepstorff,  A.  Handberg,  F.  Dela,  J.  Vinten,  J.G. McCormack, C. Reynet, and H. Beck‐Nielsen. Proteome analysis reveals phosphorylation of ATP synthase beta ‐subunit in human skeletal muscle and proteins with potential roles in type 2 diabetes. J Biol Chem, 2003. 278(12): 10436‐42. 

14.  Morino, K., K.F. Petersen, S. Dufour, D. Befroy, J. Frattini, N. Shatzkes, S. Neschen, M.F. White, S. Bilz, S. Sono,  M.  Pypaert,  and  G.I.  Shulman.  Reduced  mitochondrial  density  and  increased  IRS‐1  serine phosphorylation  in muscle of  insulin‐resistant offspring of  type 2 diabetic parents.  J Clin  Invest, 2005. 115(12): 3587‐93. 

15.  Mogensen,  M.,  K.  Sahlin,  M.  Fernstrom,  D.  Glintborg,  B.F.  Vind,  H.  Beck‐Nielsen,  and  K.  Hojlund. Mitochondrial  respiration  is  decreased  in  skeletal muscle  of  patients with  type  2  diabetes. Diabetes, 2007. 56(6): 1592‐9. 

16.  Petersen, K.F., D. Befroy, S. Dufour, J. Dziura, C. Ariyan, D.L. Rothman, L. DiPietro, G.W. Cline, and G.I. Shulman. Mitochondrial  dysfunction  in  the  elderly:  possible  role  in  insulin  resistance.  Science,  2003. 300(5622): 1140‐2. 

17.  Petersen, K.F., S. Dufour, D. Befroy, R. Garcia, and G.I. Shulman.  Impaired mitochondrial activity  in the insulin‐resistant offspring of patients with type 2 diabetes. N Engl J Med, 2004. 350(7): 664‐71. 

18.  Szendroedi,  J.,  A.I.  Schmid, M.  Chmelik,  C.  Toth,  A.  Brehm, M.  Krssak,  P.  Nowotny, M. Wolzt, W. Waldhausl, and M. Roden. Muscle mitochondrial ATP synthesis and glucose transport/phosphorylation in type 2 diabetes. PLoS Med, 2007. 4(5): e154. 

19.  Schrauwen‐Hinderling, V.B., M.E. Kooi, M.K. Hesselink, J.A. Jeneson, W.H. Backes, C.J. van Echteld, J.M. van Engelshoven, M. Mensink, and P. Schrauwen.  Impaired  in vivo mitochondrial  function but  similar intramyocellular  lipid  content  in  patients  with  type  2  diabetes  mellitus  and  BMI‐matched  control subjects. Diabetologia, 2007. 50(1): 113‐20. 

20.  Sirikul,  B.,  B.A.  Gower,  G.R.  Hunter,  D.E.  Larson‐Meyer,  and  B.R.  Newcomer.  Relationship  between insulin sensitivity and  in vivo mitochondrial function  in skeletal muscle. Am J Physiol Endocrinol Metab, 2006. 291(4): E724‐8. 

In vivo mitochondrial function in type 2 diabetes 

95 

21.  Boushel, R., E. Gnaiger, P. Schjerling, M. Skovbro, R. Kraunsoe, and F. Dela. Patients with type 2 diabetes have normal mitochondrial function in skeletal muscle. Diabetologia, 2007. 50(4): 790‐6. 

22.  Hawley, J.A. and S.J. Lessard. Mitochondrial function: use it or lose it. Diabetologia, 2007. 50(4): 699‐702. 23.  Rabol, R., R. Boushel, and F. Dela. Mitochondrial oxidative  function and  type 2 diabetes. Appl Physiol 

Nutr Metab, 2006. 31(6): 675‐83. 24.  Short, K.R., K.S. Nair, and C.S. Stump.  Impaired mitochondrial activity and  insulin‐resistant offspring of 

patients with type 2 diabetes. N Engl J Med, 2004. 350(23): 2419‐21; author reply 2419‐21. 25.  Wagenmakers, A.J. Insulin resistance  in the offspring of parents with type 2 diabetes. PLoS Med, 2005. 

2(9): e289. 26.  Brehm, A., M. Krssak, A.I. Schmid, P. Nowotny, W. Waldhausl, and M. Roden. Increased lipid availability 

impairs insulin‐stimulated ATP synthesis in human skeletal muscle. Diabetes, 2006. 55(1): 136‐40. 27.  Sreekumar, R., P. Halvatsiotis, J.C. Schimke, and K.S. Nair. Gene expression profile  in skeletal muscle of 

type 2 diabetes and the effect of insulin treatment. Diabetes, 2002. 51(6): 1913‐20. 28.  Asmann, Y.W., C.S. Stump, K.R. Short, J.M. Coenen‐Schimke, Z. Guo, M.L. Bigelow, and K.S. Nair. Skeletal 

muscle mitochondrial functions, mitochondrial DNA copy numbers, and gene transcript profiles in type 2 diabetic and nondiabetic subjects at equal levels of low or high insulin and euglycemia. Diabetes, 2006. 55(12): 3309‐19. 

29.  Radda, G.K., P.J. Bore, D.G. Gadian, B.D. Ross, P. Styles, D.J. Taylor, and  J. Morgan‐Hughes. 31P NMR examination of two patients with NADH‐CoQ reductase deficiency. Nature, 1982. 295(5850): 608‐9. 

30.  Arnold, D.L., P.M. Matthews, and G.K. Radda. Metabolic recovery after exercise and the assessment of mitochondrial function in vivo in human skeletal muscle by means of 31P NMR. Magn Reson Med, 1984. 1(3): 307‐15. 

31.  Chance, B.,  J.  Im, S. Nioka, and M. Kushmerick. Skeletal muscle energetics with PNMR: personal views and historic perspectives. NMR Biomed, 2006. 19(7): 904‐26. 

32.  World Health Organization and  International Diabetes Federation, Definition and diagnosis of diabetes mellitus  and  intermediate  hyperglycaemia:  report  of  a  WHO/IDF  consultation.  2006,  Geneva, Switzerland: WHO Press. 

33.  Praet, S.F., H.M. Feyter, R.A. Jonkers, K. Nicolay, C. Pul, H. Kuipers, L.J. Loon, and J.J. Prompers. (31)P MR spectroscopy and in vitro markers of oxidative capacity in type 2 diabetes patients. Magma, 2006. 19(6): 321‐31. 

34.  De Feyter, H.M., S.F. Praet, N.M. van den Broek, H. Kuipers, C.D. Stehouwer, K. Nicolay, J.J. Prompers, and  L.J.  van  Loon. Exercise  training  improves glycemic  control  in  long‐standing  insulin‐treated  type 2 diabetic patients. Diabetes Care, 2007. 30(10): 2511‐3. 

35.  Montoye, H.J., H.C.G. Kemper, W.H.M. Saris, and R.A. Washburn, Measuring physical activity and energy expenditure. 1996, Champaign, Illinois: Human Kinetics. 

36.  Zhang,  Y.Y., M.C.  Johnson,  2nd,  N.  Chow,  and  K. Wasserman.  Effect  of  exercise  testing  protocol  on parameters of aerobic function. Med Sci Sports Exerc, 1991. 23(5): 625‐30. 

37.  Weber,  C.T.,  J.S.  Janicki,  and  P.A.  McElroy,  Cardiopulmonary  exercise  testing  (CPX)  testing.  1986, Philadelphia: W. B. Saunders. 

38.  Gellish, R.L., B.R. Goslin, R.E. Olson, A. McDonald, G.D. Russi, and V.K. Moudgil. Longitudinal modeling of the relationship between age and maximal heart rate. Med Sci Sports Exerc, 2007. 39(5): 822‐9. 

39.  Matthews, D.R.,  J.P. Hosker, A.S. Rudenski, B.A. Naylor, D.F.  Treacher,  and R.C.  Turner. Homeostasis model  assessment:  insulin  resistance  and  beta‐cell  function  from  fasting  plasma  glucose  and  insulin concentrations in man. Diabetologia, 1985. 28(7): 412‐9. 

40.  Vanhamme,  L., A.  van  den Boogaart,  and  S. Van Huffel.  Improved method  for  accurate  and  efficient quantification of MRS data with use of prior knowledge. J Magn Reson, 1997. 129(1): 35‐43. 

41.  Boesch, C.,  J. Slotboom, H. Hoppeler, and R. Kreis.  In vivo determination of  intra‐myocellular  lipids  in human muscle by means of localized 1H‐MR‐spectroscopy. Magn Reson Med, 1997. 37(4): 484‐93. 

42.  Taylor, D.J., P. Styles, P.M. Matthews, D.A. Arnold, D.G. Gadian, P. Bore, and G.K. Radda. Energetics of human muscle: exercise‐induced ATP depletion. Magn Reson Med, 1986. 3(1): 44‐54. 

43.  Taylor, D.J., P.J. Bore, P. Styles, D.G. Gadian, and G.K. Radda. Bioenergetics of  intact human muscle. A 31P nuclear magnetic resonance study. Mol Biol Med, 1983. 1(1): 77‐94. 

44.  Lawson, J.W. and R.L. Veech. Effects of pH and free Mg2+ on the Keq of the creatine kinase reaction and other phosphate hydrolyses and phosphate transfer reactions. J Biol Chem, 1979. 254(14): 6528‐37. 

45.  Quistorff, B., L. Johansen, and K. Sahlin. Absence of phosphocreatine resynthesis  in human calf muscle during ischaemic recovery. Biochem J, 1993. 291 ( Pt 3): 681‐6. 

46.  Kemp, G.J. and G.K. Radda. Quantitative interpretation of bioenergetic data from 31P and 1H magnetic resonance spectroscopic studies of skeletal muscle: an analytical review. Magn Reson Q, 1994. 10(1): 43‐63. 

Chapter 4 

96 

47.  Kemp, G.J., C.H. Thompson, P.R. Barnes, and G.K. Radda. Comparisons of ATP turnover in human muscle during  ischemic and aerobic exercise using 31P magnetic  resonance  spectroscopy. Magn Reson Med, 1994. 31(3): 248‐58. 

48.  Chance,  B.,  J.S.  Leigh,  Jr.,  B.J.  Clark,  J. Maris,  J.  Kent,  S.  Nioka,  and  D.  Smith.  Control  of  oxidative metabolism and oxygen delivery  in human skeletal muscle: a steady‐state analysis of the work/energy cost transfer function. Proc Natl Acad Sci U S A, 1985. 82(24): 8384‐8. 

49.  Iotti, S., R. Lodi, C. Frassineti, P. Zaniol, and B. Barbiroli. In vivo assessment of mitochondrial functionality in human gastrocnemius muscle by 31P MRS. The role of pH  in the evaluation of phosphocreatine and inorganic phosphate recoveries from exercise. NMR Biomed, 1993. 6(4): 248‐53. 

50.  van den Broek, N.M., H.M. De Feyter, L. de Graaf, K. Nicolay, and J.J. Prompers. Intersubject differences in  the  effect  of  acidosis  on  phosphocreatine  recovery  kinetics  in  muscle  after  exercise  are  due  to differences in proton efflux rates. Am J Physiol Cell Physiol, 2007. 293(1): C228‐37. 

51.  Argov, Z., N. De Stefano, and D.L. Arnold. ADP  recovery after a brief  ischemic exercise  in normal and diseased human muscle‐‐a 31P MRS study. NMR Biomed, 1996. 9(4): 165‐72. 

52.  Lodi, R., G.J. Kemp, S. Iotti, G.K. Radda, and B. Barbiroli. Influence of cytosolic pH on in vivo assessment of human muscle mitochondrial  respiration by phosphorus magnetic  resonance  spectroscopy. Magma, 1997. 5(2): 165‐71. 

53.  Roussel, M., D. Bendahan, J.P. Mattei, Y. Le Fur, and P.J. Cozzone. 31P magnetic resonance spectroscopy study  of  phosphocreatine  recovery  kinetics  in  skeletal  muscle:  the  issue  of  intersubject  variability. Biochim Biophys Acta, 2000. 1457(1‐2): 18‐26. 

54.  Kent‐Braun, J.A. and A.V. Ng. Skeletal muscle oxidative capacity  in young and older women and men. J Appl Physiol, 2000. 89(3): 1072‐8. 

55.  Conley, K.E., S.A. Jubrias, and P.C. Esselman. Oxidative capacity and ageing in human muscle. J Physiol, 2000. 526(Pt 1): 203‐10. 

56.  Scheuermann‐Freestone, M., P.L. Madsen, D. Manners, A.M. Blamire, R.E. Buckingham, P. Styles, G.K. Radda, S. Neubauer, and K. Clarke. Abnormal cardiac and skeletal muscle energy metabolism in patients with type 2 diabetes. Circulation, 2003. 107(24): 3040‐6. 

57.  Stump, C.S., K.R. Short, M.L. Bigelow,  J.M. Schimke, and K.S. Nair. Effect of  insulin on human  skeletal muscle mitochondrial ATP production, protein synthesis, and mRNA transcripts. Proc Natl Acad Sci U S A, 2003. 100(13): 7996‐8001. 

58.  Petersen, K.F., S. Dufour, and G.I. Shulman. Decreased  insulin‐stimulated ATP synthesis and phosphate transport in muscle of insulin‐resistant offspring of type 2 diabetic parents. PLoS Med, 2005. 2(9): e233. 

59.  Ortenblad, N., M. Mogensen, I. Petersen, K. Hojlund, K. Levin, K. Sahlin, H. Beck‐Nielsen, and M. Gaster. Reduced  insulin‐mediated  citrate  synthase activity  in  cultured  skeletal muscle  cells  from patients with type 2 diabetes: evidence for an intrinsic oxidative enzyme defect. Biochim Biophys Acta, 2005. 1741(1‐2): 206‐14. 

60.  Timmons,  J.A.,  J. Norrbom, C. Scheele, H. Thonberg, C. Wahlestedt, and P. Tesch. Expression profiling following  local  muscle  inactivity  in  humans  provides  new  perspective  on  diabetes‐related  genes. Genomics, 2006. 87(1): 165‐72. 

61.  Turner, N., C.R. Bruce, S.M. Beale, K.L. Hoehn, T. So, M.S. Rolph, and G.J. Cooney. Excess lipid availability increases mitochondrial fatty acid oxidative capacity in muscle: evidence against a role for reduced fatty acid oxidation in lipid‐induced insulin resistance in rodents. Diabetes, 2007. 56(8): 2085‐92. 

  

 

97 

 

98 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Adapted from 

N. M. A. van den Broek, J. Ciapaite, H. M. M. L De Feyter, S. M. Houten, R. J. A. Wanders,  

J. A. L. Jeneson, K. Nicolay, J. J. Prompers. Increased mitochondrial content rescues in vivo 

muscle oxidative capacity in long‐term high‐fat diet fed rats.  

FASEB J, 2010. 24(5):1354‐64.

Chapter     Increased mitochondrial content rescues  

in vivo muscle oxidative capacity  

in long‐term high‐fat diet fed rats 

Chapter 5 

100 

Abstract 

Mitochondria are thought to play a crucial role in the etiology of muscle insulin resistance 

(IR).  The  aim  of  this  study  was  to  gain  more  insight  into  the  timing  and  nature  of 

mitochondrial adaptations during the development of high‐fat diet (HFD)‐induced IR. Adult 

Wistar  rats were  fed HFD  or  normal  chow  for  2.5  and  25 weeks.  Intramyocellular  lipids 

(IMCL) were quantified  in  vivo using  1H magnetic  resonance  spectroscopy  (MRS). Muscle 

oxidative  capacity  was  assessed  in  vivo  using  31P  MRS  and  in  vitro  by  measuring 

mitochondrial DNA copy number and oxygen consumption in isolated mitochondria. MRS in 

tibialis  anterior  muscle  revealed  3.3‐fold  higher  IMCL  content  and  1.2‐fold  increased 

oxidative capacity after 2.5 weeks of HFD feeding. The latter result could be fully accounted 

for by  increased mitochondrial  content. After 25 weeks of HFD, maximal ADP‐stimulated 

oxygen  consumption  in  isolated mitochondria  oxidizing  pyruvate  plus malate  remained 

unaffected,  while  IMCL  and  mitochondrial  content  had  further  increased  compared  to 

controls (5.1‐fold and 1.4‐fold, respectively). Interestingly, in vivo oxidative capacity at this 

time  point  was  identical  to  controls.  These  results  show  that  skeletal  muscle  in  HFD‐

induced  IR  accompanied  by  IMCL  accumulation  requires  a  progressively  larger 

mitochondrial pool size to maintain normal oxidative capacity in vivo. 

Mitochondrial function and insulin resistance 

101 

Introduction 

High  caloric  diets  and  an  inactive  lifestyle  contribute  to  the  worldwide  increase  in 

prevalence of obesity, one of the main risk factors for the development of insulin resistance 

(IR) and type 2 diabetes [1]. In obesity, non‐adipose tissues are exposed to abnormally high 

levels  of  fat‐derived  substrates,  leading  to  accumulation  of  intracellular  lipids  [2].  A 

negative correlation between the content of intramyocellular lipids (IMCL) and whole‐body 

insulin  sensitivity  in  obese  and  diabetic  individuals  has  been  demonstrated  in  several 

studies [3‐5], indicating that lipids play a key role in the development of IR. 

Based on the in vivo observation that basal ATP synthesis rates in skeletal muscle are lower 

in  IR  subjects  and  their  offspring  compared  to  healthy  controls  [6‐7],  it  has  been 

hypothesized  that  the accumulation of  IMCL  is a consequence of  impaired mitochondrial 

function.  Presumably,  this  leads  to  accumulation  of  long‐chain  acyl‐CoA  esters, 

diacylglycerols and ceramides, which interfere with the insulin signaling cascade [8].  

The  nature  of mitochondrial  dysfunction  and  the  cause  and  effect  relationship  between 

mitochondrial  dysfunction  and  the  development  of  IR  remain  elusive.  Several  human 

studies have provided evidence  for dysfunctional muscle mitochondria  in  insulin resistant 

states  by  showing  down‐regulation  of  genes  encoding  mitochondrial  enzymes  [9‐10], 

decreased mitochondrial  content and  lower mitochondrial  respiratory  chain activity  [11], 

while other human studies did not reveal mitochondrial dysfunction  in  IR muscle  [12‐13]. 

However,  the observation  that  improved  glycemic  control  achieved by  insulin  treatment 

results  in  normalized  expression  of  at  least  some  genes  involved  in  mitochondrial 

metabolism  [14] suggests  that  the different outcome of  the aforementioned studies may 

be  due  to  a  varying  level  of  glycemic  control  in  the  study‐subjects  and  implies  that  the 

down‐regulation  of mitochondrial  genes, which  has  been  associated with mitochondrial 

dysfunction, is not the cause but rather the effect of IR. 

Similarly, reports on mitochondrial adaptations in skeletal muscle during the development 

of  IR  in  rodent models  of  diet‐induced  obesity  and  IR  have  been  inconclusive  and  have 

shown  altered  mitochondrial  morphology  and  impaired  function  [15‐16]  as  well  as 

improved  mitochondrial  capacity  to  oxidize  fat‐derived  substrates  and  increased 

mitochondrial number [17‐18].  

These  contrasting  findings,  at  least  in  rodent  models,  may  be  partially  explained  by 

differences  in  study  design  (e.g.  dietary  lipid  content  and  composition,  duration  of  the 

feeding).  Indeed,  some  reports  suggest  time‐dependence  of  mitochondrial  adaptations 

during the development of IR [19], reinforcing the need for longitudinal studies. Moreover, 

few  attempts  have  been  made  to  evaluate  to  what  extent  changes  in  mitochondrial 

number and function observed  in vitro translate  into changes  in oxidative capacity  in vivo 

and, consequently, how significant these changes are for whole‐body glucose homeostasis 

in vivo. In this study we therefore aimed to obtain a complete picture of changes in skeletal 

Chapter 5 

102 

muscle mitochondrial number and function in early and later stages of high‐fat diet (HFD)‐

induced  IR (after 2.5 and 25 weeks of diet, respectively) by combining  in vitro and  in vivo 

methodologies. 

Materials and Methods 

Animals 

Adult male Wistar rats  (366 ± 16 g, 14 weeks old, n = 38, Charles River Laboratories, The 

Netherlands) were housed  in pairs at 20°C and 50% humidity, on a 12‐h  light‐dark cycle. 

Rats were given ad libitum access to water and to either a high‐fat diet (HFD, 45.7% calories 

from  fat  (predominantly  lard),  35.5%  calories  from  carbohydrate,  18.3%  calories  from 

protein  (diet no. 58V8, Testdiet, Richmond,  IN, USA))  (n = 19) or normal chow  (NC, 9.2% 

calories  from  fat, 67.2%  calories  from  carbohydrate, 23.6%  calories  from protein  (R/M‐H 

diet, Ssniff Spezialdiäten GmbH, Soest, Germany)) (n = 19) for 25 weeks. After 2.5 wk n = 9 

rats from each diet group were killed and tissues were collected for  in vitro analyses. The 

remaining rats (n = 10 per diet group) were used for in vivo measurements after 2.5 and 25 

wk of diet and  in vitro measurements after 25 wk of diet. Rats were killed by  incising the 

inferior vena cava under anesthesia. Animal handling conformed to the rules of the Animal 

Ethics Committee of Maastricht University.  

Plasma parameters 

Oral glucose tolerance tests (OGTT) were performed after 15 days and 25 wk of diet, two 

days before the  in vivo measurements. After an overnight  fast (20h) rats received an oral 

glucose bolus of 1g/kg body weight. Blood samples were taken without anesthesia from the 

vena saphena at 0, 15, 30, 60, 90 and 120 min after the bolus. Blood glucose concentration 

was determined using an automatic glucometer (FreeStyle, Abbott, IL, USA). Plasma insulin 

concentration  was  determined  using  an  ultrasensitive  rat  insulin  ELISA  kit  (Mercodia, 

Uppsala, Sweden). 

To  quantify  whole‐body  insulin  resistance,  the  area  under  the  glucose  curve  (AUCg) 

obtained during OGTT was multiplied by the area under the insulin curve (AUCi) measured 

during the OGTT [20]. 

The  concentration  of  plasma  free  fatty  acids  (FFA)  and  triacylglycerols  (TAG)  was 

determined  using  NEFA  C  kit  (Wako  Chemicals  GmbH,  Neuss,  Germany)  and  serum 

triglyceride determination kit (Sigma‐Aldrich, Zwijndrecht, The Netherlands), respectively.  

Mitochondrial function and insulin resistance 

103 

Determination of muscle acylcarnitine content 

The content of acylcarnitines was determined in freeze‐dried lateral gastrocnemius muscle 

as described previously [21]. 

Magnetic resonance spectroscopy  

All magnetic resonance spectroscopy (MRS) measurements were performed on a 6.3 Tesla 

horizontal  Bruker MR  system  (Bruker,  Ettlingen,  Germany).  Animals were  anaesthetized 

using  isoflurane  (Forene®)  (1‐2%)  with  medical  air  (0.6  L/min).  Body  temperature  was 

maintained  at  36 ± 1C using heating pads. Respiration was monitored using  a pressure 

sensor registering thorax movement (Rapid Biomedical, Rimpar, Germany). 

IMCL  content  in  TA  after  2.5 weeks  and  25 weeks of diet was determined  in  vivo using 

single‐voxel  localized  1H MRS  as  described  previously  [22].  Voxels  of  222 mm3 were 

measured  in white  (ventral) and  red  (dorsal) TA using an ellipsoid  1H  surface  coil  (18/22 

mm). The 1H MR spectra were acquired using the LASER sequence [23] (repetition time TR = 

1 s, echo time TE = 16 ms, SWAMP water suppression [24], 512 averages). 

In vivo muscle oxidative capacity was measured in TA after 2.5 weeks and 25 weeks of diet 

using  31P MRS.  A  circular  1H  surface  coil  (40 mm)  and  an  ellipsoid  31P MRS  surface  coil 

(10/18 mm) were positioned over the TA as described previously [25] and 31P spectra were 

acquired by applying an adiabatic excitation pulse with a flip angle of 90. Fully relaxed (TR = 20 s, 32 averages) and partially saturated spectra (TR = 5 s, 128 averages) were measured 

at rest, followed by the acquisition of a time series of spectra (TR = 5 s, 4 averages) before, 

during  and  after  electrical  stimulation  of  TA  via  subcutaneously  implanted  electrodes 

positioned  along  the  distal  nerve  trajectory  of  the  N.  Peroneus  Communis  [25].  A  time 

series  consisted  of  3 min  rest,  2 min  of  electrical  stimulation  and  10 min  of  recovery. 

Stimulation pulse length was 100 ms, frequency was 80 Hz, stimulation voltage was about 3 

V and pulses were applied 1/s. Three to 4 time series were measured for each rat during a 

single session. 

31P  and  1H MR  spectra were  fitted  in  the  time  domain  using  a  nonlinear  least  squares 

algorithm  (AMARES)  in the  jMRUI software package  [26] as described previously  [22, 25]. 

IMCL was expressed as a percentage of the water signal measured  in the same voxel. PCr 

resynthesis data were  fitted  to a mono‐exponential  function using Matlab  (version 7.04, 

Mathworks, Natick, MA, USA) yielding a rate constant kPCr. For each animal, the results of 

two time series with similar end‐exercise pH values were averaged. 

