MHC-LINKED GENETIC SUSCEPTIBILITY TO INSULIN-DEPENDENT DIABETES MELLITUS

(IDDM) IN THE BB RAT

Rohan Pointer

Deparmient of Physiology

McGiU University, Montreal. Quebec. Canada

A thesis

submitted to the Faculty of Graduate Studies and Research

in partial fu l fhent of the requiremenü for the degree of Master of Science

@Rohan Pointer, 1996

National Library Bibliothèque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Setvices services bibliographiques 395 Wellingîm Street 395, nie Weliington ûtîawaON K 1 A W W O N K 1 A W Canada canada

The author has granted a non- exclusive licence allowing the National Libraty of Canada to reproduce, loan, distribute or seil copies of this thesis in microform, paper or electronic formats.

The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts from it may be printed or otherwise reproduced without the author's permission.

L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/nlm, de reproduction sur papier ou sur format électronique.

L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.

Abstract

Genetic predisposition to insulin-dependent diabetes meiiitus (IDDM) involves one or more

loci within the class II region of the major histocompatibility cornplex (MHC). The

strongest MHC-linked determinants of disease susceptibility have k e n associated with polymorphisms in both the a and B chain subunits of HLA-DQ (human) and 1-A (mouse)

class II molecules. Specifically, protection against IDDM developmeni is associated with the presence of aspartic acid at position 57 of the chah while non-aspartic acid residues

are found in diabetogenic B chahs. Ln humans, the greatest risk of disease development is

observed in individuals with Arg 52+ d A s p 57- B heterodimers. The BB rat is a usehl

system in which one c m identify and characterize the genes necessary for the onset of

IDDM. Although sequence data have been reported for various alleles of these class ïI genes, the effect of polymorphisms in the rat MHC is not nearly as well characterized as it is in humans or the NOD mouse. The rat MHC (RTl) contains two expressed class II loci, RT 1.B and RT 1 .D, each encoding two class II molecules: RT I .B a and B. and RT 1 .D a and B. This study detemined the nucleotide sequences of relevant regions from the RTl .B and RTL .D a@ genes in five rat strains (ACI, BB. Buffalo, Lewis, and Wistar-Furth) of

varying susceptibility to IDDM to examine the role of specific polymorphisms in

predisposition to disease. The data show that BB and Wistar-Furth rats (RTP haplotype) have identical class II sequences at al1 of the regions examined. Although no unique a chain

sequences were found to associate with IDDM, we did confirm the association of aspartic acid at position 57 of RT 1 .BP with susceptibility to diabetes. We suggest that the aspartate

observed at position 57 of the RT1 .DP chain - though not associated with IDDM - may influence genetic susceptibility to other autoimmune diseases. Both class 11 P chain loci

were also found to contain pseudogenes which may play a role in the generation and

maintenance of MHC divenity.

Résumé

La prédisposition génétique au diabète insulino-dépendant (DID) implique un ou plusieurs

gènes de classe II du complexe majeur d'histocompatibilité (CMH). La liaison la plus forte

entre cette region et le risque de développer un diabète de type 1 a été associée avec des polymorphismes spécifiques sur les chaînes a et P du CMH classe II chez l'homme (HLA-

DQ) et chez la souris (1-A). Une protection contre le DID est associée avec la présence d'un acide aspartique en position 57 de la chaîne P, tandis qubn trouve d'autres acides aminés à

cette place sur les chaînes qui sont diabétogéniques. Les individus les plus à risque de

développer le Dm sont ceux qui possèdent les hétérodimères Arg 52+ a/Asp 57- p. Dans

notre laboratoire, nous nous servons du rat BB pour identifier et caractériser les gènes de

prédisposition au DID. Malgré le fait que des séquences d'ADN ont été rapportées pour quelques allèles de ces gènes de classe ïI chez le rat. l'effet des polymorphismes dans le

CMH du rat n'est pas aussi bien caractérisé qu'il est pour les humains ou la souris NOD. Le CMH du rat a deux loci. RTI .B et RTI .D, qui contiennent chacun deux molécules de classe II: RT1.B a et B, et RT1.D a et P. Cette étude a déterminé les séquences

nucléotidiques des régions pertinentes des gènes RT1.B et RT 1 .D (a et P) pour cinq

souches de rat (ACI, BB, Buffalo, Lewis, et Wistar-Furth) qui different dans leur degré de

prédisposition au DID. Nous avons étudié le rôle possible des polymorphismes spécifiques

dans la susceptibilité au diabète de type 1. Les résultats montrent que le rat BB et le rat

Wistar-Furth (I'haplotype RTIU) ont des séquences de classe Ii qui sont identiques à toutes les régions examinées. Quoiqu'on ne trouve pas de séquences uniques de la chaîne a qui

s'associe avec le DiD, on a confme l'association de Asp 57+ sur la chaîne P de RT1 .B avec une prédisposition au diabète. On suggère que l'acide aspartique présent à la position 57 sur la chaîne p de RT1.D - même s'il n'est pas associé avec le DID - pourrait influencer

la prédisposition génétique aux autres maladies autoimmunes. De plus, nous avons trouvé des pseudogènes dans les deux loci de classe iI pour les chaînes p qui pourraient peut-être

jouer un rôle dans la production et le maintien de la diversité du CMH.

Table of Contents

Abstract

Résumé

Table of Contents

List of Tables and Figures

Acknowledgements

1 . Introduction

Historical Perspective

The Pancreas

Insulin

Autoimmunity

Animal Models

a. The BB Rat

b. The NOD Mouse

Gene tics

Major Histocompatibility Complex

a. Molecdar Structure

b. Regulation of h u n e Response

c. Association with Type 1 Diabetes

Objectives

2 . Materials and Methods

2.1 Rats

2 2 Preparation of DNA

3.3 Polymeme Chain Reaction

2.4 Sequencing

Table of Contents (continuedl

2.5 PCR Amplification of RTl.DP cDNA

2.6 Southem Blot Analysis

2.7 DNA Probe

2.8 Allele-Specific Oligonucleotide Slot Blots

3 . Results

3.1 Determination of the Partial Nucleotide Sequence for RT 1 .Ba

3.2 Determination of the Partiai Nucleotide Sequence for RT 1 .BP

3 -3 Determination of the Partial Nucleotide Sequence for RT 1 .Da

3.4 Determination of the Partial Nucleotide Sequence for RT 1 .DB

4. Discussion

5 . Conclusion

6. Bibliopphy

List of Finures and Tables:

Figure 1:

Figure 2:

Figure 3:

Table 1:

Figure 4:

Figure 5:

Figure 6:

Figure 7:

Figure 8:

Figure 9:

Figure 10:

Figure 1 1 :

Figure 12:

Figure 13:

Figure 14:

MHC-restricted antigen presentation to T ceils

Schematic diagram of the structure of a class II MHC molecule

Genornic organization of the MHC in humans, mice and rats

Nucleotide sequences of primers

Nucleotide sequences from 1 st domain of RT 1 .Ba

Comparison of 1st domain amino acid sequences for RTl .Ba

Nucleotide sequences from I st domain of RT 1 .BP

Allele-specific oligonucleotide (ASO) slot blots

Cornparison of 1st domain amho acid sequences for RT 1 .BP

Nucleotide sequences from 1 st domain of RT 1 .Da

Comparison of 1st domain amino acid sequences for RT1 .Da

Nucleotide sequences from 1st domain of RTl-DP

Southem blot analysis of ScaI-digested DNA kom AC1 and BB rats

Comparison of 1st domain arnino acid sequences for RT I .DP

The a and gene order within the class II loci of the rat MHC

This Master's thesis is the culrniaatioa of three yeras spent in the McGill Cancer

Centre. DiiRng that timc, 1 have k c n helped by many paoplt within and outsdc the hb

who desem mention. Rachdle Lega patitntly taught m ihc tcchuiques which this pmjeçt

d d e d Aurora Labitan also pas& on som of what she knows and kept me laugbing

during my shm-hed career in tissue culture. 'Ibe dl-impor*int rats (and rat picas) for my

expaimcnts were prwidcd by M m Al-Sa€far whilc Helbe Lacmix gcnaously gave a

geat deal of technid advice. 1 worked in the Cancer C e n a and was aided in innumerable

ways by its staff, but Liada Tracey was my life line to the Physiology Deparment and

madcitapleasuntobeasndaittùerem.

My supcmisor, Dr. A. Fuks, &as taught mt much about science and about life for

which 1 am grateful. His wisdotn, knowledge, and kindness will continue to inspire me

long after 1 have moved on. Unofficially, Dr. G. Rice was my co-supervisor. This entailed

nos ody helping m to analyse data, but also having an open door and empty chair when 1

needed it and he had many otha things to wony about. My supe~sory cornmittee was

comprised of Drs. G. Prud'homme, E. Colle. aad R. Guttmann; their expertise in

immunology bettered my project and ducation.

nie Cancer Center has been hill of fkiends who helpeù me to weather the tough

times of graduate school and celebrate the good ones. However. 1 owe the most to Annie,

h a family, and my own. Their support and encouragement got me here in the k t place.

1. Introduction

1.1 Historical Peitsoective

The earliest recorded description of diabetes mellitus dates back thousands of years

to ancient Egypt (Goodfellow et al., 1994). Diabetes, Literally "through-passer" in Greek,

was coined in the second century BC after one of the disease's charactenstic symptoms. "a

wasting of the flesh and limbs into urine" (Von Engelhardt, 1987). Mellitus, Latin for

"honey", was later added in reference to the diagnostic discovery that urine of diabetics was

sweet to the taste (Kahn et al., 1994). It was not until the close of the 18th century,

however, that this sweetness was Iinked to elevated levels of sugar in the urine (Bliss,

1982). Subsequent clinical studies showed that the degree of glycosuria could be

influenced by diet: under-nourishment on regimens high in fat and protein resulted in the

lowest levels of excreted glucose and, therefore, was prescribed to prolong the lives of

those afflicted (Kahn et al., 1994). These restricted diets remained the best treatment

available to diabetics for more than 100 years.

I .2 The Pancreas

Much controversy surrounded the organ(s) primarily involved in diabetes rnellitus;

candidates included the kidneys. liver, pancreas, and stomach. The first step toward

definitively narrowing this field came in 1875 with the publication of a senes of long-term

studies that identified two foms of the disease. In response to a restricted diet and exercise

the condition of older (usually obese) patients was seen to improve remarkably while the

health of younger patients contùiued to deteriorate despite the same treatment. Post-mortem

examinations revealed pancreatic lesions only in the younger group of patients. Taken

together, these observations suggested that juvenile (type 1) diabetes mellitus was a disease

of the pancreas (Kahn et al., 1994).

2

At the time of this study it was difficult to explain how the pancreas could be

involved in the pathogenesis of a metabolic disease such as diabetes mellitus because

understanding of the organ was limited to its exocrine function. This soon changed when

the association between the pancreas and diabetes mellitus was fomiitously confirmed by a

study designed to determine the exact role of the pancreas in digestion. The experiments

consisted of performing complete pancreatectomies on healthy dogs and subsequently

observing them for theY ability to absorb fats. However, within 24 hours of the operations

every animai had become acutely diabetic (Kahn et al., 1994). This unexpected tum of

evenü convincingly established that the pancreas has two distinct functions - one important

for digestion and the other crucial to metabolism - and thus paved the way for research on

the treatment of diabetes mellitus.

The realization of this dichotomy brought the scientific world's attention back to the

almost-forgotten dissertation of a German medical student by the narne of Paul Langerhans

who, nearly twenty years earlier, had presented his findings on pancreatic histology. In

addition to the organ's acinar cells aiready known to secrete digestive enzymes, Langerhans

had described a new ce11 type distributed throughout the pancreas, localized in clusters, and

histologically distinct from the acinar cells. The function of these "islets of Langerhans"

was not known (Bliss, 1982). With the description of a sudden-onset diabetes in

depancreatized dogs, speculâtion arose that the islets of Langerhans produced a substance

necessary for the regulation of metabolism and absent in the diabetic staie. Logically, the

next step was to isolate this substance and deliver it to diabetics. Efforts to do so began

around 1900 and continued until 1921 when Frederick Banting and Charles Best

successfully extracted the elusive pancreatic hormone which they called insulin (Bliss,

1982). This discovery changed the lives of diabetics around the world.

1.3 Insulin

Insulin acts on various cells of the body to promote the uptake of glucose. In a

healthy individual as blood glucose levels rise there is a correspondhg increase in the

production and release of insulin from the beta cells within the islets of Langerhans.

