Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
1
Materials and Methods
Genetic Mapping Population and Plant Material
Rice (Oryza sativa L.) recombinant inbred lines (RILs) were developed by crossing
indica variety ‘Teqing’ with temperate japonica variety ‘02428’, followed by more
than six rounds of self-pollination (1). The near-isogenic line was isolated from a
BC5F2 backcross population in the ‘Teqing’ background. The indica rice cultivar
‘Teqing’ and the japonica rice cultivar ‘Nipponbare’ and ‘Zhonghua 11’ were used
for genetic transformation. A set of 101 O. sativa and 21 O. rufipogon accessions
collected worldwide were used for the HAN1 haplotyping by Sanger sequencing (2, SI
Appendix, Tab. S5-6). In addition, 572 rice accessions with genomic sequence
information generated by next generation sequencing were analyzed for nucleotide
diversity and used in a selective sweep analysis. Some accessions with known
geographic information were mapped. Information for each accession is provided in
SI Appendix, Tab. S7. Raw sequence data have been deposited in the Genome
Sequence Archive in BIG Data Center, Beijing Institute of Genomics, Chinese
Academy of Sciences, under accession numbers CRA000778, CRA000779 and
CRA000995 and are publicly accessible (http://bigd.big.ac.cn/gsa).
Evaluation of Phenotypes
To test chilling tolerance of rice, 7-day-old seedlings of the RILs and the ‘Teqing’
transgenic lines were cold-treated at 10oC for 4-6 days, while the ‘Nipponbare’ or
‘Zhonghua 11’ and their derived transgenic lines were treated at 4oC for 4-6 days in a
growth chamber (Percival Scientific, Perry, IA). After the plants had recovered at
28oC/25
oC day/night cycles for 3–7 days, the survival rates were determined based on
the percentage of surviving seedlings (3). To test freezing tolerance of Arabidopsis,
12-day-old soil-grown plants of wild type (Col-0), mutant cyp94b3, and
complementary line carrying 35S::HAN1 in the mutant, were freeze-treated at -10°C
for 1.5 h. After freezing treatment, plants were incubated at 4°C in the darkness for 10
h and then transferred to light at 22°C. Survival rates of the seedlings were scored
www.pnas.org/cgi/doi/10.1073/pnas.1819769116
2
visually after 7 d (4). At least three independent experiments were carried out. A total
of 30-50 healthy plants were cold treated in each treatment. The significant
differences between genotypes were analyzed using ANOVA or Student’s t-test.
To evaluate yield-related traits, each line was planted in the experimental fields in
Changsha (28°11’N, 112°58’E) or Sanya (18°09′N, 109°48′E) both in China, and
cultivated following standard agricultural management practices for rice (5). There
were ten plants for each line, and significant differences between genotypes were
analyzed with Student’s t-test.
QTL Analysis and Fine Mapping
Linkage maps were constructed with MAPMAKER/EXP 3.0 software (6). Putative
QTLs were determined using interval mapping in Windows QTL Cartographer 2.5
software (7). LOD thresholds were based on 1,000-iteration permutation tests
(P=0.05). The additive and dominant effects, as well as phenotypic variances (R2)
explained by each QTL, were estimated from the peak LOD score. The 95%
confidence interval for each QTL was determined by the left and right points having a
LOD value of 2 points below the peak point (8). Thirteen extremely cold-sensitive
RILs with <5% survival rate and 10 extremely cold-tolerant RILs with survival
rate >85% were genotyped using the newly developed markers around the primary
HAN1 mapping interval, and HAN1 was fine-mapped to an 871-kb interval.
To fine-map the interval containing HAN1, we genotyped a total of 3,000 BC5F2
individuals derived from BC5F1 plants that were heterozygous at the 871-kb region
but homozygous at another QTL on chromosome 4. A total of 11 recombinants were
isolated for further phenotyping. Based on the differences in chilling tolerance in the
B5CF2 plants, we localized HAN1 to a 59-kb genomic interval between marker loci
R11ID1693 and R11ID1699.
Plasmid Construction and Plant Transformation
Fragments of HAN1 were amplified from genomic DNA of ‘Teqing’ and ‘02428’ for
vector construction. Each DNA fragment was cloned into the binary vectors based on
3
homologous recombination technology using the ClonExpress Entry One Step
Cloning Kit (Vazyme, Nanjing, China). The recipient vectors were pTCK303 for
overexpression of HAN1 (pUbiquitin::HAN1Teqing
, and pUbiquitin::HAN102428
),
pBWA(V)HVE for estrogen-inducible expression of HAN1 (pER8::HAN1Teqing
,
pER8::HAN102428
), pCAMBIA1300 for the complementation assay
(pHAN1Teqing
::HAN102428
, pHAN102428
::HAN102428
), and pCAMBIA1301 for activity
analysis of the HAN1 promoter regions (pHAN1Teqing
::GUS, pHAN102428
::GUS),
respectively. To generate the CRISPR/Cas9 knockout lines, the Cas9 gene was driven
by the promoter of CaMV35S, while the 20 bases upstream of the protospacer
adjacent motifs (PAM) were selected as candidate target sequences and driven by the
promoter of OsU3 in the binary vector of BGK03. The target regions in the genome of
the transgenic plants were then sequenced using the PCR products (9). To obtain the
lines with a deletion of the MYB cis-element in the promoter of HAN1(han1ΔMYB
), the
24-bp long fragment containing the MYB cis-element was deleted by Cas9 protein
recognizing and digesting its two flanking PAM motifs in the genetic background of
temperate japonica rice cultivar ‘Zhonghua 11’. All plasmid vectors were introduced
into Agrobacterium tumefaciens strain EHA105 followed by Agrobacterium-mediated
transformation of rice cultivars ‘Teqing’, ‘Nipponbare’, or ‘Zhonghua 11’. For
complementation of the Arabidopsis mutant cyp94b3, the full-length coding region of
HAN102428
was cloned into the plant binary vector pBWA(V)HS to generate
35S::HAN1, which was then used to transform the Arabidopsis mutant cyp94b3 by
Agrobacterium-mediated transformation. With the exception of T0 transgenic plants of
pUbiquitin::HAN1Teqing
and pUbiquitin::HAN102428
, all other homozygous T3 seedling
were phenotyped. The total number of independent transgenic lines are as followed:
18 of pUbiquitin::HAN1Teqing
, 15 of pUbiquitin::HAN1
02428, 11 of pER8::HAN1
02428,
12 of pER8::HANTeqing
, seven of pHAN1Teqing
::GUS, six of pHAN102428
::GUS, four of
pHAN1Teqing
::HAN102428
, five of pHAN102428
::HAN102428
, three of 35S::HAN1/cyp94b3,
two of han1 and one han1ΔMYB
respectively.
4
Transient expression in plant protoplasts
The firefly luciferase (LUC) was fused to the promoters of HAN1 with ‘Teqing’ or
‘02428’ genotypes, and also to a mutated promoter of HAN1 with only one base
change from A to G at the -1543(G-A) site on the base of ‘02428’ type. Subsequently,
two parental types, pHAN1Teqing
::LUC and pHAN102428
::LUC, and the mutated type,
pHAN102428m
::LUC, were introduced into Arabidopsis protoplasts by PEG-mediated
transformation. The 35S::GUS plasmid was used as an internal transformation control
to provide an estimate of the transient expression level. Ratios of LUC to GUS
activity were used to define relative promoter activity. Three to five biological
replicates, each with ten technical replicates, were assayed for each construct. The
methodological details are described in Zhang et al. (10).
Subcellular Localization and GUS staining of HAN1
The vectors 35S::HAN1-GFP, 35S::GFP, and the endoplasmic reticulum (ER) marker
35S::HDEL-RFP, were introduced into rice protoplast cells by PEG-mediated
transformation or into leaves of N. benthamiana by agro-infiltration. Green and red
fluorescence signals were observed with a laser confocal microscope (Olympus
FV1000). GFP was excited with a 488nm laser, and RFP was excited with a 543nm
laser. The emission spectra were collected at 500-550 nm for GFP, and 565-653 nm
for RFP.
