View
218
Download
5
Embed Size (px)
Citation preview
1MCB 140 11/29/06
The genetics of heterochromatin in metazoa
3MCB 140 11/29/06
4MCB 140 11/29/06
Hermann Joseph Muller
1946 Nobel Prize in Medicine:
"for the discovery of the production of mutations by means of X-ray irradiation"
5MCB 140 11/29/06
White wild-type
White mutant
The true meaning of "red eye reduction":
6MCB 140 11/29/0612.14
7MCB 140 11/29/0612.14
8MCB 140 11/29/06
Gene behavior can change depending on where on the chromosome the gene lies.
= “position effect” (bar is the most commonly used example)
“Position effect variegation” (PEV): cell-to-cell variability of expression of a gene that has been relocated to a new position in the genome.
Epigenetic phenomenon:Stable change in expression without change in sequence!
9MCB 140 11/29/06
Enhancer of PEV
Suppressor of PEV
10MCB 140 11/29/06
2 genes:
Su(var)2-5
Su(var)3-9
11MCB 140 11/29/06
12MCB 140 11/29/06
13MCB 140 11/29/06
HP1(Sarah Elgin)
(heterochromatin protein 1)
Identified in a BIOCHEMICAL scheme to discover proteins that are associated with heterochromatin.
14MCB 140 11/29/06
15MCB 140 11/29/06
HP1 = Su(var)2-5
Conserved in humans and in mice(both in terms of sequence and intranuclearlocation!).
biochemistry genetics
Why does HP1 go to places that HP1 goes to?
16MCB 140 11/29/06
“Biochemical epistasis”(T. Jenuwein)
Overexpression of mouse Su(var)3-9 leads to a MASSIVE redistribution of HP1 in the
nucleus of mouse cells.
17MCB 140 11/29/06
Who would have thunk it?
NCBI: Su(var)3-9 contains a domain (the SET domain) that is somewhat similar to, ahem, RUBISCO methyltransferase.
Su(var)3-9 is a HISTONE methyltransferase.
18MCB 140 11/29/06
Histone methylation
19MCB 140 11/29/06
Calling David Duchovny and Gillian Anderson
• Su(var)3-9 was given this name because it was the 9th gene isolated on the 3rd chromosome in a screen for Su(var)s.
• It methylates lysine 9 in histone H3.
This was discovered 18 years after it was named.
20MCB 140 11/29/06
And finally
• HP1 preferentially BINDS histone H3 methylated on lysine 9.
• That’s why Su(var)3-9 determines localization of HP1 to heterochromatin (it methylates histones in heterochromatin).
• At least in fission yeast, and perhaps in worms, this has to do with RNAi.
21MCB 140 11/29/06
22MCB 140 11/29/06
23MCB 140 11/29/06
HP1 HP1
24MCB 140 11/29/06
HP1 HP1 HP1 HP1 HP1 HP1HP1 HP1= = =
25MCB 140 11/29/06
Remembrance of things past:chromatin as an epigenetic vehicle
26MCB 140 11/29/06
Homology(orthologs of heterochomatin proteins in fission yeast, insects, and humans)
27MCB 140 11/29/06
Analogy
Fission yeast, flies, mammals. Budding yeast.
28MCB 140 11/29/06
Nature, October 10, 2002
The polycomb group protein EZH2 is involved in progression of prostate cancer
Varambally et al.
Prostate cancer is a leading cause of cancer-related death in males and is second only to lung cancer. Although effective surgical and radiation treatments exist for clinically localized prostate cancer, metastatic prostate cancer remains essentially incurable. Here we show, through gene expression profiling, that the polycomb group protein enhancer of zeste homolog 2 (EZH2) is overexpressed in hormone-refractory, metastatic prostate cancer. … Dysregulated expression of EZH2 may be involved in the progression of prostate cancer, as well as being a marker that distinguishes indolent prostate cancer from those at risk of lethal progression.
29
From egg to embryo
?
30
31MCB 140 11/29/06
Homeotic mutations (W. Bateson)
“… Not that there has merely been a change, but that something has been changed into the likeness of something else.”
Genetics
Allele
Heterozygous
Homozygous
32MCB 140 11/29/06
wt antennapedia
33MCB 140 11/29/06
34
The segmentation hierarchy
35MCB 140 11/29/06
“Do you have any idea who I think I am?!!”
1. Segment identity is determined by transcription factors.
2. They act on target genes only transiently. Then they go away, and the activity of their targets is maintained by large complexes: Polycomb represses genes, and Trithorax activates them.
3. Nobody knew how Polycomb and Trithorax do this.
36MCB 140 11/29/06
How Polycomb and Trithorax work
37MCB 140 11/29/06
extra sex combs
enhancer of zeste
38MCB 140 11/29/06
E(z) does it
Posted September 13, 2002 – CELL immediate early publication
Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A., and Pirrotta, V. Drosophila Enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell. Published online September 13, 2002. 10.1016/S0092867402009753
Müller, J., Hart, C.M., Francis, N.J., Vargas, M.L., Sengupta, A., Wild, B., Miller, E.L., O'Connor, M.B., Kingston, R.E., and Simon, J.A. Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell. Published online September 13, 2002. 10.1016/S0092867402009765
39MCB 140 11/29/06
40MCB 140 11/29/06
“Influential ideas are always simple. Since natural phenomena need not be simple, we master them, if at all, by formulating simple ideas and exploring their limitations.”
Al Hershey
41MCB 140 11/29/06
Regulation of genes occurs via the interaction of trans-acting factors (proteins) with cis-acting sequences near the genes themselves.
+
stimulus
+
42MCB 140 11/29/06
43
44
Bicoid is the anterior morphogen
45MCB 140 11/29/06
46MCB 140 11/29/06
What democracy, I mean, gene regulation, is really like
• Trans-acting factors do not distribute in the nucleus based on the primary sequence of the genome: some factors fail to bind most genes that have sequences waiting for them, and other factors bind a large number of genes that do NOT have sequences for them
• Even when a factor binds next to a gene, many times, nothing happens; the same factor bound to two different genes can exert diametrically opposite effects
• Most genes in the human genome are under considerable regulatory influence from entities other than “simple” trans-acting factors; these entities include noncoding RNA and modified histones
47MCB 140 11/29/06
Boyer and Young Cell Sept. 23, 2005
Fischle, Wang, Allis COCB 2003
David Allis: “the histone code”
51MCB 140 11/29/06
1963-2000 2000 - …
Henry et al. (11/1/2003) Genes Dev. 17: 2648.
Genetic information
Lac operator
gaattgtgagcggataacaattt
Genetic information
Genetic information
-
+?