Together with its antagonist, glucagon (another hormone of the pancreatic islets), insulin

maintains a constant blood sugar level (Guyton. 1991). Insulin deficiency - as seen in

insulin-dependent diabetes mellitus (IDDM - cnpples the regulation of blood glucose levels

with grave consequences. in fact pnor to the availability of insulin replacement therapy,

diagnosis of type I diabetes was effectively a death sentence since most patients died within

one year. No longer able to utilize dieiary glucose, their bodies would allow it to

accumulate in the bloodstream. This hyperglycemia eventually overwhelmed the kidneys

and glycosuna would develop. The sugar (a potent diuretic) resulted in frequent urination

and an insatiable thirst. Despite an increased appetite, the lack of nourishrnent quicldy led to

weight loss and weakness. The body would then attempt to compensate for its inability to

metabolize carbohydrates by switching to fats and proteins as a source of energy, but

because the catabolism of fatty acids is accompanied by a nse in the levels of aciâic ketones

this strategy failed and patients soon developed metabolic acidosis (Bennett et al., 1996).

Diabetics at this stage were often described as lethargic and smeiling of "rotten apples" due

to the volatile ketone bodies which they exhaled (Bliss, 1982). As the metabolic burden

becme intolenble these patients slipped into a coma and died.

With the advent of insulin, effective treatrnent of DDM was fmally possible and the

helpless decline toward death became a thing of the pst . However, patients were now

dependent on multiple daily insulin injections for the rest of their Lives and vulnerable to

long-term complications including retinopathy. nephropathy. and atherosclerosis (Bennett

et al., 1996). Ideally, what diabetics desired was a way to cure their disease or, better yet,

4

prevent it aftogether. With this in muid. reseachers set out to undeatand what goes wrong

to bnng about IDDM and who was at nsk for developing disease.

1.4 Autoirnmunitv

While the lesions fint noted during autopsies of juvenile diabetics in the 19th

cenniry implicated the pancreas in disease progression, a full appreciation of their relevance

to disease pathogenesis could only corne with the discovery of insulin and a better

understanding of the pancreas' endocrine functions. It was thus that a series of studies

beginning in the 1940's provided the fust evidence to suggest that IDDM was autoimmune

in nature. Under rnicroscopic examination. pancreatic sections from patients who had died

of a recent onset of type 1 diabetes repeatedly showed that the characteristic lesion, insulitis,

was due to an infiltration of mononuclear immune cells into the islets. These cells included

macrophages, T lymphocytes. and B lymphocytes (Bach, 1994). An autoimmune

pathogenesis for iDDM was further supported by subsequent discoveries of: islet ce11

antibodies in diabetic patients (Bottauo et al., 1989); specific responses against islet ce11

antigens in vitro with T lymphocytes obtained from diabetic patients (Rossini et al., 1985);

rejection of pancreatic transplants between identical twins discordant for disease (Bach.

1994); and the partially-successful treatrnent of type 1 diabetes with irnmunosuppressive

dmgs such as cyclosporin A (Stiller et al., 1984).

1 -5 Animal Models

Animal models for type 1 diabetes have been invaluable in advancing Our

understanding of the etiology of IDDM. They aiiow for selective breeding of inbred strains,

observation of many generations in a short p e n d of time, complete environmental control,

biochemical and genetic alterations, and testing of experimental therapies to cure or prevent

disease - al1 of which are fundamentdly important to diabetes research but

5

impossible in human studies. While no one animal mode1 perfectly &ors human IDDM,

the non-obese diabetic (NOD) mouse and Bio-Breeding (BB) rat are widely accepted as the

best models avaiiable.

a. The BB Rat

The BB rat was discovered in 1974 at the Bio-Breeding Laboratories of Canada

Ltd. in Ottawa when it was noted that the death rate among weaniings from a commercial

colony of Wistar-derived rats was unusuaily high. Further investigation into this elevated

mortality revealed that diabetes mellitus was the cause (PYfrey et al., 1989). Through daily

injections of insulin, these animals were kept dive and a breeding coiony of diabetic rats

was created. Crossbreeding parents of diabetic animals gave a disease incidence of 10%

which could be increased to 25% by selective father-daughter mating (Crisa et al., 1992).

Breeding colonies descended from these original litters in Ottawa have since k e n

established around the world and Vary in both the incidence (20-80%) and severity of

diabetes (Kahn et al., 1994; Parfrey et al., 1989).

Disease in these rodents shares many characteristics of human IDDM including:

weight loss, hyperglycemia, hypoinsulinemia, glycosuria, and ketonuria. The sudden

appearance of these clinical symptoms in adolescent male and female rats is preceded by

insulitis and. ultimately, destruction of the insulin-producing beta ceiis. Pancreatic biopsies

have shown the infiltrating cells to consist of lymphocytes, macrophages, natural killer

cells, and occasionally eosinophils (Crisa et al., 1992). While the mean age of disease

onset is 85 days, it can range from 55 to 140 days (Colle, 1990) and quickly leads to death

if the animais do not receive insulin injections.

In addition to insulitis, numerous observations in the BB rat support an

autoimune pathogenesis of IDDM. One of the most convincing demonstrations of T cell-

mediated autoimrnunity in type 1 diabetes meiiitus cornes h m passive transfer

6

experiments. When ConA-activated peripheral or splenic lymphocytes from diabetic BB

rats are injected into diabetes-prone BB rats, diabetes can be transferred to a large

percentage of the recipients (who normally have a low disease incidence (Rossini et al.,

1985)). Further evidence of T cells in the pathogenesis of IDDM cornes from studies

showing that neonatal thymectomies of BB rats prevent the development of IDDM in later

life (Crisa et al., 1992). Aiso, as with human disease, islet transplants from disease-

resistant BB rats to syngeneic, diabetic BB rats are rejected (Rossini et al., 1985).

Unlike human IDDM, disease in the rat is sometimes accompanied by an

autoimmune thyroiditis (Colle et al., 1985). The most srriking difference between diabetes

in humans and the BB rat, however, is that the latter bas an immunoregulatory defect which

results in marked T ce11 lymphopenia in peripheral blood, spleen, and lymph nodes

(Parfrey et al., 1989). Breeding studies between lymphopenic rats and other inbred strains

indicate that this T ce11 lymphopenia is an autosomal recessive trait (Colle, 1990). While

there is a global deficiency in T ce11 subsets, the predominant depletion is observed in

cytotoxic/suppressor (CD8+) OX8+ cells (Crisa et al., 1992). Diabetic rats are also devoid

of RT6+ T lymphocytes; RT6 being a T cell-differentiation antigen of unknown function

(Koch et al., 1990). Because IDDM can be induced in diabetes-resistant BB rats by

selectively depleting their RT6+ T lymphocytes. this ce11 population is thought to be

important in the regulation of IDDM susceptibility (Greiner et al., 1987; Kosuda et al.,

1994).

Functionally, the lymphocytes of diabetic BB rats have depressed proliferative

responses to ConA and other mitogens, but these can be improved by the removal of

macrophages from the ce11 suspension (Prud'homme et al., 1984). The histology of the

thymus in BI3 rats prone to diabetes is nomal (Colle, 1990) and thyrnic transplants from

diabetes-resistant rats into irradiated diabetes-prone (DP) rats reconstituted with DP bone

7

marrow cannot correct disease (Parfrey et ai.. 1989) suggesting that the irnmunoregulatory

defect is prethyrnic.

While islet ce11 surface antibodies (ICSA) - which are infrequently found in litters

from low-incidence rat lines - are present in most BB rats from high-incidence colonies,

islet ce11 cytoplasmic antibodies have not been detected in the BB rat. This would seem to

support a role for humoral immunity in pancreatic islet destruction without directly targeting

the beta ceiis (Rossini et al., 1985).

b. The NOD Mouse

The NOD mouse was developed in Iapan in 1980 from a breeding program

intended to establish a cataract-prone line (CTS) of inbred mice from the non-inbred ICR

strain (Jaramillo et al., 1994). 26 generations of selective breeding between a

hyperglycernic subline of the CTS mice gave rise to a female mouse who spontaneously

developed diabetes. and the NOD mouse strain was bom. Disease incidence in NOD

colonies is consistently 80% of females and 20% of males by seven months of age

(Kikutani et al., 1992); a gender bias that is not observed in human diabetic patients. As

with the BB rat, IDDM arises spontaneously in juvede NOD mice (between 12-16 weeks)

and manifests the clinical features associated with human disease.

Insulitis is also observed in NOD mice prior to the onset of diabetes. T cells

constitu te the majority of these mononuclear infiltrates which also include B lymphocytes.

monocytes. and natural killer (NK) cells (Kahn et al., 1994). Evidence supporting T cells

as the mediator in autoimmune destruction is, again, abundant. Neonatal thymectomies

significantly reduce the incidence of IDDM in NOD mice (Bach, 1988). and nude NOD

rnice which are T ce11 irnrnunodeficient never develop diabetes (Kahn et al., 1994).

Monoclonal anti-CD4 antibodies administered in vivo can prevent insulitis and overt

diabetes in NOD mice or block progression to diabetes in mice that have pancreatic lesions

8

(Kikutani et al.. 1992). These findings suggest that CD4+ T lymphocytes are instrumental

in the initiation and progression of IDDM. They do not act alone, though, as shown by cell

transfer experiments: spleen celis of T lymphocytes fiom diabetic mice lose their ability to

transfer diabetes to young irradiated or neonatal NOD mice when the donor cells are

depleted of either CD4+ or CD€!+ T lymphocytes (Kikutani et al., 1992). While islet cell-

specific autoantibodies can be detected in the sera of NOD mice, many researchen believe

these antibodies to be secondary to the T cell-mediated autoimmune destruction of

pancreatic islets (Castano et al.. 1990; Kikutani et al., 1992).

1.6 Genetics

As this research on the pathogenesis of disease advanced, knowledge of the

genetics underlying D D M was also progressing. Epidemiologic studies have shown that

type 1 diabetes occun predominantiy in children and young adults under the age of 20

(Todd et al., 1988). While the incidence of IDDM varies among different ethnic groups.

roughly 0.5% of the Caucasian population is affected (Rossini et al.. 1985). IDDM has

long been recognized as a familial disease but does not follow the classic laws of Mendelian

inheritance: the risk of developing diabetes is approximately 6 9 for a child born to a

diabetic and 7% for the sibling of a diabetic; the concordance rate between monozygotic

twins is 3540% (Bach, 1994).

This non-iinear increase in diabetic risk with increasing genetic-relatedness mles out

the possibility of a single-gene model of disease and instead supports a polygenic mode of

inheritance. The fact that identicai twins have a disease concordance rate weli below 100%

indicates that a non-genetic component is also invoived in susceptibility. Severai multi-gene

models were tested for the observed risk relationships and the best-fittinp model was found

to be that of a single major susceptibility locus requiring many minor genetic/environrnentai

factors which contribute a much srnaiier, additive effect (Rich, 1990). Observations of

9

seasonal variation in the onset of IDDM and associations between virai infections (from

Coxsackie to influenza) and diabetes gave rise to the theory that an environmental insult

such as viral infection triggers disease onset in genetically-susceptible individuals (Rossini

et al., 1985).

Armed with this blueprint of genetic susceptibility to DDM. researchers were

determined to identifj the predisposing genes. Begiming in the 1 9 8 0 s . a number of family

and population studies indicated that the strongest genetic determinani of susceptibility to

IDDM is encoded by one or more genes within the Major Histocompatibility Complex

(MHC).

1 -7 The Major Histocompatibilitv Complex

The MHC was discovered in the 1940's by George Snell during his analysis of the

mxhanisms of skin gr& rejection. By performing transplantations between inbred mice

strains he showed that: 1) grafts between mice of the same inbred strain are always

accepted 2) grafts between mice of different inbred strains are ahnost always rejected and 3)

when two different inbred strains are mated. the resulting offspring will never reject a graft

from either parent but the parents will almost always reject a graft from their offspring

(Abbas et al., 199 1).

These observations led Snell to hypothesize that graft rejection resulted from the

recognition by the host's immune system of CO-dominantly expressed, polymorphic gene

products present in the donor graft. To identify the genes which encoded these target

proteins, he inbred the donor and recipient animals until the genetic differences between the

two had been rninimized to a small region of DNA containing the responsible genes. These

congenic mice showed that although multiple (minor histocompatibility) genes contribute to

rejection, a complex of related genetic loci, the major histocompatibility complex. is

primarily responsible for the success or failure of a transplant (Damell et al.. 1990).