GUS staining of young seedlings and mature transgenic plants harboring the
pHAN1::GUS construct was performed as previously described (11).
In silico Microarray Expression Data Analysis
Expression profile data of HAN1 at all growth stages were retrieved from CREP
(http://crep.ncpgr.cn) (12).
Quantitative RT-PCR Analysis
Total RNA was extracted from plant tissues using TRIZOL reagent (Sangon, Shanghai,
China) and was reverse transcribed into cDNA using the M-MLV Reverse
5
Transcriptase kit (Promega, Madison, WI, USA). Quantitative RT-PCR (qPCR) was
performed using SYBR I Premix ExTaq (Takara Bio, Kusatsu, Shiga, Japan). The
gene expression levels in three biological replicates were calculated using the ∆∆Ct
method. Student’s t-test was used to determine whether there were significant
differences between samples.
Oxidase Activity Assay
Using an in vitro enzyme assay in yeast heterologous expression system, CYP94B3,
the HAN1-orthologous protein in Arabidopsis, has been shown to act as an oxidase
that metabolizes JA-Ile, the biologically active form of JA, to 12OHJA-ILE, an
inactive form (13). To confirm HAN1 oxidase activity, the ORFs of HAN1Teqing
,
HAN102428
, and CYP94B3 were amplified from the genomic DNA of rice cultivars
‘Teqing’ and ‘02428’, and Arabidopsis ecotype Colombia (Col-0), and subsequently
cloned individually into the yeast expression vector pYES2/NTC. The resulting
vectors, pGAL1::HAN1Teqing
, pGAL1::HAN102428
, and pGAL1::CYP94B3 (positive
control), plus the empty vector (negative control), were transformed into the INVSc1
strain of S. cerevisiae. The microsomal proteins isolated from these yeast cells under
galactose inducible expression were incubated with the JA-Ile substrate in the reaction
mixture at 37oC for 1 hour. The resulting mixture was directly analyzed for the
presence of 12OH-JA-Ile by LC-MS/MS. For details of the methods used, refer to
Koo et al. (13).
Measuring Endogenous JA-Ile Levels
Quantification of endogenous JA-Ile was performed as described by Koo et al. (13).
Briefly, 7-day old seedlings of the NILs with genotypes HAN1Teqing/Teqing
and
HAN102428/02428
were treated at 8oC in a Percival growth chamber. Fresh leaves were
harvested after 0, 3, and 24 hours of cold treatment, and ~1 g samples were used for
the measurements, with three biological replicates.
Haplotype Analysis and Phylogenetic Analysis of HAN1
Haplotype analysis was performed on the genomic sequences including the HAN1
6
promoter and coding regions from 101 O. sativa and 22 O. rufipogon accessions.
HAN1 was amplified by PCR, and the resulting DNA fragments were subjected to
Sanger sequencing. A neighbor-joining tree based on the HAN1 nucleotide sequences
from the rice varieties was constructed using MEGA 5.0 (14). Nucleotide diversity of
HAN1 in the different groups was calculated using DnaSP 5.10 (15). A phylogenetic
network was constructed using the median-joining model implemented in network
version 4.6 (16).
The sequences of the 1.0-Mb regions flanking HAN1 from 572 rice cultivars were
retrieved from sequence dataset (http://bigd.big.ac.cn/gsa. Accession numbers:
CRA000778, CRA000779 and CRA000995). Possible artificial selection on HAN1
was evaluated between two populations cultivated in either typical temperate climate
regions at high latitudes (>40oN) or in subtropical and tropical climate regions at
lower latitudes (<40oN) using ‘vcftools’ with 10k sliding windows and 5k step (17).
The likelihood-based selective sweep detection was calculated by ‘SweeD’ with a 2kb
grid size (18). Windowed nucleotide diversity and selection likelihood in the region
ranging from 16.5 Mb to 17.5 Mb on chromosome11 were plotted using the R
package ‘ggplot2’ (19).
Oligonucleotide Primers
The sequences of primers used for QTL mapping, gene cloning, expression analysis,
and vector construction are listed in SI Appendix, Tab. S8.
References
1. Mao DH, Liu TM, Xu CG, Li XH, Xing YZ (2011) Epistasis and complementary
gene action adequately account for the genetic bases of transgressive segregation of
kilo-grain weight in rice. Euphytica 180: 261-271.
2. Garris AJ, Tai TH, Coburn J, Kresovich S, McCouch S (2005) Genetic structure
and diversity in Oryza sativa L. Genetics 169:1631–1638.
3. Mao D, Yu L, Chen D, Li L, Zhu Y, Xiao Y, Zhang D, Chen C (2015) Multiple cold
7
resistance loci confer the high cold tolerance adaptation of Dongxiang wild rice
(Oryza rufipogon) to its high-latitude habitat. Theor Appl Genet 128(7):1359-1371.
4. Hu Y, Jiang L, Wang F, Yu D (2013) Jasmonate regulates the inducer of CBF
EXPRESSION-C-REPEAT BINDING FACTOR/DRE BINDING FACTOR1 cascade
and freezing tolerance in Arabidopsis. Plant Cell 25(8):2907-2924.
5. Xing Y, Tan Y, Xu C, Hua J, Sun X (2001) Mapping quantitative trait loci for grain
appearance traits of rice using a recombinant inbred line population. Acta Bot Sin
43:840-845.
6. Stephen EL, Lincoln SE, Lander ES (1990) Constructing genetic maps with
MAPMAKER: a tutorial and reference manual. A Whitehead Institute for Biomedical
Research, Cambridge, USA.
7. Wang S, Basten C, and Zeng ZB (2006) Windows QTL Cartographer 2.5.
Department of Statistics, North Carolina State University, Raleigh, NC.
8. Van Ooijen JW, Boer MP, Jansen RC, Maliepaard C (2002) MapQTL 4.0, software
for the calculation of QTL positions on genetic maps. Plant Research International,
Wageningen, the Netherlands.
9. Lu Y, Ye X, Guo R, Huang J, Wang W, Tang J, Tan L, Zhu JK, Chu C, Qian Y
(2017) Genome-wide targeted mutagenesis in rice using the CRISPR/Cas9 system.
Mol Plant 10(9):1242-1245.
10. Zhang Z, Li J, Pan Y, Li J, Zhou L, Shi H, Zeng Y, Guo H, Yang S, Zheng W, Yu J,
Sun X, Li G, Ding Y, Ma L, Shen S, Dai L, Zhang H, Yang S, Guo Y, Li Z (2017)
Natural variation in CTB4a enhances rice adaptation to cold habitats. Nat Commun
8:14788.
11. Liu W, Zhang D, Tang M, Li D, Zhu Y, Zhu L, Chen C (2013) THIS1 is a putative
lipase that regulates tillering, plant height, and spikelet fertility in rice. J Exp Bot.
64(14):4389-4402.
12. Wang L, Xie W, Chen Y, Tang W, Yang J, Ye R, Liu L, Lin Y, Xu C, Xiao J, Zhang
8
Q (2010) A dynamic gene expression atlas covering the entire life cycle of rice. Plant
J 61(5):752-766.
13. Koo AJ, Cooke TF, Howe GA (2011) Cytochrome P450 CYP94B3 mediates
catabolism and inactivation of the plant hormone jasmonoyl-L-isoleucine. Proc Natl
Acad Sci USA 108(22):9298-9303.
14. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4, molecular evolutionary
genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596–1599.
15. Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive analysis of
DNA polymorphism data. Bioinformatics 25(11):1451-1452.
16. Bandelt HJ, Forster P, RolA (1999) Median-joining networks for inferring
intraspecific phylogenies. Mol Biol Evol 16(1):37-48.
17. Danecek P, Auton A, Abecasis G, Albers CA, Banks E, DePristo M, Handsaker R,
Lunter G, Marth G, Sherry S, McVean G, Durbin Rd (2011) The variant call format
and VCFtools. Bioinformatics 27: 2156–2158.
18. Nielsen R, Williamson S, Kim Y, Hubisz MJ, Clark AG, Bustamante C (2005)
Genomic scans for selective sweeps using SNP data. Genome Res 15(11):1566-1575.