Chapter 5 

104 

Isolation of mitochondria 

Mitochondria were isolated from one whole TA muscle through a differential centrifugation 

procedure  [27].  Briefly,  TA muscle  was  excised,  washed  in  ice  cold  0.9%  KCl,  freed  of 

connective and adipose tissue, weighed and minced with scissors  in  ice cold medium A (5 

ml for 1 g tissue) containing 150 mM sucrose, 75 mM KCl, 50 mM MOPS, 1 mM KH2PO4, 5 

mM MgCl2, 1 mM EGTA, 0.4 mg/ml bacterial proteinase type XXIV, pH 7.4. Next, 20 ml of 

medium B containing 250 mM sucrose, 0.1 mM EGTA and 20 mM MOPS, 2 mg/ml BSA, pH 

7.4 was added and the mixture was homogenized using Potter‐Elvehjem homogenizer. The 

homogenate  was  centrifuged  at  800  g  for  10 min,  4C.  The  resulting  supernatant  was centrifuged at 10000 g  for 10 min, 4C. The pellet was resuspended  in 15 ml of  fresh  ice 

cold medium  B  and  centrifuged  at  10000  g  for  10 min,  4C. Mitochondrial  pellet  was 

resuspended  in 100 l of medium B. Protein  content was determined using BCA protein 

assay kit (Pierce, Thermo Fisher Scientific Inc., Rockford, IL, USA). 

Measurement of oxygen consumption 

Oxygen  consumption  rate  was  measured  at  37C  using  a  two‐channel  high‐resolution Oroboros  oxygraph‐2  k  (Oroboros,  Innsbruck,  Austria). Mitochondria  (0.15 mg/ml) were 

incubated  in 1 ml of assay medium containing 110 mM KCl, 20 mM Tris, 2.3 mM MgCl2, 5 

mM KH2PO4, 1 mg/ml BSA, pH 7.3, and supplemented with either 5 mM pyruvate plus 5 

mM malate or 25 M palmitoyl‐L‐carnitine plus 2.5 mM malate as the oxidizable substrate. 

An ADP‐regenerating system consisting of excess hexokinase (4.8 U/ml) and glucose (12.5 

mM) was  used  to maintain  steady‐state  oxygen  consumption  rates.  1 mM  of  ATP was 

added  to  initiate  state  3  respiration. Oxygen  consumption  in  resting  state  (state  4)  and 

uncoupled state (state U) was determined after addition of 1.25 M carboxyatractyloside 

and  1  M  carbonyl  cyanide  3‐chlorophenyl  hydrazone,  respectively.  The  quality  of 

mitochondrial preparation was assessed by determining the effect of 20 M cytochrome c 

and 1 M coenzyme Q10 on oxygen consumption  rate  in  state 3 and  state 4. The  signals 

from the oxygen electrode were recorded at 0.5 s  intervals. Data acquisition and analysis 

was  performed  using  Oxygraph‐2k‐DatLab  software  version  4.2  (Oroboros,  Innsbruck, 

Austria). 

Determination of the relative mitochondrial copy number 

Genomic DNA was isolated from a 25 mg transversal slice of mid‐belly TA using GenElute™ 

Mammalian  Genomic  DNA  Miniprep  Kit  (Sigma‐Aldrich,  Zwijndrecht,  The  Netherlands). 

Mitochondrial  DNA  (mtDNA)  content  relative  to  peroxisome  proliferator‐activated 

receptor‐γ coactivator 1 (PGC‐1) gene was measured using real‐time PCR as described in 

[28]. Primers  for mtDNA were:  forward primer  ‐5′‐ACACCAAAAGGACGAACCTG‐3′,  reverse 

Mitochondrial function and insulin resistance 

105 

primer  ‐5′‐ATGGGGAAGAAGCCCTAGAA‐3′,  and  for  PGC‐1:  forward  primer  ‐5′‐

ATGAATGCAGCGGTCTTAGC‐3′,  reverse  primer  ‐5′‐AACAATGGCAGGGTTTGTTC‐3′.  The 

relative mtDNA copy number was calculated using Ct method as described in [29]. 

Determination of enzyme activities 

Homogenates of transversal sections of mid‐belly TA muscle were prepared as described in 

[25].  Succinate  dehydrogenase  (SDH)  activity  was  determined  as  described  in  [30]. 

Cytochrome  c  oxidase  (CCO)  activity  was  measured  using  a  method  described  by 

Cooperstein and Lazarow [31]. Citrate synthase (CS) activity was measured as described in 

[32]. Very long chain acyl‐CoA dehydrogenase (VLCAD) activity was measured as described 

in [33].  

Immunoprecipitation and Western blotting 

Frozen transversal sections of mid‐belly TA (100‐150 mg) were homogenized in 10 volumes 

of  cold RIPA buffer  (1% Nonidet P40  substitute, 0.5% Na deoxycholate, 0.1% Na dodecyl 

sulfate, 150 mM NaCl, 50 mM Tris, pH 8)  supplemented with protease  inhibitor  cocktail 

(dilution  1:200)  (Sigma‐Aldrich,  Zwijndrecht,  The  Netherlands).  Homogenates  were 

solubilized for 2 h at 4C and centrifuged at 12000 g for 15 min at 4C. Supernatants (10 g of total protein) were resolved by SDS‐PAGE. Furthermore, 1 ml of diluted supernatant (1 

mg/ml of  total protein) was  immunoprecipitated with 4 µg of anti‐IRS1 antibody  (Sigma‐

Aldrich, Zwijndrecht, The Netherlands) overnight at 4C, followed by 2 hour incubation with protein  A‐agarose  beads  (Sigma‐Aldrich,  Zwijndrecht,  The  Netherlands).  Washed  beads 

were mixed with Laemmli buffer, heated at 98C for 5 min and centrifuged at 14000 g for 1 

min at 4C and the supernatant was resolved by SDS‐PAGE. 

After  electrophoresis  proteins were  transferred  to  polyvinylidene  difluoride membranes 

(Millipore).  After  blocking membranes were  incubated with  anti‐UCP3  antibody  (Sigma‐

Aldrich, Zwijndrecht, The Netherlands), anti‐PGC1  (Santa Cruz Biotechnology  Inc., Santa Cruz, CA, USA), anti‐IRS1 or anti‐phospho‐IRS1 (pIRS1, pSer312, Sigma‐Aldrich, Zwijndrecht, 

The  Netherlands)  overnight  at  4C.  After  washing  with  PBS  containing  0.1%  Tween, membranes  were  treated  with  horse‐radish  peroxidase  conjugated  goat  anti‐rabbit  IgG 

(Pierce, Thermo Fisher Scientific  Inc., Rockford,  IL, USA) for 1 h at room temperature. The 

immunocomplexes  were  detected  using  SuperSignal  West  Dura  Extended  Duration 

Substrate  (Pierce,  Thermo  Fisher  Scientific  Inc.,  Rockford,  IL,  USA)  and  quantified  using 

Quantity One 1‐D analysis software version 4.4.0 (Bio‐Rad Laboratories  Inc., Hercules, CA, 

USA). The level of IRS1 phosphorylation was expressed as the fraction of pIRS1 in the total 

pool of IRS1.  

Chapter 5 

106 

Statistical analysis 

Data are presented as means ± SD. The  listed n values  represent  the number of animals 

used for a particular experiment. The statistical significance of the diet and age effects was 

assessed  using  either  ANOVA  for  repeated measures with  one  between‐subjects  factor 

(diet)  and  one within‐subjects  factor  (age)  (body weight,  energy  intake,  plasma  glucose 

concentrations and MRS data) or two‐way ANOVA with two between‐subjects factor (diet 

and age) (the remaining data). Only if the interaction term between the factors was found 

to be  significant,  the effect of each  factor was analyzed  separately using Student’s  t‐test 

(paired  or  unpaired,  depending  on  the  type  of  the  measurement).  All  analyses  were 

performed with SPSS 16.0 (SPSS Inc., Chicago, IL, USA). Level of statistical significance was 

set at p < 0.05. 

 

Figure 1. The effect of high‐fat diet on glucose homeostasis. (A) Glucose concentrations during OGTT (n 

=  9  and  n  =  10,  for  2.5  and  25  wk  data,  respectively).  Symbols  denoting  statistically  significant 

differences were  excluded  for  simplicity.  (B)  Insulin  concentrations  during OGTT  (n  =  5‐10  per  time 

point).  Symbols  denoting  statistically  significant  differences  were  excluded  for  simplicity.  (C) 

Development of insulin resistance in HFD‐fed rats. Insulin resistance was quantified by multiplying AUCg 

with AUCi (Table 1). *p < 0.05 vs. NC‐fed rats of the same age; #p < 0.05 vs. the same diet group after 2.5 

wk of diet. (D) Phosphorylation of IRS1 at ser307 in TA. The level of IRS1 phosphorylation was expressed 

as  the  fraction of phosphorylated  IRS1  in  the  total pool of  IRS1  (n  = 6 per diet  group).  There was  a 

significant effect of HFD (p < 0.001) and age (p < 0.001) on IRS1 phosphorylation level. Data are means ± 

SD. 

Mitochondrial function and insulin resistance 

107 

Results 

Animal model 

Animal characteristics after 2.5 and 25 wk of diet are summarized in Table 1. Body weight 

and energy intake of HFD‐fed rats was significantly higher (p < 0.001) compared to NC‐fed 

rats at both time points. Fasting blood glucose concentration was not affected by HFD, but 

significantly  increased with age  (p < 0.01). Fasting  insulin  concentration was  significantly 

higher  (p  <  0.001)  in HFD‐fed  animals  compared  to  controls  at  both  time  points. OGTT 

revealed progressive glucose intolerance in HFD‐fed animals as indicated by increased AUCg 

(p  <  0.001)  (Figure  1A,  Table  1)  and  AUCi  (p  <  0.01)  (Figure  1B,  Table  1)  compared  to 

controls. In addition, plasma FFA, TAG and glycerol concentrations increased significantly (p 

< 0.001) in response to HFD feeding. 

 

Table 1. Animal characteristics.

  2.5 wk 25 wk

NC HFD NC HFD 

   Body weight (g)  385 ± 18 426 ± 20

#505 ± 30

$655 ± 55

#,$ 

Food intake (kJ/week)   2014 ± 118 2716 ± 270#

2018 ± 89 2310 ± 82#,$ 

Fasting glucose (mM)* 

4.3 ± 0.5 4.6 ± 0.4 4.9 ± 0.5 5.0 ± 0.7 

AUCg (mM∙h)*,† 

10.3 ± 0.8 12.2 ± 1.1 10.6 ± 0.8 13.5 ± 1.1 

Fasting insulin (pM)*,† 

137 ± 25 317 ± 140 200 ± 165 517 ± 25 

AUCi (pM∙h)  313 ± 56 756 ± 220‡

408 ± 20 1517 ± 125#,$ 

AUCg*AUCi (mM∙h*pM∙h)  3189 ± 631 9628 ± 2789‡

3485 ± 1113 20839 ± 2482#,◊ 

Plasma FFA (mM)*,† 

0.07 ± 0.03 0.30 ± 0.07 0.18 ± 0.05 0.33 ± 0.06 

Plasma TAG (mM)*,† 

0.7 ± 0.2 1.2 ± 0.3 1.1 ± 0.3 1.5 ± 0.4 

Plasma glycerol (mM)*,† 

0.07 ± 0.02 0.15 ± 0.04 0.09 ± 0.03 0.19 ± 0.05 

Data are from n = 9 and n = 10 animals for 2.5 wk and 25 wk, respectively, and are expressed as means ± 

SD. NC,  normal  chow; HFD,  high‐fat  diet;  AUCg  and AUCi,  area  under  the  glucose  and  insulin  curve, 

respectively; FFA, free fatty acids; TAG, triacylglycerols. *General age effect (p < 0.05), †General effect of 

HFD (p < 0.05), #p < 0.001 vs. NC‐fed rats of the same age, 

‡p < 0.05 vs. NC‐fed rats of the same age, 

$p < 

0.001 vs. the same diet group after 2.5 wk of diet, ◊p < 0.05 vs. the same diet group after 2.5 wk of diet. 

Chapter 5 

108 

 

 

Figure 2. Muscle  IMCL  content and acylcarnitine profile. Representative examples of 1H MR  spectra, 

measured in the dorsal TA of the same rat after 2.5 wk (A) and 25 wk (B) of HFD and of the same rat after 

2.5 wk  (C)  and  25 wk  (D)  of NC.  Cr,  creatine;  tCr,  total  creatine;  EMCL,  extramyocellular  lipid;  IMCL, 

intramyocellular lipid. (E) IMCL content in the dorsal TA (n = 10 for each diet group). IMCL content was 

expressed as a percentage of the water signal. *P < 0.001 vs. NC‐fed rats of the same age, #P < 0.001 vs. 

the same diet group after 2.5 wk of diet. (F) Acylcarnitine content in gastrocnemius muscle (n = 9 and n = 

10, for 2.5 and 25 wk data, respectively). *p < 0.001 vs. NC‐fed rats of the same age, #p < 0.001 vs. the 

same diet group after 2.5 wk of diet, †p = 0.06 vs. NC‐fed rats of the same age. Data are means ± SD. 

Mitochondrial function and insulin resistance 

109 

HFD feeding  led to development of whole‐body  insulin resistance as  indicated by 2.9 (p < 

0.01) and 4.7 (p < 0.001) fold higher product of AUCg and AUCi (Figure 1C, Table 1) in HFD‐

fed  rats  compared  to  controls  after  2.5  and  25 wk  of  diet,  respectively.  To  confirm  an 

impairment  of  the  insulin  signaling  cascade  in  skeletal  muscle,  we  determined  the 

phosphorylation level of insulin receptor substrate 1 (IRS1) at serine 307 (ser307). IRS1 ser307 

phosphorylation was  higher  (p  <  0.001)  in  tibialis  anterior  (TA) muscle  of  HFD‐fed  rats 

compared to controls both after 2.5 wk and 25 wk (Figure 1D). Irrespective of the diet, the 

level of IRS1 ser307 phosphorylation significantly (p < 0.001) increased with age. 

IMCL and acylcarnitine content 

Next, we  assessed  IMCL  levels  in  TA  using  1H MRS.  Representative  examples  of  1H MR 

spectra of the dorsal, oxidative part of TA are shown  in Figure 2A‐D.  IMCL content  in this 

part of the TA was 3.3 (p < 0.001) and 5.1 (p < 0.001) fold higher  in HFD‐fed compared to 

controls  after  2.5  wk  and  25  wk  of  diet,  respectively  (Figure  2E).  IMCL  content  in  the 

ventral, glycolytic part of TA was lower than that in the oxidative part in both NC‐ and HFD‐

fed rats (data not shown). HFD feeding  led to a 3.2 and 3.8 fold higher  IMCL content (p < 

0.001) in this part of the TA after 2.5 wk and 25 wk of diet, respectively (data not shown). 

To  verify  impairment  of  lipid  metabolism,  we  determined  the  content  of  different 

acylcarnitine  species  in  the  muscle.  The  content  of  free  carnitine,  acetylcarnitine  and 

propionylcarnitine was lower in the muscle of HFD‐fed rats compared to controls after 2.5 

and 25 wk of diet  (data not shown). The content of medium‐  (data not shown) and  long‐

chain acylcarnitines  in almost all  cases was  significantly higher  in muscle of HFD‐fed  rats 

both after 2.5 and 25 wk of diet (Figure 2F). The largest increase in response to HFD feeding 

was observed in long‐chain acylcarnitine species (C16:0, C18:0 and C18:1), which reflect the 

major dietary and stored fatty acids. The relative increase was similar after 2.5 and 25 wk of 

diet, but the absolute levels were higher after 25 wk of HFD.  

In vivo muscle oxidative capacity 

We used 31P MRS to measure post‐exercise phosphocreatine (PCr) recovery rate in TA, an in 

vivo measure of the oxidative capacity of this muscle [34]. Representative examples of 31P 

MR spectra from TA during rest and at the end of electrical stimulation are shown in Figure 

3A and 3B, respectively. Concentrations of metabolites and pH obtained  from the  31P MR 

spectra are summarized in Table 2. HFD feeding had no significant effect on the metabolite 

concentrations in TA at rest and at the end of electrical stimulation, except for [Pi] at rest, 

which was significantly higher (p < 0.05) after 25 wk of HFD. 

Chapter 5 

110 

PCr concentrations during the recovery after electrical stimulation were fitted with a mono‐

exponential  function  (Figure  3C)  and  recovery  rate  constants  (kPCr),  representing  in  vivo 

muscle oxidative capacity, were calculated (Figure 3D). kPCr was significantly higher (20%, p 

< 0.01)  in HFD‐fed  rats  compared  to NC‐fed  rats after 2.5 wk of diet. However,  kPCr was 

similar for HFD‐ and NC‐fed rats after 25 wk of diet. Irrespective of the diet, kPCr decreased 

with age (p < 0.001). 

 

Figure  3.  In  vivo  oxidative  capacity  of  TA  assessed  by 31P MRS.  Representative  examples  of 

31P MR 

spectra at rest (A) and at the end of stimulation (B), measured in TA of the same NC‐fed rat after 2.5 wk 

of  diet.  ,    and  γ,  phosphate  groups  of  ATP;  PCr,  phosphocreatine;  Pi,  inorganic  phosphate.  (C) Representative example of fitting of PCr concentrations during the recovery after electrical stimulation. 

(D) The rate constants of PCr recovery (kPCr) in TA after electrical stimulation (n = 10 for each diet group). 

*p < 0.001 vs. NC‐fed rats of the same age, #p < 0.001 vs. the same diet group after 2.5 wk of diet. Data 

are means ± SD. 

Mitochondrial function and insulin resistance 

111 

Intrinsic mitochondrial function 

Table 3  summarizes  the effects of HFD  feeding on  the  intrinsic mitochondrial  function  in 

vitro,  represented  by  oxygen  consumption  rates  in  isolated  TA  mitochondria  oxidizing 

glucose‐  or  fat‐derived  substrates  under  different metabolic  states. HFD  feeding  had  no 

significant  effect  on  pyruvate  plus  malate‐driven  oxygen  consumption  in  actively 

phosphorylating  (state  3),  resting  (state  4)  and  uncoupled  (state  U)  mitochondria. 

Interestingly, a ~30% higher palmitoyl‐L‐carnitine plus malate driven oxygen consumption 

rate in state 3 and state U was observed in mitochondria from TA of HFD‐fed rats compared 

to controls after 25 wk of diet. Independent of the diet, oxygen consumption rates declined 

with age (p < 0.001).  

FFA‐ and reactive oxygen species‐induced expression and activation of uncoupling protein 3 

(UCP3)  [35] may  increase proton permeability of  the  inner mitochondrial membrane and 

diminish ATP synthesis efficiency. Figure 4A shows that there was no significant difference 

in UCP3 expression in TA of NC‐ and HFD‐fed rats after 2.5 wk of diet, whereas after 25 wk 

expression of UCP3 was 76% higher (p < 0.001) in TA of HFD‐fed rats compared to controls 

of the same age. 

Table 2. Metabolite concentrations and pH in TA measured by in vivo 31P MRS.

Rest  2.5 wk  25 wk

NC  HFD NC HFD 

   pH  7.14 ± 0.01  7.16 ± 0.03 7.13 ± 0.04 7.15 ± 0.03 

[PCr] (mM)* 40.1 ± 2.1  38.2 ± 2.5 41.1 ± 1.5 41.1 ± 3.4 

[Pi] (mM)  2.6 ± 0.7  2.4 ± 0.6 2.7 ± 0.8 3.6 ± 0.6†,‡ 

[ADP] (μM)  12.4 ± 0.6  12.4 ± 0.7 11.8 ± 1.0 12.4 ± 0.7 

End stimulation  2.5 wk  25 wk

NC  HFD NC HFD 

   pH  7.01 ± 0.05  7.02 ± 0.04 7.04 ± 0.04 7.01 ± 0.04 

[PCr] (mM)* 18.0 ± 2.2  16.8 ± 1.2 20.0 ± 3.8 18.5 ± 2.3 

[Pi] (mM)  22.4 ± 1.8  20.8 ± 2.4 21.7 ± 2.7 23.3 ± 3.75 

[ADP] (μM)  83.9 ± 10.4  88.1 ± 10.2 81.0 ± 24.6 82.2 ± 16.3 

Data are from n = 10 animals for each group and are expressed as means ± SD. NC, normal chow; 

HFD, high‐ diet; PCr, phosphocreatine; Pi,  inorganic phosphate. *General age effect (p < 0.05), †p < 

0.05 vs. NC‐fed fat rats of the same age, ‡p < 0.001 vs. the same diet group after 2.5 wk of diet. 

Chapter 5 

112 

Mitochondrial content 

Skeletal  muscle  oxidative  capacity  in  vivo  is  determined  by  the  intrinsic  mitochondrial 

function as well as  the amount of mitochondria  in  the  tissue. Figure 4B  shows  that HFD 

feeding  resulted  in  a  significant  increase  (p  <  0.001)  in  the  relative mitochondrial  copy 

number  in TA  compared  to  controls  (23% and 42% after 2.5 wk and 25 wk of HFD diet, 

respectively).  In  addition,  the  expression  of  peroxisome  proliferator‐activated  receptor‐γ 

coactivator 1 (PGC1) was significantly higher (p < 0.001) in TA of HFD‐fed rats compared 

to controls (36% and 66% after 2.5 and 25 wk of HFD, respectively) (Figure 4C),  indicating 

that the increase in the relative mitochondrial copy number may be mediated by PGC1. 

Enzyme activities 

To further study muscle adaptations to HFD feeding, we determined  in vitro activities of a 

number of mitochondrial enzymes  involved  in  substrate oxidation and  the mitochondrial 

respiratory chain. The  specific activities of citrate  synthase  (CS), very‐long‐chain acyl‐CoA 

dehydrogenase (VLCAD), succinate dehydrogenase (SDH) and cytochrome c oxidase (CCO) 

were significantly elevated (p < 0.05) after HFD feeding (Table 4). A substantial increase in 

Table 3. Oxygen consumption rates in isolated TA mitochondria oxidizing different substrates in different 

metabolic states. 

Pyruvate plus malate  2.5 wk 25 wk

  NC HFD NC HFD 

   State 3 (nmol O2min

‐1∙mg protein

‐1)* 641 ± 76 654 ± 113 375 ± 60 375 ± 80 

State 4 (nmol O2min‐1∙mg protein

‐1)*  38 ± 4 41 ± 8 31 ± 5 27 ± 6 

State U (nmol O2min‐1∙mg protein

‐1)*  784 ± 103 777 ± 145 495 ± 112 475 ± 118 

Palmitoyl‐L‐carnitine plus malate  2.5 wk 25 wk

  NC HFD NC HFD 

   State 3 (nmol O2min

‐1∙mg protein

‐1)*  275 ± 96 279 ± 48 103 ± 32 137 ± 34 

State 4 (nmol O2min

‐1∙mg protein

‐1)*  37 ± 12 44 ± 13 30 ± 7 25 ± 6 

State U (nmol O2min‐1∙mg protein

‐1)*  312 ± 72 319 ± 53 146 ± 42 187 ± 50 

Data are from n = 9 and n = 10 animals for 2.5 wk and 25 wk, respectively, and are expressed as means ± 

SD. NC, normal chow; HFD, high‐fat diet; State 3, maximal ADP‐stimulated oxygen consumption; State 4, 

oxygen consumption  in the absence of ATP synthesis; State U, oxygen consumption  in uncoupled state. 

*General age effect (p < 0.05). 

Mitochondrial function and insulin resistance 

113 

enzyme activities was already observed after 2.5 wk of HFD (CS by 17%, VLCAD by 40%, SDH 

by 27% and CCO by 39%), which became more pronounced after 25 wk of HFD (CS by 42%, 

VLCAD  by  84%,  SDH  by  49%  and  CCO  by  49%).  Increased  activities  of  mitochondrial 

enzymes provide further evidence for increased mitochondrial proliferation in response to 

HFD  feeding.  Interestingly, VLCAD was  the  enzyme with  the  largest  increase,  suggesting 

increased VLCAD enzyme activity per mitochondrion. 

Table 4. Specific enzyme activities in TA homogenates.

  2.5 wk 25 wk

NC HFD NC HFD 

   CS (nmolmin

‐1∙mg protein

‐1)*

,†  193.4 ± 33.7 226.7 ± 34.8 152.2 ± 38.7 216.3 ± 41.9 

VLCAD (nmolmin‐1∙mg protein

‐1)*

,†  30.8 ± 9.9 43.0 ± 16.5 11.0 ± 5.0 20.3 ± 5.3 

SDH (nmolmin‐1∙mg protein

‐1)*

,†  10.5 ± 2.7 13.4 ± 2.7 6.4 ± 2.3 9.5 ± 2.6 

CCO (nmolmin‐1∙mg protein

‐1)†  33.5 ± 6.1 46.5 ± 12.8 36.5 ± 10.0 54.5 ± 13.4 

Data are from n = 9 and n = 10 animals for 2.5 wk and 25 wk, respectively, and are expressed as means ± 

SD.  NC,  normal  chow;  HFD,  high‐fat  diet;  CS,  citrate  synthase,  VLCAD,  very‐long‐chain  acyl‐CoA 

dehydrogenase;  SDH,  succinate  dehydrogenase;  CCO,  cytochrome  c  oxidase.  *General  age  effect  (p  < 

0.05), †General effect of HFD (p < 0.05). 

 

 

Figure  4.  The  effect  of  high‐fat  diet  on  mitochondrial  content  and  protein  expression  in  TA.  (A) 

Expression of UCP3  in TA  (n = 4  for each diet group). *p < 0.001 vs. NC‐fed  rats of  the  same age.  (B) 

Relative mitochondrial copy number  in TA as determined by quantitative PCR (n = 9 and n = 10, for 2.5 

and 25 wk data, respectively). There was a significant effect of HFD (p < 0.001) and age (p < 0.001) on the 

relative mitochondrial copy number in TA. (C) Expression of PGC1 in TA (n = 6 per diet group). There was a significant effect of HFD (p < 0.001) and age (p < 0.01) on PGC1 expression in TA. Data are means ± SD. 

 

Chapter 5 

114 

Discussion 

Several  lines  of  evidence  indicate  that  decreased  skeletal  muscle  oxidative  capacity, 

presumably associated with a reduced mitochondrial capacity to oxidize fatty acids, might 

stimulate IMCL accumulation and contribute to the development of skeletal muscle IR [36]. 