10

Despite the fact that the MHC was discovered through its role in transplant

rejection, it is now clear that the main function of the proteins encoded by this complex is to

regulate the physiological immune response. T lymphocytes are incapable of recognizing

soluble antigen. The T ce11 receptor cm only recognize - and mount a cell-mediated

response against - antigen which has been processed into peptide fragments that are

presented in the context of an MHC molecule. As shown in Figure 1, the T ce11 receptor

recognizes the MHC molecule and antigenic peptide as a single complex.

The genes of the MHC can be grouped into three classes, two of which bind

antigen and are crucial to cell-mediated immunity. Class 1 genes encode the classic

transplantation antigens of Snell's experiments. These glycoproteins are found on the

surface of al1 nucleated cells and are the self molecules recognized in conjunction with

endogenously-synthesized antigen by the CD8+ cytotoxic T cells. The expression of class

II genes is restricted to a srnaller pool of cells (antigen-presenting cells) largely made up of

B lymphocytes, macrophages, and dendritic cells. As with class 1 molecules, these class II

glycoproteins are present on the ce11 surface but function in the presentation of exogenous

antigen to CD4+ helper T cells. The remaining genes of the MHC are grouped into the class

III locus and encode a variety of blood proteins and other ce11 surface proteins (Watson et

al., 1992).

a. Molecular Structure

Class 1 and class 11 MHC molecules have a very similar structure. As seen in Figure

2, class II MHC molecules are composed of two non-covalently associated polypeptide

chains. These a (32-34 kD) and (29-32 kD) chains are encoded by different genes of the

MHC whose exonlintron organization correlates with the protein structure (one exon per

domain). The extracellular region is subdivided into two domains, each approximately 90

amino acids long with the amino termini of both the a and chains (al and P 1,

Figure 1: MHC-restricted antigen presentation to T cells. Class II MHC

heterodimers on the surface of antigen presenting cells (APC) present processed antigen to

T lymphocytes. The T ce11 receptor recognizes the peptide and MHC molecule as a single

cornplex, leading to T ce11 activation and Lymphokine production.

class II MHC \

T ce11 receptor

13

respectively) forming the antigen binding site. Nuclaotide sequencing has shown this

region to be highly plymorphic. In contrast, the membrane-proximal regions (a2 and $2)

are relatively non-polymarphic and contain intemal disulnde bonds which are simüar to

immunoglobuiin domains* Less than om third of each chah is accounted for by the

intraceiluiar carboxy terminus and cransmembrane domain (Abbas et al., 199 1; Kauhnan a

ai., 1984).

When the thra-dimcasiood structure of c h 1 (Bjorkman et al., 1987) and lata.

class II MHC molecules (Brown et al., 1988) was determinecl by X-ray crystallography , it

showed that the a and f!irst extraceliular domah folded to form an eight-stranded, P- pleated sheet supporting two a helices; simply put - a pocket. This pocket f m the

antigen recognition si& within which antige~c peptides are bound for presentation to T

lymphocytes. As previously mentioned, nucleotide sequencing had shown diis region of

die MHC m o l d e to be highly polymorphic. Whai the amino acid substitutions resulting

fiom these nucleutide polymorphisms were mapped to their positions in the mode1 many

of the differences were found to occur at residues located dong the interior face of the cleft

wail which corne into direct contact with the bound antigen.

b. Wlation of Immune Remonse

This stmcturai insight provided a functional basis for immune spefificity.

Polymorphisms within the peptide-anding cleft generate different MHC molecules (alieles)

that Vary in their ab'ility to bind a given antigen and present it a> die cellular immune system

for recognition and response. This has been documentai in peptide elution studies which

show that class II molecules differing by d y one residue in the antigen recognition site

will bind overlapping - but distinct - sets of peptides (Rarnensee et al., 1995; Reich et al.,

1994). Antigen presentation is thus MHC-resaicted as wel as king MHC-dependent.

MHC-nstnction is of fundamental importance to the inmiune ceil interactions which

Figure 2: Schematic Diagram of the Structure of a Class II MHC Molecule.

The class II MHC molecule c m be divided into domains which correspond to the exon-

intron structure of the underlying genes. The membrane-proximal a2 and P2 domains have

structural homology with irnrnunoglobulin constant region domains while the highly

polymorphic a 1 and P 1 domains fold to fom the antigen recognition site.

al P l

peptide binding re --------- --LI-------.

immunoglobulin-like region

membrane

cytoplasm

HOOC COOH

16

determine the T ce11 repertoire during thyrnic education. Positive-selection of self-MHC-

restncted T lymphocytes is Followed by negative selection of potentidiy autoreactive clones

(Abbas et al.. 1991) which, ideally, results in a tolerance to self while creating a mature T

ceIl repertoire capable of responding against foreign antigen. MHC gene products continue

to control the fate of these mature T lymphocytes as discussed above.

In these capacities, class 1 and class II MHC molecules greatly influence the

specificity and degree of immune responsiveness. making them prime candidates as

predisposition genes for an autoimmune disease such as IDDM. Ironically, the inital

association between these molecules and IDDM was made fortuitously in the early 1980's

before the regulatory role of the MHC in cell-mediated irnmunity was fully understood.

When the frequencies of serologically-defined alleles of MHC molecules were compared

among diabetics (both related and non-related) and the general population. a linkage

disequilibrium was observed (Bach, 1994). Certain sets OF MHC alleles (haplotypes) were

positively associated with disease while others displayed a negative association. Similar

linkage disequilibriums have subsequently been observed in both rodent models of disease.

The human MHC, more comrnonly referred to as the human leukocyte antigens

(HLA), is located on chromosome 6 where it spans over 3000 kb. The gene order moving

from centromere to telomere is depicted in Figure 3: class II loci (HLA-DP, -DQ, and

-DR), class III, and class I loci (HLA-B, -C, -A) (Todd et al., 1988). Genomic

organization of the somewhat smaller (approxirnately 2 0 kb) MHC cornplex in rocients

differs from that of the HLA (Figure 3). The class 1 loci of the murine MHC (the

histocompatibility-2 (H-2) complex, located on chromosome 17) are divided to flank the

class II and class III loci, giving a centromere to telomere order of: class 1 (H2-K), class II

(1-A, -E), class III, and class 1 (H2-D, -L) (Abbas et al., 199 1). The rat MHC, or RT1 for

rat transplantation antigens, is located on chromosome 20 and shares the mouse gene

17

mgankation: class I (RT1 A), class II @€Tl-H, .B, and .D), ciass III, and class 1 (RT1 E

and .C) (Srivastava et ai,, 199 1).

c, Association with Twe 1 Di-

Susceptibility to IDDM is m ~ s t closely Wed to the class II region of the MHC. in

humans, the strongest positive disease association is specificaily with the HLA-DR3 and/or

-DR4 haplotypes (95% of Caucasian IDDM patients compared with 50% of the genaal

population) (Field, 1988). Numemus serological and restriction fragment length

polymorphism (RFLP) studies have indicateû that genes of the HLA-DQ locus contribute

more m this association than the -DR genes within these haplotypes (Sterkers et al., 1988;

Todd et al., 1988). Several 0th- HLA haplotypes consistently exhibit a negative

association with type 1 diabetes suggesting that the MHC-Iinked gene(s) can confa both

resistance and susceptibility to disease (Ronningen et al., 1989).

When the expressad class II gene products exhibiting some degrce of

polymorphism in humans were sequenced from the cDNA of diabetics and healthy

conaols, a unique sequence exclusive to the patients was not obsmed. However, many of

the haplotypes which positively associateci with lDDM did correlate dirscdy with a

polymorphism in the amino acid sequence of the HLA-DQB chah: susceptibity to IDDM

stmngly associated with the alleles which encodtd an amino acid orher than aspartic acid at

position 57 (Asp 57.) of this chah whik aspartic acid was present (Asp 5 7 9 in al1 of the

alleles which were negatively associated with disease (Td et al., 1987).

Foliowing extensive sequencing of class II MHC aüeles within the Caucasian

population, it was postuiated that Asp 57- homozygosity is necessary, yet not sufficient,

for fidl HLA-susceptibility in the majority of diabetics. 90% of the Caucasian diabetics

whose EEA-DQp deles were sequenced proved to be Asp 57- homozygotes while

individuals who were hetermygous (Asp 57-/Asp 5 7 9 at the HLA-Da chah

Figure 3: Genomic Organization of the MAC in Humans, Miee and Rats.

Genomic maps of the human, mouse. and rat MHC on chromosomes 6, 17, and 20

respectively. The three maps have been aligned to allow for a cornparison of the order of

the hornologous loci in these three species.

Class II Class 1

HLA-8 HLA-C HLA-A

1 centromere telomere

MOUSE

Class 1 Class 1

1- A 1-E H2-D H2-L

I centromere te tomere

RAT

Class 1 Class III Class 1

RT1 .A RT1.H RT1.B RT1.D RT1.E RT1.C

I ce ntromere telomere

20

demonstrated a much lower ri& of developing IDDM. The presence of two Asp 57+ alleles

provided a h t complete nsistance to IDDM (Todd a al., 1987). Sequencing studies in

d e r ethnic groups ais0 supponed this correlation. 'Ihe incidence of type 1 diabetes in

Japan, for example, is 5-10% of its North American couterpart and h s t ali of the HLA-

DQf3 chab alleles in the Japanese population are Asp 57+ (TOM et al., 1988).

It is known that disease developmnt in the BB rat also requires the expression of

specific ciass II alleles. Susceptibility to IDDM is 8SSOCi8ted with th RTlU haplotype of

the class II loci in these d e n t s (Fuks a al., 1988; Ono et al., 1989). Although the rat

MHC contains three class II loci, expression at the œll surface has been contirnicd for the

RT1.B and RT1.D loci only (Natori et al., 1985; Fujii et al., 1991a). Nucleotide

sequencing of the RT1 .Bp dele (HIA-DQb homologue) in diabetes-susceptible BB rats

detennined that position 57 encodes an Asp 57- amino acid (Figueroa et al., 1985;

Holowachuk et al., 1989; Chao et al., 1989). Similar studies in the IDDM-resistant AC1 rat

(RTla) showed that the RT1.BB chah was Asp 57+ in this strain (Fujii et al., 1991b).

The correlation of position 57 with disease susceptibility has bem confinned in the

NOD mouse mode1 of IDDM as well. The class II MHC repertoire of these mice is unique.

Due to a deletion in the 1-Ea chah gene, they do not express 1-E molecules (Acha-ûrbea a

al., 1991). This leaves them dependent upon the 1-A ciass II MHC ~01ecuies (1-A") for

presentation of antigens to C D ~ + T lymphocytes. Squencing of the I-A~* allele revealed

the B chah to be Asp 57- (Acha-Orbea et al., 1987). Homozygosity of this class II

haplotype appears to be necessary for IDDM development as demonstrated by crosses of

NOD mice with a nomial mouse strain voâà et al., 1987).

Several groups have shown that the transgenic expression of an Asp 57+ chah

(eitha in the form of an Asp 57+ LA chah or a functional 1-E molecule) in NOD mice can

prevent the onset of diabetes (Lund et al., 1990, M i y d et al., 1990, Slattery et al., 1990,

and Singer et al., 1993). However, these same researchm also demoastrated that Asp 57+

21

is not essential for protection against disease. When Asp 57- 1 - ~ k molecules were

expressed in transgenic NOD mice, the animais did no< deveIop IDDM (Miyazalâ et al.,

1990). A compfementaxy approach in proving that Asp 57+ i s not essential to diseasc

resistance consisteù of changing codon 56 of 1-A- h m histidiw to prohe (the ariiino

aciâ found in 1-A~) in transgenic NOD mice. This single substitution conferred dominant

protection against IDDM in Asp 57- chahs (Lund et al., 1990).

While these studies do show ihat Asp 57+ is not sufEcient for IDDM-resistance.

they do not p v e that its presence is not imponant. The coizelation between pndisposition

to IDDM and residue 57 of the chah is tao stmng to be irrelevant. (hie p s i b i l e

explanation for the insuffsciency of position 57 to account for ai l of the MHC-linked

susceptibility or resistance to type 1 diabetes is drat this amino acid is a tnarker for another

closely iinked gene nodd, 1990) presumably also located within the class II loci.