19. Ginestet C. ggplot2: Elegant Graphics for Data Analysis (2011) Journal of the
Royal Statistical Society 174(1):245–246.
9
Supplementary Figure 1 QTL mapping for chilling tolerance at the seedling stage in
the population derived from a cross between the two cultivars ‘Teqing’ and‘02428’.
A) Performance of the parental rice cultivars ‘Teqing’ and ‘02428’ after 4, 6, 8, and 10
days of chilling stress treatment. B) The survival rate (%) of the parental rice cultivars
10
‘Teqing’ and ‘02428’ after 4, 6, 8, and 10 days of chilling stress treatment (Student’s
t-test, *P < 0.01, n = 3). C) Survival rate frequencies of the RILs after chilling stress
treatment. The results of three biological replications, I to III, are shown. D) Location
of the HAN1 QTL on the linkage map constructed in the ‘Teqing’/‘02428’ RIL
population (interval mapping in Windows QTL Cartographer 2.5 software). E)
Graphical genotyping of the HAN1 fine-mapping NIL involving the chilling tolerance
QTL on chromosomes (Chr.). Ovals indicate QTLs for chilling tolerance detected at
the seedling stage in the ‘Teqing’/‘02428’ RILs population; horizontal lines show the
molecular marker loci used for genotyping; the white, grey and green rectangles
represent homozygous ‘Teqing’, heterozygous, and homozygous ‘02428’ regions,
respectively. F) Chilling tolerance of three genotypes in the near isogenic line
background. Letters ‘a’ and ‘b’ indicate that there was a significant difference in
chilling tolerance among the genotypes using Student’s t-test with P < 0.05 (5
independent lines of T/T, 8 lines of T/0, and 3 lines of 0/0).
11
Supplementary Figure 2 The performance of HAN1-overexpressing transgenic rice
plants. A) Schematic diagram of the DNA constructs used for overexpression of
HAN1 in rice. B) Performance of the pUbi::HAN1 transgenic plants carrying the two
parental alleles at the seedling stage.
12
Supplementary Figure 3 The performance of HAN1 transgenic lines using the
estrogen inducible expression system. A) Diagram of the genetic constructs used for
estrogen-inducible expression of HAN1. B) Relative expression level of HAN1 in
HAN1 transgenic lines and wild type (Student’s t test, **
P < 0.01, NS
P > 0.05, n = 3). C)
Performance of HAN1 transgenic lines and wild type after chilling stress. D) Survival
of HAN1 transgenic lines and wild type after chilling treatment (Letters ‘a’ and ‘b’
indicate a significant difference in chilling tolerance among the genotypes by
Student’s t-test with P < 0.05 and n = 3).
13
Supplementary Figure 4 Subcellular localization of HAN1.
A-E) The subcellular localization of GFP from the empty vector (A-C), and the
subcellular co-localization of HAN1 and the endoplasmic reticulum marker HDEL via
transient expression in rice protoplasts (C-E). F-K) Subcellular localization of HAN1
and the ER marker protein HDEL via transient expression in cells of agro-infiltrated
tobacco leaves. I, J, and K are the enlarged insets in panels F, G, and H, respectively.
14
Supplementary Figure 5 Expression profiles of HAN1 in rice. Gene expression
profile data of HAN1 during the entire growth period was retrieved from CREP
(http://crep.ncpgr.cn.) and RiceGE (http://signal.salk.edu/cgi-bin/RiceGE). ZS97,
MH63 and IR64 are the rice cultivars used for gene expression analysis.
15
Supplementary Figure 6 GUS histochemical assays of HAN1 expression
The transgenic plants that carried the reporter gene GUS driven by the HAN1
promoter region from either ‘Teqing’ or ‘02428’ allele in the ‘Nipponbare’
background were histologically stained to analyze the expression pattern. A-K) GUS
staining of rice tissues under normal conditions: A young panicle, B glume, C glume
and stamen, D mature seed, E leaf sheath, F leaf, G stem, H root hair, I root, J radicle
and coleoptile, and K leaf sections stained for GUS expression before and after
chilling treatments.
16
Supplementary Figure 7 Analysis of HAN1oxidase activity .
The microsomal proteins isolated from these yeast cells expressing pGAL::CYP94B3,
pGAL::HAN1Teqing
, pGAL::HAN102428
, or empty vector under galactose inducible
expression were incubated with JA-Ile substrate in the reaction mixture at 37oC for 1
hour. A) LC-MS/MS analysis of substrate JA-Ile in the terminated reaction mixture. B)
LC-MS/MS analysis of 12OH-JA-Ile in the terminated reaction mixture.
pGAL::CYP94B3 and empty vector represented the positive and negative control,
respectively.
17
Supplementary Figure 8 Phylogenetic tree of the HAN1 gene in the five ecotypes
and O. rufipogon accessions based on Sanger sequencing data. Ind, Aus, Aro, Trj, Tej,
and Wild represent the five rice ecotypes, indica, aus, aromatic, tropical japonica, and
temperate japonica rice, and wild O. rufipogon rice, respectively.
18
Supplementary Figure 9 Haplotype network of HAN1 in 122 cultivated and wild rice
accessions. Circle size is proportional to the number of samples of a given haplotype.
Different colors represent different subgroups: orange for aus, yellow for indica, gray
for aromatic, light green for tropical, dark green for temperate japonica rice, and blue
for wild rice.
19
Supplementary Figure 10 Functional analysis of the putative MYB cis-element in
the promoter region of HAN1
A) DNA construct maps and relative expression levels of LUC under chilling
treatment (4oC) in Arabidopsis protoplasts driven by the promoters of pHAN1
02428,
pHAN1Teqing
, and pHAN102428m
. pHAN102428
and pHAN1Teqing
are the promoters from
the two parental lines. pHAN102428m
represents the mutant promoter with a single base
change from A to G at the MYB cis-element. Student’s t-test, **
P < 0.01, n = 5. B)
20
Partial DNA sequences from wild type and HAN1 knockout mutant han1ΔMYB
,
showing the specific mutations. MYB represents the MYB cis-element with base
sequence AACCA, and PAM represents protospacer adjacent motif (NGG) for
CRISPR/Cas9 DNA target cleavage. C) a 24-bp deletion was detected by molecular
marker. D) and E) Seedling performance of han1ΔMYB
and wild type in genetic
background of japonica rice cultivar ‘Zhonghua 11’ under control (D) or chilling
treatment (E). F) RT-qPCR expression analysis of han1ΔMYB
and wild type under
chilling stress (NT, normal temperature of 28oC for 24hr; CS, chilling stress of 4
oC for
24hr; Actin is reference gene, Student’s t-test, **P < 0.01, n = 3). G) Seedling survival
rate of han1ΔMYB
and wild type after chilling stress treatment (Student’s t-test,
*P<0.05, n = 3).
21
Supplementary Figure 11 Yield-related traits for HAN1 NILs, transgenic lines, and
knock-out lines grown under field conditions. A) han1 and WT, the CRISPR/Cas9
HAN1 knock-out line and the wild type ‘Nipponbare’; B) 290C and WT, the
pHAN102428
::HAN102428
transgenic line and the wild type ‘Teqing’; C) TT and OO, the
NILs with genotypes of HAN1Teqing/Teqing
or HAN102428/02428
. Student’s t-test, *P < 0.05,
**P < 0.01, and NS
P > 0.05 (n = 10).