However,  an  increasing  number  of  studies  in  humans  and  rodents  show  a  dissociation 

between mitochondrial dysfunction and insulin resistance [12‐13, 17‐18, 37]. To clarify this 

issue, we  investigated the adaptations of skeletal muscle oxidative metabolism during the 

development  of HFD‐induced  IR  in  rats  using  both  in  vivo  and  in  vitro  approaches. We 

showed  that  HFD  feeding  does  not  affect  the  maximal  ADP‐stimulated  (i.e.  state  3) 

pyruvate plus malate‐driven oxygen consumption rate  in  isolated mitochondria, but  leads 

to an  increased number of muscle mitochondria and an  increased capacity to oxidize  fat‐

derived  substrates  in  vitro.  Surprisingly,  this  did  not  result  in  a  higher muscle  oxidative 

capacity  in  vivo  after  long‐term  HFD  feeding.  These  findings  indicate  that  the  higher 

mitochondrial  content  compensates  for a  compromised  in  vivo mitochondrial  function  in 

insulin resistant muscle. 

The  results of our  in  vitro measurements are  in agreement with previous  studies on  the 

effect  of HFD  feeding  on muscle mitochondrial  function  in  rats.  It  has  repeatedly  been 

shown  that  HFD  does  not  affect  respiration  of  rat  muscle  mitochondria  when  using 

substrates other  than  fatty acids,  i.e. pyruvate/glutamate plus malate and  succinate  [17, 

38‐39],  implying that the  intrinsic functioning of the mitochondria  is not changed  in vitro. 

Furthermore, a number of studies have shown that HFD feeding  in rats  induces  increased 

biogenesis  of  mitochondria  and  increases  in  vitro  mitochondrial  fatty  acid  oxidative 

capacity in skeletal muscle [15, 17‐18, 40‐42]. The strength of this study is that it combines 

in vitro and in vivo methodologies to measure mitochondrial function, resulting in the new 

and  unexpected  finding  that  the  mitochondrial  adaptations  observed  in  vitro  are  not 

paralleled by an increased muscle oxidative capacity in vivo after long‐term HFD feeding. 

In vivo skeletal muscle oxidative capacity is determined by mitochondrial content, intrinsic 

mitochondrial  function  and  other  factors  like  the  supply  of  oxygen  and  substrates. We 

showed  that  short‐term  (2.5 wk) HFD  feeding  resulted  in  the  accumulation of  IMCL  and 

higher oxidative  capacity of  TA  as  indicated by  a 20% higher PCr  recovery  rate  constant 

(kPCr)  compared  to  controls.  kPCr  reflects  in  vivo muscle mitochondrial  oxidative  capacity 

because  during  recovery  from  exercise  PCr  is  resynthesized  purely  as  a  consequence  of 

oxidative  ATP  synthesis  [43‐45]  and  the  creatine  kinase  reaction  is  much  faster  than 

oxidative  ATP  production  [46].  Since  during  the  recovery  from  short  intense  exercise 

carbohydrates are preferentially used as the source of oxidizable substrates  in the muscle 

[47], our observation that pyruvate plus malate‐driven oxygen consumption  in  isolated TA 

mitochondria was similar in NC‐ and HFD‐fed rats implies that the increase in TA oxidative 

capacity observed in vivo after 2.5 wk of HFD feeding was not a consequence of improved 

intrinsic mitochondrial function. We showed that the relative mitochondrial copy number 

Mitochondrial function and insulin resistance 

115 

as  well  as  CS  activity,  which  has  been  shown  to  correlate  with  mitochondrial  volume 

density  [48‐49], was  increased  in  the  same  range as  kPCr,  suggesting  that  the  increase  in 

mitochondrial content caused the higher in vivo muscle oxidative capacity after short‐term 

HFD feeding. 

Long‐term HFD feeding caused further accumulation of IMCL in TA. However, in contrast to 

short‐term HFD  feeding,  long‐term  (25 wk) HFD  feeding  resulted  in  similar  TA  oxidative 

capacity  in vivo compared  to controls as  indicated by similar kPCr.  In agreement, pyruvate 

plus  malate‐driven  oxygen  consumption  rates  in  isolated  TA  mitochondria  were  not 

significantly different  in  the  two diet groups at  this  time point. However,  long‐term HFD 

feeding  caused  a  further  increase  in  PGC1  expression with  a  concomitant  increase  in 

mitochondrial  copy  number  and  CS  activity  in  TA  compared  to  controls.  Therefore,  one 

would also expect a higher  in vivo oxidative capacity  in TA of HFD‐fed  rats. However, we 

showed  that 42% more mitochondria were needed  in TA of HFD‐fed rats  to maintain  the 

same  in  vivo muscle  oxidative  capacity  as  in  controls  of  the  same  age.  This  discrepancy 

suggests that the intrinsic functioning of mitochondria is impaired when they are placed in 

their natural cellular environment by factors that are not taken into account during in vitro 

measurement of intrinsic mitochondrial function. Efficient supply of substrates and oxygen 

to  the  muscle  and  removal  of  potentially  toxic  metabolites  is  essential  for  normal 

mitochondrial  function  in  the  tissue.  Insulin  regulates  muscle  blood  flow  through 

stimulation of nitric oxide‐dependent vasodilation [50]. Consequently, the development of 

vascular  IR  in  response  to  HFD‐feeding may  result  in  diminished muscle  perfusion  and 

substrate  supply  causing  sub‐optimal mitochondrial  performance  in  vivo.  However,  our 

observation that during electrical stimulation the rate of acidification and the degree of PCr 

depletion  was  similar  in  TA  of  HFD‐fed  rats  compared  to  controls  at  both  time  points 

indicates that the perfusion of TA was not affected by HFD feeding. 

Not only the shortage but also the excess of substrates may negatively affect mitochondrial 

function  in  vivo.  High  concentrations  of  FFA  and  their  metabolites  may  impair 

mitochondrial ATP production through a number of mechanisms. E.g.  long‐chain acyl‐CoA 

esters  may  inhibit  mitochondrial  adenine  nucleotide  translocator  leading  to  impaired 

exchange of cytosolic ADP  for mitochondrial ATP  [51]. Moreover,  increased availability of 

FFA may lead to increased expression [17] as well as activation of UCP3 [35], which in turn 

may  lead  to diminished efficiency of ATP synthesis. We showed  that both  the content of 

long‐chain  acylcarnitines,  which  reflects  the  long‐chain  acyl‐CoA  content  [52],  and  the 

expression of UCP3 in the muscle were significantly increased after long‐term HFD feeding 

suggesting  that  both  proposed  mechanisms  (i.e.  inhibition  of  adenine  nucleotide 

translocator  and mitochondrial  uncoupling) may  contribute  to mitochondrial  functional 

impairment in vivo. On the other hand, increased expression of UCP3 in the muscle may be 

a  trade‐off  between  lower  mitochondrial  efficiency  (in  terms  of  ATP  production)  and 

lipotoxicity  in  vivo,  which  enables  muscle  cells  to  burn  more  fat  [53]  and  to  protect 

Chapter 5 

116 

themselves from increased production of reactive oxygen species arising from increased fat 

oxidation [35]. 

Fatty  acids  are  activating  ligands of peroxisome proliferator‐activated  receptors  (PPARs), 

which regulate the expression of genes encoding enzymes  involved  in fatty acid oxidation 

[54].  The  increase  in mitochondrial  capacity  to oxidize  fatty  acids observed  in  this  study 

may therefore be related to direct activation of PPARs by fatty acids. In addition, PPARs are 

co‐activated by PGC1, the master regulator of mitochondrial biogenesis [55]. We showed 

that  the expression of PGC1  in TA was progressively  stimulated by HFD  feeding with a 

concomitant increase in mitochondrial DNA copy number. However, also high insulin levels 

stimulate  mitochondrial  protein  synthesis  [56].  Therefore,  the  HFD‐induced  changes  in 

skeletal muscle oxidative metabolism observed  in this study could be caused by  increased 

levels of FFA or insulin, or both. 

As  an  alternative  to  measuring  muscle  oxidative  capacity  from  dynamic  31P  MRS 

experiments after exercise, Laurent et al. applied 31P MRS saturation transfer experiments 

to measure mitochondrial ATP  synthesis  rates  in  resting  skeletal muscle  of HFD‐fed  rats 

[19].  ATP  synthesis  rates  rapidly  declined  after  the  commencement  of  HFD  feeding, 

returned  to  normal  values  after  2‐3 weeks  and  decreased  again  after  1 month  of  HFD 

feeding  and  the  lower  rates were  taken  as  evidence  for mitochondrial  dysfunction  [19]. 

However,  the  interpretation  of  31P  saturation  transfer  data  is  not  straightforward.  The 

lower basal ATP synthesis rates in insulin‐resistant states [6‐7] could actually reflect a lower 

energy  demand  caused  by  impaired  insulin  signaling  rather  than  an  impairment  of 

mitochondrial function [57‐59]. Moreover, the fluxes obtained from 31P saturation transfer 

measurements are comprised of both ATP synthesis flux and glycolytic exchange flux, with 

the  latter  contributing  by  as  much  as  80%  [60‐61].  Therefore,  decreased  basal  ATP 

synthesis rates do not necessarily reflect a mitochondrial defect. 

It  has  been  suggested  that  an  increased  expression  of  enzymes  involved  in  ‐oxidation without  a  concomitant  upregulation  of  enzymes  involved  in  the  tricarboxylic  acid  (TCA) 

cycle  may  result  in  incomplete  oxidation  of  fatty  acids  and  depletion  of  TCA  cycle 

intermediates  leading  to  reduced glucose oxidation and  IR  [62]. Our data on  the enzyme 

activities and oxygen consumption  in  isolated mitochondria suggest that such dissociation 

may indeed occur in the muscle of HFD‐fed rats. Furthermore, the increase  in the content 

of medium‐chain acylcarnitines and the decrease in acetylcarnitine content in the muscle of 

HFD‐fed rats may imply incomplete oxidation of fatty acids. However, we did not measure 

TCA  cycle  and beta oxidation  flux  and  therefore our  interpretation  is  rather  speculative. 

Moreover, acetyl‐CoA, the precursor of acetylcarnitine, is also produced during oxidation of 

glucose and amino acids. Therefore, the decrease  in acetylcarnitine content  in the muscle 

of HFD‐fed rats may indicate decreased glucose oxidation rather than incomplete oxidation 

of fatty acids.  

Mitochondrial function and insulin resistance 

117 

In  conclusion,  this  study  revealed  the  adaptations  of  rat  skeletal muscle mitochondria 

characteristic  to  early  and  later  stages  of  HFD‐induced  IR. We  demonstrated  that  HFD 

feeding  resulted  in progressive  increase  in mitochondrial  content  and higher  capacity  to 

oxidize  fat‐derived  substrates  in  the  long‐term. Most  importantly,  the  combination of  in 

vitro and in vivo approaches allowed the establishment of the relationship between in vitro 

intrinsic  mitochondrial  function,  mitochondrial  number,  and  in  vivo  muscle  oxidative 

capacity, showing that an increased number of mitochondria with normal function  in vitro 

was  required  to maintain normal oxidative  capacity  in vivo during  later  stages of  IR. The 

observed dissociation between  in vivo and  in vitro muscle oxidative capacity suggests that 

in vivo mitochondrial function in insulin resistant rat muscle is compromised by factors not 

taken into account when mitochondrial function is assed under in vitro conditions. 

Acknowledgements 

We  would  like  to  thank  J.W.  Habets,  L.B.P  Niesen  and  R.A.M.  Jonkers  for  technical 

assistance. 

The work of J.C. and J.A.J.  is financed by the Netherlands Consortium for Systems Biology 

(NCSB) which is part of the Netherlands Genomics Initiative / Netherlands Organization for 

Scientific Research.  J.J.P.  and  S.M.H.  are  supported by VIDI  grants  from  the Netherlands 

Organization  for  Scientific  Research  (VIDI  grant  numbers  700.58.421  and  016.086.336, 

respectively). 

Chapter 5 

118 

References 1.  Wang, Y., E.B. Rimm, M.J. Stampfer, W.C. Willett, and F.B. Hu. Comparison of abdominal adiposity and 

overall obesity in predicting risk of type 2 diabetes among men. Am J Clin Nutr, 2005. 81(3): 555‐63. 2.  Boden, G., B. Lebed, M. Schatz, C. Homko, and S. Lemieux. Effects of acute changes of plasma free fatty 

acids on  intramyocellular  fat content and  insulin  resistance  in healthy subjects. Diabetes, 2001. 50(7): 1612‐7. 

3.  Goodpaster, B.H., J. He, S. Watkins, and D.E. Kelley. Skeletal muscle lipid content and insulin resistance: evidence for a paradox in endurance‐trained athletes. J Clin Endocrinol Metab, 2001. 86(12): 5755‐61. 

4.  Sinha,  R.,  S.  Dufour,  K.F.  Petersen,  V.  LeBon,  S.  Enoksson,  Y.Z. Ma, M.  Savoye,  D.L.  Rothman,  G.I. Shulman,  and  S. Caprio. Assessment of  skeletal muscle  triglyceride  content by  (1)H nuclear magnetic resonance spectroscopy in lean and obese adolescents: relationships to insulin sensitivity, total body fat, and central adiposity. Diabetes, 2002. 51(4): 1022‐7. 

5.  van  Loon,  L.J., R. Koopman, R. Manders, W.  van der Weegen, G.P.  van Kranenburg, and H.A. Keizer. Intramyocellular lipid content in type 2 diabetes patients compared with overweight sedentary men and highly trained endurance athletes. Am J Physiol Endocrinol Metab, 2004. 287(3): E558‐65. 

6.  Petersen, K.F., D. Befroy, S. Dufour, J. Dziura, C. Ariyan, D.L. Rothman, L. DiPietro, G.W. Cline, and G.I. Shulman. Mitochondrial  dysfunction  in  the  elderly:  possible  role  in  insulin  resistance.  Science,  2003. 300(5622): 1140‐2. 

7.  Petersen, K.F., S. Dufour, D. Befroy, R. Garcia, and G.I. Shulman.  Impaired mitochondrial activity  in the insulin‐resistant offspring of patients with type 2 diabetes. N Engl J Med, 2004. 350(7): 664‐71. 

8.  Yu,  C.,  Y.  Chen,  G.W.  Cline,  D.  Zhang,  H.  Zong,  Y. Wang,  R.  Bergeron,  J.K.  Kim,  S.W.  Cushman,  G.J. Cooney,  B. Atcheson, M.F. White,  E.W.  Kraegen,  and G.I.  Shulman. Mechanism  by which  fatty  acids inhibit  insulin activation of  insulin receptor substrate‐1  (IRS‐1)‐associated phosphatidylinositol 3‐kinase activity in muscle. J Biol Chem, 2002. 277(52): 50230‐6. 

9.  Mootha, V.K., C.M. Lindgren, K.F. Eriksson, A. Subramanian, S. Sihag, J. Lehar, P. Puigserver, E. Carlsson, M. Ridderstrale, E. Laurila, N. Houstis, M.J. Daly, N. Patterson,  J.P. Mesirov, T.R. Golub, P. Tamayo, B. Spiegelman,  E.S.  Lander,  J.N. Hirschhorn, D.  Altshuler,  and  L.C. Groop.  PGC‐1alpha‐responsive  genes involved  in oxidative phosphorylation are  coordinately downregulated  in human diabetes. Nat Genet, 2003. 34(3): 267‐73. 

10.  Patti, M.E., A.J. Butte, S. Crunkhorn, K. Cusi, R. Berria, S. Kashyap, Y. Miyazaki, I. Kohane, M. Costello, R. Saccone, E.J. Landaker, A.B. Goldfine, E. Mun, R. DeFronzo, J. Finlayson, C.R. Kahn, and L.J. Mandarino. Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: Potential role of PGC1 and NRF1. Proc Natl Acad Sci U S A, 2003. 100(14): 8466‐71. 

11.  Ritov,  V.B.,  E.V.  Menshikova,  J.  He,  R.E.  Ferrell,  B.H.  Goodpaster,  and  D.E.  Kelley.  Deficiency  of subsarcolemmal mitochondria in obesity and type 2 diabetes. Diabetes, 2005. 54(1): 8‐14. 

12.  Boushel, R., E. Gnaiger, P. Schjerling, M. Skovbro, R. Kraunsoe, and F. Dela. Patients with type 2 diabetes have normal mitochondrial function in skeletal muscle. Diabetologia, 2007. 50(4): 790‐6. 

13.  De Feyter, H.M., N.M. van den Broek, S.F. Praet, K. Nicolay, L.J. van Loon, and  J.J. Prompers. Early or advanced stage type 2 diabetes is not accompanied by in vivo skeletal muscle mitochondrial dysfunction. Eur J Endocrinol, 2008. 158(5): 643‐53. 

14.  Sreekumar, R., P. Halvatsiotis, J.C. Schimke, and K.S. Nair. Gene expression profile  in skeletal muscle of type 2 diabetes and the effect of insulin treatment. Diabetes, 2002. 51(6): 1913‐20. 

15.  Iossa, S., L. Lionetti, M.P. Mollica, R. Crescenzo, M. Botta, A. Barletta, and G. Liverini. Effect of high‐fat feeding on metabolic efficiency and mitochondrial oxidative capacity in adult rats. Br J Nutr, 2003. 90(5): 953‐60. 

16.  Bonnard, C., A. Durand,  S. Peyrol, E. Chanseaume, M.A. Chauvin, B. Morio, H. Vidal, and  J. Rieusset. Mitochondrial  dysfunction  results  from  oxidative  stress  in  the  skeletal muscle  of  diet‐induced  insulin‐resistant mice. J Clin Invest, 2008. 118(2): 789‐800. 

17.  Turner, N., C.R. Bruce, S.M. Beale, K.L. Hoehn, T. So, M.S. Rolph, and G.J. Cooney. Excess lipid availability increases mitochondrial fatty acid oxidative capacity in muscle: evidence against a role for reduced fatty acid oxidation in lipid‐induced insulin resistance in rodents. Diabetes, 2007. 56(8): 2085‐92. 

18.  Hancock, C.R., D.H. Han, M. Chen, S. Terada, T. Yasuda, D.C. Wright, and  J.O. Holloszy. High‐fat diets cause  insulin  resistance despite an  increase  in muscle mitochondria. Proc Natl Acad  Sci U  S A, 2008. 105(22): 7815‐20. 

19.  Laurent, D., B. Yerby, R. Deacon, and  J. Gao. Diet‐induced modulation of mitochondrial activity  in  rat muscle. Am J Physiol Endocrinol Metab, 2007. 293(5): E1169‐77. 

20.  Tran,  T.T., N.  Gupta,  T.  Goh, D. Naigamwalla, M.C.  Chia, N.  Koohestani,  S. Mehrotra,  G. McKeown‐Eyssen,  A.  Giacca,  and W.R.  Bruce.  Direct  measure  of  insulin  sensitivity  with  the  hyperinsulinemic‐euglycemic  clamp  and  surrogate measures  of  insulin  sensitivity with  the  oral  glucose  tolerance  test: 

Mitochondrial function and insulin resistance 

119 

correlations with aberrant crypt foci promotion in rats. Cancer Epidemiol Biomarkers Prev, 2003. 12(1): 47‐56. 

21.  van Vlies, N.,  L.  Tian, H. Overmars, A.H. Bootsma, W. Kulik, R.J. Wanders, P.A. Wood,  and  F.M. Vaz. Characterization  of  carnitine  and  fatty  acid metabolism  in  the  long‐chain  acyl‐CoA  dehydrogenase‐deficient mouse. Biochem J, 2005. 387(Pt 1): 185‐93. 

22.  De  Feyter,  H.M.,  G.  Schaart, M.K.  Hesselink,  P.  Schrauwen,  K.  Nicolay,  and  J.J.  Prompers.  Regional variations  in  intramyocellular  lipid  concentration  correlate with muscle  fiber  type  distribution  in  rat tibialis anterior muscle. Magn Reson Med, 2006. 56(1): 19‐25. 

23.  Garwood, M.  and  L.  DelaBarre.  The  return  of  the  frequency  sweep:  designing  adiabatic  pulses  for contemporary NMR. J Magn Reson, 2001. 153(2): 155‐77. 

24.  de Graaf, R.A. and K. Nicolay. Adiabatic water  suppression using  frequency  selective excitation. Magn Reson Med, 1998. 40(5): 690‐6. 

25.  De Feyter, H.M., E. Lenaers, S.M. Houten, P. Schrauwen, M.K. Hesselink, R.J. Wanders, K. Nicolay, and J.J.  Prompers.  Increased  intramyocellular  lipid  content  but  normal  skeletal  muscle  mitochondrial oxidative capacity throughout the pathogenesis of type 2 diabetes. Faseb J, 2008. 22(11): 3947‐55. 

26.  Vanhamme,  L., A.  van  den Boogaart,  and  S. Van Huffel.  Improved method  for  accurate  and  efficient quantification of MRS data with use of prior knowledge. J Magn Reson, 1997. 129(1): 35‐43. 

27.  Reichert, M., H. Schaller, W. Kunz, and G. Gerber. The dependence on the extramitochondrial ATP/ADP‐ratio of  the oxidative phosphorylation  in mitochondria  isolated by a new procedure  from  rat  skeletal muscle. Acta Biol Med Ger, 1978. 37(8): 1167‐76. 

28.  Ciapaite,  J.,  S.J. Bakker, G. Van Eikenhorst, M.J. Wagner, T. Teerlink, C.G.  Schalkwijk, M.  Fodor, D.M. Ouwens, M. Diamant, R.J. Heine, H.V. Westerhoff, and K. Krab. Functioning of oxidative phosphorylation in liver mitochondria of high‐fat diet fed rats. Biochim Biophys Acta, 2007. 1772(3): 307‐16. 

29.  Szuhai, K., J. Ouweland, R. Dirks, M. Lemaitre, J. Truffert, G. Janssen, H. Tanke, E. Holme, J. Maassen, and A.  Raap.  Simultaneous  A8344G  heteroplasmy  and mitochondrial  DNA  copy  number  quantification  in myoclonus epilepsy and  ragged‐red  fibers  (MERRF)  syndrome by a multiplex molecular beacon based real‐time fluorescence PCR. Nucleic Acids Res, 2001. 29(3): E13. 

30.  Munujos, P., J. Coll‐Canti, F. Gonzalez‐Sastre, and F.J. Gella. Assay of succinate dehydrogenase activity by a  colorimetric‐continuous  method  using  iodonitrotetrazolium  chloride  as  electron  acceptor.  Anal Biochem, 1993. 212(2): 506‐9. 

31.  Cooperstein,  S.J.  and  A.  Lazarow.  A  microspectrophotometric  method  for  the  determination  of cytochrome oxidase. J Biol Chem, 1951. 189(2): 665‐70. 

32.  Srere, P.A., H. Brazil, and L. Gonen. The citrate condensing enzyme of pigeon breast muscle and moth flight muscle. Acta. Chem. Scand. , 1963. 17: S129‐S134. 

33.  Wanders,  R.J.,  P.  Vreken,  M.E.  den  Boer,  F.A.  Wijburg,  A.H.  van  Gennip,  and  I.J.  L.  Disorders  of mitochondrial fatty acyl‐CoA beta‐oxidation. J Inherit Metab Dis, 1999. 22(4): 442‐87. 

34.  Kemp, G.J. and G.K. Radda. Quantitative interpretation of bioenergetic data from 31P and 1H magnetic resonance spectroscopic studies of skeletal muscle: an analytical review. Magn Reson Q, 1994. 10(1): 43‐63. 

35.  Echtay, K.S., D. Roussel, J. St‐Pierre, M.B. Jekabsons, S. Cadenas, J.A. Stuart, J.A. Harper, S.J. Roebuck, A. Morrison,  S. Pickering,  J.C. Clapham,  and M.D. Brand.  Superoxide activates mitochondrial uncoupling proteins. Nature, 2002. 415(6867): 96‐9. 

36.  Morino, K., K.F. Petersen, and G.I. Shulman. Molecular mechanisms of insulin resistance in humans and their potential links with mitochondrial dysfunction. Diabetes, 2006. 55 Suppl 2: S9‐S15. 

37.  Turner,  N.  and  L.K.  Heilbronn.  Is  mitochondrial  dysfunction  a  cause  of  insulin  resistance?  Trends Endocrinol Metab, 2008. 19(9): 324‐30. 

38.  Chanseaume,  E.,  A.L.  Tardy,  J.  Salles,  C. Giraudet,  P.  Rousset,  A.  Tissandier,  Y.  Boirie,  and  B. Morio. Chronological approach of diet‐induced alterations  in muscle mitochondrial  functions  in  rats. Obesity (Silver Spring), 2007. 15(1): 50‐9. 

39.  Hoeks,  J.,  J.J. Briede,  J. de Vogel, G.  Schaart, M. Nabben, E. Moonen‐Kornips, M.K. Hesselink, and P. Schrauwen. Mitochondrial function, content and ROS production in rat skeletal muscle: effect of high‐fat feeding. FEBS Lett, 2008. 582(4): 510‐6. 

40.  Nemeth, P.M., B.W. Rosser, R.M. Choksi, B.J. Norris, and K.M. Baker. Metabolic response to a high‐fat diet in neonatal and adult rat muscle. Am J Physiol, 1992. 262(2 Pt 1): C282‐6. 

41.  Garcia‐Roves, P.,  J.M. Huss, D.H. Han, C.R. Hancock, E.  Iglesias‐Gutierrez, M. Chen, and  J.O. Holloszy. Raising plasma fatty acid concentration induces increased biogenesis of mitochondria in skeletal muscle. Proc Natl Acad Sci U S A, 2007. 104(25): 10709‐13. 