It was hypothesized that this "other gene" c d be found w i h the HIA-DQa

locus. Because the a and chahs are interdependent, it was thought that the a genes could

contribute to discase susceptibility by combining with HLA-Da molecules m generate

unique a,@ he t e m i h m capable of triggering die autoimmune destruction of pancreatic

beta celis (Field, 1988). Indeed, when the a chah deles were tested for linkage

disequiiitnium with IDDM, the results supparted the involvement of HLA-DQa in disease

(Khalil et al., 1990). Specifically , the presence of an arginine at position 52 of the a chab

associateci with susceptibility to IDDM. The greatest nsk of developing type 1 diabetes is,

therefore, obsaved in iadividuals with heterodimers which are Arg 52+ HLA-DQa / Asp

57- HLA-DQp (Khalîl et al., 1992).

22

1.7 Obiectives

Our laboratory has chosen to study IDDM in the BI3 rat. The RTlU class II

haplotype of these animals is associated with the greatest risk of developing IDDM.

Breeding studies have shown that male and female rats of R T P haplotype in

heterozygosity with either RT 1 l or RT 1 readily develop IDDM. However, animals having

one R T P haplotype in combination with an R T P haplotype are rarely diabetic (Fuks et al.,

1990). The sequence data from other species discussed above suggests that this protective

mechanism in the rat could be explained by polyrnorphisms in one or more of the claîs II

alleles, particularly the a and P genes of the RT 1 .B locus. Sequence data for the rat class II

genes have been reported but not studied thoroughly enough to permit the cornparison of a

senes of RT 1 .B and RT 1 .D a and alleles. As a result. assessing the contribution of class

ï I polymorphisms to MHC-encoded IDDM resistance or susceptibility has been difficult.

This study, therefore, determined nucleotide sequences in the relevant regions of a

and p chains at both the RT 1 .B and RT 1 .D loci from five rat sirains of varying disease

susceptibility. We sought to determine whether the relative resistance of heterozygous

RT lu anirnals canying an RT la haplotype - compared with those bearing RT lb or RT 11 -

could be explained by sequence differences of their corresponding class II alleles. It was

hypothesized that the alleles which permit diabetes in heterozygosity with R T P would be

found to have arnino acids other than aspartic acid at position 57 of one or both P chains

while the protective RT la haplotype would have an aspartic acid residue at position 57 of

one or both fi c h a h . Additionally, it was postulated that the increased susceptibility

observed in the RTlu haplotype is due to the presence of an arginine at position 52 of one

or both of the complementary cx chains.

2. Materials and Methods

2.1 Rats

DNA samples from the following 6 rat strains were used in these experiments: AC1

(RTla), BB (RTIU) , Buffalo (RTlb) , DA (RTP) , Lewis ( ~ ~ 1 1 ) , and Wistar-Furth

(RT 1 U) .

2.2 Pre~arationofDNA

High molecular weight DNA was extracted from spleens previously excised from

the rats and stored at -800C. A small piece (approximately 1 cm3) of tissue was placed in 5

ml of phosphate-buffered saline (PBS) and disrupted through a wire sieve using a glass

pestle. 0.5 ml of 5 M NaCl and 0.25 ml of 10% sodium dodecyl sulfate (SDS) were added

to the ce11 suspension and the mixture was incubated on ice for at least 10 min. Nucleic acid

was isolated from contarninating proteins via a series of phenoVchloroform and chloroform

extractions. The DNA, in aqueous phase, was precipitated in 10 ml of ethanol and

resuspended in 1.5 ml of 10 m . Tris-HCI and 0.1 m . EDTA, pH 7.5.

2.3 Polvmerase Chain Reaction

Genomic DNA sarnples prepared from the various rat strains were subjected to

polymerase chah reaction (PCR) amplification using a PTC- 10TM programmable thermal

controller. The reactions were carried out in 50 pl aliquots containing: approxirnately 1p.g

of genomic DNA; 0.5pM of each oligonucleotide primer (see Table 1); 400p.M each of

dATP, dCTP, dGTP, and dTTP; the reaction buffer recommended by the manufacturer

containing 10 rnM KCL, 10 m M (NH4)2SO4, 20 mM Tris-HCI (pH 8.8 at 250C). 2 rnM

MgSOq, and 0.1% Triton X-LOO; and 0.25 Unit of VENT DNA polymerase (New England

Biolabs). After an initial incubation at 94OC for 3 min. 33 cycles of amplification were

24

carried out, each consisting of denaturation for 1 min at 940C, anneaiing at 530C for 1

min, and a 30 sec extension at 720C followed by a final 10 min extension at 720C. The

PCR products were analysed by electrophoresis through a 3% NuSieve GTG agarose low

melting-temperature gel (FMR) in Tris-borateEDTA (TBE) buffer and visuaiized by

ethidium brornide staining. The DNA of desired length was cut out of the gel and extracted

from the agarose. Using the pCR-Script SK(+) cloning kit (Stratagene), each purified,

bluntended fragment was then cloned in preparation for sequencing.

2.4 Seauencing

Dideoxy sequencing was performed using a T7 sequencing kit (Pharmacia) and

3%-labeled dATP (NEN). The products of these reactions were electrophoresed on 8M

urea, polyacrylamide gels. The gels were dried and exposed ovemight. X-ray films were

developed and the target sequence was read from the radioautograph. Sequences were

confirmed by analysis of both DNA stcands from at least two clones.

2.5 PCR Amoli fication of RT 1 .Do cDNA

Total RNA was isolated from a srnail piece of spleen tissue homogenized in a Pro

polytron fitted with a 7 mm X 75 mm generator (Diamed) following the single step method

described by Chomczynski et al. (Chomczynski et ai., 1987) cDNA synthesis was carried

out using approximately 5pg of total RNA incubated at 370C for 1 hour with reverse

transcriptase and random hexarner primers (Gibco) under the recommended reaction

conditions. The products of this reverse transcription were then subjected to PCR

amplification (as previously described) using the appropriate primers €rom Table 1. This

selectively-amplified DNA ffagment was then cloned and sequenced.

25

2.6 Southern Blot Analvsis

IOpg of genomic DNA were digested ovemight with a 2-fold excess (20 units) of

the restriction endonuclease, ScaI (Gibco), in the React 6 buffer specified by the

manufacturer. The following day the digested DNA was ethanol precipitated and

resuspended in 12p1 of TE (pH 7.5). Before loading on a 1 % agarose gel, each sample was

heated at 700C for 10 min. The restriction fragments were separated by electrophoresis at

35 V for 18 hours in a 1X TAE buffer (0.04 M Tris-acetate and 0.001 M EDTA). After

electrophoresis, DNA fragments were transferred to a Hybond-N membrane (Amersham)

by the method of Southem. The membrane was baked at 800C for 20 min and briefly

exposed to UV light to cross-link the DNA. Prehybridization was performed in the

presence of competing, nonspecific salmon sperm DNA at 42OC for at least 4 houn in a

preannealing buffer containing: 50% deionized formamide, 5% SSPE (O. 18M NaCl,

O.OlM Naphosphate pH 7.7. and 0.001M EDTA), 0.5% SDS, 5% Denhardts solution,

and approximately LOO pg/ml of denatured salmon sperm DNA. At the time of

hybndization, this prehybridization buffer was discarded and replaced by a sirnilar solution

containing a 32~-labeled heat-denatured probe. The membrane was incubated with this

probe for 15 hours at 420C. Following hybridization, a series of washes were performed

to remove non-specific hybridization (2 15-min washes in 2 X SSPE and 0.1% SDS at

room temperature; 1 15-min wash in 1 X SSPE and 0.1% SDS at 60°C; and 1 10-min

wash in 0.1% SSPE and 0.1% SDS at 600C) before the membrane was subjected to

radioautography .

2.7 DNA Probe

The Southern blot was probed with a 225 bp fragment derived from a PCR-

amplified RT 1 .DpU clone. 25 ng of the probe was labeled with 50pCi a - [ 3 2 ~ ] dCTP

(NEN) by random hexanucleotide priming (Quick Prime kit, Pharmacia).

26

2.8 Allele-S~ecific Olieonucleotide SJot Blots

Using the PCR conditions previously described and primer pair #2 (see Table 1), a

237 bp fragment within the RT 1 .Bp locus was amplified from genomic DNA of RT la,

RT ln, and RT@ anirnals. Following ethidium brornide fluorescent quantification,

approxirnately lOOpg of each PCR product was blotted ont0 a nylon membrane (Amersham

Life Science) using a vacuum apparatus. This blotting procedure was repeated and the two

duplicate membranes were then baked at 800C and UV cross-linked before

prehybndization for 2 hours at 550C in a buffer containing: 6X SSC10.05% sodium

pyrophosphate (PPi). 0.5% SDS, 5X Denhardts, and LOOpg/ml denatured salmon sperm

DNA. The membranes were probed ovemight with either an RTla-specific (5'-

GTCCGGCCGCCCCAGCTG-3') or UT LU-specific (5'-TGAGGGCCGCCCCAGCTC-

3') y-[32P] dATP-labeled oligonucleotide in a hybridization solution containing: 6X

SSC/O.OS% PPi, LX Denhardts, and 1OOpglml denatured salmon sperm DNA. Non-

specific hybridization was removed by 1 15-minute wash in 6X SSC/O. 1% PPi at room

temperature followed by another wash at 5g°C for 90 minutes. Membranes were then

radioautographed.

Table 1 Nucleotide Seauence of Primers*

Locus Primer Seauence Amino Acid Position

3 . R T L B ~ w i t h

E c o R I site

CAGTATCATGAATCCAAAGGCC

GACAGCTGGGGTTGAATTTG

C(A/T)CCAACGGGACGCAGCGCAT

TCAAGCCGCCGCAGGGAGGTG

AAGAATTCAGA(T/C) ( M G ) C ( A / T ) TCTACAAC (C/A)GGGAG

AAGAATTCCTCGTAGTTGT (G /A) TCTGCA (G/C ) ( M G ) C

TTTGACTTTGACGGCGACGA

CTGGGGTGTTGTTGGAGCG

TCATTTCTACAACGGGACGC

AGGAA (G/T) CTATCA (A/G) A(A/G) ATCTCG

* The fonvard primer is listed first and the reverse primer second, both shown in the 5' to 3' orientation. PCR pnmers were designed from previously published class II RT 1 sequences. The oligonucleotides were generated with an Expedite 8909 DNA synthesizer (Perspective Biosysiems).

3 .O Results

3.1 Determination of the partial nucleotide quence for the 1 st domain of RT 1 .Ba

Sequences determined from the five rat strains are shown in figure 4. While the 2 10

nucleotide-long sequence was identical in anirnals of RTIU haplotype (BB and WF), these

R T P sequences differed from those of the three non-u haplotypes at a number of positions

throughout the first domain. No polymorphism was observed at residue 52 among the five

rat strains; each has a codon for phenylalanine. The predicted arnino acid sequences are

depicted in figure 5 for comparison with their murine (Acha-Orbea et ai., 199 1) and human

(Hom et ai., 1988; Todd et al., 1987) homologs.

3 -2 Determination of the partial nucleotide seauence for the 1 st domain of RT 1 .BP

Alrnost al1 of the 1st domain of RTl.BB was sequenced. BB and WF anirnals

sharing the class iI RT 1 haplotype also shared an identical 237 nucleotide-long RT 1 .BP

sequence (figure 6). In contrast, a high degree of polymorphism exists among the different

haplotypes. Substitutions at codon 57 were of particular interest. RT luvl, and haplotypes

encode serine at this position. Initial difficulties in PCR amplification of RTP genornic

DNA were overcome using a second set of primers interna1 to the original pair. These

nested oligonucletides amplified a sequence which differed drasticaily from the other

haplotypes and had an isoleucine at position 57. To confirm this RTP sequence, the same

pnmers were used to ampli& this region from genomic DNA of the related DA strain and a

rat (C 1232) from our own animal colony whose MHC had previously been typed as R T P

by an independent method. Four such clones were examined and found to be identical in

sequence to the original, five AC1 clones with Ile 57+.