22
Supplementary Table 1 QTL mapping of chilling tolerance at seedling stage in the
‘Teqing’/ ‘02428’ RIL population
Chr.a Interval
b LOD
c Add%
d Var%
e
4 RM518-RM261 5.2 -12.4 13.2
11 RM332-RM536 11.5 20.4 35.8
aChromosomes where QTLs were located;
bIntervals where QTLs were located;
cLOD
threshold was confirmed by 1000-iteration permutation test (P=0.05), and LOD
scores greater than the thresholds are shown in the table; dAdditive effect, where a
positive value means that the ‘02428’ allele increased chilling tolerance; ePercentage
of total phenotypic variance explained by QTLs;
23
Supplementary Table 2 Extremely sensitive or tolerant RILs for fine mapping of
HAN1 R
IL N
um
ber
a Marker genotype
b
Phen
oty
pe
c
RM
332
R11ID
443
R11ID
542
R11ID
722
R11ID
807
RM
536
RM
5857
RM
26652
R11ID
1646
R111ID
1693
RM
287
R11ID
1733
R11ID
1764
RM
229
155 T T T T T T T T T T T 0 0 0 ES
116 T T T T T T T T T T T T T 0 ES
186 0 T T T T T T T T T T T T T ES
57 0 0 T T T T T T T T T T T T ES
97 0 0 0 T T T T T T T T T T T ES
100 0 0 0 T T T T T T T T T T T ES
41 T 0 0 T T T T T T T T T T T ES
59 T T 0 0 T T T T T T T T T T ES
21 0 0 0 0 T T T T T T T T T T ES
93 0 0 0 0 T T T T T T T T T T ES
63 0 0 0 0 0 0 T T T T T T T T ES
145 T 0 0 0 0 0 0 T T T T T T T ES
101 0 0 0 0 0 0 0 0 0 T T T T T ES
89 T T T T T 0 0 0 0 0 0 0 0 0 ET
45 T T T 0 0 0 0 0 0 0 0 0 0 T ET
58 T 0 0 0 0 0 0 0 0 0 0 0 0 T ET
84 T 0 0 0 0 0 0 0 0 0 0 0 0 0 ET
67 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ET
71 0 0 0 0 0 0 0 0 0 0 0 0 0 T ET
103 0 0 0 0 0 0 0 0 0 0 0 0 0 T ET
123 0 0 0 0 0 0 0 0 0 0 0 T T T ET
131 T T T 0 0 0 0 0 0 0 0 0 0 0 ET
135 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ET
a Number of each RIL;
b Marker genotype of each RIL, ‘T’ and ‘0’ mean ‘Teqing’/
‘Teqing’ or ‘02428’/‘02428’ genotype, respectively; c
Phenotype of each line, ES
and ET stand for extremely sensitive or tolerant to chilling stress (The survival rate:
ES < 5%, ET > 85%; three biological repeats for chilling tolerance phenotyping of
each line).
24
Supplementary Table 3 Recombinants from RIL and NIL populations for fine mapping of HAN1 R
ecom
bin
ant
s N
um
ber
s a
R11ID
1535 b
R11ID
1542
R11ID
1551
R11ID
1578
R11ID
1583
R11ID
1628
R11ID
1646
R11ID
1693
R11ID
1699
RM
287
R11ID
1733
R11ID
1740
R11ID
1748
R11ID
1762
R11ID
1764
SU
R%
c
SU
R%
(T/T
)d
SU
R%
(0/0
) e
P-V
alue
f
Ril101 0 0 0 0 0 0 0 T T T T T T T T 0.0±0.0
Ril123 0 0 0 0 0 0 0 0 0 0 T T T T T 87.1±0.6
Ril155 T T T T T T T T T T 0 0 0 0 0 2.4±4.1
Nil-c15 T T T T T T T T T T H H H H H 1.3±2.3 0.5±0.9 0.405
Nil-c23 T T T T T T T T T T H H H H H 22.0±11.4 17.2±16.7 0.644
Nil-m25 T T T T T T T T T T H H H H H 15.2±7.0 12.7±8.9 0.591
Nil-s13 T T H H H H H H H H H H H H H 0.3±0.8 7.8±6.1 0.026
Nil-m31 H H H H H H H H H H T T T T T 4.9±4.1 51.5±12.3 5E-04
Nil-s26 0 0 H H H H H H H H H H H H H 14.1±10.2 43.8±24.5 0.044
Nil-s54 0 0 H H H H H H H H H H H H H 30.5±4.0 56.2±12.3 3E-04
Nil-m10 0 0 0 0 H H H H H H H H H H H 7.6±6.6 39.5±18.4 0.042
Nil-c51 0 0 0 0 0 0 0 0 0 H H H H H H 37.4±8.7 24.1±2.1 0.135
Nil-c54 0 0 0 0 0 0 0 0 0 H H H H H H 26.6±14.5 42.1±25.9 0.169
Nil-c29 0 0 0 0 0 0 0 0 0 0 H H H H H 68.6±13.9 64.0±17.9 0.607 a Recombinants for fine mapping of HAN1 (‘Ril’ and ‘Nil’ were derived from RIL or NIL population, respectively);
b Marker genotype of each
recombinant group: ‘T’ , ‘0’ , and ‘H’ indicate the genotypes of ‘Teqing’/‘Teqing’, ‘02428’/‘02428’, or ‘Teqing’/‘02428’, respectively; c
Chilling
tolerance of recombinants from RIL population; d
and e Chilling tolerance of ‘Teqing’/‘Teqing’ or ‘02428’/‘02428’ progenies of NIL
recombinants based on the genotypes of markers in the ‘Teqing’/‘02428’ interval (n ≥ 3 for each genotype); f Student’s t-test between two
genotypes of the progenies.
25
Supplementary Table 4 Candidate genes in the HAN1 interval
Gene ID Annotation Orthologous genes Putative function Pub
LOC_Os11g29200 Protein transport protein - -
LOC_Os11g29210 Resistance-gene-interacting protein - -
LOC_Os11g29220 Hypothetical protein - -
LOC_Os11g29230 Pentatricopeptide repeat protein - -
LOC_Os11g29240 Expressed protein - -
LOC_Os11g29250 Expressed protein - -
LOC_Os11g29260 Expressed protein - -
LOC_Os11g29274 conserved hypothetical protein - -
LOC_Os11g29290 Cytochrome P450 CYP94B3 JA metabolism Koo et al., 2011
LOC_Os11g29300 Expressed protein - -
Supplementary Table 5 Background information of 101 rice cultivars for HAN1 sequencing
Accession namea IRGC
b Origin
c Group
d Hap
e Sur%
f Sur%
g Sur%
h
Norin 20 418 Japan Tej 1 100.0 - 80.0
Haginomae Mochi 2540 Japan Tej 1 100.0 87.5 -
Kotobuki Mochi 2545 Japan Trj 1 100.0 80.0 90.8
Mansaku 8191 Japan Tej 1 95.8 70.5 -
Baber 33984 India Tej 1 97.6 93.6 60.9
Aichi Asahi 40252 Japan Tej 1 - 94.4 -
26
Aedal 55441 Korea Tej 1 77.7 81.3 88.7
Beonjo 55457 Korea Tej 1 100.0 100.0 56.0
Chodongji 55471 South Korea Tej 1 97.8 95.8 67.8
Heukgyeong 55530 South Korea Tej 1 93.8 100.0 61.0
Baghlani
Nangarhar 58266 Afghanistan Tej 1 96.7 66.7 15.3
Luk Takhar 58286 Afghanistan Tej 1 100.0 100.0 86.2
Taibei309 - China Tej 1 97.1 87.2 98.4
2428 - China Tej 1 68.9 - -
Nipponbare - Japan Tej 1 94.2 90.0 97.2
Arias 43325
Indonesia(West
Java) Trj 2 27.5 48.9 12.3
Ta Hung Ku 1107 China Tej 3 95.6 94.4 51.3