42.  McAinch, A.J., J.S. Lee, C.R. Bruce, R.J. Tunstall, J.A. Hawley, and D. Cameron‐Smith. Dietary regulation of fat oxidative gene expression in different skeletal muscle fiber types. Obes Res, 2003. 11(12): 1471‐9. 

Chapter 5 

120 

43.  Taylor, D.J., P.J. Bore, P. Styles, D.G. Gadian, and G.K. Radda. Bioenergetics of  intact human muscle. A 31P nuclear magnetic resonance study. Mol Biol Med, 1983. 1(1): 77‐94. 

44.  Sahlin, K.  Intracellular pH and energy metabolism  in skeletal muscle of man. With special reference to exercise. Acta Physiol Scand Suppl, 1978. 455: 1‐56. 

45.  Quistorff, B., L. Johansen, and K. Sahlin. Absence of phosphocreatine resynthesis  in human calf muscle during ischaemic recovery. Biochem J, 1993. 291( Pt 3): 681‐6. 

46.  Vicini, P. and M.J. Kushmerick. Cellular energetics analysis by a mathematical model of energy balance: estimation of parameters in human skeletal muscle. Am J Physiol Cell Physiol, 2000. 279(1): C213‐24. 

47.  van Hall, G., J. Gonzalez‐Alonso, M. Sacchetti, and B. Saltin. Skeletal muscle substrate metabolism during exercise: methodological considerations. Proc Nutr Soc, 1999. 58(4): 899‐912. 

48.  Andrade, F.H., C.A. McMullen, and R.E. Rumbaut. Mitochondria are  fast Ca2+  sinks  in  rat extraocular muscles: a novel regulatory influence on contractile function and metabolism. Invest Ophthalmol Vis Sci, 2005. 46(12): 4541‐7. 

49.  Toledo, F.G., E.V. Menshikova, V.B. Ritov, K. Azuma, Z. Radikova,  J. DeLany, and D.E. Kelley. Effects of physical activity and weight loss on skeletal muscle mitochondria and relationship with glucose control in type 2 diabetes. Diabetes, 2007. 56(8): 2142‐7. 

50.  Laakso, M., S.V. Edelman, G. Brechtel, and A.D. Baron. Impaired insulin‐mediated skeletal muscle blood flow in patients with NIDDM. Diabetes, 1992. 41(9): 1076‐83. 

51.  Lerner, E., A.L. Shug, C. Elson, and E. Shrago. Reversible inhibition of adenine nucleotide translocation by long chain fatty acyl coenzyme A esters in liver mitochondria of diabetic and hibernating animals. J Biol Chem, 1972. 247(5): 1513‐9. 

52.  Brass, E.P. and C.L. Hoppel. Relationship between acid‐soluble carnitine and coenzyme A pools  in vivo. Biochem J, 1980. 190(3): 495‐504. 

53.  Costford,  S.R.,  S.N.  Chaudhry,  S.A.  Crawford,  M.  Salkhordeh,  and  M.E.  Harper.  Long‐term  high‐fat feeding induces greater fat storage in mice lacking UCP3. Am J Physiol Endocrinol Metab, 2008. 295(5): E1018‐24. 

54.  Gulick, T., S. Cresci, T. Caira, D.D. Moore, and D.P. Kelly. The peroxisome proliferator‐activated receptor regulates mitochondrial  fatty acid oxidative enzyme gene expression. Proc Natl Acad Sci U S A, 1994. 91(23): 11012‐6. 

55.  Lin,  J.,  P.  Puigserver,  J.  Donovan,  P.  Tarr,  and  B.M.  Spiegelman.  Peroxisome  proliferator‐activated receptor  gamma  coactivator  1beta  (PGC‐1beta  ),  a  novel  PGC‐1‐related  transcription  coactivator associated with host cell factor. J Biol Chem, 2002. 277(3): 1645‐8. 

56.  Stump, C.S., K.R. Short, M.L. Bigelow,  J.M. Schimke, and K.S. Nair. Effect of  insulin on human  skeletal muscle mitochondrial ATP production, protein synthesis, and mRNA transcripts. Proc Natl Acad Sci U S A, 2003. 100(13): 7996‐8001. 

57.  Short, K.R., K.S. Nair, and C.S. Stump.  Impaired mitochondrial activity and  insulin‐resistant offspring of patients with type 2 diabetes. N Engl J Med, 2004. 350(23): 2419‐21; author reply 2419‐21. 

58.  Wagenmakers, A.J. Insulin resistance  in the offspring of parents with type 2 diabetes. PLoS Med, 2005. 2(9): e289. 

59.  Kemp, G.J. The interpretation of abnormal 31P magnetic resonance saturation transfer measurements of Pi/ATP exchange in insulin‐resistant skeletal muscle. Am J Physiol Endocrinol Metab, 2008. 294(3): E640‐2; author reply E643‐4. 

60.  Brindle,  K.M.,  M.J.  Blackledge,  R.A.  Challiss,  and  G.K.  Radda.  31P  NMR  magnetization‐transfer measurements of ATP turnover during steady‐state  isometric muscle contraction  in the rat hind  limb  in vivo. Biochemistry, 1989. 28(11): 4887‐93. 

61.  Brindle, K.M. and G.K. Radda. 31P‐NMR saturation transfer measurements of exchange between Pi and ATP  in  the  reactions  catalysed  by  glyceraldehyde‐3‐phosphate  dehydrogenase  and  phosphoglycerate kinase in vitro. Biochim Biophys Acta, 1987. 928(1): 45‐55. 

62.  Koves, T.R., J.R. Ussher, R.C. Noland, D. Slentz, M. Mosedale, O. Ilkayeva, J. Bain, R. Stevens, J.R. Dyck, C.B.  Newgard,  G.D.  Lopaschuk,  and  D.M. Muoio. Mitochondrial  overload  and  incomplete  fatty  acid oxidation contribute to skeletal muscle insulin resistance. Cell Metab, 2008. 7(1): 45‐56. 

  

 

121 

 

122 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Adapted from 

N. M. A. van den Broek, J. Ciapaite, S. M. Houten, R. J. A. Wanders, K. Nicolay,  

J. J. Prompers. Carnitine insufficiency in high‐fat diet fed rats does not contribute to lipid‐

induced impairment of skeletal muscle mitochondrial function in vivo. 

In preparation 

Chapter     Carnitine insufficiency in high‐fat diet fed rats  

does not contribute to lipid‐induced impairment 

of skeletal muscle mitochondrial function in vivo 

Chapter 6 

124 

Abstract 

Muscle  lipid  overload  plays  an  important  role  in  the  development  of  insulin  resistance. 

Although  it  has  been  hypothesized  that  mitochondrial  dysfunction  and  an  associated 

decreased capacity to oxidize  fatty acids  (FAs) are the primary cause  for this disturbance, 

recently  it has been shown that high‐fat diets  lead to  increased rather than decreased FA 

oxidation,  resulting  in  the  accumulation  of  lipid  intermediates  causing  mitochondrial 

dysfunction.  Carnitine  supplementation might  be  effective  in  reducing  these  toxic  lipid 

intermediates  by  increasing  FA  oxidation  and  export  of  lipid  metabolites  out  of  the 

mitochondria and into the plasma. The aim of the present study was to test the hypothesis 

that carnitine supplementation reduces high‐fat diet‐induced lipotoxicity, improves muscle 

mitochondrial  function  and  ameliorates  insulin  resistance.  Wistar  rats  were  fed  either 

normal chow or a high‐fat diet  for 15 weeks and one group of high‐fat diet  fed  rats was 

supplemented with L‐carnitine during the last 8 weeks. Muscle mitochondrial function was 

measured in vivo by 31P MRS (PCr recovery after contraction and resting ATP synthesis and 

creatine kinase fluxes) and in vitro by high‐resolution respirometry. Muscle lipid status was 

determined  by  1H  MRS  (intramyocellular  lipids)  and  tandem  mass  spectrometry 

(acylcarnitines).  High‐fat  diet  feeding  induced  carnitine  insufficiency  and  muscle  lipid 

overload  and  led  to  an  increased  number  of  muscle  mitochondria  with  an  improved 

capacity  to  oxidize  FAs  in  vitro.  At  the  same  time,  in  vivo mitochondrial  function  was 

compromised, probably by elevated  levels of  lipid  intermediates  leading  to  increased FA‐

induced  mitochondrial  uncoupling.  Despite  the  restoration  of  muscle  free  carnitine 

content, carnitine supplementation did not induce improvements in muscle  lipid status,  in 

vivo mitochondrial function or insulin resistance. These results suggest that the decrease in 

muscle free carnitine as a result of high‐fat diet feeding did not contribute to the observed 

impairment in in vivo muscle mitochondrial function.  

Carnitine insufficiency and mitochondrial function 

125 

Introduction 

Diabetes has reached epidemic proportions worldwide [1]. Type 2 diabetes accounts for 85‐

95%  of  all  diabetes  cases  and  is  characterized  by  insulin  resistance  in major metabolic 

tissues  [2]. One of  the  leading hypotheses  in  the  research  field of  type 2 diabetes  is  that 

inherited  or  acquired    muscle  mitochondrial  dysfunction,  associated  with  a  reduced 

mitochondrial capacity to oxidize fatty acids (FAs), leads to a lipid overload in muscle cells, 

causing insulin resistance [3‐4]. Recent studies have challenged this theory and link insulin 

resistance to an  increased capacity to oxidize FAs  [5‐8]. However,  it has been shown that 

the  high  rates  of  ‐oxidation  in  insulin‐resistant  states  are  associated with  low  rates  of complete FA oxidation and therefore  increased  incomplete ‐oxidation [9‐11].  It has been hypothesized that the accumulation of  incompletely metabolized FAs  in the mitochondria 

causes  ‘mitochondrial  stress’  and  that  this  contributes  to  the  development  of  insulin 

resistance [10, 12]. 

Carnitine is an essential nutrient with multiple functions. Its major role is  in the formation 

of acylcarnitines  from  long‐chain FAs, which  is required  for  the transport of acyl moieties 

into  the mitochondrial matrix  for  ‐oxidation  [13‐14].  A  second  role  for  carnitine  is  to increase  acyl  and  acetyl  group  efflux out of  the mitochondria  and  into  the plasma  [15]. 

Moreover,  carnitine  stimulates  the  oxidation  of  pyruvate  by  lowering  the mitochondrial 

acetyl‐CoA/CoA  ratio  in  a  reaction  catalyzed  by  carnitine  acetyltransferase  (CAT), which 

converts acetyl‐CoA into acetylcarnitine [16]. 

Carnitine  insufficiency  is  a  common  feature  of  insulin‐resistant  states  and  it  has  been 

shown  that  muscle  free  carnitine  negatively  correlates  with  insulin  resistance  [11]. 

Therefore,  it  has  been  suggested  that  carnitine  supplementation might  be  an  effective 

treatment  for  type  2  diabetes  [17].  Indeed,  intravenous  infusion  of  carnitine  during  a 

hyperinsulinaemic‐euglycaemic  clamp  has  been  shown  to  increase  whole‐body  glucose 

disposal in both healthy subjects and type 2 diabetes patients [18‐22]. Moreover, carnitine 

supplementation  has  been  shown  to  attenuate  the  development  of  insulin  resistance  in 

mice  and  rats  fed with high‐fat diets  [11,  23].  The positive  effect of  carnitine on  insulin 

sensitivity can be explained by different mechanisms, depending on  the concentration of 

carnitine.  In  the  perfused  isolated  working  rat  heart,  the  addition  of  carnitine  to  the 

perfusion medium increased glucose oxidation by lowering the concentration of acetyl‐CoA 

in  the  mitochondrial  matrix  through  CAT  [24].  However,  at  the  lower  concentrations 

achievable  in vivo, carnitine has been shown  to stimulate FA oxidation  [25‐26]  through a 

mass‐action effect on the transport of long‐chain FAs into the mitochondrial matrix [27]. At 

the  same  time,  carnitine  increases  the  efflux  of  acylcarnitines  from muscle  tissue  [11]. 

Therefore,  it  has  been  proposed  that  carnitine  supplementation  ameliorates  insulin 

resistance  by  reducing  lipotoxicity  both  through  the  increased  oxidation  and  increased 

export of muscle lipid metabolites [17]. 

Chapter 6 

126 

In a previous study, we showed  that rats  fed a  long‐term high‐fat diet have an  increased 

number  of  muscle  mitochondria,  with  an  increased  capacity  to  oxidize  fat‐derived 

substrates  and  a  normal  capacity  to  oxidize  glucose‐derived  substrates  in  vitro  [8]. 

Surprisingly, this did not result in a higher muscle oxidative capacity in vivo, as measured by 31P magnetic resonance spectroscopy (MRS). Muscle tissue free carnitine was significantly 

decreased after  long‐term high‐fat diet  feeding, whereas muscle  long‐chain acylcarnitines 

were  significantly  increased.  This  finding  indicates  that  in  vivo  muscle  mitochondrial 

function might have been  compromised by high  concentrations of  lipid metabolites. The 

aim of the present study was to test the hypothesis that carnitine supplementation reduces 

high‐fat  diet‐induced  lipotoxicity,  improves  in  vivo  muscle  mitochondrial  function  and 

ameliorates  insulin resistance. Wistar rats were  fed either normal chow or a high‐fat diet 

for 15 weeks and one group of high‐fat diet  fed  rats was  supplemented with  L‐carnitine 

(300 mg/kg body weight/d) during the last 8 weeks. In vivo muscle mitochondrial function 

was  measured  by  several  31P  MRS  methods  and  in  vitro  mitochondrial  function  was 

determined  by  measuring  oxygen  consumption  in  isolated  mitochondria.  Furthermore, 

intramyocellular  lipid  levels  were  determined  by  1H  MRS  and  free  carnitine  and 

acylcarnitine levels were determined in muscle tissue, blood and urine using tandem mass 

spectrometry. 

Materials and Methods 

Animals 

Adult male Wistar rats  (348 ± 18 g, 14 weeks old, n = 30, Charles River Laboratories, The 

Netherlands) were housed in pairs at 20C and 50% humidity, with a 12‐h light‐dark cycle. 

Ad libitum food and water was provided during a period of 15 weeks. The rats were divided 

in  three groups: A  control group  receiving normal  chow  (NC, 10%  calories  from  fat, 70% 

calories  from carbohydrate, 20% calories  from protein  (D12450B, Research Diet Services, 

Wijk bij Duurstede, the Netherlands), n = 10), a group receiving a high‐fat diet (HFD, 45% 

calories from fat (predominantly  lard), 35% calories from carbohydrate, 20% calories from 

protein (D12451, Research Diet Services, Wijk bij Duurstede, the Netherlands), n = 10), and 

a group receiving the same high‐fat diet, supplemented with 300 mg/kg body weight/d L‐

carnitine in their drinking water for the last 8 weeks (HFDC, n = 10). Body weight and food 

and water intake were determined weekly. 

About  two days after  the  in vivo MRS measurements,  rats were sacrificed by  incising  the 

inferior vena cava under anesthesia. One tibialis anterior (TA) muscle (fresh) was used for 

isolation of mitochondria. The other TA was frozen in liquid nitrogen and stored at ‐80C for acylcarnitine content and mitochondrial DNA content determinations. Urine samples were 

Carnitine insufficiency and mitochondrial function 

127 

taken and stored at  ‐80C  for acylcarnitine determination. Animal handling conformed  to 

the rules of the Animal Ethics Committee of Maastricht University.  

Oral glucose tolerance test 

Oral glucose  tolerance  tests  (OGTT) were performed after 15 weeks of diet,  three  to  five 

days before the in vivo measurements. After a four‐hour fast, rats received an oral glucose 

bolus of 1 g/kg body weight. Blood samples were taken without anesthesia from the vena 

saphena  just  before  and  at  15,  30,  60,  90  and  120 min  after  the  bolus.  Blood  glucose 

concentration was determined using an automatic glucometer (FreeStyle, Abbott, IL, USA). 

Plasma  insulin  concentration was determined using an ultrasensitive  rat  insulin  ELISA  kit 

(Mercodia, Uppsala, Sweden). Areas under  the OGTT  curves  for both glucose  (AUCg) and 

insulin (AUCi) were calculated. 

Determination of acylcarnitine content 

The content of acylcarnitines was determined in freeze‐dried TA muscle, blood and urine by 

tandem mass spectrometry as described previously [28‐30]. 

Magnetic resonance spectroscopy  

All magnetic resonance spectroscopy (MRS) measurements were performed on a 6.3 Tesla 

horizontal  Bruker MR  system  (Bruker,  Ettlingen,  Germany).  Animals were  anaesthetized 

using  isoflurane  (Forene®)  (1‐2%) with medical air  (0.6 L/min) and body temperature was 

maintained at 36 ± 0.5C using heating pads. Respiration was monitored using a pressure 

sensor registering thorax movement (Rapid Biomedical, Rimpar, Germany). 

Intramyocellular lipid (IMCL) content in TA was measured in vivo using single‐voxel localized 1H MRS. Voxels of 333 mm3 were measured in the dorsal part of the TA, close to the tibia 

bone, with a circular  1H surface coil  (Ø 40mm) and using  the PRESS sequence  (repetition 

time  TR  =  1.5  s,  echo  time  TE  =  9.4  ms).  One  spectrum  was  acquired  without  water 

suppression (16 averages) and one with water suppression (VAPOR water suppression, 512 

averages).  1H  MR  spectra  were  fit  in  the  time  domain  using  an  advanced  magnetic 

resonance  (AMARES)  nonlinear  least  squares  algorithm  in  the  jMRUI  software  package 

(jMRUI V2.1) [31] as described previously [32]. IMCL was expressed as a percentage of the 

water signal measured in the same voxel. 

PCr  recovery  rate  (kPCr),  ATP  synthesis  flux  (VATP)  and  creatine  kinase  flux  (VCK)  were 

measured  in the TA by 31P MRS to determine  in vivo mitochondrial function. 31P MRS was 

Chapter 6 

128 

applied  using  a  combination  of  a  circular  1H  surface  coil  (40 mm)  for  shimming  and  an 

ellipsoid 31P MRS surface coil (10/18 mm), positioned over the TA, as described previously 

[32‐33].  31P MR  spectra were  acquired  applying  an  adiabatic  excitation  pulse with  a  flip 

angle of 90 [34]. A fully relaxed (TR = 25 s, 48 averages) spectrum was measured at rest, 

followed by the saturation transfer (ST) experiment in resting TA muscle to determine VATP 

and VCK. Three spectra (TR = 10.4 s) were acquired for the ST experiments: A spectrum with 

frequency  selective  saturation  of  the  ‐ATP  peak  yielding  the  steady  state  Pi  and  PCr magnetizations in the presence of saturation (  and  , respectively, 2*64 averages), a 

reference spectrum with saturation at a downfield frequency, equidistant from Pi, yielding 

the  equilibrium  Pi magnetization  ( , ,  128  averages),  and  a  reference  spectrum  with 

saturation  at  a  downfield  frequency,  equidistant  from  PCr,  yielding  the  equilibrium  PCr 

magnetization ( , , 64 averages). For all three experiments the saturation pulse  length 

was set to 10 s. The apparent longitudinal relaxation times of Pi ( , ) and PCr ( , ) were 

determined by performing a 7‐point  inversion  recovery experiment with an adiabatic  full 

passage  pulse  for  inversion  and  with  ‐ATP  saturation  prior  to  (10  s)  and  during  the inversion delay (inversion times = 0.01, 1, 2, 4, 6.5, 10.5 and 17 s, 32 averages). The total 

duration of the ST and inversion recovery experiments was about 2 hours.  

After the ST experiments, time series of 31P MR spectra (TR = 5 s, 4 averages) before, during 

and  after  muscle  contractions  were  acquired.  Muscle  contractions  were  induced  by 

electrical stimulation of the TA, via subcutaneously  implanted electrodes positioned along 

the  distal N.  Peroneus  Communis  [33].  The  stimulation  protocol  consisted  of  a  series  of 

stimulation pulses, applied every second, for a duration of 2 min. Stimulation pulse length 

was 100 ms, frequency was 80 Hz and stimulation voltage varied between 2.5 and 4 Volt, to 

reach  similar  levels of PCr depletion. Recovery was  followed  for 10 minutes. Three  time 

series were measured for each rat. 

 31P MR  spectra were  fit  in  the  time  domain  by  using  an  advanced magnetic  resonance 

(AMARES) nonlinear  least squares algorithm  in  the  jMRUI software package  (jMRUI V2.1) 

[31]. PCr and Pi peaks were fit to Lorentzian line shapes, whereas ‐, ‐, and ‐ATP signals were fit with Gaussian line shapes. Besides the cytosolic Pi signal, a second, smaller Pi peak 

was  observed  in  the  spectra  at  a  frequency  ~0.3  ppm  downfield  from  the  cytosolic  Pi 

resonance. The two Pi signals were separately fitted and the  line widths were constrained 

with  respect  to  the  line width of  the PCr  signal.  In  the dynamic MRS  spectra,  the  two Pi 

signals  could not be distinguished  and  a  single Pi peak was  fit  to  a Gaussian  line  shape. 

Concentrations of PCr and Pi were determined relative to the ATP concentration, which was 

assumed  to be 11.6 mM  (~7.8  μmol/g wet wt)  in  resting  TA muscle, as was determined 

previously  (Chapter  2).  ADP  concentrations  were  calculated  using  the  creatine  kinase 

equilibrium  [35]  and  intracellular  pH  was  calculated  from  the  chemical  shift  difference 

between PCr and the cytosolic Pi resonance [36]. 

Carnitine insufficiency and mitochondrial function 

129 

The apparent T1 ( ) relaxation times of Pi and PCr were determined by fitting the inversion 

recovery data with a 3‐parameter mono‐exponential  function using Origin  (OriginPro 7.5 

SR0, OriginLab Corporation, Northampton, MA, USA). The Pi  ATP exchange rate constant 

( ) was calculated  from  ,  and  the  fractional reduction of Pi magnetization upon 

selective saturation of ‐ATP according to:  

1 / ,

, 

The resting ATP synthesis flux (VATP) was then calculated by multiplying   with the Pi 

concentration  at  rest,  as  determined  from  the  fully  relaxed  spectrum.  The  PCr   ATP 

exchange rate constant was calculated according to: 

1 / ,

, 

The creatine kinase  flux  (VCK) was calculated by multiplying   with the resting PCr 

concentration. 

The data of PCr  recovery were  fit  to a mono‐exponential  function using Matlab  (version 

7.04, Mathworks, Natick, MA, USA)  yielding  a  rate  constant,  kPCr. Results  from  two  time 

series with end‐stimulation pH values higher than 6.92 [37] were averaged.  

Isolation of mitochondria 

Mitochondria were isolated from one whole TA muscle through a differential centrifugation 

procedure as described previously [38]. Briefly, TA muscle was excised, washed  in  ice cold 

0.9% KCl, freed of connective and adipose tissue, weighed and minced with scissors  in  ice 

cold medium A (5 ml for 1 g tissue) containing 150 mM sucrose, 75 mM KCl, 50 mM MOPS, 

1 mM KH2PO4, 5 mM MgCl2, 1 mM EGTA, 0.4 mg/ml bacterial proteinase type XXIV, pH 7.4. 

Next, 20 ml of medium B containing 250 mM sucrose, 0.1 mM EGTA and 20 mM MOPS, 2 

mg/ml BSA, pH 7.4 was added and the mixture was homogenized using a Potter‐Elvehjem 

homogenizer.  The  homogenate was  centrifuged  at  800  g  for  10 min,  4C.  The  resulting supernatant was centrifuged at 10000 g for 10 min, 4C. The pellet was resuspended in 15 ml of  fresh  ice cold medium B and centrifuged at 10000 g  for 10 min, 4C. Mitochondrial 

pellet was resuspended in 100 l of medium B. Protein content was determined using the 

BCA protein assay kit (Pierce, Thermo Fisher Scientific Inc., Rockford, IL, USA). 

Chapter 6 

130 

Measurement of oxygen consumption 

Oxygen  consumption  rate  was  measured  at  37°C  using  a  two‐channel  high‐resolution 

Oroboros oxygraph‐2 k (Oroboros, Innsbruck, Austria). Mitochondria were incubated in the 

assay medium  containing 110 mM KCl, 20 mM Tris, 2.3 mM MgCl2, 5 mM KH2PO4 and 1 

mg/ml BSA, pH 7.3. All measurements were performed in 1 ml of assay medium containing 

0.15 mg/ml of mitochondrial protein. Three different combinations of substrates were used 

to  asses mitochondrial  capacity  to  oxidize  tricarboxylic  acid  cycle  (TCA)  and  ‐oxidation substrates:  (i)  5  mM  pyruvate  plus  5  mM  malate  (TCA  cycle),  (ii)  25  M  palmitoyl‐L‐

carnitine plus 2.5 mM malate  (‐oxidation and TCA  cycle), and  (iii) 25 M palmitoyl‐CoA 

plus 2.5 mM  L‐carnitine plus 2.5 mM malate  (carnitine palmitoyltransferase 1  (CPT1), ‐oxidation and TCA cycle). An ADP‐regenerating system consisting of excess hexokinase (4.8 

U/ml) and glucose (12.5 mM) was used to maintain steady‐state oxygen consumption rates. 

Maximal ADP‐stimulated oxygen consumption rate (state 3) was  initiated by addition of 1 

mM  of  ATP.  Maximal  oxygen  consumption  rate  in  the  uncoupled  state  (state  U)  was 

determined  after  addition  of  1  M  carbonyl  cyanide  3‐chlorophenyl  hydrazone  (CCCP). 