Figure 4: Nucleotide Sequences from the 1st Domain of RT1.Ba in Five

Rat Strains. The predicted amino acid sequence is shown with nurnbers marking their

positions in the mature protein. Dots represent sequence homology and underlined

nucleotides indicate the regions cornplementary to the primers used for sequencing. The

Sprague Dawley nucleotide sequence (Barran et al.. 1987) is also shown for cornparison.

u BE u W F b B u f 1 L e w a AC1

G l n Tyr His G l u S e r L y s G l y G l n Tyr T h r His G l u Phe CAG TAT CAT GAA TCC N4A GGC CAG TAC ACA CAT GAA TTT

. . . . . . TT. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . TT. . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . TT.

d SD(Barran et al) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

40 A s p G l y A s p G l u Arg P h e T y r V a l A s p L e u A s p L y s L y s G l u T h r Ile T r p Arg GAT GGT GAC GAG AGA TTC TAT GTG GAC TTG GAT AAG AAG GAG ACC ATC TGG AGG

50 60 I l e P r o G l u Ph0 G l y G i n L e u T h r Ser Phe A s p P r o G l n G l y A l a L e u G l n Ser ATC CCC GAG TTT GGA CAA CTG ACA AGC TTT GAC CCC CAA GGT GCA CTT CAA AGT

70 80 I le A l a T h r Ile L y s Tyr A s n L e u G l u I le L e u T h r L y s Arg Ser A s n Ser T h r ATA GCT ACA ATA AAA TAC AAT TTG GAA ATC CTG ACG AAG AGG TCA AAT TCA ACC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .T. . . . . . . C . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . C-. . . . . . . . . . . . . . . . .T. . . . . . . . . . . . . . . . . . . . . . . . . .T. . . . . . . C , . . . . . . . . . . . . . . . . .T. . . . . . . . . . . . . . . . . . .

Pro A l a V a l CCA GCT GTC

Figure 5: Cornparison of the 1st domain amino acid sequences for RT1.Ba

alleles and their human (Todd et al., 1987; Horn et al., 1988) and mouse

(Acha-Orbea et al., 1991) homologs. The single-letter amino acid code is used.

Exon 1 of HLA-DQa encodes four arnino acids of the 1st domain (compared with five

residues in RT1.Ba and 1-Aa) so human sequences were shifted one amino acid for

purposes of alignment

20 30 40 u Q Y H E S K G Q Y T H E F D G D E R F Y V D L D K K E T b t l , a . . . . . . . . . . F . . . . . . I . S . . . . . . . N d . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-AtX NOD S P G D I . . . . . . . . . . . L . . . . . . . . K .

. . . . . . . . . . . . . . 1-ACX NON S P G D I : , . . . F . L . HLA-DQa DR4 . S Y G P S . . . S . . . . . . . E . . . . . E R . . . HLA-DQa DR2 . F Y G P S . . . . . . . . . . . Q . . . . . E R . . .

50 I W R I P E F G Q L T S F D

80 R S N S T P A V

60 70 P Q G A L Q S I A T I K Y N L E I L T K . . . . . . N . . I . . H . . . . . M .

R N . . I H . . . . . M . . . . . . . . G . . N . . A E . H . . G . . * . . . . G . . E . , . G . . * * . . . I . . . .

. . F * . T N . . V L . H . . N . V I . R N M . V A . H . . N . M I . . . . . .

33

However, two observations prompted us to resequence this RTl.BP domain from

splenic cDNA using the original extemal primer set: 1) our RTP sequence disagreed with

that previously reported by Fujii et al (Fujii et al, 1991b) and 2) the existence of a

nucleotide substitution at the 3' end of the 2nd intemal primer. A total of eight clones were

exarnined (five using the external primers and three using the internai set). Al1 eight shared

an identical sequence which was completely different from the original RTla genomic

clones but matched the published RT la sequence of Fujii et al encoding aspartic acid at

residue 57. This Asp 57+ sequence was confirmed from two cDNA clones using the sarne

RT 1" haplotype animais listed above. RT lu cDNA was also isolated and sequenced at this

region to ensure that the nucleotide sequence of RTlU cDNA and genomic clones did not

differ. Figure 7 shows an allele-specific oligonucleotide dot blot which both confirms the

sequence data and provides a rapid rnethod for identifjing the MHC class II haplotype of

animals in our ongoing breeding studies.

As can be seen in figure 8, many differences exist between the predicted amino acid

sequences of these five rat strains. Interestingly, our iie 57+ genomic R T P sequence has

an overall resemblance to that of the Sprague-Dawley rat reported by Fujii et al (Fujii et al.,

199 lb). Homologous munne (Todd et al, 1988; Acha-Orbea et al., 1987) and human

(Todd et al., 1988) protein sequences are also given from iDDM-resistant and -susceptible

haplotypes for comparison.

3.3 Detemination of the partial nucleotide sequence for the 1 st domain of RT 1 .Da

The arnino terminal domain of the RT 1 .Da chah was identicai in the five rat strains

we examined (figure 9). Alanine was present at residue 52 in al1 alleles. Once again, mouse

and human RT1.Da homologs (Holowachuk et ai., 1987) are given for compatison (figure

10).

Figure 6: Nucleotide sequences from the 1st domain of RT1.BB in five rat

strains. Asterisks at codons 65 and 67 indicate deletions. Underlined regions represent

the original set of primers while the second, interna1 primer pair is shown in italics. Primer

degeneracy is not depicted.

haglotype/strain

20 T h r A s n G l y Thr G i n Arg I l e Arg A s n

u BB C ACC AAC GGG ACG CAG CGC ATA CGG AAT u W F . . . . . . . . . . . . . . . . . . . . . . . . . . . . b B u f . . . . . . . . . . . . . . . . . . . .G ... CTC 1 Lew . . . . . . . . . . . . . . . . . . . . . . . . . G , . a AC1 genomic DNA a AC1 cDNA . . . . . . . . . . . . . . . . . . . . . . . . . GG.

3 0 Val Ile Arg Tyr GTG ATC AGA TAC . . . . . . . . . . . .

. C . C . . -.. ...

40 Ile Tyr A s n Arg Glu Glu Tyr Leu Arg Tyr A s p Ser A s p V a l G l y G l u Ty r Arg ATC TAC AAC CGG GAG GAG TAC CTG CGC TAC GAC AGC GAC GTG GGC GAG TAC CGC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G . . .T. C . . . . . . . . . . . .A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T.. . . . . . . . . . . . . . . . . T . GC. ... .T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

50 A l a Val GCG GTG

S . . S . .

... C..

. . . C..

. . . . . .

. . . C . .

60 Thr G l u Leu G l y Arg Pro Ser A l a Glu T y r ACC GAG CTG GGG CGG CCC TCA GCC GAG TAC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

AG. AT. ..G . . . . . . . . . . . . . . . . . . . . . ... C . . . . . . . . . . . ..G CIAC . . . . . . . . .

7 0 L e u Glu Arg T h r Arg A l a G l u Leu A s p T h r

* * * CTG GAG CGG ACG CGG GCC GAG CTG GAC ACG * * * . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . * * * . . . S . . .A. . . . . . . . . . . . . . . . . . . .G. * * * . . . . . . . A . . . . . . . . . . . . . . . . . . . . . .

. . . . . . TTC A . . ... .A, G . . . . . . . . .C. G..

. . . . . . . . . . . . . . . * * * . . . . . . .A , C . . G . .

P h e A s n Lys G l n Tyr TTT AAC AAG CAG * * * TAC . . . . . . . . . . . . * * * . 2 .

. . . . . . . . . GG T * * * . . * * * * . . . . . . . . . . . . ...

. . G ... . . A . . . AAG G.G . . . . . . . . A . .A *** . . -

90 L y s Thr G l u Val P r o T h r Ser Leu Arg Arg Leu AAG ACA GAG GTC CCC ACC TCC CTG CGG CGG CTT GA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . GG. C . G . C . CGT . T . GG. T . G . . . . . . .G. . . . . . . . . . . . . . . . . . . . .

80 V a l C y s Arg H i s A s n Tyr G l u GTC TGC AGA CAC AAC TAC GAG

. . . . . . . . . T . . . . . m . . . . .

A . . . . . . . . . . . . . . . . . . . .

G . . . . G . . . . . - . . . - . - . . . - S . . . . . . . . . . . .

Figure 7: Allele-Specific Oligonucleotide (ASO) Slot Blots. An example of

slot blot hybridization between RT P- or RT 1"-specific oligonucleotides and PCR-

amplified genomic DNA from AC1 (slot A), BB (slot B), and FI (slots C and D) anirnals.

Membranes 1 and 2 were hybridized with RT la- and RT I U-specific probes, respectively.

Figure 8: Cornparison of the 1st domain amino acid sequences for RTl.BP

alleles (Sprague Dawley sequence from Fujii et al., 1991b) and their human

(Todd et al., 1988) and mouse (Acha-Orbea et al., 1987; Todd et al., 1988)

homologs.

hapla type

u b 1 b (SD) a genomic a cDNA 1-AP NOD 1-AB NON HLA-DQB DR4 HLA-DQP DR2

20 30 40 T N G T Q R I R N V I R Y I Y N R E E Y L R Y D S D V . . . . . . M . L . T . H . - . . . . . V . F . . . L

. . . . . . . . . . . . . . . . D . . . . Q . . * . . . . . . . . . . . . . . . S . D . R F - . Q . . F . .

C F F A . F e - . . . . . . . . . . . . . . . . . . . . . G . . . . . . . . . . . V .

L . T . F . . . . S . . . . . . . . - . S . . . . . .

. . . . . . . S . T . N . . . . . . . . . . . . - E . V . L . T . - . . . . . . . A . F . . . . . . . . E . V . L . T - . . . . . . . . A . F . . . .

50 60 70 G E Y R A V T E L G R P S A E Y F N K Q * Y f L Q R T R A E L D T V C . . . . . L . . . . . . . . . . W . . . - . . . . Q . . . . . . R . .

. . . . . . . . . . S . . . . L . . . . . . . , . Q . . . . . . . . . . . F . . L . . . . . S W . D D W . S . K E 1 . E Q K . . . M . . . . . . . . . . . . . . . S I . . . L . . . K E F M . Q A . . A V . . I . . . . . L . Q . . . . b . . . Y . . . . . . . . Q . - . Q V . . . . . . . . . . . . . . . H . . . . Y . . . . . . . E . . - . - . . . A .

S D . . E Q . . . A . . . . . . . . . . . . . . . . . . . - . * . . . . . . . . . . . . V . . . . . P . . P . A . . . W . S . K E V . E

. . V . . . P Q . . . D . . . W . S . K E V . E G . . . . . . . . .

80 90 R H N Y E K T E V P T S L R R L

. . . . . . Y . . , G P A R L

. . . . . . . . . . . G S . . R

. . . . . . Y . . . E * . . .

. . . . . E . . . . . . . . * . . . . E . . . . . . . . . .

. . . , Q L E L R T . L Q . .

. . . . . V A F R G I L Q . .

Figure 9: Nucleotide sequences from the 1st domain of RT1.Da in five rat

strains. The nucleotide sequence previously reported for the RTLU haplotype

(Holowachuk et al.. 1987) is shown for cornparison.

u BB U W F

b B u f 1 Lew a AC1

u ( H o l o w a c h u k )

30 P h e Asp P h e A s p Gly Asp Glu Ile P h e His Val A s p Ile TTT GAC TTT GAC GGC GAC GAG ATT TTC CAT GTA GAT ATT

40 50 L y s L y s Ser Glu T h r I l e T r p Arg Leu Glu G l u Phe Ala Gln P h e Ala Ser P h e AAA AAG TCA GAG ACC ATC TGG AGA CTT GAA GAA TTT GCA CAG TTT W C AGC TTT

. . . . . . . . . . . . . . . ..T . . . . . . . . . . . . . . . . . . . . . A.. . . . . o . . . . . . .

60 70 Glu Ala G l n G l y Ala Leu A l a A s n I le A l a Val Asp Lys Ala Asn Leu Asp Ile GAG GCT CAG GGT GCA TTG GCT AAT ATA GCT GTG GAC AAA GCT AAC CTG GAC ATC

80 Met 11e Lys Arg S e r A s n A s n Thr P r o ATG ATA AAG CGC TCC AAC AAC ACC CCA G

Figure 10: Comparison of the 1st domain amino acid sequences for

RT1.Da alleles and their human and mouse homologs (Holowachuk et al.,

1987)

30 40 U, b, 1, a F D F D G D E I F H V D I K K S E T I W R L E E F A u ( Holowachuk) . . . . . . . . . . . . . . . . . . . . . . . . . . I -EC@ . . . . . . . . . . . . . E . . . . . . . . . . . .

. . . . . . . . . . . . . . HLA-DRff M A . K V . . . . . . G

50 60 7 O 80 Q F A S F E A Q G A L A N I A V D K A N L D I M I K R S N N T P L . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . K . . . . . . . . . . . . . . . . . . . . . V . K E . . . . . . R . . . . . . . . . . . . . . . . . . . . E . , T . . . . Y . .