Dourado Agulha 3297 Brazil Trj 3 100.0 - 11.1
Kinastano 3782 Philippines Trj 3 97.9 76.2 27.3
CAAWA/Fortuna
6-103-15 5441 Taiwan Trj 3 70.8 100.0 52.5
Davao 8244 Phillipines Trj 3 100.0 87.8 8.3
Hu Lo Tao 8264 China Tej 3 91.1 - 98.2
RT 1031-69 15092 Zaire Trj 3 100.0 95.8 22.0
27
IAC 25 19642 Brazil Trj 3 93.8 - 38.8
Binulawan 26872 Phillipines Ind 3 25.0 - 0.0
NPE 826 38694 Pakistan Aro 3 35.6 84.3 43.2
Gogo Lempuk 43394 Indonesia Trj 3 23.8 0.0 0.0
Canella De Ferro 50448 Brazil Trj 3 93.8 96.3 18.0
L-202 66292 USA Trj 3 65.3 100.0 80.9
N 12 6298 India Aro 4 38.4 92.7 -
Dom Sofid 12880 Iran Aro 4 0.0 42.5 15.3
Chahora 144 27869 Pakistan Trj 4 81.1 100.0 6.6
Rexoro 1715 USA Trj 5 66.4 68.8 -
Pankhari 203 5999 India Aro 5 2.4 47.2 -
JC101 9060 India Aro 5 0.0 20.5 -
Mehr 12883 Iran Aus 5 0.0 70.7 7.5
Darmali 27630 Nepal Tej 5 16.9 100.0 60.8
Phudugey 32399 Bhutan Aus 5 83.3 64.5 11.4
NPE 253 38690 Pakistan Tej 5 96.1 66.7 40.7
NPE 417 38692 Pakistan Trj 5 - 100.0 -
BJ 1 45195 India Aus 5 0.0 0.0 0.0
28
Lageado 50490 Brazil Ind 5 47.9 44.4 -
Ghati Kamma
Nangarhar 58278 Afghanistan Aus 5 0.0 12.5 0.0
Chhote Dhan 58930 Nepal Ind 5 0.0 0.0 -
Kasalath - India Aus 5 0.9 0.0 0.0
JC149 9070 India Aro 6 0.0 5.6 -
Taichung Native 1 105 Taiwan Ind 7 2.1 - 0.0
DA 7 5809 Bangladesh Ind 7 0.0 0.0 -
DA 9 5854 Bangladesh Ind 7 0.0 0.0 -
DA 5 5855 Bangladesh Ind 7 0.0 - -
DA 11 6046 Bangladesh Ind 7 0.0 0.0 -
CO 18 6331 India Ind 7 0.0 - -
Bhadoia 233 6541 Bangladesh Aus 7 0.0 0.0 -
Baguamon 14 6590 Bangladesh Ind 7 0.0 0.0 -
Kalukantha 7755 Sri Lanka Ind 7 0.0 4.2 -
MTU9 7919 India Ind 7 0.0 0.0 -
Pratao 7937 Brazil Ind 7 - - -
Peh-Kuh-Tsao-Tu 8237 Taiwan Ind 7 0.0 0.0 0.0
Pappaku 8268 Taiwan Ind 7 0.0 - 0.0
29
Pao-Tou-Hung 51400 China Ind 7 0.0 8.3 0.0
Chitraj (DA23) 6208 Bangladesh Ind 8 0.0 - -
Seratoes Hari 8260 Indonesia Ind 8 0.0 0.0 0.0
JC111 9062 India Aro 8 0.0 6.1 -
TKM6 237 India Ind 9 0.0 2.8 -
IRGA 409 77483 Brazil Ind 9 0.0 0.0 0.0
- - - Ind 9 0.6 33.3 3.7
Peh-Kuh 8238 Taiwan Ind 10 6.5 20.4 1.5
Ai-Chiao-Hong 51250 China Ind 10 0.0 0.0 0.0
XieqingzaoB - China Ind 10 0.0 - 0.0
I-Geo-Tze 120 Taiwan Ind 11 0.0 78.4 0.6
Teqing - China Ind 11 11.5 - 0.0
Makalioka-34 6087 Madagascar Ind 12 0.0 0.0 -
Mudgo 6663 India Ind 12 0.0 0.0 0.0
O-Lurn-Cheung 8179 Taiwan Ind 12 5.4 10.3 20.2
Shai-Kuh 8197 China Ind 12 68.1 85.6 0.0
Som Cau 70A 8227 Vietnam Tej 12 0.0 0.0 -
Hsia-Chioh-Keh-Tu 8240 Taiwan Ind 12 0.0 2.4 -
30
Shuang-Chiang 8242 Taiwan Ind 12 0.0 0.0 -
JC157 9179 India Aro 12 0.0 12.5 1.8
Chiem Chanh 10214 Vietnam Ind 12 6.3 87.5 2.5
Kalamkati 45975 India Aus 12 0.0 0.0 -
Guan-Yin-Tsan 51300 China Ind 12 6.3 0.0 0.0
Chau 56036 Vietnam Ind 13 0.0 0.0 -
JC1 9091 India Aro 14 0.0 0.0 -
FR13 A 6144 India Aus 15 0.0 - -
N 22 6264 India Trj 15 2.1 76.4 0.0
PTB9 6274 India Ind 15 0.0 4.4 -
T 1 6294 India Aus 15 0.0 24.4 1.9
Jhona 349 6307 India Aus 15 2.1 26.1 0.6
DZ78 8555 Bangladesh Aus 15 0.0 21.0 0.0
ARC 10177 12386 India Aus 15 - 0.0 -
ARC 10352 12440 India Aro 15 0.0 0.0 0.0
Miriti 25901 Bangladesh Trj 15 0.0 3.0 0.7
Black Gora (Ncs12) 40275 India Aus 15 0.0 2.8 0.0
Lal Aman 46202 India Ind 15 0.0 57.4 0.0
31
RTS4 8177 Vietnam Ind 16 0.0 0.0 -
RTS14 8178 Vietnam Ind 16 0.0 - 11.5
Padi Kasalle 8261 Indonesia Trj 16 0.0 - 18.7
Gundil Kuning 16428 Indonesia Trj 16 - - -
Sintane Diofor 5418 Burkina Fasao Ind 17 0.0 0.0 -
JC73-4 9115 India Aro 17 2.1 0.0 -
aName of cultivated rice accessions;
bNumber of each accession in the IRRI IRGC database;
dCountry of origin of each accession;
eSubgroup of
each accession according to Garris et al. (2005); f-h
Survival percent of seedling at chilling stresses of 10oC for 7 days, 8
oC for 6 days, and 4
oC for
4 days, respectively.
32
Supplementary Table 6 Origins of 21 wild rice accessions (O. rufipogon) used for
HAN1 sequencing
Accession number Country of origin
172 Malaysia
173 China
174 Thailand
176 Thailand
181 Laos
182 Myanmar
183 Papau New Guinea
188 Myanmar
189 India
190 Philippines
191 Taiwan
192 Bangladesh
211 Malaysia
212 Philippines
213 Cambodia
214 India
225 Malaysia
242 Papau New Guinea
243 Cambodia
DXWR China
CLWR China
33
Supplementary Table 7 Background information and classification of 572 rice accessions with resequencing genome data
Name of cultivars Subgroup Region of origin Latitude Longitude
9113 Indica II Hunan,China 28.2 112.9
H383 Indica_inter
H421 Indica_inter
H72 Indica_inter
Fu58 Indica_inter
Fu608 Indica_inter
Fu9811 Indica I
Jiazao66 Indica_inter Zhejiang,China 30.3 120.2
Yuenuo6hao Indica_inter Zhejiang,China 30.3 120.2
Zhongjiazao6hao Indica_inter Zhejiang,China 30.3 120.2
Zhongxiangzao4hao Indica_inter
Xqzb Indica I Anhui,China 31.8 117.2
Jin23b Indica I Hunan,China 28.2 112.9
Xieb Indica I
Fengyuanb Indica I Hunan,China 28.2 112.9
Ganxiangb Indica_inter Jiangxi,China 28.7 115.8
706b Indica_inter
Jiangxi1587 Indica II
V20b Indica I Hunan,China 28.2 112.9
Yevb Indica_inter
Peh-kuh-tsao-tu Indica_inter
Zx97b Indica I Zhejiang,China 30.3 120.2
Digu Indica I Fujian,China 26.1 119.3
Guangluai4hao Indica I Guangdong,China 23.1 113.3
34
Jinyou974 Indica_inter Hunan,China 28.2 112.9
Xiangzaoxian45hao Indica_inter Hunan,China 28.2 112.9
Zhenshan97b Indica_inter Zhejiang,China 30.3 120.2
Minghui63 Indica_inter Fujian,China 26.1 119.3