Basal oxygen  consumption  rate  in  the  absence of ATP  synthesis  (state 4), which  reflects 

basal proton leak rate across the inner mitochondrial membrane, was measured after fully 

blocking  ATP  synthesis  with  1.25  M  carboxyatractyloside.  The  sensitivity  of  the  basal 

proton  leak rate to fatty acids, which reflects activation of the uncoupling proteins (UCPs) 

[39],  was  determined  by measuring  stimulation  of  oxygen  uptake  rate  in  state  4  after 

addition  of  90 µM of palmitic  acid  (C16:0).  The  signals  from  the  oxygen  electrode were 

recorded at 0.5 s intervals. Data acquisition and analysis was performed using Oxygraph‐2k‐

DatLab software version 4.2 (Oroboros, Innsbruck, Austria). 

Determination of the relative mitochondrial copy number  

Relative mitochondrial  copy  number was measured  as  described  previously  [8].  Briefly, 

Genomic DNA was isolated from a 25 mg transversal slice of mid‐belly TA using GenElute™ 

Mammalian  Genomic  DNA  Miniprep  Kit  (Sigma‐Aldrich,  Zwijndrecht,  The  Netherlands). 

Mitochondrial  DNA  (mtDNA)  content  relative  to  peroxisome  proliferator‐activated 

receptor‐ coactivator 1 (PGC‐1) gene was measured using real‐time PCR as described in 

[40]. Primers for mtDNA were: forward primer – 5’‐ACACCAAAAGGACGAACCTG‐3’, reverse 

primer  ‐  5’‐ATGGGGAAGAAGCCCTAGAA‐3’,  and  for  PGC‐1:  forward  primer  –  5’‐

ATGAATGCAGCGGTCTTAGC‐3’,  reverse  primer  –  5’‐AACAATGGCAGGGTTTGTTC‐3’.  The 

relative mtDNA copy number was calculated using the Ct method as described in [41]. 

Carnitine insufficiency and mitochondrial function 

131 

Statistical analysis 

Data are presented as means ± SD. The  listed n values  represent  the number of animals 

used for a particular experiment. Statistical significance of the differences was assessed by 

applying one way Analysis of Variance  (ANOVA) using Tukey HSD post hoc analysis  in  the 

SPSS 16.0 statistical package (SPSS Inc., Chicago, IL, USA). The level of statistical significance 

was set at p < 0.05. 

Results 

Animal model 

Animal characteristics are summarized  in Table 1. Body weight was significantly  lower for 

the HFD group compared to the HFDC group at the start of the experiment. After 15 wk of 

diet,  body weight was  similar  in  all  groups, whereas  body weight  gain was  significantly 

higher  in HFD animals compared to NC  (p = 0.047) and HFDC  (p = 0.02) animals. Average 

energy intake did not differ between groups (Table 1). 

Fasting plasma  insulin and blood glucose  levels during the OGTT are presented  in Table 1. 

After 15 wk of diet, animals had similar fasting blood glucose and plasma insulin levels. The 

AUCg from the OGTT was significantly higher for both HFD (p = 0.02) and HFDC (p = 0.003) 

groups when compared to controls, whereas the AUCi was not different between the three 

groups.  

Table 1. Animal characteristics 

  NC HFD HFDC 

 Body weight (g) t = 0   349 ± 18 338 ± 18 359 ± 12

† 

Body weight (g) t = 15  538 ± 23 559 ± 32 543 ± 25  

Delta body weight (g)  189 ± 22 221 ± 38* 185 ± 23† 

Food intake (kJ/week)   2239 ± 74 2342 ± 156 2286 ± 187 

Fasting glucose (mM)  5.4 ± 0.7 5.6 ± 0.7 5.8 ± 0.5 

AUCg (mM∙h) 

11.3 ± 0.6  12.4 ± 1.2* 12.7 ± 0.7* 

Fasting insulin (pM) 

546 ± 222 561 ± 207 521 ± 160 

AUCi (pM∙h)  1526 ± 359 1451 ± 370 1534 ± 465 

Data are from n = 10 NC, n = 9 HFD and n = 10 HFDC animals after 15 wk of diet and are expressed as 

means ±  SD. NC, normal  chow; HFD, high‐fat diet; HFDC, high‐fat diet  supplemented with  carnitine; 

AUCg and AUCi, area under the glucose and insulin curve, respectively; *p < 0.05 when compared to NC, †p < 0.05 when compared to HFD. 

Chapter 6 

132 

IMCL content  

In vivo  1H MRS was applied  to evaluate  the effect of 15 wk of high‐fat diet and 15 wk of 

high‐fat diet  in combination with 8 wk of carnitine supplementation on  IMCL  levels  in TA 

muscle. As  is shown  in Figure 1,  IMCL  levels were two‐fold higher  in HFD  (p < 0.001) and 

HFDC (p < 0.005) rats as compared to controls. Eight wk of carnitine supplementation had 

no effect on IMCL content. 

Acylcarnitine content 

To  verify  impairment  of  lipid  metabolism,  we  determined  the  content  of  different 

acylcarnitine species in TA muscle, blood and urine. Free carnitine and acetylcarnitine levels 

and  levels of  short‐, medium‐  and  long‐chain  acylcarnitines  are  represented  in  Figure  2. 

After 15 wk of diet,  free  carnitine  (C0)  levels were decreased  in muscle  (p = 0.003) and 

blood  (p = 0.001) of HFD animals. Carnitine  treatment  in rats  fed a high‐fat diet restored 

muscle  free  carnitine  levels  and  led  to  a  1.5  fold  higher  blood  free  carnitine  level  as 

compared to NC animals. Muscle acetylcarnitine (C2) levels were not significantly different 

between the three groups, whereas acetylcarnitine levels were two‐fold higher in blood of 

HFDC  animals  compared  to  HFD  animals  (p  <  0.001).  Carnitine  treatment  resulted  in 

massive  increases  in  urine  free  carnitine  (40‐fold),  acetylcarnitine  (25‐fold)  and 

short/medium‐chain acylcarnitine  levels. However, no changes  in  long‐chain acylcarnitines 

in urine were observed. Muscle medium‐ and  long‐chain acylcarnitines were  in almost all 

cases significantly elevated  in HFD and HFDC groups compared to NC, but similar for HFD 

and HFDC groups. For most medium‐ and  long‐chain acylcarnitines  in blood, a significant 

decrease  was  observed  as  a  result  of  15  wk  of  high‐fat  diet,  whereas  levels  of  these 

medium‐ and  long‐chain acylcarnitines were restored or  increased  in HFDC rats compared 

to controls. 

Figure 1. IMCL content in the dorsal 

part of the TA muscle of NC (n = 10), 

HFD (n = 9) and HFDC (n = 10) rats. IMCL 

content was expressed as a percentage 

of the water signal. *p < 0.05 when 

compared to NC.  

Carnitine insufficiency and mitochondrial function 

133 

Mitochondrial function in vivo 

31P  MRS  was  used  to  assess  in  vivo  muscle  mitochondrial  function.  Concentrations  of 

metabolites and pH obtained from the 31P MR spectra in resting TA muscle are summarized 

in Table 2. These parameters were not affected by the high‐fat diet feeding alone or by the 

high‐fat diet in combination with carnitine supplementation. 

From the 31P ST spectra, the ratios of Pi and PCr magnetization with and without selective 

saturation of ‐ATP ( / ,  and  / , , respectively) were determined and these 

ratios were  not  significantly  different  between  groups  for  both  Pi  and  PCr  (Table  3).   

relaxation  times of Pi and PCr  in  case of  saturation of  ‐ATP were determined  from a 7‐

point  inversion recovery experiment. Although the   relaxation times of Pi and PCr seem 

to be decreased  in HFD and HFDC animals, there were no significant differences between 

the three groups (Table 3). The exchange rate constant   and ATP synthesis flux, VATP, 

 

Figure 2. Free carnitine and acetylcarnitine content in TA muscle (A), blood (D) and urine (G), short‐ and 

medium‐chain acylcarnitine content in TA muscle (B), blood (E) and urine (H) and long‐chain acylcarnitine 

content in TA muscle (C), blood (F) and urine (I) of NC (n = 10), HFD (n = 9) and HFDC (n = 10) rats. *p < 

0.05 when compared to NC, †p < 0.05 when compared to HFD 

Chapter 6 

134 

were  also  not  significantly  different  between  NC,  HFD  and  HFDC  groups  (Table  3). 

Interestingly,   and the CK flux, VCK, were significantly higher in both HFD (p = 0.01 

and 0.02 for   and VCK, respectively) and HFDC (p = 0.02 and 0.03 for   and 

VCK, respectively) groups compared to controls.  

Dynamic  31P MRS measurements during and after  recovery  from electrical  stimulation of 

the TA were performed to determine the rate constant of PCr recovery after contraction. 

Concentrations of PCr, Pi and ADP and the  intracellular pH at the end of stimulation were 

not  significantly  different  between  groups  (Table  2).  PCr  concentrations  during  recovery 

Table 2. Metabolite concentrations and pH in TA measured by in vivo 31P MRS.

Rest  NC  HFD HFDC

   pH  7.18 ± 0.05  7.18 ± 0.03 7.18 ± 0.02

[PCr] (mM) 

45.8 ± 3.7  46.2 ± 2.5 46.3 ± 3.3

[Pi] (mM)  4.0 ± 1.0  4.0 ± 1.1 3.4 ± 0.5

[ADP] (μM)  13.1 ± 1.3  13.2 ± 0.8 13.1 ± 0.7

End stimulation  NC  HFD HFDC

   pH  7.04 ± 0.05  7.05 ± 0.04 7.07 ± 0.04

[PCr] (mM) 

20.6 ± 4.4  23.9 ± 3.0 23.6 ± 1.6

[Pi] (mM)  28.0 ± 5.0  25.0 ± 2.5 24.8 ± 1.4

[ADP] (μM)  92.5 ± 32.7  73.4 ± 14.3 76.8 ± 12.0

Data are from n = 10 NC, n = 9 HFD and n = 10 HFDC animals and are expressed as means ± SD. NC, 

normal  chow;  HFD,  high‐fat  diet;  HFDC,  high‐fat  diet  supplemented  with  carnitine;  PCr, 

phosphocreatine; Pi, inorganic phosphate; ADP, adenosine diphosphate. No significant differences 

were observed. 

 

Figure  3.  The  rate  constant  of  PCr  recovery  (kPCr)  in  TA  after  electrical  stimulation  (A)    and  relative 

mitochondrial DNA copy number (B) measured in TA muscle of NC (n = 10), HFD (n = 9) and HFDC (n = 

10) rats. *p < 0.05 when compared to NC, †p < 0.05 when compared to HFD.

Carnitine insufficiency and mitochondrial function 

135 

were fitted with a mono‐exponential function yielding kPCr. kPCr was similar for the NC, HFD 

and HFDC animals (Figure 3a).  

Mitochondrial function in vitro 

Table 4 summarizes the effects of 15 wk of high‐fat diet feeding and 15 wk of high‐fat diet 

feeding  in combination with 8 wk of carnitine supplementation on  intrinsic mitochondrial 

function  in  vitro,  represented  by  oxygen  consumption  rates  in  isolated  TA mitochondria 

oxidizing glucose‐ or fat‐derived substrates in different metabolic states. Both high‐fat diet 

feeding  and high‐fat diet  feeding  in  combination with  carnitine  supplementation had no 

significant effect on pyruvate plus malate‐driven oxygen consumption rate in any metabolic 

state.  Interestingly,  a  ~15%  higher  palmitoyl‐L‐carnitine  plus  malate  driven  oxygen 

consumption rate in state 3 and state U was observed in mitochondria from HFD and HFDC 

rats  compared  to NC. A  similar effect was observed when palmitoyl‐CoA plus  L‐carnitine 

plus malate was used as the oxidizible substrate. Oxygen consumption rate  in state 4 was 

similar  in all  three groups with both palmitoyl‐L‐carnitine plus malate and palmitoyl‐CoA 

plus L‐carnitine plus malate as the oxidizible substrate. 

Table 3. Parameters determined from 31P saturation transfer MRS

  NC HFD HFDC 

 / ,    0.76 ± 0.09 0.79 ± 0.05 0.77 ± 0.05 

,  (s)  4.25 ± 0.38 3.82 ± 0.74 3.62 ± 0.25 

 (s‐1) 3.24 ± 1.31 3.35 ± 0.81 3.84 ± 0.84 

VATP (μmol/g/min)  9.22 ± 5.53 9.20 ± 4.64 9.16 ± 2.55 

  NC HFD HFDC 

 / ,    0.58 ± 0.03 0.54 ± 0.03 0.55 ± 0.02 

,  (s)  2.09 ± 0.10 2.00 ± 0.05 2.00 ± 0.10 

 (s‐1)  12.2 ± 1.1 13.5 ± 1.0* 13.5 ± 0.9* 

VCK (μmol/g/min)  372 ± 36 426 ± 42* 423 ± 43* 

Data  in the upper part of the table are  from n = 7 NC, n = 8 HFD and n = 9 HFDC animals. Data  in the 

lower part of the table are from n = 10 NC, n = 9 HFD and n = 9 HFDC animals. All data are expressed as 

means ± SD. NC, normal chow; HFD, high‐fat diet; HFDC, high‐fat diet supplemented with carnitine;  , 

magnetization of Pi and PCr with saturation of ‐ATP;  , , magnetization of Pi and PCr with saturation at 

a downfield  frequency, equidistant  from Pi and PCr,  respectively;  , , apparent  longitudinal  relaxation 

time of Pi and PCr with saturation of ‐ATP;  , Pi  ATP exchange rate constant; VATP, resting ATP 

synthesis flux;  , PCr  ATP exchange rate constant; VCK, resting creatine kinase flux. *p < 0.05 

when compared to NC.  

Chapter 6 

136 

Table 4 also shows the effect of 90 µM of palmitic acid on the oxygen consumption rate in 

state 4 in isolated mitochondria respiring on pyruvate plus malate. Addition of palmitic acid 

caused  a  significantly higher  increase  in  the  oxygen  consumption  rate  in  the HFD  group 

compared  to  NC  group  (p  =  0.02),  indicating  increased  FA‐induced  mitochondrial 

uncoupling. The effect of palmitic acid  in  the HFDC group was  similar  to  that  in  the HFD 

group, but not significantly different from the effect in the NC group. 

The  effect  of  15  wk  of  high‐fat  diet  feeding  and  15  wk  of  high‐fat  diet  feeding  in 

combination  with  8  wk  of  carnitine  supplementation  on  mitochondrial  biogenesis  was 

assessed  by  determining mtDNA  copy  number  in  TA muscle.  The  relative mtDNA  copy 

number  was  significantly  increased  in  HFD  (p  =  0.03)  and  HFDC  (p  =  0.04)  animals  as 

compared  to NC  animals, whereas  no  difference was  observed  between HFD  and HFDC 

animals (Figure 3b). 

Table 4. Oxygen consumption rates in isolated TA mitochondria oxidizing different substrates in different 

metabolic states. 

Pyruvate plus malate  NC HFD HFDC 

State 3 (nmol O2min‐1mg protein

‐1)  543 ± 69 564 ± 42 567 ± 74 

State 4 (nmol O2min‐1mg protein

‐1)  36 ± 8 34 ± 3 38 ± 5 

State U (nmol O2min‐1mg protein

‐1)  649 ± 76 669 ± 49 684 ± 85 

Pyruvate plus malate plus palmitic acid NC HFD HFDC 

State 4 (nmol O2min‐1mg protein

‐1)  204 ± 29 257 ± 22* 237 ± 56 

Palmitoylcarnitine plus malate  NC HFD HFDC 

State 3 (nmol O2min‐1mg protein

‐1) 146 ± 18 171 ± 20* 166 ± 20 

State 4 (nmol O2min‐1mg protein

‐1)  31 ± 5 31 ± 2 32 ± 3 

State U (nmol O2min‐1mg protein

‐1)  223 ± 27 251 ± 22 254 ± 29* 

PalmitoylCoA plus L‐carnitine plus malate NC HFD HFDC 

State 3 (nmol O2min‐1mg protein

‐1) 140 ± 20 167 ± 14* 167 ± 26* 

State 4 (nmol O2min‐1mg protein

‐1)  31 ± 5 31 ± 2 31 ± 5 

State U (nmol O2min‐1mg protein

‐1)  230 ± 29 265 ± 15* 263 ± 31* 

Data are  from n = 10 NC, n = 9 HFD and n = 10 HFDC animals and are expressed as means ± SD. NC, 

normal chow; HFD, high‐fat diet; HFDC, high‐fat diet supplemented with carnitine; State 3, maximal ADP‐

stimulated oxygen consumption; State 4, oxygen consumption in the absence of ATP synthesis; State U, 

oxygen consumption after uncoupling. *p < 0.05 when compared to NC. 

Carnitine insufficiency and mitochondrial function 

137 

Discussion 

It  is generally accepted  that muscle  lipid overload  leads  to  insulin  resistance. Although  it 

has  been  hypothesized  that  mitochondrial  dysfunction  and  an  associated  decreased 

capacity  to  oxidize  FAs  are  at  the  basis  of  this  derangement  [3‐4],  recently  it  has  been 

shown that high‐fat diets lead to increased rather than decreased FA oxidation, resulting in 

the  accumulation  of  lipid  intermediates  which  can  cause  metabolic  stress  and  induce 

mitochondrial dysfunction [8‐11]. Carnitine supplementation might be effective in reducing 

these  toxic  lipid  intermediates  by  increasing  complete  FA  oxidation  and  export  of  lipid 

metabolites  out  of  the  mitochondria  and  into  the  plasma.  Therefore,  to  investigate 

whether  carnitine  supplementation  can  reduce  high‐fat  diet‐induced  lipotoxicity,  we 

determined muscle  lipid  status,  in  vivo  and  in  vitro muscle mitochondrial  function,  and 

insulin resistance in rats which received a 15 wk high‐fat diet and in rats which received a 

15 wk high‐fat diet in combination with 8 wk carnitine supplementation. In agreement with 

previous results, high‐fat diet feeding resulted in a decrease in muscle free carnitine [8, 11], 

increased IMCL [8] and muscle, blood and urine acylcarnitine levels [8, 10‐11], an increased 

capacity  to  oxidize  fat‐derived  substrates  in  vitro  [5‐6,  8,  42],  an  increased  number  of 

muscle  mitochondria  [5‐6,  8,  42],  but  a  normal  muscle  oxidative  capacity  in  vivo  [8], 

indicating  that  in  vivo mitochondrial  function was  compromised,  possibly  by  toxic  lipid 

intermediates.  Despite  the  restoration  of  muscle  free  carnitine  content,  carnitine 

supplementation did not induce improvements in muscle lipid status, in vivo mitochondrial 

function  or  insulin  resistance.  These  results  indicate  that  the  decrease  in  muscle  free 

carnitine as a result of high‐fat diet feeding did not contribute to the observed impairment 

in in vivo muscle mitochondrial function. 

One of the  leading hypotheses  in the research field of type 2 diabetes  is that  inherited or 

acquired  skeletal  muscle  mitochondrial  dysfunction,  associated  with  a  reduced 

mitochondrial  capacity  to  oxidize  FAs,  leads  to  a  lipid  overload  in muscle  cells,  causing 

insulin  resistance  [3‐4].  Recent  studies  have  challenged  this  theory  and  link  insulin 

resistance  to  an  increased  capacity  to  oxidize  FAs  [5‐8]. However,  it  has  been  shown  in 

myotubes and  rodent models  that high  rates of ‐oxidation  in  insulin‐resistant states are associated with low rates of complete FA oxidation and elevated incomplete ‐oxidation [9‐11]. High rates of  incomplete ‐oxidation occur when carbon flux through the ‐oxidation machinery  outpaces  entry  of  acetyl‐CoA  into  the  tricarboxylic  acid  cycle.  It  has  been 

hypothesized that the accumulation of  incompletely metabolized FAs  in the mitochondria 

causes  ‘mitochondrial  stress’  leading  to mitochondrial  dysfunction  and  insulin  resistance 

[10,  12].  In  the  two  contradictory  hypotheses mitochondrial  dysfunction  is  put  forward 

either  as  a  cause  or  a  consequence  of  excessive  accumulation  of  lipids  and  lipid 

intermediates in muscle cells [9‐11]. The results of our in vitro measurements, showing up‐

regulation of FA oxidation in vitro, are in line with the latter hypothesis. In previous studies 

equivalent  increases  in  in vitro mitochondrial FA oxidative capacity have been observed  in 

skeletal muscle of high‐fat diet fed rats [6, 42‐47]. Our results are also  in agreement with 

Chapter 6 

138 

other  studies which  have  shown  that  high‐fat  feeding  does  not  affect  respiration  of  rat 

muscle mitochondria when using substrates other than fatty acids, i.e. pyruvate/glutamate 

plus  malate  and  succinate  [6,  46‐47],  implying  that  the  intrinsic  functioning  of  the 

mitochondria  is not  impaired  in  vitro.  The observed  25%  increase  in mitochondrial  copy 

number in HFD animals is in agreement with our previous study, in which it was shown that 

long‐term  high‐fat  diet  feeding  causes  an  increase  in  peroxisome  proliferator‐activated 

receptor‐ coactivator 1 (PGC1) expression with a concomitant increase in mitochondrial 

copy  number  and  citrate  synthase  activity  compared  to  controls  [8].  Furthermore,  a 

number  of  other  studies  has  likewise  shown  that  high‐fat  diet  feeding  in  rats  induces 

increased biogenesis of mitochondria  [5‐6, 42‐45] as an adaptive  response  to  the higher 

mitochondrial FA load. 

From the observed upregulation of in vitro muscle mitochondrial function and content, one 

would expect a concomitant improvement of in vivo muscle mitochondrial function. In vivo 

resting ATP synthesis flux (VATP) was not changed in HFD rats compared to NC rats, which is 

in contrast with data from a previous study in high‐fat diet fed rats. In the latter study, VATP 

decreased by about 40% after 5 wk of high‐fat diet, which was explained as a failure of the 

mitochondria to compensate for the relatively long duration of the high‐fat diet [48]. As far 

as we know, no VATP data have been presented after longer term high‐fat diet feeding. The 

interpretation of resting VATP data as a measure for mitochondrial function is, however, not 

straightforward. Mitochondrial ATP synthesis  is a demand driven process and a decreased 

VATP under resting conditions could simply reflect a normal regulatory response to a lower 

energy  demand  [49‐52].  Moreover,  the  Pi    ATP  fluxes  obtained  from  31P  ST 

measurements are comprised of both ATP synthesis flux and glycolytic exchange flux, with 

the  latter  contributing  by  as  much  as  80%  at  rest  [50,  53‐56].  Besides  VATP,  we  also 

determined VCK from the 31P ST experiments and we found that VCK was increased by 15% in 

HFD  rats  compared  to  controls.  However,  the  physiological  relevance  of  the  observed 

increase in VCK in HFD animals is not entirely clear. In a previous study, an increase in VCK in 

skeletal  muscle  of  high‐fat  diet  fed  rats  compared  to  control  rats  was  explained  as  a 

compensatory mechanism  in response  to  impaired mitochondrial  function  [57]. However, 

this  seems unlikely, because  in normal  conditions  the  creatine kinase  reaction  is already 

much  faster  than oxidative ATP production  [58]. Alternatively,  the 15% higher VCK  in HFD 

rats can point towards a shift in muscle fiber type towards more oxidative fibers [59]. 

We have shown in a previous study that the rate of PCr recovery after exercise has a more 

direct  relationship with  skeletal muscle mitochondrial  function  than  resting VATP  (Chapter 

2). The PCr  recovery  rate constant  (kPCr) was equal  for HFD and NC  rats, despite  the 25% 

increase in the number of mitochondria, which is in agreement with our previous results in 

long‐term  high‐fat  diet  fed  rats  [8].  These  data  indicate  that  an  increased  number  of 

mitochondria  with  normal  or  even  improved  function  in  vitro  is  required  to  maintain 

normal oxidative  capacity  in vivo  in HFD  rats. The observed dissociation between  in  vivo 

and in vitro muscle oxidative capacity suggests that in vivo mitochondrial function in muscle 

Carnitine insufficiency and mitochondrial function 

139 

of HFD rats is compromised by factors not taken into account when mitochondrial function 

is assessed under in vitro conditions. 

Despite a similar body weight, HFD rats had 90% more IMCL compared to NC animals. The 

acylcarnitine profile  likewise showed  that muscle of HFD  rats was overloaded with  lipids. 

The vast majority of acylcarnitines is produced in the mitochondria, and acylcarnitine levels 

can therefore, in combination with measurements of substrate oxidation and mitochondrial 

function,  be  interpreted  as  a measure  for  (incomplete)  β‐oxidation.  In  agreement with 

previous  studies,  even,  medium‐chain  (C6‐C12)  acylcarnitine  intermediates,  which 

represent  incompletely oxidized FAs, were elevated  in muscle from HFD rats compared to 

NC animals [9‐11]. Although the measurement of acylcarnitines provides a comprehensive 

snapshot  of  intermediary  metabolism,  it  is  important  to  emphasize  that  steady‐state 

metabolite  concentrations  represent  the net balance between production,  consumption, 

import and export. However, from the combination of increased in vitro fat oxidation rates 

and  increased  levels of medium‐chain acylcarnitines  in muscle of HFD animals,  it  can be 

speculated that incomplete ‐oxidation is elevated in HFD animals.  

It has been  shown  that elevated  levels of  FAs may  impair mitochondrial ATP production 

through  a  number  of  mechanisms.  E.g.  long‐chain  acyl‐CoA  esters  may  inhibit  the 

mitochondrial  adenine nucleotide  translocator  leading  to  impaired exchange of  cytosolic 

ADP  for  mitochondrial  ATP  [60].  Moreover,  increased  availability  of  FAs  may  lead  to 

increased expression  [6, 8] as well as activation of UCP3  [39], which  in  turn may  lead  to 

diminished efficiency of ATP synthesis due to increased mitochondrial uncoupling. In order 

to test whether the  latter mechanism could have been the cause for the observed  in vivo 

mitochondrial  dysfunction,  we measured  state  4  oxygen  consumption  rates  in  isolated 

mitochondria  respiring  on  pyruvate  plus malate  in  the  presence  of  palmitic  acid.  In  this 

experiment, we  observed  significantly  higher  oxygen  consumption  rates  in mitochondria 

isolated from HFD rats compared to NC rats, indicating increased mitochondrial uncoupling 

due to the presence of FAs. Together with the finding that muscle medium‐ and long‐chain 

acylcarnitines were increased in HFD rats compared to controls, these data strongly suggest 

that FA‐induced mitochondrial uncoupling may contribute  to  the observed mitochondrial 

functional impairment in HFD rats in vivo. 