44

3.4 Determination of the ~artial nucleotide seauence for the 1 st domain of RT 1 .D@

RT 1 .DB chain nucleotide sequences were identical for the BB and Wistar-Furth rat

strains (RTP haplotype). The difTerent haplotypes that we examined exhibited a high

degree of allelic polymorphisrn thoughout the 1st domain (figure 1 1). Except for the RT lb

haplotype which is Asp 57+, all alleles code for serine at this position. RTLa genomic DNA

yielded two P chah sequences that differed by only one nucleotide. Of the ten RT La clones

sequenced, four encoded arginine at position 48 whiie the rernaining six clones had a C to

T substitution at the first nucleotide of codon 48 that would predict an arginine to cysteine

substitution in the amino acid sequence. Two clones sequenced from a second AC1 animal

showed the same heterogeneity: one king Cys 48+ and the other, Arg 48+. A further four

clones were sequenced from the related DA strain. They too were split 5050

(Arg48+:Cys48+). These ambiguous results prompted us to obtain sequences from RTla

cDNA. Nine such clones were sequenced from AC1 splenic cDNA dong with three RT lu

cDNA clones from a BB animal. Al1 twelve clones encoded arginine at residue 48.

Because the C to T substitution observed at codon 48 creates a novel ScaI site in

RT l a genomic DNA, the sequencing results were confirmed by a Southern Blot of

genomic RTP and RTP DNA digested with this restriction endonuclease and probed with

a 32~-labeled RT 1 .DPU clone. This blot shows a different restriction pattern for the two rat

strains (figure 12). Figure 13 compares the predicted amino acid sequences of the five rat

strains presented in this paper and mouse ( Acha-Orbea et al., 199 1) and human (Hom et

al., 1988; Todd et al, 1987) RT 1 .DP homologs.

Figure 11: Nucleotide sequences €rom the 1 s t domain of RT1.DP in €ive rat

strains. Primer degeneracy is not shown.

u BB u W F b B u f 1 Lew a AC1

20 H i s P h e T y r A s n G l y T h r G l n Arg V a l Arg L e u L e u A l a

T CAT TTC TAC AAC GGG ACG CAG CGC GTG CGG CTT CTG GCC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A ... A , . TA. ... ,A. . . . . . . . . . . . . . . . . . . . . . . . . A . . C ... T . . . . . . . .

30 40 Arg L e u I le Tyr A s n A r g G l u G l u Tyr A l a Arg P h e A s p Ser A s p V a l G l y G l u AGA TTA ATC TAC AAC AGG GAG GAG TAC GCG CGC TTC GAC AGC GAC GTG GGC GAG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .AC T . . . . . . . . C . . . . . . . . . . . . . . . . . . A . . . . . . . . . . . . . . . . . T . ... .AC . . . . . . . . . C . . . . . . . . . . . A . . . . . . . . . . . . . . . . . . . . . . . . . .

50 60 Tyr A r g A l a V a l T h r G l u L e u G l y Arg P r o Ser A l a G l u T y r Arg A s n L y s G l n TAC CGC GCG GTG ACC GAG CTG GGG CGG CCC TCA GCC GAG TAC AGG AAC AAA CAG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G DM: T . . .GC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . TAT . . . . . . . . .

70 80 L y s G l u Phe Met G l u Arg Arg Arg A l a A l a V a l A s p Thr Tyr C y s Arg H i s A s n AAG GAG TTC ATG GAG CGG AGG CGG GCC GCG GTG GAC ACG TAC TGC AGA CAC AAC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A . . C.. . . . . . . .A . . . . . . . .A. T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .A. . . . . . . .A. TT . . . . . . . A , . . . . . . . . . . GC. ... . A . . . . G . .

90 Tyr Glu I le Ser A s p Ser Phe TAC GAG ATT TCT GAT AGC TTC CT

In R T l a g e n o m i c DNA roughly half of t he sixteen clones sequenced were observed t o have a C a t t h i s pos i t ion while the other half had undergone a C t o T m u t a t i o n . Nine RTla cDNA clones wexe then sequenced and al1 had a C at t h e 1st pos i t ion of codon 48 .

Figure 12: Southern blot analysis of ScaI-digested DNA from AC1 and BB

rat strains. Arrows indicate the sizes in kilobases of the restriction fragments. We

propose that the 7.7 kb fragment seen in the BB rat represents a pseudogene. This

pseudogene is also present in the AC1 rat but is cut into two fragments (5.1 kb and 1.4 kb)

due to a novel ScaI site created by the C to T mutation at codon 48 which was observed in

the genomic sequence. The 900 bp fragment seen in both rat strains is the expressed

RTl.DB gene.

Figure 13: Cornparison of the 1st domain amino acid sequence for RT1.DB

alleles and their human (Todd et al., 1987; Horn et al., 1988) and mouse

(Acha-Orbea et al., 1991) homologs.

U

b 1 a NON 1-EP NOD 1-EP HLA-DR2 ~ w 2 pl HLA-DR~BI

20 H F Y N G T Q R V R L L A R . . . . . . . . . . Y - D . . . S . . . . . . . F . . . . . . . . . . . . . . . . . . . . . . . . . . . F . E . . . . . . . . . . . F . K . . . F . . . E . . . F . H . F . . E . . . F . D .

30 L I Y N R E E Y A R Y F . . . . . . . . Y . . . . . . . T .

40 50 60 F D S D V G E Y R A V T E L G R P S A E Y R N K Q K E F M E Y . . . . . V . . . . . . . . . . D . . . W . S . . . I L .

. . . . . . . . . . . . . . . . . F . , . Y . . . . . Y . . . . . . . . . . * . . . . . . . . . . . . . . . . . . . . .

0 . . . W . S . P . I L . . . . . . . . . . . . . . . . . . . . . . . . . F . . . . . . . . . D . . N W - S . P . I L .

D . . . W . S . . D . L . . . . . . . . . . . . . . . . . . D . . . W . S . . D I L . . . . . . . . . . . . . . . . . .

80 V D T Y C R H N Y E I S D S F L . . . . . . . . . . . . . . * . . A . K . D . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F . N . . . . . . . . . . . . F . N . . . . . . . . . . G V G E . .

G V V E . . . . . . . . . . .

R A A . . E . . T

*1n genomic R T ~ ~ clones this position was heterozygous for cysteine and arginine but when sequenced frorn cDNA it was repeatedly found to encode an arginine

4.0 Discussion

More than a decade after the association of IDDM with the MHC, research aimed at

identibing the diabetes susceptibility gene(s) within this region continues. Sequencing of

human and murine class II MHC alleles from haplotypes positively- and negatively-

associated with IDDM identified oniy one polymorphism in the P chain which consistently

correlates with disease: position 57 in non-diabetogenic d e l e s encodes aspartic acid while

diabetogenic P chains have a codon for a non-aspartic acid, non-charged residue (Acha-

Orbea et al., 1987; Todd et al., 1987). These observations provided a molecular basis for

IDDM susceptibility that, in humans, was extended to encompass the a chah of class LI

antigens. Individuals at the greatest nsk of developing IDDM were found to be those whose

class II heterodimers are Arg 52+ dAsp 57- (Khalil et al., 1992).

Studies in the rat have revealed that sirnilar sequence polymorphisms at position 57

of the RTl.BP chah also seem to mediate susceptibility or resistance to IDDM (Fujii et al.,

1991b). However, because class II MHC sequence data are not as abundant for the rat as

for either the human or mouse, assessing the contribution of other class II RTI

polymorphisms to IDDM susceptibility has been diffïcult. This project expanded upon the

previously published rat class II sequences by generating a complete series of allelic

sequences for this animal mode1 of IDDM. To do so, we determined nucleotide sequences

for the relevant regions of a and chains from both RT 1 .B and RT I .D loci in five

diabetes-susceptible or -resistant nt strains. These aileles were then compared with each

other - and with the hornologous human and rnurine sequences - to identify disease-

associated polymorphisms unique to the rat or cornmon to al1 three species. It was hoped

that this would identib specific class II substitutions or sequences which could account for

the different relative resistances of the haplotypes examined.

52

Sequences of the RT1 .Ba chah have not ken previously reported for any of the rat

strains which we examined. Our results showed that BB and Wistar-Furth strains (of the

R T P haplotype) share an identical a chah sequence. When this sequence was cornpared

with those sequences which we determined for the other alleles and with the aiready-

published Sprague-Dawley sequence (Barran et al., 1987) a low degree of diversity was

observed (Figure 4). No correlation was found to exist between residue 52 of the a chah

and predisposition to disease. Interspecies sequence cornparisons at this locus displayed a

higher degree of divenity but did not reveal any a chah sequences which could be

specificaliy associated with IDDM (Figure 5).

At the other class II locus, RT 1 .D, al1 of the haplotypes which we examined shared

an identical a chah sequence (Figure 9). The RTIU allele had previously been published

for this locus (Holowachuk et al., 1987) and it differed from our a chain sequence at two

nucleotides that predict one substitution in the amino acid sequence. These discrepancies

could represent veritable differences between the nucleotide sequences of the two RT lu rat

strains from our respective laboratories (presumably not of the same immediate origin) or,

alternatively, could be artifacts of sequencing. The absence of polymorphism among the

RT1.Da alleles which we examined supports the sequence data for human and murine

RT1.Da homologues (Figure 10) which are known to be the most invariant of the class II

molecules, demonstrating little or no polymorphism (Field, 1988; Holowachuk et al.,

1987). The lack of polyrnorphism between rat strains pre-empted any correlation between

residue 52 of these a chahs and predisposition to disease.

Nucleotide sequences have already been determined for the RTL .BP haplotypes

which we examined, though the sequences published by different groups for a given

haplotype do not always agree. Consequently, while the sequences reported herein are

identical to some of those previously published (Fujii et al., 199 la; Chao et ai., 1989) they

disagree with others (Holowachuk et al., 1989; Figueroa et al., 1988). Once again, our two

53

RT 1 alleles had an identical sequence despite the fact that, overall, the RTl .BP chah

alleles which we (and othea) sequenced were extrernely polymorphic (Figure 6). This high

degree of diversity suggests that generation and maintenance of polymorphism are

functionally important to this region of the class II rnolecule. It follows that the sequence

discrepancies for a given haplotype as reported by different groups are likely real, resulting

from generations of breeding in separate faciiities.

Our results confirmed the association of Asp 57+ with disease resistance first

reported in the rat by Fujii et al.: the RTl.BB sequences of AC1 rats and two other diabetes-

resistant RT? strains wkch we examined were Asp 57+, compared with the IDDM-

susceptible, Asp 57- haplotypes. A practical application of this difference c m be seen in

Figure 7. Based upon the sequence data, two oligonucleotides that span position 57 and

that are specific for either the RT la or RT 1 LI haplotype were synthesized (see Materials &

Methods section for the oligonucleotide sequences). These aliele-specific oligonucleotides

(ASO) can be used to probe slot blots of PCR-arnplified genomic DNA from rats generated

in our breeding studies. This technique provides an accurate, more efficient alternative to

Southen Blots for the class II typing of rat progeny in our animal colony.

We also report a new RTL .BP sequence which could only be detected in genomic

RT 1 a DNA. This novel sequence differed markedly from both the RT 1 a cDNA sequence

and the other alleles examined in this study, dthough it did resemble the R T L ~ haplotype

(Fujii et ai., 1991b) in its absence of deletions at positions 65 and 67 and its increased

polymorphism between residues 55-70 (Figure 8). We are not the first to report evidence of

multiple chah genes at the RT1.B locus. Southem blot analysis of Wistar-Furth genomic

DNA with an HLA-DQB cDNA probe has suggested the presence of several RTL .BP genes

(Scholler et al., 1985). When these same researchers screened a genomic R T P rat library

with the HLA-DQP chah cDNA probe, a positive clone encoding the complete 2nd domain

of the RTl .BP chah was isolated. This sequence showed a far higher homology (93%)

54

with the mouse 1-AP2 gene than with any other 2nd dornain sequence and, therefore, was

dubbed RTI .BB2.

Genomic rat libraries have also been screened with probes from the 1-Aa, 1-AP, I-

AP2, I-Ea, and LEP genes of mice (Diamond et al., 1989). This work identified a number

of positive clones which - by differential hybridization with each of the probes, and by

restriction digest mapping - could by divided into two clusten (corresponding to the RT 1 .B

and RTL .D loci) each containing three class II sequences: two and one a. At the time of

this discovery, the genornic organization of the RT 1 .B and RT 1 .D loci had already k e n

determined by RFLP analysis of intra-RTI recombinant rats (Blankenhom et al., 1985) but

the gene order which this work established did not account for the existence of multiple fl

genes at either class U locus. It therefore becarne necessary to determine the organization of

these a and B genes. The gene order was axertained from experiments in which rnouse

cells were transfected with different combinations of the RT 1 .B and RT 1 .D a and p genes

and then analyzed for class II expression. The transfectants showed that for the RT 1.B

region, the expressed P gene (RT 1 .BP 1) is adjacent to the a gene whereas for the RT 1 .D

locus, the expressed gene is separated from the a gene by RTl.DB2 (Diamond et al.,

1989). Subsequent experiments examined the genomic organization of the RT 1.H locus

(Fujii et al, 1991b). The map which results from these studies -showing al1 of the class II

loci and genes identified to date - can be seen in Figure 14.