Lucaihao Indica I Fujian,China 26.1 119.3
75-79 Indica I
Minkezao77 Indica I
Guangluai15-1 Indica I Guangxi,China 22.8 108.4
Cuganshangzao Indica I
Xiujiangzao9hao Indica I Jiangxi,China 28.7 115.8
Suxian1hao Indica I
Zhenhong17 Indica I Fujian,China 26.1 119.3
Nt02 Indica I
Dongzao Indica I
Zhe733 Indica_inter Zhejiang,China 30.3 120.2
Zhe852 Indica I Zhejiang,China 30.3 120.2
Zaodongliu45 Indica I Zhejiang,China 30.3 120.2
Zaolian31 Indica I Zhejiang,China 30.3 120.2
S08-18 TEJ
Wenteqing Indica I
Liushiqing Indica I
Hongmeizao Indica I Guangdong,China 23.1 113.3
Jinke5hao Indica_inter
Gaoye50zao Indica I
Jxyzhongzao35 Indica_inter Zhejiang,China 30.3 120.2
Qiuzhi TEJ
35
Luzhouzaob Indica_inter Sichuan,China 30.6 104.1
Hang406b Indica I
406b Indica I
Ghatikammanangarhar Indica I
Qitouwang Indica I
Kezhongfu Indica I
Mangzhan Indica I
Sandongqi Indica I
Xiguzao Indica I
R894 Indica II Sichuan,China 30.6 104.1
R463 Indica II Sichuan,China 30.6 104.1
Xiagu5hao Indica I
Dongshuizao Indica I
Aimeizao3 Indica_inter Guangdong,China 23.1 113.3
R301 Indica II Jiangxi,China 28.7 115.8
Rikutokemochi Japonica_Inter Japan 35.4 138.5
Nanjing11 Indica_inter Jiangsu,China 32.1 118.8
Zhenong9906 Indica_inter Zhejiang,China 30.3 120.2
Rts14 Indica I
O-lurn-cheung Indica I
Nj11 Indica_inter
Fushe31 Indica_inter Fujian,China 26.1 119.3
Guangchangai6hao Indica I Guangdong,China 23.1 113.3
Zhaiyeqing4hao Indica_inter Guangdong,China 23.1 113.3
Nantehao Indica I Jiangxi,China 28.7 115.8
Tuanhuangzhan Indica_inter Guangxi,China 22.8 108.4
36
Chaoyangzao18 Indica I Guangdong,China 23.1 113.3
Sanyazao Indica I
Guangchang13 Indica I Guangdong,China 23.1 113.3
Xiangfengb Indica_inter Jiangxi,China 28.7 115.8
Zaohuang Indica I
Zhefu7 Indica_inter Zhejiang,China 30.3 120.2
R286 Indica_inter Guangxi,China 22.8 108.4
Longge113 Indica I Fujian,China 26.1 119.3
Bashizaozhan Indica I
Hongliusi MIX
Fenggui1hao Indica_inter Guangdong,China 23.1 113.3
26-1 Indica I
Tiepizhong Indica I
Qiyuezao Indica I
Huaai35hao Indica I Hubei,China 30.6 114.3
Dular AUS India 28.4 77.1
Norin20 TEJ
Irri-24 Indica II Philippines 15.0 121.0
3207-998 Indica II
Irri-55 Indica II Philippines 15.0 121.0
R210 Indica II Hunan,China 28.2 112.9
R463 Indica II Sichuan,China 30.6 104.1
R128 Indica II Hunan,China 28.2 112.9
Tr1988 Indica II
Aixiangzhan Indica II Guangdong,China 23.1 113.3
Aoqixinzhan Indica II Guangdong,China 23.1 113.3
37
Chengnuoruanzhan Indica II
Fengxinzhan Indica II Guangdong,China 23.1 113.3
Fengxiangsimiao2hao Indica II Guangdong,China 23.1 113.3
Gufengzhan Indica II Guangdong,China 23.1 113.3
Guangyan1hao Indica II Guangdong,China 23.1 113.3
Hangtezhan Indica II
Huahang3hao Indica II Guangdong,China 23.1 113.3
Huazhongzhan2hao Indica II
Huangguangzhan Indica II Guangdong,China 23.1 113.3
Huanghuazhan Indica II Guangdong,China 23.1 113.3
Huangruanxiangzhan Indica II
Jinhuaruanzhan Indica II
Kangwen5 Indica II
Liweizhan Indica II
Meixiangzhan2hao Indica II Guangdong,China 23.1 113.3
Meiyazhan Indica II Guangdong,China 23.1 113.3
Ningbo2 MIX
Pinghui141 Indica II Jiangxi,China 27.6 113.8
Shanqingzhan Indica II
Suixiangzhan Indica II
Tainongxin5 Indica II Taiwan 24.0 120.0
Texiansimiao Indica II Guangdong,China 23.1 113.3
Wushanxiuzhan Indica II Guangdong,China 23.1 113.3
Xianliangzhan Indica II
Xiangfu994 AUS Hunan,China 28.2 112.9
Xinhuangzhan(guangpu) Indica II Guangdong,China 23.1 113.3
38
Yuguangzhan Indica II
Yujingzhan Indica II Guangdong,China 23.1 113.3
Yushanfengzhan Indica II
Yushanlizhan Indica II
Yushansimiao Indica II
Yuefengsizhan Indica II Guangdong,China 23.1 113.3
Yuexinzhan2hao Indica II Guangdong,China 23.1 113.3
Zaohuazhan Indica II Guangdong,China 23.1 113.3
Zhongguangsimiao Indica II Guangdong,China 23.1 113.3
Zhongxiang1hao Indica II Zhejiang,China 30.3 120.2
Tq Indica II Guangdong,China 23.1 113.3
Huazhan Indica II Guangdong,China 23.1 113.3
Yuetaib Indica_inter Guangdong,China 23.1 113.3
Luxiang618b Indica_inter Sichuan,China 30.6 104.1
Yixiang1b Indica_inter Sichuan,China 30.6 104.1
Jiafuzhan Indica_inter Fujian,China 26.1 119.3
Ⅱ-32b Indica I Hunan,China 28.2 112.9
Xiangaib Indica_inter Jiangxi,China 27.6 113.8
Yuefengb Indica_inter Guangdong,China 23.1 113.3
Yuzhenxiang Indica_inter Hunan,China 28.2 112.9
Gumei4hao Indica_inter Sichuan,China 30.6 104.1
Mianhui3724 Indica II Sichuan,China 31.5 104.7
Mianhui523 Indica II Sichuan,China 31.5 104.7
Mianhui528 Indica II Sichuan,China 31.5 104.7
Luhui602 Indica II Sichuan,China 30.6 104.1
Chuanr527 Indica II
39
Shuhui166 Indica II Sichuan,China 30.6 104.1
Shuhui498 Indica II Sichuan,China 30.6 104.1
Chuanhui687 Indica II Sichuan,China 30.6 104.1
Zhen084 Indica II
T136 MIX Jiangsu,China 32.4 119.4
R6547 Indica II Jiangsu,China 32.4 119.4
Zaoshur13 Indica II
Ranxuan6hao Indica II
Luobiao Indica_inter
Zhongjiangd208 Indica II
Yangdao6hao(youmang) Indica II Jiangsu,China 32.4 119.4
02428 Indica II Jiangsu,China 32.1 118.8
Guanghui998 Indica II Guangdong,China 23.1 113.3
Meitezhan Indica II
Wanxian98 Indica II Hubei,China 30.6 114.3
Ir64 Indica II Philippines 15.0 121.0
Yuer9113 Indica II Hunan,China 28.2 112.9
Liufengxiangzhan Indica_inter Guangxi,China 22.8 108.4
Guihongyihao Indica II Guangxi,China 22.8 108.4
Yesizhan Indica II Guangdong,China 23.1 113.3