Concomitantly with increased muscle acylcarnitine levels, a decrease was observed in free 

carnitine levels in HFD animals. It has been shown that whole‐body carnitine insufficiency is 

a common  feature  in  insulin  resistant  states  such as advanced age, genetic diabetes and 

diet‐induced obesity  [11].  This  can be explained by a decreased biosynthesis  in  the  liver 

[10‐11, 61‐62], but also by increased sequestration of carnitine in the muscle acylcarnitine 

pool  [10‐11].  The  insulin  resistance  related decline  in  free  carnitine has been  associated 

with impaired mitochondrial function and an imbalance between complete and incomplete 

fat oxidation [11, 17]. Most direct evidence linking carnitine  insufficiency to mitochondrial 

dysfunction comes from  juvenile visceral steatosis (jvs) mice, a genetic model of carnitine 

Chapter 6 

140 

deficiency, showing marked derangements in mitochondrial biogenesis and morphology, as 

well  as whole‐body  lipid  and  energy metabolism  [63‐64].  It  has  been  hypothesized  that 

carnitine  supplementation  ameliorates mitochondrial  function  and  insulin  resistance  by 

reducing lipotoxicity both through the  increased oxidation and increased export of muscle 

lipid metabolites [17]. In a recent study by Noland et al., it was shown that 8 wk of carnitine 

supplementation  in  long‐term  high‐fat  diet  fed  rats  restored  the  ratio  of  complete  to 

incomplete fat oxidation and  increased efflux of muscle acylcarnitine  intermediates, while 

improving glucose tolerance [11]. 

To  investigate  the  effects  of  carnitine  supplementation  on  muscle  lipid  status,  muscle 

mitochondrial  function  and  insulin  sensitivity  in  high‐fat  diet  fed  rats, we  supplemented 

them with 300 mg/kg body weight/d carnitine during the last 8 wk of the 15 wk diet. While 

carnitine  supplementation  restored muscle  free  carnitine  to  the  value  found  in  control 

animals fed with normal chow, no differences in in vivo IMCL levels were observed between 

HFD and HFDC rats. Similar  levels of muscle acylcarnitines  in HFD and HFDC rats provided 

further evidence of unchanged lipid levels inside the muscle, despite the increased levels of 

acylcarnitines  in  blood  and  urine  in  the  carnitine  supplemented  group.  The  effects  of 

carnitine  supplementation  on  acylcarnitine  profiles  in  muscle,  blood  and  urine  are  in 

agreement  with  the  results  of  Noland  et  al.  [11].  In  this  study  it  was  concluded  that 

carnitine  supplementation  facilitates  the  efflux  and  excretion  of  acylcarnitines,  possibly 

leading to a decrease in tissue long‐chain acyl‐CoAs, but currently there is no proof for this 

theory.  

In line with the lack of effects on muscle lipid status, carnitine supplementation also did not 

improve  muscle  mitochondrial  function  or  insulin  sensitivity  in  high‐fat  diet  fed  rats. 

Oxygen  consumption  rates  of muscle mitochondria  respiring  on  glucose‐  or  fat‐derived 

substrates were  similar  for HFD  and HFDC  rats. Addition  of  palmitic  acid  had  the  same 

effect  on  mitochondria  from  HFD  and  HFDC  rats,  both  showing  increased  FA‐induced 

mitochondrial  uncoupling  compared  to mitochondria  from NC  animals. Both  in HFD  and 

HFDC rats muscle mitochondrial content was increased by about 25% relatively to controls, 

but  in both groups this did not result  in an  increased muscle oxidative capacity  in vivo as 

determined  from  the  rate  of  PCr  recovery,  indicating  that  in  both  groups  in  vivo 

mitochondrial  function  was  similarly  impaired.  Our  results  on  muscle  mitochondrial 

function  and  insulin  sensitivity  are  in  contrast  with  the  findings  of  Noland  et  al.,  who 

showed that exactly the same regimen of carnitine supplementation (i.e. 300 mg/kg body 

weight/d during 8 wk) improved whole‐body glucose tolerance and reversed mitochondrial 

abnormalities in rats fed with a high‐fat diet [11]. A difference between the two studies  is 

the duration of the high‐fat diet,  i.e. 15 wk  in this study versus 12 months  in the study by 

Noland  et  al.  However,  the  15  wk  and  12  month  high‐fat  diet  feeding  led  to  similar 

decreases  in  muscle  free  carnitine  and  comparable  increases  in  muscle  acylcarnitines. 

Another  difference  between  the  two  studies  resides  in  the methods  to  assess muscle 

mitochondrial function. Noland et al. measured the ratio of complete to incomplete oleate 

Carnitine insufficiency and mitochondrial function 

141 

oxidation  in  isolated  mitochondria,  which  was  decreased  in  high‐fat  diet  fed  rats,  but 

completely restored after carnitine supplementation [11]. In the current study we have no 

data  on  the  ratio  of  complete  to  incomplete  fat  oxidation,  but  we  have  shown  that 

carnitine supplementation does not improve in vivo muscle mitochondrial function. 

Reduction  of  the  free  carnitine  pool  in  response  to HFD  feeding might  have  a  negative 

effect on mitochondrial fatty oxidation only if free carnitine is depleted to an extent that it 

becomes  limiting  for CPT1 activity,  resulting  in a decreased entry of  long‐chain acyl‐CoAs 

into the mitochondrial matrix. The absence of an effect of 8 wk carnitine treatment in high‐

fat diet fed animals regarding muscle mitochondrial function suggests that this was not the 

case  in  the  present  study. Moreover,  our  observation  that  state  3  oxygen  consumption 

rates with palmitoyl‐CoA plus L‐carnitine plus malate and palmitoyl‐L‐carnitine plus malate 

as  the  oxidizible  substrates were  similar  in HFD  and HFDC  groups  suggests  that  neither 

palmitoyl‐CoA  transport  nor  oxidation  capacity  was  affected  by  carnitine  treatment. 

Currently it is not known whether it is sufficient to correct an incipient carnitine deficiency 

status  or  whether  supra‐physiological  carnitine  levels  in  both  blood  and  muscle  are 

necessary  to obtain  clinically  beneficial  effects of  carnitine  supplementation. Due  to  the 

pharmacokinetic properties of carnitine, including a poor gut absorption and bioavailability, 

a  high  renal  clearance  rate  and  uptake  into  tissues  via  high  affinity  transporters,  it  is 

difficult to achieve supra‐physiological levels of free carnitine in the muscle.  

In  conclusion,  we  showed  that  high‐fat  diet  feeding  induces  carnitine  insufficiency  and 

muscle  lipid  overload,  leading  to  an  increased  number  of muscle mitochondria with  an 

improved  capacity  to oxidize  FAs  in  vitro, but without  a  concomitant  increase  in muscle 

oxidative  capacity  in  vivo.  These  results  indicate  that  in  vivo mitochondrial  function was 

compromised  in muscle of high‐fat diet  fed  rats. We provided  evidence  that  the  in  vivo 

mitochondrial dysfunction  in high‐fat diet  fed  rats was  caused by elevated  levels of  lipid 

intermediates,  leading  to  increased  FA‐induced mitochondrial  uncoupling  and  therefore 

less  efficient  ATP  synthesis.  Despite  the  restoration  of  muscle  free  carnitine  content, 

carnitine  supplementation  did  not  induce  improvements  in muscle  lipid  status,  in  vivo 

mitochondrial  function  or  insulin  resistance.  These  results  indicate  that  the  decrease  in 

muscle free carnitine as a result of high‐fat diet feeding did not contribute to the observed 

impairment in in vivo muscle mitochondrial function. 

Acknowledgements 

We are grateful to sigma‐tau (Utrecht, the Netherlands) for providing L‐carnitine. The work 

of J.C. is financed by the Netherlands Consortium for Systems Biology (NCSB) which is part 

of the Netherlands Genomics  Initiative / Netherlands Organisation for Scientific Research. 

J.J.P.  and  S.M.H.  are  supported  by  VIDI  grants  from  the  Netherlands  Organisation  for 

Scientific Research (VIDI grant numbers 700.58.421 and 016.086.336, respectively). 

Chapter 6 

142 

References 1.  Wild, S., G. Roglic, A. Green, R. Sicree, and H. King. Global prevalence of diabetes: estimates for the year 

2000 and projections for 2030. Diabetes Care, 2004. 27(5): 1047‐53. 2.  DeFronzo, R.A. Pathogenesis of type 2 (non‐insulin dependent) diabetes mellitus: a balanced overview. 

Diabetologia, 1992. 35(4): 389‐97. 3.  Lowell, B.B. and G.I. Shulman. Mitochondrial dysfunction and type 2 diabetes. Science, 2005. 307(5708): 

384‐7. 4.  Morino, K., K.F. Petersen, and G.I. Shulman. Molecular mechanisms of insulin resistance in humans and 

their potential links with mitochondrial dysfunction. Diabetes, 2006. 55 Suppl 2: S9‐S15. 5.  Hancock, C.R., D.H. Han, M. Chen, S. Terada, T. Yasuda, D.C. Wright, and  J.O. Holloszy. High‐fat diets 

cause  insulin  resistance despite an  increase  in muscle mitochondria. Proc Natl Acad  Sci U  S A, 2008. 105(22): 7815‐20. 

6.  Turner, N., C.R. Bruce, S.M. Beale, K.L. Hoehn, T. So, M.S. Rolph, and G.J. Cooney. Excess lipid availability increases mitochondrial fatty acid oxidative capacity in muscle: evidence against a role for reduced fatty acid oxidation in lipid‐induced insulin resistance in rodents. Diabetes, 2007. 56(8): 2085‐92. 

7.  Turner,  N.  and  L.K.  Heilbronn.  Is  mitochondrial  dysfunction  a  cause  of  insulin  resistance?  Trends Endocrinol Metab, 2008. 19(9): 324‐30. 

8.  van den Broek, N.M., J. Ciapaite, H.M. De Feyter, S.M. Houten, R.J. Wanders, J.A. Jeneson, K. Nicolay, and  J.J. Prompers.  Increased mitochondrial  content  rescues  in  vivo muscle oxidative  capacity  in  long‐term high‐fat‐diet‐fed rats. FASEB J, 2010. 24(5): 1354‐64. 

9.  Koves, T.R., P. Li,  J. An, T. Akimoto, D. Slentz, O.  Ilkayeva, G.L. Dohm, Z. Yan, C.B. Newgard, and D.M. Muoio.  Peroxisome  proliferator‐activated  receptor‐gamma  co‐activator  1alpha‐mediated  metabolic remodeling  of  skeletal  myocytes  mimics  exercise  training  and  reverses  lipid‐induced  mitochondrial inefficiency. J Biol Chem, 2005. 280(39): 33588‐98. 

10.  Koves, T.R., J.R. Ussher, R.C. Noland, D. Slentz, M. Mosedale, O. Ilkayeva, J. Bain, R. Stevens, J.R. Dyck, C.B.  Newgard,  G.D.  Lopaschuk,  and  D.M. Muoio. Mitochondrial  overload  and  incomplete  fatty  acid oxidation contribute to skeletal muscle insulin resistance. Cell Metab, 2008. 7(1): 45‐56. 

11.  Noland, R.C., T.R. Koves, S.E. Seiler, H. Lum, R.M. Lust, O. Ilkayeva, R.D. Stevens, F.G. Hegardt, and D.M. Muoio.  Carnitine  insufficiency  caused  by  aging  and  overnutrition  compromises  mitochondrial performance and metabolic control. J Biol Chem, 2009. 284(34): 22840‐52. 

12.  Muoio, D.M. and T.R. Koves. Skeletal muscle adaptation to fatty acid depends on coordinated actions of the PPARs and PGC1 alpha:  implications  for metabolic disease. Appl Physiol Nutr Metab, 2007. 32(5): 874‐83. 

13.  Fritz, I.B. and K.T. Yue. Long‐Chain Carnitine Acyltransferase and the Role of Acylcarnitine Derivatives in the Catalytic Increase of Fatty Acid Oxidation Induced by Carnitine. J Lipid Res, 1963. 4: 279‐88. 

14.  Stephens, F.B., D. Constantin‐Teodosiu, and P.L. Greenhaff. New insights concerning the role of carnitine in the regulation of fuel metabolism in skeletal muscle. J Physiol, 2007. 581(Pt 2): 431‐44. 

15.  Ventura, F.V., L.  Ijlst,  J. Ruiter, R. Ofman, C.G. Costa, C.  Jakobs, M. Duran,  I. Tavares de Almeida, L.L. Bieber,  and  R.J.  Wanders.  Carnitine  palmitoyltransferase  II  specificity  towards  beta‐oxidation intermediates‐‐evidence for a reverse carnitine cycle in mitochondria. Eur J Biochem, 1998. 253(3): 614‐8. 

16.  Uziel, G.,  B. Garavaglia,  and  S. Di Donato.  Carnitine  stimulation  of  pyruvate  dehydrogenase  complex (PDHC) in isolated human skeletal muscle mitochondria. Muscle Nerve, 1988. 11(7): 720‐4. 

17.  Mynatt, R.L. Carnitine and type 2 diabetes. Diabetes Metab Res Rev, 2009. 25 Suppl 1: S45‐9. 18.  Ferrannini, E., G. Buzzigoli, S. Bevilacqua, C. Boni, D. Del Chiaro, M. Oleggini, L. Brandi, and F. Maccari. 

Interaction of carnitine with insulin‐stimulated glucose metabolism in humans. Am J Physiol, 1988. 255(6 Pt 1): E946‐52. 

19.  Capaldo,  B.,  R.  Napoli,  P.  Di  Bonito,  G.  Albano,  and  L.  Sacca.  Carnitine  improves  peripheral  glucose disposal in non‐insulin‐dependent diabetic patients. Diabetes Res Clin Pract, 1991. 14(3): 191‐5. 

20.  De Gaetano, A., G. Mingrone, M. Castagneto, and M. Calvani. Carnitine  increases glucose disposal  in humans. J Am Coll Nutr, 1999. 18(4): 289‐95. 

21.  Giancaterini, A., A. De Gaetano, G. Mingrone, D. Gniuli, E. Liverani, E. Capristo, and A.V. Greco. Acetyl‐L‐carnitine infusion increases glucose disposal in type 2 diabetic patients. Metabolism, 2000. 49(6): 704‐8. 

22.  Mingrone, G., A.V. Greco, E. Capristo, G. Benedetti, A. Giancaterini, A. De Gaetano, and G. Gasbarrini. L‐carnitine improves glucose disposal in type 2 diabetic patients. J Am Coll Nutr, 1999. 18(1): 77‐82. 

23.  Power,  R.A., M.W.  Hulver,  J.Y.  Zhang,  J.  Dubois,  R.M. Marchand, O.  Ilkayeva,  D.M. Muoio,  and  R.L. Mynatt. Carnitine revisited: potential use as adjunctive treatment in diabetes. Diabetologia, 2007. 50(4): 824‐32. 

Carnitine insufficiency and mitochondrial function 

143 

24.  Broderick, T.L., H.A. Quinney, and G.D. Lopaschuk. Carnitine stimulation of glucose oxidation in the fatty acid perfused isolated working rat heart. J Biol Chem, 1992. 267(6): 3758‐63. 

25.  Wutzke,  K.D.  and  H.  Lorenz.  The  effect  of  l‐carnitine  on  fat  oxidation,  protein  turnover,  and  body composition in slightly overweight subjects. Metabolism, 2004. 53(8): 1002‐6. 

26.  Muller, D.M., H. Seim, W. Kiess, H. Loster, and T. Richter. Effects of oral L‐carnitine supplementation on in vivo long‐chain fatty acid oxidation in healthy adults. Metabolism, 2002. 51(11): 1389‐91. 

27.  Arduini, A., M. Bonomini, V. Savica, A. Amato, and V. Zammit. Carnitine in metabolic disease: potential for pharmacological intervention. Pharmacol Ther, 2008. 120(2): 149‐56. 

28.  van Vlies, N.,  L.  Tian, H. Overmars, A.H. Bootsma, W. Kulik, R.J. Wanders, P.A. Wood,  and  F.M. Vaz. Characterization  of  carnitine  and  fatty  acid metabolism  in  the  long‐chain  acyl‐CoA  dehydrogenase‐deficient mouse. Biochem J, 2005. 387(Pt 1): 185‐93. 

29.  Chegary, M., H. Brinke, J.P. Ruiter, F.A. Wijburg, M.S. Stoll, P.E. Minkler, M. van Weeghel, H. Schulz, C.L. Hoppel, R.J. Wanders, and S.M. Houten. Mitochondrial long chain fatty acid beta‐oxidation in man and mouse. Biochim Biophys Acta, 2009. 1791(8): 806‐15. 

30.  Ventura,  F.V., C.G. Costa,  E.A.  Struys,  J. Ruiter, P. Allers,  L.  Ijlst,  I.  Tavares de Almeida, M. Duran, C. Jakobs, and R.J. Wanders. Quantitative acylcarnitine profiling  in fibroblasts using [U‐13C] palmitic acid: an improved tool for the diagnosis of fatty acid oxidation defects. Clin Chim Acta, 1999. 281(1‐2): 1‐17. 

31.  Vanhamme,  L., A.  van  den Boogaart,  and  S. Van Huffel.  Improved method  for  accurate  and  efficient quantification of MRS data with use of prior knowledge. J Magn Reson, 1997. 129(1): 35‐43. 

32.  De  Feyter,  H.M.,  G.  Schaart, M.K.  Hesselink,  P.  Schrauwen,  K.  Nicolay,  and  J.J.  Prompers.  Regional variations  in  intramyocellular  lipid  concentration  correlate with muscle  fiber  type  distribution  in  rat tibialis anterior muscle. Magn Reson Med, 2006. 56(1): 19‐25. 

33.  De Feyter, H.M., E. Lenaers, S.M. Houten, P. Schrauwen, M.K. Hesselink, R.J. Wanders, K. Nicolay, and J.J.  Prompers.  Increased  intramyocellular  lipid  content  but  normal  skeletal  muscle  mitochondrial oxidative capacity throughout the pathogenesis of type 2 diabetes. Faseb J, 2008. 22(11): 3947‐55. 

34.  Garwood, M.  and  L.  DelaBarre.  The  return  of  the  frequency  sweep:  designing  adiabatic  pulses  for contemporary NMR. J Magn Reson, 2001. 153(2): 155‐77. 

35.  Lawson, J.W. and R.L. Veech. Effects of pH and free Mg2+ on the Keq of the creatine kinase reaction and other phosphate hydrolyses and phosphate transfer reactions. J Biol Chem, 1979. 254(14): 6528‐37. 

36.  Taylor, D.J., P.J. Bore, P. Styles, D.G. Gadian, and G.K. Radda. Bioenergetics of  intact human muscle. A 31P nuclear magnetic resonance study. Mol Biol Med, 1983. 1(1): 77‐94. 

37.  van den Broek, N.M., H.M. De Feyter, L. de Graaf, K. Nicolay, and J.J. Prompers. Intersubject differences in  the  effect  of  acidosis  on  phosphocreatine  recovery  kinetics  in  muscle  after  exercise  are  due  to differences in proton efflux rates. Am J Physiol Cell Physiol, 2007. 293(1): C228‐37. 

38.  Reichert, M., H. Schaller, W. Kunz, and G. Gerber. The dependence on the extramitochondrial ATP/ADP‐ratio of  the oxidative phosphorylation  in mitochondria  isolated by a new procedure  from  rat  skeletal muscle. Acta Biol Med Ger, 1978. 37(8): 1167‐76. 

39.  Echtay, K.S., D. Roussel, J. St‐Pierre, M.B. Jekabsons, S. Cadenas, J.A. Stuart, J.A. Harper, S.J. Roebuck, A. Morrison,  S. Pickering,  J.C. Clapham,  and M.D. Brand.  Superoxide activates mitochondrial uncoupling proteins. Nature, 2002. 415(6867): 96‐9. 

40.  Ciapaite,  J.,  S.J. Bakker, G. Van Eikenhorst, M.J. Wagner, T. Teerlink, C.G.  Schalkwijk, M.  Fodor, D.M. Ouwens, M. Diamant, R.J. Heine, H.V. Westerhoff, and K. Krab. Functioning of oxidative phosphorylation in liver mitochondria of high‐fat diet fed rats. Biochim Biophys Acta, 2007. 1772(3): 307‐16. 

41.  Szuhai, K., J. Ouweland, R. Dirks, M. Lemaitre, J. Truffert, G. Janssen, H. Tanke, E. Holme, J. Maassen, and A.  Raap.  Simultaneous  A8344G  heteroplasmy  and mitochondrial  DNA  copy  number  quantification  in myoclonus epilepsy and  ragged‐red  fibers  (MERRF)  syndrome by a multiplex molecular beacon based real‐time fluorescence PCR. Nucleic Acids Res, 2001. 29(3): E13. 

42.  Garcia‐Roves, P.,  J.M. Huss, D.H. Han, C.R. Hancock, E.  Iglesias‐Gutierrez, M. Chen, and  J.O. Holloszy. Raising plasma fatty acid concentration induces increased biogenesis of mitochondria in skeletal muscle. Proc Natl Acad Sci U S A, 2007. 104(25): 10709‐13. 

43.  Iossa, S., L. Lionetti, M.P. Mollica, R. Crescenzo, M. Botta, A. Barletta, and G. Liverini. Effect of high‐fat feeding on metabolic efficiency and mitochondrial oxidative capacity in adult rats. Br J Nutr, 2003. 90(5): 953‐60. 

44.  McAinch, A.J., J.S. Lee, C.R. Bruce, R.J. Tunstall, J.A. Hawley, and D. Cameron‐Smith. Dietary regulation of fat oxidative gene expression in different skeletal muscle fiber types. Obes Res, 2003. 11(12): 1471‐9. 

45.  Nemeth, P.M., B.W. Rosser, R.M. Choksi, B.J. Norris, and K.M. Baker. Metabolic response to a high‐fat diet in neonatal and adult rat muscle. Am J Physiol, 1992. 262(2 Pt 1): C282‐6. 

46.  Chanseaume,  E.,  A.L.  Tardy,  J.  Salles,  C. Giraudet,  P.  Rousset,  A.  Tissandier,  Y.  Boirie,  and  B. Morio. Chronological approach of diet‐induced alterations  in muscle mitochondrial  functions  in  rats. Obesity (Silver Spring), 2007. 15(1): 50‐9. 

Chapter 6 

144 

47.  Hoeks,  J.,  J.J. Briede,  J. de Vogel, G.  Schaart, M. Nabben, E. Moonen‐Kornips, M.K. Hesselink, and P. Schrauwen. Mitochondrial function, content and ROS production in rat skeletal muscle: effect of high‐fat feeding. FEBS Lett, 2008. 582(4): 510‐6. 

48.  Laurent, D., B. Yerby, R. Deacon, and  J. Gao. Diet‐induced modulation of mitochondrial activity  in  rat muscle. Am J Physiol Endocrinol Metab, 2007. 293(5): E1169‐77. 

49.  Brehm, A., M. Krssak, A.I. Schmid, P. Nowotny, W. Waldhausl, and M. Roden. Increased lipid availability impairs insulin‐stimulated ATP synthesis in human skeletal muscle. Diabetes, 2006. 55(1): 136‐40. 

50.  Kemp, G.J. The interpretation of abnormal 31P magnetic resonance saturation transfer measurements of Pi/ATP exchange in insulin‐resistant skeletal muscle. Am J Physiol Endocrinol Metab, 2008. 294(3): E640‐642. 

51.  Short, K.R., K.S. Nair, and C.S. Stump.  Impaired mitochondrial activity and  insulin‐resistant offspring of patients with type 2 diabetes. N Engl J Med, 2004. 350(23): 2419‐21; author reply 2419‐21. 

52.  Wagenmakers, A.J. Insulin resistance  in the offspring of parents with type 2 diabetes. PLoS Med, 2005. 2(9): e289. 

53.  Brindle,  K.M.,  M.J.  Blackledge,  R.A.  Challiss,  and  G.K.  Radda.  31P  NMR  magnetization‐transfer measurements of ATP turnover during steady‐state  isometric muscle contraction  in the rat hind  limb  in vivo. Biochemistry, 1989. 28(11): 4887‐93. 

54.  Brindle, K.M. and G.K. Radda. 31P‐NMR saturation transfer measurements of exchange between Pi and ATP  in  the  reactions  catalysed  by  glyceraldehyde‐3‐phosphate  dehydrogenase  and  phosphoglycerate kinase in vitro. Biochim Biophys Acta, 1987. 928(1): 45‐55. 

55.  Campbell‐Burk,  S.L.,  K.A.  Jones,  and  R.G.  Shulman.  31P  NMR  saturation‐transfer  measurements  in Saccharomyces  cerevisiae:  characterization  of  phosphate  exchange  reactions  by  iodoacetate  and antimycin A inhibition. Biochemistry, 1987. 26(23): 7483‐92. 

56.  Kingsley‐Hickman,  P.B.,  E.Y.  Sako,  P. Mohanakrishnan,  P.M.  Robitaille,  A.H.  From,  J.E.  Foker,  and  K. Ugurbil.  31P  NMR  studies  of  ATP  synthesis  and  hydrolysis  kinetics  in  the  intact  myocardium. Biochemistry, 1987. 26(23): 7501‐10. 