The RT l.Bp2 gene has no known protein product and is thought to be a

pseudogene (Scholler et al., 1985; Diamond et al., 1989). The novel sequence which we

observed in genomic RTP DNA is not homologous to the reported sequence for RTl .BP2

and, therefore, may represent another pseudogene of this locus. Alternatively, it may be the

sequence of a p gene from the upstrearn, non-transcribed RT 1 .H locus. This would only be

possible if there was a high enough degree of homology between the RTl .B and RT 1 .H

Figure 14: The a and P gene order within the class II loci of the rat MHC.

a a

centromere telomere

57

loci to allow the RTl .B P-specific primen to anned to the RT1.H region during PCR

amplification.

Regardiess of its origin and the fact that it is non-transcribed, the pseudogene which

we detected in the RT1.B locus could stiil be an important component of the rat MHC. The

observed preservation of pseudogene nucleotide sequences throughout evolution is thought

to reflect this importance (i.e. - 93% homology between the seqeunces of RTL.BB2 and I-

AP2 (Scholler et d., 1985)). Gene conversion refers to the intra-locus (or inter-loci)

recombination of a short segment of DNA between two alleles and is one of the proposed

rnechanisms in which pseudogenes operate to enhance polymorphism at MHC loci (Erlich

et al., 199 la; Erlich et al., 199 lb; Marx, 1982; Gyllensten et al., 1990). Pseudogenes

permit the MHC to maintain allelic diversity through the conservation of multiple copies of

similar genes. Sequence exchanges between these "dormant" genes and expressed alleles

generate new MHC molecules. Evidence of such sequence exchanges can be seen in

cornparisons of the allelic RTl sequences with their homologues in closely- and distantly-

related species. The observed "patchwork pattern" of polymorphism (Le. - figures 6 and

13), with sequence conservation in certain regions and a high incidence of polymorphism in

others, is characteristic of gene conversion . The final region of the rat MHC which we examined was the RTLDP chain.

Sequences of the RTlU haplotype (BB and Wistar-Furth rats) were identical here, as they

were at every other locus. In contrast to this shared RT l u sequence, a high degree of

polymorphisrn was observed among the RT 1 .Dp chain aileles of different haplotypes

(Figure 1 1). Our RT 1 .DU and RT 1 .DI P chah sequences were not identical to those RT LU

(Chao et al., 1989; Holowachuk et al., 1989; Robertson et al., 1985) and ~ ~ 1 1 (Chao et

al., 1989; Holowachuk et al., 1989) haplotypes previously reported by others and, once

again, these discrepancies probably represent real differences resulting from generations of

breeding in separate colonies.

58

It does not appear that residue 57 in the RTl.DP chah associates with IDDM

resistance since both diabetes-susceptibile and -resistant strains code for serine at this

position. However, it is possible that the presence of Asp 57+ in RT 1 .Db molecules affects

the severity of spontaneous organ-specific autoimrnune diseases in other rat strains. The

only allele which coded for aspartic acid at position 57 of RT I .DP belonged to the RTL

haplotype, and it is known that these inbred Buffalo rats are prone to developing

spontaneous thyroiditis (Colle et al., 1985). In contrast to the protective efTect observed at

RTI .BP, an Asp 57+ P chain at the RTL .D locus could conceivably confer susceptibility to

thyroiditis by preferentially binding a select set of peptides which, when presented to T

lymphocytes, induce an autoimmune response against this organ.

Thus, the sequence data suggest that for both class II loci. residue 57 of the chah

is important to the structure and function of the MHC molecule. Modeling studies have

helped to explain how this single difference in the arnino acid sequence of an MHC

molecule could result in predisposition to an autoimrnune disease. As previously discussed,

the three-dimensional mode1 of a class II molecule places residue 57 on the imer-face of the

antigen binding cleft where it is capable of directly interacting with the bound peptide.

Additionaly, it is believed that amino acid substitutions at ihis position can aCfect a/p chah

pairing. A negatively-charged residue (such as aspartic acid) at position 57 of the HLA-

DQP chain is close enough to the a chain residue, Arg 79, to f o m a salt bridge. Non-

conservative substitutions at position 57 of the P chain disrupt this bond. change the class

II structure, and affect its affiinity for binding certain peptides (Todd, 1990). These models

convincingly demonstrate that substitutions within the antigen binding cleft can alter the

MHC structure with pleiotropic effects (i.e. - positive and negative selection in the thymus.

antigen presentation to mature T cells, etc) capable of inducing autoimmunity.

59

Though substitutions at position 57 of either P chah locus may affect the host's

immune response by altering the conformation of the antigen binding cleft, there are amino

acid changes within class II molecules which do not necessarily have functional

consequences. We observed a non-conservative arginine to cysteine change at amino acid

48 in genornic DNA sequences from RT 1 .DU and RT 1 .Da chains, respectively (Figure

I l ) . The underlying cytosine-to-thymine substitution was not observed in any of the nine

RT la cDNA clones which we subsequently sequenced implying that the novel sequence

represented a pseudogene, but the sirnilarity of this pseudogene to the expressed gene led

us to doubt its validity. Fortunately, the single difference in the nucleotide sequence created

a novel ScaI site in the RTla ailele allowing us to confirm the presence of this pseudogene

by Southern blot analysis (Figure 12).

A search of the literature revealed that the same substitution at position 48 has been

studied in T ce11 hybridomas serologically selected for class II 1-AP mutations (Brown et

al., 1990). These experiments determined that the functional properties of such a class II

molecule would be unaffected. In the rat, because it is a pseudogene this Cys 48+ allele

cannot enhance MHC diversity through expression at the ce11 surface. However, this non-

expressed allele may be a duplicate of the expressed RT 1 a P chain allele and gene

duplication is another mechanism of molecuIar evolution which contribu tes to MHC

diversity (Ohta, 1991). Duplicated genes gradually diverge frorn their template to acquire

different functions and, whether they are expressed or exist as pseudogenes, these new

alleles can enhance sequence diversity by the mechanisrns previously discussed.

While this project focused on the role of the MHC in genetic predisposition to

IDDM in the BB rat, it must be remembered that type 1 diabetes is a multigenic,

multifactorial disease. The genetic contribution of the MHC is necessary but not sufficient

for disease development. Therefore, though the polymorphisms in the chah of class II

60

molecules which we identified rnay be important to IDDM susceptibility, they cannot

explain al1 of the genetic predisposition to this disease. In the BB rat, it is known that at

least three loci are necessary for the occurrence of DDM (Fuks et al., 1995) and the most

recent estimate in the NOD mouse is that fifteen other loci contribute to genetic

predisposition (Tisch et al., 1996). Current and future work in IDDM involves identifying:

the other loci which contribute to disease susceptibility (Vyse et al., 1996; Tisch et al.,

1996), the environmental factor(s) capable of triggenng or modulating disease (Bach,

1994), the autoantigen targeted by the autoimmune response (Aguilar-Diosdado et al.,

1994), and the effector mechanisms employed by the immune system to destroy the

pancreatic beta cells (Katz et al., 1995). It is hoped that a better understanding in one or

more of these areas will lead to an effective immunotherapy or irnrnunoprevention for

insulin-dependent diabetes mellitus.

5 -0 Conclusion

Our sequence anaiysis of the rat class II molecules from five rat strains of varying

susceptibility to IDDM: 1) confirmed at the DNA level the results of numerous other

biochemical techniques (Colle, 1990) which have shown the class II gene products of the

RTlU BB rat to be indistinghuishable from those of the parental RT lu haplotype in the

Wistar-Furth strain and 2) identified coding differences between the different haplotypes in

both the a and P chain sequences. We could not identiQ any a chah sequence features

uniquely associated with diabetogenic alleles. While it is possible that the a chain

contributes to disease susceptibility via sequence differences outside of the first domain

(other exons or regulatory DNA regions) it would appear from Our data that the

polymorphic P chains are more important in MHC-linked IDDM susceptibility. We

confirmed the association of Asp 57+ at RTl.BP with resistance to diabetes. Position 57 of

RT1.DB did not seem to aîsociate with IDDM but rnay affect predisposition to other organ-

specific autoirnmune diseases, such as thyroiditis. The sequence data reported here can also

be applied to ailele-specific oligonucIeotide slot blots as an efficient means of typing rat

progeny in our animal colony.

Our results aiso revealed a number of findings relevant to the mechanisms of class ii

diversity. We detected multiple P chain sequences at both the RT 1 .B and RT 1 .D loci that

were restricted to genomic DNA and could represent alleles of the RT 1 .H locus, or RT I .B

and RT1.D pseudogenes. Though not transcribed, such "dormant" genes are capable of

promoting MHC diversity via sequence exchanges with expressed alleles; a concept

supported by comparisons of the allelic RTL sequences with their homologues in closely-

and distantly-related species. This gene conversion, together with natural selection, results

in the MHC variability that is necessary for effective antigen recognition. Paradoxically,

these sarne mechanisms of diversity also generate a l p chah combinations which lead to the

autoirnmune destruction of pancreatic beta cetls.

Abbas AK, Lichtman AH, Pober JS: Cellular and Molecular Imrnunolow. Montréal: WB

Saunders Company, 199 1.

Acha-Orbea H, McDevitt HO: The first external domain of the nonobese diabetic mouse

class II 1-AB chah is unique. Proc. Natl. Acad. Sci. USA. 84: 2435-2439, 1987.

Acha-Orbea H, Scarpeiiino L: Nonobese diabetic and nonobese nondiabetic mice have

unique MHC class II haplotypes. Immunogenetics 34: 57-59, 199 1.

Aguilo-Diosdado M, Parkinson D, Corbett JA, Kwon G, Marshall CA, Gingerich RL,

Santiago JV, McDaniel ML: Potential autoantigens in IDDM. Diabetes 43: 4 18-425,

1994.

Bach JF: Mechanisms of autoirnmunity in IDDM. Clin. Exp. Immunol. 72: 1-8, 1988.

Bach JF: Insulin-dependent diabetes mellitus as an autoimmune disease. Endocrine

Reviews 15(4): 5 16-542, 1994.

Barran PA. McMaster WR: DNA sequence analysis of the rat RT 1 .B a gene.

lmrnunogenetics 26: 56-62, 1987.

Bennett JC, PIum F: Cecil Textbook of Medicine. 20th edition. Montreal: WB Saunders

Company, 1996.

Bjorkrnan PJ, Saper MA, Samraoui B, Bennett WS, Sirominger JL, Wiley DC: Structure

of the hurnan class [i histocompatibility antigen, HLA-A2. Nature 329(8): 506-

512, 1987.

Blankenhom EP, Cramer DV: Orientation of the loci encoding RTL .B polypeptides in the

major histocompatibility complex of the rat. ùnmunogenetics 2 1 : 135- 142, 1985.

Bliss M: The Discoverv of Insulin. Chicago: The U. of Chicago Press, 1982.

Bottazzo GF, Bosi E, Bonifacio E, Mirakian R, Todd 1, Pujol-Borrel R: Pathogenesis of

type 1 (insulin-dependent) diabetes: possible mechanisms of autoimmune damage.

British Medical Bulletin 45(1): 37-57, 1989.

Brown JH, Jardetzky TT Saper MA: A hypothetical mode1 of foreign antigen binding site

of class II histocompatibility molecules. Nature 332: 845-850, 1988.

Brown MA, Griffith IJ, Glimcher LH: Functional and molecular characterization of E A ~ P

mutants is consistent with the predicted three-dimensional structure of class II MHC

molecules. Molec. Irnmunol. 27(7): 645-650, 1990.

Castano L, Eisenbarth GS: Type 1 diabetes: a chronic autoimmune disease of huamn,

mouse, and rat. A. Rev. Irnmunology 8: 647-679, 1990.

Chao NJ, Timmerrnan L, McDevitt HO, Jacob CO: Molecular characterization of MHC

class II antigens (pl domain) in the BB diabetes-prone and -resistant rat.

Imrnunogene tics 29: 23 1-234, 1989.