Xinxiangzhan Indica_inter Guangxi,China 22.8 108.4
Minghui77 Indica II Fujian,China 26.1 119.3
Jusuidao Indica_inter
Gui99 Indica II Guangxi,China 22.8 108.4
Miyang46 Indica II South Korea 37.3 126.6
R725 Indica II
40
Rb207 Indica_inter Hunan,China 28.2 112.9
R299 Indica_inter Sichuan,China 30.6 104.1
Xiangwannuoyihao Indica II Hunan,China 28.2 112.9
Yuetaisimiao Indica II Guangdong,China 23.1 113.3
Huangsizhan Indica II Guangdong,China 23.1 113.3
Nongxiang26 Indica II Hunan,China 28.2 112.9
Nongxiang28 Indica II Hunan,China 28.2 112.9
Ii-32b Indica I Hunan,China 28.2 112.9
Taichungnative1 Indica I Taiwan 24.2 120.7
I-geo-tze Indica I
T1 AUS
Jhona349 AUS Pakistan 33.4 73.1
Peh-kuh Indica I
Seratoeshari Indica_inter
Dz78 AUS
Chiemchanh Indica_inter
Arc10177 AUS
Ir36 Indica II Philippines 15.0 121.0
Blackgora(Ncs12) AUS Philippines 15.0 121.0
Bj1 AUS Philippines 15.0 121.0
Lalaman MIX Bangladesh 23.7 90.4
Ai-chiao-hong Indica I
Guan-yin-tsan Indica I
Pao-tou-hung Indica I
9311 Indica II Jiangsu,China 32.1 118.8
C418 MIX
41
Mh63 Indica II Fujian,China 26.1 119.3
Kasalath AUS Japan 35.4 138.5
Irbb56 Indica II
Teqing Indica II Philippines 15.0 121.0
Irat109 TRJ Brazil
Huakexianluo Indica I
Xu213 Indica II
Jinghong1hao Indica I
9487 Indica_inter
Mianxing4hao Indica II
Xiaoyeqing Indica_inter
Wuqizhan Indica_inter
Shixieai Indica_inter
Nanzhuai2hao Indica_inter Guangdong,China 23.1 113.3
Chuanzaozhong Indica I
Wuxiangxian107 Indica_inter
Nannongxian2hao Indica_inter Jiangsu,China 32.1 118.8
Jinxuan2hao Indica_inter
Jiqing Indica_inter Guangxi,China 22.8 108.4
Longtepu Indica_inter Guangxi,China 22.8 108.4
Huazhan Indica_inter
Wunong7hao Indica_inter
Ir64 Indica II Philippines 15.0 121.0
Xingningzhan Indica I
Nanjing2157 Indica II
78xuan15 Indica_inter
42
Teqing2hao Indica II Guangdong,China 23.1 113.3
Zhend-1 Indica_inter Fujian,China 26.1 119.3
Heiyenuo Indica_inter
Nannong4028 Indica II
Longyang2hao Indica_inter
Datouzhan Indica I
Jianzao Indica I
Yinfeng Indica I Guangxi,China 22.8 108.4
Xiangsimiao2 Indica II Guangdong,China 23.1 113.3
Shuhui527 Indica II Sichuan,China 30.6 104.1
Xinqingai Indica I Guangdong,China 23.1 113.3
Guichao2hao Indica_inter Guangdong,China 23.1 113.3
Shuangzhuzhan Indica_inter Guangdong,China 23.1 113.3
Yigenmiao Indica I
2036-1 Indica_inter
Chaocong302 Indica_inter
Bairizao Indica I
Ailun Indica_inter
Heijiazhan Indica I
Shuangchao7 Indica_inter Guangdong,China 23.1 113.3
88272 Indica_inter
525 Indica_inter Hubei,China 30.6 114.3
9522 TEJ
Zhongyu1hao Indica_inter Zhejiang,China 30.3 120.2
Qinghuafugui Indica_inter
Jiangaizao Indica I
43
Gharib Japonica_Inter
Douradoprecoce TRJ Brazil
Yuelin1hao Indica II Guangdong,China 23.1 113.3
Zhongzu14 Indica II Zhejiang,China 30.3 120.2
Kibi TEJ
Xing1 Indica II
Changxianggu AUS
Yinjingsizhan Indica II Guangdong,China 23.1 113.3
Yuejingsimiao Indica II Guangdong,China 23.1 113.3
Yuezhenzhan Indica II Guangdong,China 23.1 113.3
93-11 Indica II Jiangsu,China 32.1 118.8
Minghui86 Indica II Fujian,China 26.1 119.3
Neihui99-14 Indica II Sichuan,China 29.6 105.1
Mianhui146 Indica II Sichuan,China 31.5 104.7
R702 Indica_inter
R411 Indica II
Zhenzhunuo Indica II
R9368 Indica II
Yangdao6hao(wumang) Indica II Jiangsu,China 32.4 119.4
Yangdao8hao Indica II Jiangsu,China 32.4 119.4
Binulawan TRJ
Ir24 Indica II Philippines 15.0 121.0
Ir50 Indica II India 28.4 77.1
Nj16 Indica_inter
Yns Indica I
6406 Indica I
44
6302 Indica I
7900 Indica II
6730 TEJ
7975 Indica II
Zhenxian232 Indica_inter Jiangsu,China 32.1 118.8
Meigui1hao Indica_inter Guangxi,China 22.8 108.4
Gerdeh AUS Iran
Carolinagold Japonica_Inter
Shankiuju TEJ
Nhta10 TEJ
Shortgrain Indica_inter
Iguapecateto TRJ
Kaniranga Indica_inter
5814 Indica II
Minfeng3hao Indica_inter
Yangdao4hao Indica_inter Jiangsu,China 32.4 119.4
Haginomaemochi AUS
Kun-min-tsieh-hunan Indica_inter
Phudugey MIX Bhutan 27.3 90.3
Irga409 Indica_inter
Meilianzao Indica_inter
Pagaiyahan MIX
Ir141 Indica II Philippines 15.0 121.0
Irri-54 Indica II
Mudgo Indica_inter
Shai-kuh Indica_inter
45
Pappaku Indica_inter
Wanzhong80 Indica II Sichuan,China 28.1 114.4
Zacaodao Indica_inter
9311xuan Indica_inter Jiangsu,China 32.4 119.4
Changfeng108 TEJ Fujian,China 26.1 119.3
Kongyu131 TEJ Japan 35.4 138.5
Kendao12 TEJ Heilongjiang,China 45.7 126.7
Kendao17 TEJ Heilongjiang,China 45.7 126.7
Kenjiandao13hao TEJ Heilongjiang,China 45.7 126.7
Kenjiandao14hao TEJ Heilongjiang,China 45.7 126.7
Longjing20hao TEJ Heilongjiang,China 45.7 126.7
Longjing21hao TEJ Heilongjiang,China 45.7 126.7
Longjing25hao TEJ Heilongjiang,China 45.7 126.7
Jinxuan1hao TEJ
Suidao13 TEJ Heilongjiang,China 45.7 126.7
Longqingdao1hao TEJ Heilongjiang,China 45.7 126.7
Puyou52 TEJ Heilongjiang,China 45.7 126.7
Puxuan28 TEJ Heilongjiang,China 45.7 126.7
Caidao Japonica_Inter
Wuyoudao1hao TEJ Heilongjiang,China 45.7 126.7
Jite639 TEJ Jilin,China 43.8 125.3
Songjing2hao TEJ Heilongjiang,China 45.7 126.7
Songjing10hao TEJ Heilongjiang,China 45.7 126.7
Dongnong428 TEJ Heilongjiang,China 45.7 126.7
Dongnong429 TEJ Heilongjiang,China 45.7 126.7
Longdao7hao TEJ Heilongjiang,China 45.7 126.7
46
Mudanjiang31 TEJ Heilongjiang,China 45.7 126.7
Changbai12 TEJ Jilin,China 43.8 125.3
Jupei TEJ
Liaoxing16 TEJ Liaoling,China 41.7 123.4