57.  Chanseaume,  E., G.  Bielicki,  A.L.  Tardy,  J.P.  Renou, D.  Freyssenet,  Y.  Boirie,  and  B. Morio.  Impaired resting muscle energetics studied by (31)P‐NMR in diet‐induced obese rats. Obesity (Silver Spring), 2008. 16(3): 572‐7. 

58.  Vicini, P. and M.J. Kushmerick. Cellular energetics analysis by a mathematical model of energy balance: estimation of parameters in human skeletal muscle. Am J Physiol Cell Physiol, 2000. 279(1): C213‐24. 

59.  Yamashita, K. and T. Yoshioka. Profiles of creatine kinase isoenzyme compositions in single muscle fibres of different types. J Muscle Res Cell Motil, 1991. 12(1): 37‐44. 

60.  Lerner, E., A.L. Shug, C. Elson, and E. Shrago. Reversible inhibition of adenine nucleotide translocation by long chain fatty acyl coenzyme A esters in liver mitochondria of diabetic and hibernating animals. J Biol Chem, 1972. 247(5): 1513‐9. 

61.  Li, X., B. Monks, Q. Ge, and M.J. Birnbaum. Akt/PKB regulates hepatic metabolism by directly inhibiting PGC‐1alpha transcription coactivator. Nature, 2007. 447(7147): 1012‐6. 

62.  Mikhail, M.M. and M.M. Mansour. The relationship between serum carnitine  levels and the nutritional status of patients with schistosomiasis. Clin Chim Acta, 1976. 71(2): 207‐14. 

63.  Kaido, M., H. Fujimura, A. Ono, K. Toyooka, H. Yoshikawa, T. Nishimura, K. Ozaki,  I. Narama, and M. Kuwajima. Mitochondrial  abnormalities  in  a murine model  of  primary  carnitine  deficiency.  Systemic pathology and trial of replacement therapy. Eur Neurol, 1997. 38(4): 302‐9. 

64.  Tein,  I.  Carnitine  transport:  pathophysiology  and metabolism  of  known molecular  defects.  J  Inherit Metab Dis, 2003. 26(2‐3): 147‐69. 

  

 

145 

 

146 

 

Chapter     Summary and future perspectives 

Summary and future perspectives 

148 

Summary 

Diabetes has reached epidemic proportions worldwide. Type 2 diabetes (T2D) accounts for 

about  90%  of  all  diabetes  cases  and  is  characterized  by  insulin  resistance  (IR)  in major 

metabolic tissues. The dramatic rise  in T2D  is associated with the  increased occurrence of 

obesity  and excessive ectopic  lipid  accumulation,  in particular  in  skeletal muscle, due  to 

excessive  caloric  intake  and  decreased  physical  activity.  However,  the  exact  processes 

leading to IR remain unresolved. One of the leading hypotheses in the research field of type 

2  diabetes  is  that  inherited  or  acquired  skeletal  muscle  mitochondrial  dysfunction, 

associated with a reduced mitochondrial capacity to oxidize fatty acids (FAs), leads to a lipid 

overload  in muscle cells. High  levels of  lipid  intermediates  then  induce  IR by activating a 

protein kinase, which impairs insulin signaling by phosphorylation of serine/threonine sites 

on  the  insulin  receptor.  Recent  studies  have  challenged  this  theory  and  link  insulin 

resistance  to  an  increased  capacity  to  oxidize  FAs  rather  than  the  reverse.  The  high  ‐oxidation  rates  observed  in  insulin‐resistant  muscle  are  associated  with  low  rates  of 

complete FA oxidation and elevated incomplete ‐oxidation. It has been hypothesized that the  accumulation  of  incompletely  metabolized  FAs  in  the  mitochondria  causes 

‘mitochondrial  stress’  leading  to  insulin  resistance.  To  clarify  this  issue,  the  timing  and 

nature of muscle mitochondrial adaptations during  the development of  IR and T2D have 

been investigated in this thesis using both in vivo and in vitro approaches.  

The ambiguous results on the role of muscle mitochondrial dysfunction in T2D may be due 

to the different measurement methods used to determine muscle mitochondrial function. 

In vitro methodologies, like the determination of gene expression levels, enzyme activities, 

mitochondrial  content,  morphology  and  respiration,  provide  specific  information  on 

different  aspects  of mitochondrial  energy  production,  but  the  results  cannot  be  directly 

translated  to  in  vivo mitochondrial  function.  31P magnetic  resonance  spectroscopy  (MRS) 

provides a non‐invasive tool to monitor the energetic status of the cell in vivo by measuring 

intracellular  phosphorous  containing  metabolites,  i.e.  phosphocreatine  (PCr),  ATP  and 

inorganic phosphate  (Pi). 31P MRS has been used  to assess  skeletal muscle mitochondrial 

function in vivo by measuring (1) resting ATP synthesis flux with saturation transfer (ST) or 

(2)  the  rate of PCr  recovery after exercise. However, both methods measure  completely 

different parameters, i.e. basal metabolic rate and maximal oxidative capacity, respectively, 

which might explain  the contradictory  results  that have been obtained.  In  chapter 2, we 

compared  both  parameters  in  rats  treated  with  the  complex  I  inhibitor 

diphenyleneiodonium (DPI) with the aim of establishing the most appropriate method for 

the assessment of  in  vivo muscle mitochondrial  function.  In  vivo  31P MRS measurements 

were  supplemented  by  in  vitro  measurements  of  oxygen  consumption  in  isolated 

mitochondria.  Two  weeks  of  DPI  treatment  induced  mitochondrial  dysfunction,  as 

evidenced by a 20%  lower maximal ADP‐stimulated oxygen  consumption  rate  in  isolated 

mitochondria from DPI‐treated rats oxidizing pyruvate plus malate. This was paralleled by a 

46% decrease  in  in  vivo oxidative  capacity, determined  from post‐exercise PCr  recovery. 

Summary and future perspectives 

149 

Interestingly, no significant difference in resting, ST‐based ATP synthesis flux was observed 

between DPI‐treated  rats and  controls. These  results  show  that  the  rate  constant of PCr 

recovery measured with dynamic 31P MRS after exercise provides a more sensitive measure 

of skeletal muscle mitochondrial function than the ATP synthesis flux determined with 31P 

ST  in  the  resting  state.  The  ATP  synthesis  flux  itself  represents  the ATP  demand  of  the 

muscle and in order to interpret the data in terms of mitochondrial function it is necessary 

to take the error signals, i.e. the concentrations of ADP and Pi, into account. Moreover, the 

Pi   ATP  flux  obtained  from  a  31P  ST  experiment  in  the  resting  state  is  dominated  by 

glycolytic exchange flux.  

The  second methodological chapter  (chapter 3) describes  the pH dependence of  the PCr 

recovery time constant (PCr, i.e. the inverse of the PCr recovery rate constant). It has been shown  that  muscle  tissue  acidification  at  the  end  of  exercise  severely  prolongs  PCr 

recovery, which  is  an  important  complication  in  the  interpretation  of  post‐exercise  PCr 

recovery data. It has been proposed that PCr can be normalized for the end‐exercise pH, in 

order to use it as a measure for mitochondrial function. However, a general correction for 

pH can only be applied if there are no intersubject differences in the pH dependence of PCr 

recovery  kinetics.  In  this  chapter  the  pH  dependence  of  PCr was  investigated  in  healthy human volunteers on a subject‐by‐subject basis and it turned out that the effect of acidosis 

on PCr recovery kinetics after exercise was different between subjects. The pH dependence 

of  PCr  correlated  with  the  proton  efflux  rate  at  the  start  of  recovery,  indicating  that subjects with a smaller pH dependence of PCr have a higher rate of pH recovery. Therefore, PCr can only be used as a measure of mitochondrial function when end‐exercise pH is close 

to  resting values. Simply correcting PCr  for end‐exercise pH  is not adequate,  in particular when  comparing patients  and  controls,  as  certain disorders  are  characterized by  altered 

proton efflux from muscle fibers. 

In  chapters  4‐6,  31P MRS  was  applied  to  investigate  the  role  of  muscle  mitochondrial 

dysfunction in the development of IR and T2D. Chapter 4 describes a cross‐sectional human 

study,  in which we  examined  in  vivo  skeletal muscle mitochondrial  function  in  healthy, 

normoglycaemic controls, subjects with early stage T2D and  long‐standing,  insulin‐treated 

T2D  patients.  It was  shown  that  PCr  recovery  after  exercise was  not  different  between 

groups,  indicating  that  in vivo oxidative capacity was not  impaired  in both early and  late 

stages  of  T2D.  These  results  imply  that mitochondrial  dysfunction  does  not  necessarily 

represent either cause or consequence of IR and/or T2D. It was suggested that impairments 

in oxidative metabolism  in type 2 diabetes patients observed  in previous studies are  likely 

to be secondary to a less active lifestyle and/or impaired insulin signaling. 

A cross‐sectional study, as presented in chapter 4, only provides correlative data and does 

not provide detailed information about the time course of events during the development 

of  T2D.  Therefore,  the  aim of  the next  study, described  in  chapter 5, was  to  gain more 

insight into the timing and nature of mitochondrial adaptations during the development of 

Summary and future perspectives 

150 

high‐fat diet‐induced insulin resistance in rats. Adult Wistar rats were fed a high‐fat diet or 

normal chow for 2.5 and 25 weeks. Muscle oxidative capacity was assessed in vivo from 31P 

MRS measurements  of  PCr  recovery  and  in  vitro  by measuring mitochondrial DNA  copy 

number  and  oxygen  consumption  in  isolated  mitochondria.  Muscle  lipid  status  was 

determined  by  1H  MRS  (intramyocellular  lipids,  IMCL)  and  tandem  mass  spectrometry 

(acylcarnitines). The short‐term high‐fat diet induced increases in IMCL content and muscle 

medium‐  and  long‐chain  acylcarnitines,  together  with  an  increased  in  vivo  oxidative 

capacity. The latter result could be fully accounted for by increased mitochondrial content. 

The long‐term high‐fat diet resulted in even higher IMCL and acylcarnitine levels, a further 

increase  in  the number of muscle mitochondria and an  increased capacity  to oxidize  fat‐

derived  substrates  in  vitro.  Surprisingly,  this  did  not  result  in  a  higher muscle  oxidative 

capacity  in  vivo.  These  findings  show  that  skeletal  muscle  in  high‐fat  diet‐induced  IR 

requires  a  progressively  larger  mitochondrial  pool  size  to  maintain  normal  oxidative 

capacity in vivo. 

Comparable to the results of the 25 wk high‐fat diet are the results observed in Wistar rats 

on a similar high‐fat diet  for 15 wk, as presented  in chapter 6. The observed dissociation 

between  in vivo and  in vitro determinations of muscle mitochondrial  function after  long‐

term  high‐fat  diet  feeding  in  both  chapter  5  and  6  suggests  that  in  vivo mitochondrial 

function in insulin‐resistant rat muscle is compromised by factors not taken into account in 

vitro.  In  both  studies, muscle  tissue  free  carnitine was  significantly  decreased, whereas 

muscle medium‐  and  long‐chain  acylcarnitines were  significantly  increased.  This  finding 

indicates that in vivo muscle mitochondrial function might have been compromised by high 

concentrations  of  lipid  metabolites  in  vivo.  This  was  corroborated  by  the  finding  that 

mitochondria  from  high‐fat  diet  fed  rats  were  more  susceptible  to  FA‐induced 

mitochondrial  uncoupling,  which  can  explain  the  observed  in  vivo  mitochondrial 

dysfunction.  

Next,  it was  investigated whether the observed carnitine  insufficiency, a common feature 

of  insulin‐resistant  states,  contributes  to  the  accumulation  of muscle  lipid  intermediates 

and  the  lipid‐induced  impairment  of  skeletal  muscle  mitochondrial  function  in  vivo. 

Carnitine  supplementation  might  reduce  toxic  lipid  intermediates  by  increasing  FA 

oxidation  and  export  of  lipid metabolites  out  of  the mitochondria  and  into  the  plasma, 

thereby relieving mitochondrial stress. Despite  the normalization of muscle  free carnitine 

content, carnitine supplementation did not induce improvements in muscle  lipid status,  in 

vivo mitochondrial function or insulin resistance. These results indicate that the decrease in 

muscle free carnitine as a result of high‐fat diet feeding did not contribute to the observed 

impairment in in vivo muscle mitochondrial function. 

Summary and future perspectives 

151 

Conclusions  

Although  it has been hypothesized that skeletal muscle mitochondrial dysfunction and an 

associated  decreased  capacity  to  oxidize  FAs  is  the  primary  cause  for  muscle  lipid 

accumulation and IR, the findings in this thesis are in agreement with recent studies which 

have  shown  that  high‐fat  diets  lead  to  increased  rather  than  decreased  FA  oxidation, 

resulting  in  the  accumulation  of  lipid  intermediates  causing mitochondrial  dysfunction. 

Furthermore, from the results presented in this thesis it is concluded that it  is essential to 

use a combination of several techniques, preferably both in vivo and in vitro, for a thorough 

investigation of muscle mitochondrial function. Compelling evidence for this is provided in 

chapters 5 and 6, where it was shown that a normal in vivo oxidative capacity, as measured 

by  PCr  recovery,  can mask  an  impairment  in  intrinsic mitochondrial  function when  it  is 

accompanied by increased mitochondrial content. 

Future perspectives 

In  vivo  PCr  recovery  kinetics  is  determined  by  mitochondrial  content,  intrinsic 

mitochondrial  function and other  factors  like the supply of oxygen and substrates.  In this 

thesis,  mitochondrial  content  and  intrinsic  mitochondrial  function  were  additionally 

determined  in vitro.  Intrinsic mitochondrial function was assessed from measurements on 

isolated mitochondria. An alternative method would be to measure oxygen consumption in 

permeabilized muscle fibers, which more closely reflect the in vivo environment. However, 

inhomogeneity of muscles in terms of fiber type composition relates to inhomogeneities in 

mitochondrial content. Therefore,  inhomogeneous  fiber preparation may  in  turn bias  the 

outcome  of  the  measurements.  This  is  in  particular  a  problem  when  studying  rodent 

muscle, due to the marked regionalization of different fiber types within a single muscle.  

For a comprehensive  interpretation of changes  in PCr recovery kinetics the assessment of 

muscle perfusion, regulating the supply of oxygen and substrates,  is of great value. Three 

possible  options  for measuring muscle  perfusion  and  oxygenation  are  briefly  discussed: 

arterial  spin  labeling  (ASL),  1H  MR  myoglobin  (Mb)  spectroscopy  and  near‐infrared 

spectroscopy  (NIRS). ASL  is an MR‐based  technique used  to assess  tissue perfusion  [1‐2] 

relying on differences in T1 relaxation rates of tissue, caused by inflowing blood, when using 

slice‐selective  or  non‐selective  inversion  pulses.  This  technique  has  been  successfully 

applied in brain and heart tissues (1‐2). A low perfusion hampers the application of ASL in 

skeletal muscle at  rest. However, during exercise muscle perfusion  increases  significantly 

and  is  therefore more  easy  to measure with ASL  [3].  A  recent  study  demonstrated  ASL 

during muscle stimulation in combination with 31P MRS in mice [4]. An MR method to check 

if  oxygen  flux  is  limiting  PCr  recovery  is  1H  MR  spectroscopy  of  Mb,  which  monitors 

intramyocellular  oxygenation  by  measuring  the  signal  from  deoxy‐Mb  at  71‐72  ppm 

Summary and future perspectives 

152 

downfield  of  water  [5].  Interleaved  31P/1H  spectra  obtained  in  human  quadriceps  have 

enabled detailed studies on the relation between muscle intracellular oxygenation and PCr 

recovery  [6].  In  vivo Mb  spectroscopy  data  from  skeletal muscles  of  small  animals  have 

never been  reported. The main explanation  for  this,  though possibly not  the only one,  is 

probably the lower Mb levels in small rodents [7]. NIRS is a non‐MR alternative to measure 

blood flow and local tissue oxygenation levels. NIRS is primarily based on the absorption of 

light  at  wavelengths  in  the  near‐infrared  range  (400‐1000  nm)  where  oxygenated 

hemoglobin  (oxy‐Hb)  and  deoxygenated  hemoglobin  (deoxy‐Hb)  display  different  light 

absorption  characteristics.  With  MR‐compatible  adaptations,  complementary  NIRS  and 

MRS measurements  can  be  done  simultaneously,  as was  shown  in  chronic  heart  failure 

patients [8].  

Supplementary  in  vivo measurements  can  provide  new  insights  in  the  complex  in  vivo 

mitochondrial functioning. In chapter 2, it was concluded that the interpretation of the ATP 

synthesis flux, particularly at rest, is not straightforward, partially due to the relatively large 

contribution of glycolytic exchange flux. In order to create better conditions for detecting a 

defect in mitochondrial function, the MR saturation transfer experiment would need to be 

done  in exercising muscle.  In  this case,  the ATP synthesis  flux will be significantly higher, 

resulting in less interference of glycolytic exchange flux. However, in such an experiment it 

is crucial to sustain steady‐state contractions during the whole duration of the saturation 

transfer experiment and  it  is  important  to achieve  similar  relative workloads  in different 

subjects or animals.  

In addition  to measuring ATP  synthesis  flux,  it would be valuable  to  specifically measure 

processes  more  upstream  in  oxidative  metabolism.  Koves  et  al.  suggested  that  lipid 

overload causes excessive ‐oxidation without concomitant  increases  in  tricarboxylic acid 

(TCA) cycle activity, resulting  in accumulation of  incompletely oxidized  lipid  intermediates 

[9]. To  further elucidate  this promising hypothesis,  it would be valuable  to measure TCA 

cycle and ‐oxidation activity  in vivo. TCA cycle flux has repeatedly been assessed  in brain with  13C MRS,  during  the  infusion  of  13C  labeled  glucose  or  acetate.  By measuring  13C 

incorporation into glutamate and glutamine in time, TCA cycle activity can be determined. 

Previous studies showed  that performing such measurements  in human  [10] and rat  [11] 

muscle  is possible,  in spite of the practical complications regarding the sensitivity and the 

low TCA cycle flux  in resting conditions. Similarly to what was proposed for 31P saturation 

transfer  measurements  of  ATP  synthesis  flux,  steady‐state  muscle  contractions  would 

provide a means to circumvent these difficulties by increasing the TCA cycle flux. Moreover, 

it would  be  interesting  to  combine  the  TCA  cycle  and ATP  synthesis  flux measurements 

obtained during steady state muscle contractions. These data would reflect the efficiency 

of ATP synthesis [11], i.e. mitochondrial coupling, which might be more representative of in 

vivo intrinsic muscle mitochondrial function. 

Summary and future perspectives 

153 

The  presence  of  a  relationship  between  mitochondrial  dysfunction  and  lipotoxicity  is 

generally accepted. However,  information about  the underlying processes  is scarce. Lipid 

accumulation  results  from an  imbalance between  lipid  storage and oxidation.  In  vivo  1H‐

[13C]  localized  MRS  in  combination  with  the  administration  of  13C  enriched  lipids  is  a 

promising method to assess the  incorporation of the 13C  label  into the IMCL pool, thereby 

providing  interesting  additional  information  about  the  rate  of  uptake  and  storage  of 

ingested  lipids  in vivo. Furthermore, the rate of disappearance of 13C  label  from the  IMCL 

pool  can  be  assumed  to  reflect  the  rate  of  ‐oxidation  in  vivo.  Although  IMCL  and 

acylcarnitine levels have been assumed to reflect the content of muscle lipid intermediates 

which are supposed to  induce  IR, directly measuring DAG, ceramides and  long‐chain acyl‐

CoA’s  in muscle  tissue would  improve  our  understanding  of  the molecular mechanisms 

underlying lipid‐induced mitochondrial dysfunction and IR. 

Summary and future perspectives 

154 

References 1.  Kober,  F.,  I.  Iltis,  P.J.  Cozzone,  and M.  Bernard. Myocardial  blood  flow mapping  in mice  using  high‐

resolution  spin  labeling magnetic  resonance  imaging:  influence  of  ketamine/xylazine  and  isoflurane anesthesia. Magn Reson Med, 2005. 53(3): 601‐6. 

2.  Streif, J.U., M. Nahrendorf, K.H. Hiller, C. Waller, F. Wiesmann, E. Rommel, A. Haase, and W.R. Bauer. In vivo assessment of absolute perfusion and intracapillary blood volume in the murine myocardium by spin labeling magnetic resonance imaging. Magn Reson Med, 2005. 53(3): 584‐92. 

3.  Carlier, P.G., C. Brillault‐Salvat, E. Giacomini, C. Wary, and G. Bloch. How to  investigate oxygen supply, uptake,  and  utilization  simultaneously  by  interleaved NMR  imaging  and  spectroscopy  of  the  skeletal muscle. Magn Reson Med, 2005. 54(4): 1010‐3. 

4.  Baligand, C., H. Gilson,  J.C. Menard, O.  Schakman, C. Wary,  J.P.  Thissen,  and P.G. Carlier.  Functional assessment  of  skeletal  muscle  in  intact  mice  lacking  myostatin  by  concurrent  NMR  imaging  and spectroscopy. Gene Ther, 2010. 17(3): 328‐37. 

5.  Wang, Z.Y., E.A. Noyszewski, and J.S. Leigh, Jr.  In vivo MRS measurement of deoxymyoglobin  in human forearms. Magn Reson Med, 1990. 14(3): 562‐7. 

6.  Duteil,  S.,  C.  Bourrilhon,  J.S.  Raynaud,  C.  Wary,  R.S.  Richardson,  A.  Leroy‐Willig,  J.C.  Jouanin,  C.Y. Guezennec, and P.G. Carlier. Metabolic and  vascular  support  for  the  role of myoglobin  in humans: a multiparametric NMR study. Am J Physiol Regul Integr Comp Physiol, 2004. 287(6): R1441‐9. 

7.  Ohno, T. and A. Kuroshima. Muscle myoglobin as determined by electrophoresis in thermally acclimated rat. Jpn J Physiol, 1986. 36(4): 733‐44. 

8.  Kemps, H.M.,  J.J.  Prompers, B. Wessels, W.R. De Vries, M.L.  Zonderland,  E.J.  Thijssen,  K. Nicolay, G. Schep,  and  P.A.  Doevendans.  Skeletal  muscle  metabolic  recovery  following  submaximal  exercise  in chronic heart failure is limited more by O(2) delivery than O(2) utilization. Clin Sci (Lond), 2010. 118(3): 203‐10. 

9.  Koves, T.R., J.R. Ussher, R.C. Noland, D. Slentz, M. Mosedale, O. Ilkayeva, J. Bain, R. Stevens, J.R. Dyck, C.B.  Newgard,  G.D.  Lopaschuk,  and  D.M. Muoio. Mitochondrial  overload  and  incomplete  fatty  acid oxidation contribute to skeletal muscle insulin resistance. Cell Metab, 2008. 7(1): 45‐56. 

10.  Befroy,  D.E.,  K.F.  Petersen,  S.  Dufour,  G.F. Mason,  R.A.  de  Graaf,  D.L.  Rothman,  and  G.I.  Shulman. Impaired mitochondrial  substrate  oxidation  in muscle  of  insulin‐resistant  offspring  of  type  2  diabetic patients. Diabetes, 2007. 56(5): 1376‐81. 

11.  Jucker,  B.M.,  J.  Ren,  S.  Dufour,  X.  Cao,  S.F.  Previs,  K.S.  Cadman,  and  G.I.  Shulman.  13C/31P  NMR assessment  of  mitochondrial  energy  coupling  in  skeletal  muscle  of  awake  fed  and  fasted  rats. Relationship with uncoupling protein 3 expression. J Biol Chem, 2000. 275(50): 39279‐86. 

  

 

155 

 

156 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Nederlandse samenvatting 

Dankwoord 

List of publications 

Curriculum Vitae 

Nederlandse samenvatting 

158 

Samenvatting  

“Mitochondriële aanpassingen in insulineresistente spieren” 

Diabetes  is  uitgegroeid  tot  een  wereldwijde  epidemie.  Type  2  diabetes  (T2D)  neemt 

ongeveer  90%  van  alle  diabetes  gevallen  in  beslag  en  wordt  gekarakteriseerd  door 

insulineresistentie  (IR)  in belangrijke metabole weefsels. De enorme stijging  in het aantal 

T2D patiënten  is gerelateerd aan de toename van het aantal mensen met overgewicht en 

vervetting van de organen, in het bijzonder de spieren, veroorzaakt door een overmaat aan 

voedselconsumptie en een verminderde fysieke activiteit. Echter, de exacte processen die 

leiden tot IR zijn nog niet bekend. Een belangrijke hypothese binnen het onderzoeksgebied 

naar  de  oorzaken  van  T2D  is  dat  een  verstoorde  functie  van  de  mitochondriën  in  de 

skeletspier leidt tot een verlaagde capaciteit om vetzuren te oxideren, wat resulteert in een 

ophoping  van  vetten  in  de  spiercellen  (intramyocellulaire  lipiden,  IMCL).  Verhoogde 

concentraties  IMCL  en  intermediairen  daarvan  induceren  daarop  IR  door  een  proteïne 

kinase  te activeren, welke de  insuline  signalering en daarmee glucose opname verstoort. 

Recente  studies  hebben  deze  theorie  in  twijfel  getrokken  and  linken  IR  aan  een 

toegenomen  in  plaats  van  afgenomen  capaciteit  om  vetzuren  te  oxideren.  De  hoge 

vetzuuroxidatie snelheden zoals waargenomen in insulineresistente spier zijn geassocieerd 

met een lage complete vetzuuroxidatie en een verhoogde incomplete ‐oxidatie. Daarom is 

gesuggereerd  dat  de  ophoping  van  incompleet  gemetaboliseerde  vetzuren  in  de 

mitochondriën ‘mitochondriële stress’ veroorzaakt, wat zou  leiden tot IR. Ter verheldering 

van deze kwestie worden in dit proefschrift de mitochondriële aanpassingen in skeletspier 

tijdens de ontwikkeling van  IR and T2D nader onderzocht middels het gebruik van  in vivo 

(31P  en  1H magnetische  resonantie  spectroscopie  (MRS))  en  in  vitro  (o.a. mitochondriële 

respiratie  metingen  en  bepaling  van  mitochondriaal  DNA  en  acylcarnitine  niveaus) 

methodes. 