Chomczynski P, Sacchi N: Single step method of RNA isolation by acid guanidinium

thiocyanate-phenol-chloroform extraction. Analytical Biochem. 162: 156- 159,

1987.

Colle E, Guttmann RD, Seemayer TA: Association of spontaneous thyroiditis with the

major histocompatibility complex of the rat. Endocrinology 1 l6(4): 1243- 1247,

1985.

Colle E: Short anaiytical review: genetic susceptibility to the development of spontaneous

insulin-dependent diabetes mellitus in the rat. Clinical Immunology and

Irnrnunopathology 57: 1-9, 1990.

Crisa L, Mordes JP, Rossini AA: Autoimmune diabetes meIlitus in the BB rat.

Diabetes/Metabolism Reviews 8( 1): 9-37, 1992.

Darnell J, Lodish H, Baltimore D: Molecular Ce11 Biolo9y. New York: WH Freeman and

Company, 1990.

Diamond AG, Hood LE, Howard JC, Windle M, Winoto A: The class II genes of the rat

MHC. Journal of Imrnunol. 142(9): 3268-3274, 1989.

Eccles SJ, McMaster R: DNA sequence analysis of a rat RT 1 class II A P gene.

Immunogenetics 22: 653-663, 1985.

Erlich HA, Gyllensten UB: Shared epitopes arnong HLA class II alleles: gene conversion,

comrnon ancestry and balancing selection. Immunology Today 12( 1 1): 4 1 1-4 14,

1991.

Erlich HA, Gyllensten UB: The evolution of allelic diversity at the primate major

histocompatibility complex class II loci. Human Immunology 30: 1 10- 1 18, 199 1.

Field LL: Invited editorial: Insulin-dependent diabetes meilitus: a mode1 for the study of

multifactorial disorders. Am. J. Hum. Genet. 43: 793-798, 1988.

Figueroa F, Ginther E, Klein J: MHC polymorphism pre-dating speciation. Nature 335:

265-267, 1988.

Fujii H, Kakinuma M, Yoshiki TT Natori T: Mapping and transcriptional properties of RT 1

class II region genes. Transplantation 52(2): 369-373, 199 la.

Fujii H, Kakinuma M, Yoshiki TT Natori T: Polyrnorphism of the class II gene of rat major

histocornpatibility complex, RT 1: partial sequence cornparison of the first domain of

the RT 1 .BB 1 alleles. imrnunogenetics 33: 399-403, 199 1 b.

Fuks A, Colle ET Ono SJ, Prud'homme G, Seernayer TT Guttmann RD: "Immunogenetic

studies of insulin-dependent diabetes in the BB rat." in: Frontiers in diabetes

research. Lessons from animal diabetes II. editors Shafrir E and Renold AE

Montreal: John Libbey and Co. Ltd., 29-33, 1988.

Fuks A, Ono SJ, Colle E, Guttmann RD: A single dose of the MHC-linked susceptibility

determinant associated with the RTL haplotype is permissive for insulin-dependent

diabetes mellitus in the BB rat. Expl. Ch. Immunogenet. 7: 162- 169, 1990.

Fuks A, Colle E. Guttmann RD: Recombinant haplotype bearing the lymphopenia gene of

the BB rat. Exp. Clin. Ixnmunogenet. 12: 48-52, 1995.

Goodfellow PN, Schmitt K: From the simple to the complex. Nature 37 1: 104- 105. 1994.

Greiner DL, Mordes JP, Handler ES, Angelülo M, Nakamura N, Rossini AA: Depletion

of RT6.P T lymphocytes induces diabetes in resistant BiobreedingNorcester

(BBIW) rats. J. Exp. Med. 166: 461-474, 1987.

Guyton A: Textbook of Medical Phvsiolow. 8th edition. Philadelphia: W.B. Saunders

Co., 1991.

Gyllenstein UE3, Lashkari D, Erlich H: Allele diversification at the class II DQB locus of

the rnarnrnalian major histocompatibility cornplex. Proc. Natl. Acad. Sci. USA 87:

1835- 1839, 1990.

Holowachuk EW, Greer MK: Unaltered class II histocornpatibility antigens and

pathogenesis of IDDM in BB rats. Diabetes 38: 267-27 1, 1989.

Holowachuk kW, Greer M, Martin DR: The complete sequence of the MHC class II chah

RTl D a u of the diabetic BB rat: mRNA levels of RT 1 .D a in lymphocytes. Nuc.

Acid. Res. 15(24): 1055 1- 10567, 1987.

Hom GT, Bugawan TL. Long CM, Manos MM, Erlich HA: Sequence analysis of HLA

class II genes from insulin-dependent diabetic individuals. Human ïmrnunology 2 1 :

249-263, 1988.

Iaramillo A, Giil BM, Delovitch TL. IDDM in the NOD mouse: a disease mediated by T

ce11 anergy? Science 55(15): 1 163-1 177, 1994.

Kahn RC, Weir GC: Joslinfs Diabetes Mellitus. 13th edition. Philadelphia: Lea and

Febiger, 1994.

Katz JD, Benoist L, Mathis D: T helper subsets in insulin-dependent diabetes. Science

268: 1 185- 1 188, 1995.

Kaufman IF: The class II molecules of the human and murine major histocompatibility

complex. Ce11 36: 1 - 13, 1984.

Khalil 1, d'Auriol L, Gobet M, Morin L, Lepage V, Deschamps 1, Park MS, Degos L,

Gdibert F, Hors J: A combination of HLA-DQP Asp57-negative and HLA-DQa

k g 5 2 confers susceptibility to insulin-dependent diabetes melfitus. Arnerican

Society for Clinical Investigation 85: 13 15- 13 19, L990.

Khalil 1, Deschamps 1, Lepage V, Al-Daccak R, Degos L, Hors J: Dose effect of cis- and

tram-encoded HLA-DQ a P heterodimea in IDDM susceptibility. Diabetes 4 1:

378-384, 1992.

Kikutani H, Makino S: The murine autoirnrnune diabetes model: NOD and related strains.

Advances in Imrnunology 5 1: 285-323, 1992.

Koch F, Hang F, Kashan A, Thiele HG: Primary structure of rat RT6.2, a non-

glycosylated phosphatidylinositol-linked surface marker of postthymic T cells.

Proc. Natl. Acad. Sci. USA 87: 964-967, 1990.

Kosuda LL, Hosseinzadeh H, Greiner DL. Bigazzi PE: Role of RT6+ T lymphocytes in

rnercury-induced rend autoimrnunity: experimental manipulations of "susceptible"

and "resistant" rats. Journal of Toxicology and Environmental Health 42: 303-321,

1994.

Lund T, OtReilly L, Hutchings P, Kanagawa O, Simpson E, Gravely R, Chandler P,

Dyson J, Picard JK, Edwards A, Kioussis D, Cooke A: Prevention of insulin-

dependent diabetes mefitus in non-obese diabetic mice by transgenes encoding

modified 1-A fl-chain or normal LE a-chain. Nature 345: 727-729, 1990.

Marx IL: Cloning the genes of the MHC. Science 2 16: 400-402. 1982.

Miyazaki T, Uno M, Uehira M, Kikutani H, Kishimoto T, Kimoto M, Nishimoto H,

Miyazaki JI, Yamarnura KI: Direct evidence for the contribution of the unique 1-

ANoD to the deveiopment of insulitis in non-obese diabetic mice. Nature 345: 722-

724, 1990.

Natori T, Fujimoto Y, Ikeda H, lshikawa H, Matsuno Y, Tsuchimoto S, Mizaino K,

Niiyama T, Cramer D, Aizawa M: The RT 1 .B/D-region products defined by rat

monoclonal ailoantibodies. [mmunogenetics 22: 5 1 1-5 16, 1985.

Ohta T: Role of diversiQing selection and gene conversion in evolution of major

histocompatibitity complex loci. Proc. Natl. Acad. Sci. USA 88: 67 16-6720, 1991.

Ono SJ, Fuks A, Guttrnann RD, Colle E: Susceptibility and resistance genes to insulin-

dependent diabetes mellitus in the BB rat. Expl. Clin. Immunogent. 6: 169-178,

1989.

Parfrey NA, Prud'homme GJ, Colle ET Fuks A, Seemayer TA, Guttmann RD:

Irnrnunologic and genetic studies of diabetes in the BB rat. Critical Reviews in

Imm. 9(I): 45-65, 1989.

Parham P: A diversity of diabetes. Nature 345: 662-664, 1990.

Prud'homme GJ, Fuks A, Colle E, Seemayer T, Guttmann RD: Immune dysfunction in

diabetes-prone BB rats. J. Exp. Med. 159: 463-478, 1984.

Rarnensee HC, Friede T, Stevanovic S: MHC ligands and peptide motifs: fust listing.

Irnmunogenetics 4 1 : 178-228, 1995.

Reich EP, von Grafenstein H, Barlow A, Swenson KE, Williams K, Janeway CA: Self

peptides isolated from MHC glycoproteins of non-obese diabetic mice. J.

Immunol. 152: 2279-2288, 1994.

Rich S: Mapping genes in diabetes. Diabetes 39: 13 15- 13 19, 1990.

Robertson KA, McMaster WR: Complete structure of a rat RT 1 Ep chah: extensive

conservation of MHC class II p chains. J. Immunol. 135(6): 4095-4099, 1985.

Rossini AA, Mordes JP, Like AA: Imrnunology of Insulin-dependent diabetes mellitus.

Ann. Rev. Immunol. 3: 289-320, 1985.

Schadewaldt H: The history of diabetes rnellitus. In: van Engelhardt D, ed.: Diabetes. Its

Medical and Cultural History. New York: Springer Verlag, 1987.

Scholler J, Lenrnark A: Isolation of a rat immune response gene identical to an alleged

mouse A class II Pchain pseudogene. Immunogenetics 22: 601-608, 1985.

Singer SM, Tisch R, Yang XD, McDevitt HO: An AB^ transgene prevents diabetes in

nonobese diabetic mice by inducing regulatory T cells. Proc. Natl. Acad. Sci. USA

90: 9566-9570, 1993.

Slattery RM, Kjer-Nielsen L, Allison J, Charlton B, Mandel, TE, Miller J: Prevention of

diabetes in non-obese diabetic 1 - A ~ transgenic rnice. Nature 345: 724-726, 1990.

Srivastava R, Ram BP, Tyle P: Irnmuno~enetics of the Maior Histocom~atibilitv Com~lex.

New York: VCH Publishers, hc., 199 1.

Sterkers G, Zeliszewski D, Chaussee AM, Deschamps 1, Font MP, Friedel C, Hors J,

Betuel H, Dausset J, Levy JP: HLA-DQ rather than HLA-DR region might be

involved in dominant nonsusceptibility to diabetes. Proc. Natl. Acad. Sci. USA 85:

6473-6477, 1985.

Stiller CR: Effects of cyclospotin imrnunosuppression in insulin-dependent diabetes

mellitus of recent onset Science 223: 1362- 1367, 1984.

Stryer L: Biochernistrv. 3rd ed. New York: WH Freeman and Company, 1988.

Tisch R, McDevitt HO: Insulin-dependent diabetes meiiitus. Cell85: 29 1-297, 1996.

Todd JA, Bell Ji, McDevitt HO: HLA-DQP gene contributes to susceptibility and

resistance to insulin-dependent diabetes meiiitus. Nature 329( 15): 599-604, 1987.

Todd JA, Bell JI, McDevitt HO: A molecular bais for genetic susceptibility to IDDM.

Trends in Genetics 4(5): 129- 134, 1988.

Todd JA: Genetic control of autoirnmunity in type 1 diabetes. Irnmunology Today 1 l(4):

122-128, 1990.

Todd JA, Acha-Orbea H, Bell JI, Chao N, Fronek Z, Jacob CO, McDermott M, Sinha AA,

Timmerman L, Steinman L, McDevitt HO: A molecular bais for MHC class 11-

associated autoimmunity. Science 240: 1003- 1009, 1988.

Vyse TJ, Todd JA: Genetic analysis of autoimmune disease. Ce11 85: 3 1 1-3 18, 1996.

Watson JD, Gilman M, Witkowski J, Zoller M: Recombinant DNA, 2nd editon. New

York: WH Freeman and Company, 1992.

IMAGE EVALUATION TEST TARGET (QA-3)

APPLIED IMAGE, lnc a 1653 East Main Street

,=-; Rochester, NY 14609 USA -œ .-- Phone: il W#~-O300 =-= Fu: 71 6/288-5989

O 1993, Applied Image. Inc.. All Rights Reserved