De tegenstrijdige resultaten aangaande de rol van mitochondriële disfunctie in T2D zouden 

verklaard  kunnen  worden  door  de  verschillende  technieken  die  gebruikt  zijn  om  de 

mitochondriële  functie  in  de  spier  te  bepalen.  In  vitro methodes,  zoals  de  bepaling  van 

genexpressie  niveaus,  enzym  activiteiten,  het  aantal mitochondriën,  de morfologie  van 

mitochondriën en mitochondriële respiratie, geven specifieke informatie over verschillende 

aspecten  van  mitochondriële  functie,  maar  de  resultaten  kunnen  niet  direct  vertaald 

worden naar  in vivo mitochondriële functie. Met behulp van 31P MRS kan de energetische 

status van de spiercel in vivo worden bepaald door het meten van fosfocreatine (PCr), ATP 

en  anorganisch  fosfaat  (Pi).  In  de  literatuur  zijn  twee  verschillende 31P MRS methodes 

toegepast om de mitochondriële  functie  van  skeletspier  in  vivo  te bepalen, namelijk het 

meten  van  (1)  de  ATP  synthese  flux  in  rust met  behulp  van  een  saturatie  transfer  (ST) 

experiment  en  (2)  de  snelheid  van  PCr  herstel  na  inspanning met  dynamische  31P MRS. 

Echter, deze methodes  leveren totaal verschillende parameters, te weten de snelheid van 

het  basale metabolisme  en  de maximale  oxidatieve  capaciteit.  In  hoofdstuk  2  van  dit 

Nederlandse samenvatting 

159 

proefschrift zijn beide methodes vergeleken  in ratten met mitochondriële disfunctie door 

behandeling met de  complex  I  remmer diphenyleneiodonium  (DPI), met het doel om  te 

bepalen welke methode het meest geschikt is om de mitochondriële functie van de spier in 

vivo te meten. Terwijl de dynamische 31P MRS metingen na  inspanning  lieten zien dat het 

herstel van PCr 46% langzamer was in ratten behandeld met DPI, was de ATP synthese flux 

in rust gemeten met ST niet verschillend ten opzichte van controle ratten. Deze resultaten 

tonen  aan  dat  in  vivo mitochondriële  functie  in  de  spier  directer  en  gevoeliger  bepaald 

wordt door de PCr herstelsnelheid na inspanning dan door ST metingen in rust. 

In hoofdstuk 3  is de pH‐afhankelijkheid van de PCr hersteltijdsconstante, PCr, onderzocht. Verzuring van spierweefsel vertraagt de PCr hersteltijd en bemoeilijkt de  interpretatie van 

PCr  als maat  voor  oxidatieve  capaciteit. Door meerdere  inspanningsprotocollen met  een 

variërende  intensiteit uit te  laten voeren door elke proefpersoon konden we concluderen 

dat het effect van verzuring op de PCr herstelsnelheid verschilt tussen personen en dat een 

algemene correctiefactor voor verzuring dus niet  toepasbaar  is. Daarnaast  is aangetoond 

dat de pH‐afhankelijkheid van PCr correleert met de  snelheid van de protonenflux uit de 

spier. 

In de hoofdstukken 4‐6 is 31P MRS toegepast om de rol van mitochondriële disfunctie in de 

spier  in de ontwikkeling van  IR en T2D nader te onderzoeken. Hoofdstuk 4 beschrijft een 

cross‐sectionele  studie  waarin  patiënten,  die  reeds  lange  tijd  T2D  hebben,  vergeleken 

worden met personen  in een vroeg stadium van T2D en met personen met een normale 

bloedglucose homeostase. Elke groep bestond uit mannen met gemiddeld dezelfde leeftijd, 

lichaamssamenstelling en een  laag niveau van dagelijkse  lichaamsbeweging. De resultaten 

laten  zien  dat mitochondriële  disfunctie  niet  noodzakelijk  een  oorzaak  of  gevolg  van  IR 

en/of  T2D  is.  De  verstoring  in mitochondriële  functie  in  T2D  patiënten  zoals  in  eerdere 

studies  is  aangetoond  lijkt  eerder  een  gevolg  te  zijn  van  een  verlaagde  fysieke  activiteit 

en/of een verstoorde insuline signalering. 

Met een diermodel van  IR, zoals Wistar ratten op een hoog‐vet dieet,  is het mogelijk om 

longitudinale studies uit te voeren en daarmee een inzicht te krijgen in het tijdsverloop van 

veranderingen in mitochondriële functie tijdens de ontwikkeling van IR. In hoofdstuk 5 is de 

mitochondriële  functie  en  vetophoping  in  de  spier  in  vivo  en  in  vitro  bepaald  in Wistar 

ratten na 2,5 en 25 weken hoog‐vet dieet. Op de korte termijn (2,5 week) leidde het hoog‐

vet dieet tot een stijging van IMCL en acylcarnitines in het spierweefsel en een verhoogde 

oxidatieve  capaciteit van de  spier  in vivo, welke volledig verklaard kon worden door een 

toename in het aantal mitochondriën. Na 25 weken hoog‐vet dieet was de vetophoping in 

de spier verder  toegenomen, net zoals het aantal mitochondriën en de capaciteit van de 

mitochondriën om  in vitro vet te oxideren. Echter, de  in vivo oxidatieve capaciteit van de 

spier was  niet  verhoogd, wat wijst  op  een  verlaagde mitochondriële  functie  in  vivo  die 

gecompenseerd  wordt  door  een  verhoogd  aantal  mitochondriën.  De  ogenschijnlijke 

Nederlandse samenvatting 

160 

tegenstelling  tussen  de  in  vitro  en  in  vivo  bepalingen  van mitochondriële  functie wordt 

mogelijk veroorzaakt door factoren die geen rol spelen bij de in vitro metingen. 

In hoofdstuk 6 wordt, net zoals in hoofdstuk 5, aangetoond dat in ratten op hoog‐vet dieet 

vrij  carnitine  in  de  spier  significant  is  verlaagd,  terwijl  de middellange‐  en  lange‐keten 

acylcarnitines zijn toegenomen. De verhoogde acylcarnitine niveaus in de spier duiden erop 

dat de mitochondriële disfunctie geobserveerd  in vivo veroorzaakt kan zijn door een hoge 

concentratie  vetmetabolieten,  wat  lijkt  te  worden  bevestigd  door  de  bevinding  dat 

mitochondriën van ratten op een hoog‐vet dieet vatbaarder zijn voor vetzuur‐geïnduceerde 

ontkoppeling  in  vitro.  Bovendien  wordt  in  dit  hoofdstuk  aangetoond  dat  carnitine 

supplementatie wel het carnitine  tekort  in de spier normaliseert, maar niet bijdraagt aan 

een  verbetering  van  de  lipide  huishouding  en  de  in  vivo mitochondriële  functie  van  de 

spier.  

De bevindingen die beschreven zijn in dit proefschrift zijn in overeenstemming met eerdere 

studies  die  aan  hebben  getoond  dat  IR  correleert  met  een  verhoogde  in  plaats  van 

verlaagde vetzuuroxidatie, met een ophoping van  incompleet gemetaboliseerde vetzuren 

en mitochondriële  disfunctie  als  gevolg.  Daarnaast  is  onomstreden  vastgesteld  dat  het 

gebruik van een combinatie van verschillende technieken, bij voorkeur zowel  in vivo als  in 

vitro,  essentieel  is  voor  een  grondig  onderzoek  naar  de  mitochondriële  functie  in 

skeletspier. 

 

Dankwoord 

161 

Dankwoord 

Het is gelukt! Vier jaar werk is nu gebundeld in dit proefschrift. Maar dat was me zeker niet 

gelukt zonder de samenwerking met en begeleiding van verschillende personen. Het is dan 

ook niet overbodig om hen op deze plaats daarvoor te bedanken. 

Allereerst natuurlijk Klaas, als professor  van de Biomedical NMR groep en promotor  van 

mijn promotieonderzoek heeft u in een paar jaar tijd van een klein hecht clubje een groep 

gemaakt die goed op de kaart staat. Dit heeft er ook voor gezorgd dat u het alleen maar 

drukker kreeg, maar toch wist u eigenlijk altijd tijd te maken wanneer het nodig was: van 

het bespreken en  interpreteren  van nieuwe  resultaten  tot het  corrigeren  van papers  en 

hoofdstukken. Uw positieve manier van becommentariëren heb ik altijd erg gewaardeerd.  

Jeanine, wat ben  jij belangrijk  geweest  voor de  totstandkoming  van dit boekje!  Je wilde 

overal betrokken bij zijn en  ik kon altijd bij je binnenlopen. Je persoonlijke benadering om 

duidelijk te maken wat wel en wat niet in overeenstemming was met jouw ideeën vond ik 

erg prettig, net zoals alle gesprekken over privesituaties. Bedankt voor alles wat je voor me 

hebt gedaan, ik heb vooral ook door jou de afgelopen 4 jaar met veel plezier gewerkt! 

Jolita, without you the in vitro experiments would not be of such a high quality as they are 

now.  The  dedication  with  which  you  work  in  the  lab  is  really  unbelievable  and  this  is 

directly  resulting  in  the nicest  results. Besides a very good  researcher,  I  learned  to know 

you as a very pleasant person. I enjoyed our trip to Rome really a lot!   

Sander, vooral de laatste tijd hebben onze wegen elkaar gekruist. Met jullie lab technieken 

heb  je  een  enorme  toegevoegde  waarde  gehad  in  onze  studies.  Zeker  ook  omdat  de 

samenwerking altijd zo prettig verliep, vind ik het erg jammer dat je uiteindelijk toch niet in 

mijn  commissie  kunt  zitten.  De  samenwerking  tussen  jullie  lab  van  het  AMC  en  de 

Biomedical NMR groep gaat zeker nog veel mooie studies opleveren! 

Voor de humane type 2 diabetes studie heb ik met veel plezier samen gewerkt met Luc van 

Loon en Stephan Praet. Luc, eigenlijk ben ik door jou hier op de TU/e terecht gekomen toen 

ik  bij  je  aanklopte  voor  een  afstudeerstage.  Naast  je wetenschappelijke  adviezen  zal  ik 

vooral  je wijze  raad die  je  gaf na een  afsluitingsetentje  in Veldhoven over  samenwonen 

nooit  meer  vergeten!  Stephan,  jouw  enthousiasme  heeft  me  in  het  begin  weleens 

overdonderd, maar ik weet zeker dat dit een belangrijke bijdrage heeft gehad aan de berg 

aan data die we hebben geproduceerd en wat geleid heeft tot een mooi resultaat.  

Wie ik zeker niet wil vergeten zijn alle vrijwilligers voor de humane studies: zowel voor de 

pilot studies; Ad, Ben, Sjaak en Jan, als voor de studie beschreven in hoofdstuk 3; Ewelina, 

Jeanine,  Gustav,  Koen,  Ben  en  Toon  (ook  bedankt  natuurlijk  voor  alle  andere  klusjes 

waarmee  je  me  geholpen  hebt,  zoals  het  plakken  van  mijn  fietsband:  ideaal  zo’n 

Dankwoord 

162 

conciërge!),  en  de  vrijwilligers  die  mee  hebben  gewerkt  aan  de  studie  beschreven  in 

hoofdstuk 4. 

Joep van Lier, bedankt voor het delen van jouw ‘fit’ ervaring. Ook al was wat je deed voor 

mij  soms  een  grote  puzzel,  door  jouw  hulp  zijn  onze  saturatie  transfer  data  zeker 

betrouwbaar gefit. Marije, de uurtjes bij de scanner voor onze ‘pH studie’ samen waren een 

stuk  gezelliger  dan wanneer  ik  er  alleen  zat. Helaas  zijn  de  data  nog  niet  in  dit  boekje 

verschenen, maar het wordt zeker nog een mooie publicatie.  Iedereen  in het Scheikunde 

lab bedankt voor de hulp bij het uitvoeren van de ELISA’s. 

Naast goede wetenschappelijke contacten, zijn niet of minder wetenschappelijke contacten 

belangrijk om zo goed mogelijk te presteren. De sfeer in de vakgroep heb ik als erg prettig 

ervaren,  zeker  toen  bleek  dat  er  20  collega’s  enthousiast  te  krijgen  waren  voor  een 

korfbaltoernooi. In de afgelopen 4 jaar heb ik een aantal kamergenootjes gehad, waarmee 

ik  tegenslagen maar  zeker  ook mooie momenten  heb meegemaakt.  Ewelina,  I  am  very 

happy that you will be very close to me during my defense as my usher,  just as you were 

during my whole PhD project. Hopefully next year we can arrange our plan to visit Poland 

together! Bram, Tessa en Leonie, B2.03 was echt een top kamer. Ik ga de leuke gesprekken 

en gezelligheid zeker missen. Geralda, ondertussen zit  je alweer een  jaar  in Utrecht, maar 

gelukkig hebben we nog steeds  leuk contact. De tenniscarrière, ooit zo mooi begonnen  in 

Geldrop, kunnen we voorlopig maar beter even in de koelkast zetten. Houden we het toch 

gewoon bij een etentje op zijn tijd? Ward, jij blijft toch ook meedoen met de etentjes? Erg 

fijn dat de mooie resultaten waar  je zo hard voor hebt gewerkt er nu zijn en  je boekje er 

dan toch echt lijkt te komen! 

Dan  zijn  er  nog  een  aantal  collega’s  van  de  Biomedical  NMR  groep  die  ik  hier  wil 

vernoemen.  Bart,  ik  zal  je  spannende weekend  verhalen  tijdens  de  pauze  gaan missen! 

Succes met  het  voortzetten  van  ons werk  en  als  opperorganisator  van  de  groepsuitjes. 

Richard,  soms  zit  het  tegen, maar  als  het  dan  eenmaal  lukt  gaat  het  echt meezitten  en 

resulteert alle moeite  in erg mooie studies! Hou vol, positief blijven en dan weet  ik zeker 

dat  je  een  prachtig  boekje  krijgt.  Het  blijft  natuurlijk  wel  erg  jammer  dat  onze 

spiervezelkleuringen van cross‐secties van de hele TA mijn boekje niet op fleuren. Larry, je 

was vaak een rots  in de branding als er weer eens brokken waren aan de 1.5T scanner of 

wanneer  ik als niet‐technicus  technische hulp nodig had, bedankt daarvoor. Voor mij als 

nuchtere Brabantse meid was  je af en  toe een vreemde vogel, maar wel een aardige.  Jo, 

David en  in het bijzonder Leonie bedankt voor al  jullie biotechnische hulp bij de OGTT’s, 

DEC  protocollen  enz.  Hedwig  en  Ria,  ik  ben  jullie  dankbaar  voor  de  hulp  met  alle 

administratieve  rompslomp die bij  (de afronding  van) een promotie project  komt  kijken. 

Jef, ook al luisterden we niet altijd naar je koffie oproep, toch waren de pauzes en BBQ’s na 

het Nlaag voetbal  toernooi erg gezellig! Henk, door al het werk wat  jij hier hebt gedaan, 

heb  ik een vliegende start kunnen maken en jouw werk door kunnen zetten. Verder wil  ik 

Dankwoord 

163 

natuurlijk  Gustav,  Jeroen,  Holger,  alle  andere  collega’s,  (ex‐)  aio’s  en  studenten  van  de 

Biomedical NMR groep heel erg bedanken voor de leuke pauzes en groepsuitjes.  

Zoals  iedereen die mij een beetje kent wel weet,  is korfbal een belangrijke bezigheid voor 

mij.  Ook  al  lijkt  het  soms misschien  niet  zo,  toch  is  het  een  heerlijke  ontspanning  en 

uitlaatklep. Dat komt voor een groot deel natuurlijk ook door ons gezellige, no‐nonsense, 

maar vooral  ‘hechte’  team! Naast het zelf spelen mag  ik natuurlijk de meiden van de A1 

niet  vergeten,  jullie  zijn  toppers.  Als  ik  chagrijnig was  kwam  het waarschijnlijk  door  de 

stress  om  dit  boekje, mijn  verontschuldigingen  daarvoor. Dimphy,  ik  vind  het  fijn  dat  ik 

altijd bij  je terecht kan, voor advies, opbeurende woorden,  je realistische blik, maar zeker 

ook voor gezelligheid! Doreen,  there  is something, something  I want  to  tell you…  je bent 

een geweldig vriendinnetje!  Ik hoefde dan ook niet  lang na te denken wie  ik als paranimf 

achter me wil hebben staan. 

Ons Maastricht/sinterklaas clubje: Anne, Janneke, Marije, Marijn en Nicole, ik hoop dat we 

nog lang de vriendinnen blijven die we nu zijn, op naar ons 10‐jarig jubileum! 

Frans en Nicolien, vanaf de eerste dag heb ik me welkom gevoeld bij jullie. Jullie interesse 

en betrokkenheid  in de stappen die Koen en  ik namen zijn erg belangrijk voor ons. Luc,  ik 

ben er nu ook van overtuigd dat de uren die Koen en jij achter de computer doorbrachten 

meestal niet door jou kwamen. Succes, maar vooral ook veel plezier nog met je Utrechtse 

studentenleventje! We komen binnenkort echt een keer naar  je kamer kijken, dus zet die 

wereldgerecht pakken maar klaar. 

Pap  en  mam,  hierbij  wil  ik  jullie  ook  ontzettend  bedanken  voor  alle  vrijheid  en 

mogelijkheden  die  jullie  me  altijd  gegeven  hebben.  Ook  al  hebben  jullie  weinig  kaas 

gegeten  van mitochondriën,  jullie  zijn  geïnteresseerd  in  alles wat  ik  doe  en meemaak, 

waardoor ik altijd graag thuis kom. Zo zijn de voetbalavonden samen met Kees nog steeds 

gezellig. Suus, ik ben blij dat je mijn zusje bent en ik heb altijd al geweten dat je zo’n goede 

juf zou worden als je nu bent, ik ben trots op je! 

Ook al vond je het niet nodig, toch wil en kan ik jou hier niet onvermeld laten Koen. Je bent 

belangrijk voor me, om teveel redenen om hier op te noemen. Ik ben benieuwd waar onze 

‘(trein) reis’ ons nog allemaal gaat brengen! 

List of publications 

164 

List of publications 

International refereed journal publications 

N.M.A. van den Broek,  J. Ciapaite, K. Nicolay,  J.J. Prompers. Comparison of  in vivo 

post‐exercise  phosphocreatine  recovery  and  resting  ATP  synthesis  flux  for  the 

assessment of  skeletal muscle mitochondrial  function. Am  J Physiol Cell Physiol,  in 

press. 

N.M.A. van den Broek, J. Ciapaite, H.M.M.L. De Feyter, S.M. Houten, R.J.A. Wanders, 

J.A.L. Jeneson, K. Nicolay and J.J. Prompers. Increased mitochondrial content rescues 

in  vivo muscle  oxidative  capacity  in  long‐term  high‐fat‐diet‐fed  rats.  FASEB,  2010. 

24(5):1354‐64. 

J.A.L.  Jeneson,  J.P.  Schmitz, N.M.A.  van den Broek, N.A.  van Riel,  P.A. Hilbers,  K. 

Nicolay,  J.J. Prompers. Magnitude and  control of mitochondrial  sensitivity  to ADP. 

Am J Physiol Endocrinol Metab, 2009. 297(3): E774‐84. 

H.M.M.L. De Feyter, N.M.A. van den Broek, S.F.E. Praet, K. Nicolay, L.J.C. van Loon 

and J.J. Prompers. Early or advanced stage type 2 diabetes is not accompanied by in 

vivo  skeletal muscle mitochondrial  dysfunction.  Eur  J  Endocrinol,  2008.  158:  643–

653. 

N.M.A. van den Broek, H.M.M.L. de Feyter,  L. de Graaf, K. Nicolay,  J.J. Prompers. 

Intersubject differences in the effect of acidosis on phosphocreatine recovery kinetics 

in muscle after exercise are due to differences in proton efflux rates. Am J Physiol Cell 

Physiol, 2007. 293: C228–C237. 

H.M.M.L. De Feyter, S.F.E. Praet, N.M.A. van den Broek, H. Kuipers, C.D. Stehouwer, 

K. Nicolay, J.J. Prompers, L.J.C. van Loon. Exercise training improves glycemic control 

in  longstanding,  insulin  treated  type  2 diabetes  patients. Diabetes  care,  2007.  30: 

2511‐13. 

 

List of publications 

165 

Selected abstracts at scientific meetings (First author only) 

N.M.A. van den Broek,  J. Ciapaite, K. Nicolay,  J.J. Prompers. Comparison of  in  vivo post‐

exercise PCr  recovery and basal ATP  synthesis  flux  for  the assessment of  skeletal muscle 

mitochondrial function.  ISMRM 18th scientific meeting and exhibition, Stockholm, Sweden, 

2010. 

N.M.A. van den Broek, J. Ciapaite, H.M.M.L. De Feyter, S.M. Houten, R.J.A. Wanders, J.A.L. 

Jeneson,  K.  Nicolay  and  J.J.  Prompers. Metabolic  adaptations  in  skeletal muscle  in  the 

development  of  insulin  resistance measured  in  vivo  by  31P  and  1H MRS. NWO‐CW  study 

sections  Nucleic  acids, Protein  Research  and  Lipids  &  Biomembranes,  Veldhoven,  The 

Netherlands, 2008. 

N.M.A. van den Broek, J. Ciapaite, H.M.M.L. De Feyter, K. Nicolay, J.J. Prompers. Metabolic 

Adaptations  in  Skeletal Muscle During  the Development  of  Insulin  Resistance.  EASD  44th 

Meeting, Rome, Italy, 2008.  

N.M.A.  van  den  Broek,  H.M.M.L.  de  Feyter,  K.  Nicolay,  J.J.  Prompers.  Metabolic 

adaptations in skeletal muscle in the early stage of insulin resistance measured in vivo by 31P 

and 1H MRS. ISMRM 16th scientific meeting and exhibition, Toronto, Canada, 2008. 

N.M.A.  van  den  Broek,  H.M.M.L.  de  Feyter,  K.  Nicolay,  J.J.  Prompers.  Metabolic 

adaptations in skeletal muscle in the early stage of insulin resistance measured in vivo by 31P 

and  1H MRS.  NVDO  gecombineerde wetenschappelijke  jaarvergadering,  Doorwerth,  The 

Netherlands, 2007. 

N.M.A.  van  den  Broek,  H.M.M.L.  de  Feyter,  K.  Nicolay,  J.J.  Prompers.  Metabolic 

adaptations in skeletal muscle in the early stage of insulin resistance measured in vivo by 31P 

and 1H MRS. JFD fysiologen symposium, Papendal, The Netherlands, 2007. 

N.M.A. van den Broek, H.M.M.L. De Feyter, S.F.E. Praet, K. Nicolay, L.J.C. van Loon and J.J. 

Prompers. Normal  in vivo skeletal muscle mitochondrial function  in subjects with  impaired 

glycemic  control  and  in  long‐standing,  insulin  treated  type  2  diabetes  patients.  ENP  6th 

Dutch Endo‐Neuro‐Pshycho meeting, Doorwerth, The Netherlands, 2007.  

N.M.A. van den Broek, H.M.M.L. De Feyter, S.F.E. Praet, K. Nicolay, L.J.C. van Loon and J.J. 

Prompers. Normal  in vivo skeletal muscle mitochondrial function  in subjects with  impaired 

glycemic control and in long‐standing, insulin treated type 2 diabetes patients. ISMRM 15th 

scientific meeting and exhibition, Berlin, Germany, 2007.  

N.M.A.  van  den  Broek,  H.M.M.L.  de  Feyter,  L.  de  Graaf,  K.  Nicolay,  J.J.  Prompers. 

Intersubject differences  in the effect of acidosis on phosphocreatine recovery kinetics after 

exercise. ESMRMB 23rd annual scientific meeting, Warsaw, Poland, 2006. 

 

166 

Curriculum Vitae 

167 

Curriculum Vitae 

Nicole  van  den  Broek was  born  October  23,  1983,  in  Tilburg,  The 

Netherlands. She grew up  in Diessen and graduated from secondary 

school (gymnasium) at the Koning Willem II college in Tilburg in 2001. 

In  the  same  year  she  started  her  study  Health  Sciences  at  the 

University of Maastricht. Her master project within  the Department 

of  Movement  Sciences  of  the  afore  mentioned  university  under 

supervision of dr. Luc van Loon  involved the  investigation of the pH 

dependence  of  different  parameters  for muscle  oxidative  capacity 

measured  by  31P  magnetic  resonance  spectroscopy  (MRS).  This 

project was performed in cooperation with the Biomedical NMR group of the Department 

of  Biomedical  Engineering  of  the  Eindhoven University  of  Technology.  She  obtained  her 

Master  of  Science  degree  in  2005.  She  continued  her  research  in  the  Biomedical  NMR 

group as a junior research scientist and was involved in a study with diabetes patients. Half 

a year  later she started her PhD project  in  the same group under supervision of prof. dr. 

Klaas  Nicolay  and  dr.  Jeanine  Prompers.  She  studied  the  timing  and  nature  of muscle 

mitochondrial  adaptations  during  the  development  of  insulin  resistance  and  type  2 

diabetes  using  both  in  vivo  MRS  and  in  vitro  methodology.  Her  research  dealt  with 

methodological  aspects  of  the  MRS  techniques  as  well  as  the  application  of  these 

techniques in human volunteers and animal models of insulin resistance. 

 

168