Jijing86 TEJ Jilin,China 43.8 125.3
Jiudao62 TEJ Jilin,China 43.8 125.3
Nip TEJ Japan 35.4 138.5
Tiejing4hao TEJ Liaoling,China 41.7 123.4
Kaijing1hao TEJ Liaoling,China 41.7 123.4
Shendao2hao TEJ Liaoling,China 41.7 123.4
Zhonghua11 TEJ Beijing 39.5 116.4
7981 TEJ
Tahungku Japonica_Inter
Kiang-chou-chiu Indica I
Mansaku TEJ
Baber Japonica_Inter
Aedal TEJ
Baghlaninangarhar TEJ
Changlijing MIX
Songxiangzaojing TEJ Shanghai,China 31.2 121.5
Zhonghua11 TEJ Beijing 39.5 116.4
Songxiangzaojing TEJ Jilin,China 43.8 125.3
Daohuaxiang MIX Heilongjiang,China 45.7 126.7
Xintuanheigu Japonica_Inter Yunnan,China 24.9 102.8
Shennong9741(huashizao) TEJ Heilongjiang,China 45.7 126.7
Shennong9816 TEJ Heilongjiang,China 45.7 126.7
47
Tiejing10 TEJ Liaoling,China 41.7 123.4
C4115 MIX Liaoling,China 41.7 123.4
Lindao16 TEJ Shandong,China 36.5 116.7
Lindao17 TEJ Shandong,China 36.5 116.7
Suxiu10hao TEJ Zhejiang,China 30.3 120.2
Suxiu9hao TEJ Zhejiang,China 30.3 120.2
Heukgyeong TEJ
Luktakhar TEJ
Npe844 Japonica_Inter
Gogolempuk TRJ
Trembese TRJ
L-202 TRJ
Yunjing26 MIX Yunnan,China 24.9 102.8
Sanlicun Indica I Shandxi,China 37.9 112.5
Ribenqing TEJ Japan 35.4 138.5
Shendao5hao TEJ Liaoling,China 41.7 123.4
Shengdao15 TEJ Shandong,China 36.5 116.7
Shengdao16 TEJ Shandong,China 36.5 116.7
Shengxiang2572 TEJ Shandong,China 36.5 116.7
Xujing8hao TEJ
Xindao20hao TEJ
Zhongdao1hao TEJ Beijing 39.5 116.4
Xindao29 TEJ
Wuyun1111 TEJ Jiangsu,China 32.1 118.8
Zhen9424 TEJ Jiangsu,China 32.1 118.8
Zhendao681 TEJ Jiangsu,China 32.1 118.8
48
Zrja129(irat129) TRJ
Yueyinjing TEJ
Liaoxing17hao TEJ Liaoling,China 41.7 123.4
Shennongxiangnuo1hao TEJ Heilongjiang,China 45.7 126.7
Yangguang600 TEJ
Ning9213 TEJ
Lvyijing TEJ Anhui,China 31.8 117.2
Huai66 TEJ
Huaidao5hao TEJ Jiangsu,China 32.1 118.8
Taijing1002 TEJ Jiangsu,China 32.1 118.8
Yangjing4227 TEJ Jiangsu,China 32.4 119.4
Ning5055 TEJ
Wuyunjing8hao TEJ Jiangsu,China 32.1 118.8
Nanjing44 TEJ Jiangsu,China 32.1 118.8
Huajing6hao TEJ Jiangsu,China 32.1 118.8
Lianjing6hao TEJ Jiangsu,China 32.1 118.8
Ningjing5hao TEJ Jiangsu,China 32.1 118.8
Yanjing9029 TEJ Liaoling,China 41.7 123.4
Yanjing10hao TEJ Liaoling,China 41.7 123.4
Taijing2hao TEJ Jiangsu,China 32.1 118.8
Taijing3hao TEJ Jiangsu,China 32.1 118.8
Yangyujing2hao TEJ Jiangsu,China 32.1 118.8
Hanyou8hao TEJ Shanghai,China 31.2 121.5
Jc157 Indica_inter India 26.9 75.8
Cuba65 MIX
Arc10352 AUS
49
Lijiang Japonica_Inter
Darmali Indica II
Yelaikmeedon Indica II
Beonjo TEJ
Chodongji TEJ
Douradoagulha TRJ
Kinastano TRJ
Maintmolotsy1226 TRJ
Rt1031-69 TRJ
Iac25 TRJ Brazil
Miriti AUS
Arias Indica II
Yujing13 TEJ Yunnan,China 24.9 102.8
Zhanjing12hao TEJ Yunnan,China 24.9 102.8
Zhanjing9hao TEJ Yunnan,China 24.9 102.8
Jingnuo TEJ
Zaoshu123bing1-07 TEJ
Zaoshu114bing12-09 TEJ
C013 TEJ
Liuqianxin13 TEJ Jiangsu,China 32.1 118.8
Yangjing349 TEJ Jiangsu,China 32.4 119.4
Wuyujing3hao TEJ Jiangsu,China 32.1 118.8
Xiushui40 TEJ Zhejiang,China 30.3 120.2
Yuejin2hao TEJ
Changxiangjing11-2 TEJ
N12 AUS
50
Domsofid MIX
Mehr MIX
6733 TEJ
Hulotao TEJ
Aichiasahi TEJ Japan 35.4 138.5
Tp309 TEJ
Kotobukimochi TEJ Japan 35.4 138.5
Padikasalle TRJ
Lac23 MIX
Canelladeferro TRJ
Lemont Japonica_Inter United States
Chujing28 TEJ Yunnan,China 24.9 102.8
Jiahe218 TEJ
Xiushui128 TEJ Zhejiang,China 30.3 120.2
Xiushui110 TEJ Zhejiang,China 30.3 120.2
Xiushui52 TEJ Zhejiang,China 30.3 120.2
31 TEJ
Zaoshu134bing09-03 TEJ
Xiushui117 TEJ Zhejiang,China 30.3 120.2
Nongke TEJ
Xiushui620 Japonica_Inter Zhejiang,China 30.3 120.2
Changlijing MIX
Nanjing46 TEJ Jiangsu,China 32.1 118.8
Dank4 TEJ
Wuyujing10hao TEJ Jiangsu,China 32.1 118.8
Xiushui24 TEJ Zhejiang,China 30.3 120.2
51
Chunjiang03jing TEJ
Xiushui46 TEJ Zhejiang,China 30.3 120.2
Nanjing46 TEJ Jiangsu,China 32.1 118.8
Xianghu492 TEJ
Xiushui48 TEJ Zhejiang,China 30.3 120.2
R1120 TEJ
Jia64 TEJ Zhejiang,China 30.3 120.2
Changyou1hao TEJ
Yelicanghua TEJ Tianjing,China 39.5 116.4
Chishi TEJ Japan 35.4 138.5
Balsamo Indica_inter Philippines 15.0 121.0
Rexoro/red
rice//r252 TRJ United States
Arc10521 TRJ India 28.4 77.1
Kpbctocka
ABC6/10 MIX Bulgaria
Xinrong TEJ Japan 35.4 138.5
Earlykalpi TEJ
80a60yr7
1009-1-5 Japonica_Inter Australia -13.1 142.1
Elid TEJ
Secono
brazil TEJ Brazil
Cpslo17 MIX United States
Gasmal72-1 MIX Bangladesh 23.7 90.4
Wumangshuidao TEJ Shandxi,China 37.9 112.5
52
Kpbctocka
II15A Japonica_Inter Bulgaria
Jonazo TEJ South Korea 37.3 126.6
Allorio TEJ Portuguesa
80a90yr7
2078-25 TRJ Australia -13.1 142.1
Xihai63hao TEJ Japan 35.4 138.5
Irat8 TRJ Coate d'Ivoire
Taeguna TEJ South Korea 37.3 126.6
Bidong7hao/BL7 Japonica_Inter Japan 35.4 138.5
Dosan
zo37 TEJ South Korea 37.3 126.6
Chimao TEJ Japan 35.4 138.5
Damagum TEJ Indonesia -6.0 107.0
Yr196 Japonica_Inter Australia -13.1 142.1
Muando TEJ South Korea 37.3 126.6
Huanghai53 TEJ North Korea 40.0 127.0
Binbei545 Indica_inter Bulgaria
80a86yr7
2154-17 Indica_inter Australia -13.1 142.1
Kangcheong
do TEJ South Korea 37.3 126.6
Dongyu220 TEJ Japan 35.4 138.5
Καρα
δνηδ
ΝjiblΝ
TEJ soviet union
53
Nonglin22hao Japonica_Inter Japan 35.4 138.5
Dnt157 AUS Pakistan 33.4 73.1
Boegi
jmba TRJ Indonesia -6.0 107.0
Bj1 AUS Philippines 15.0 121.0
Ucp48 AUS India 28.4 77.1
Asdt Indica_inter India 28.4 77.1
Mudo MIX India 28.4 77.1
Jabonl AUS Bangladesh 23.7 90.4
Buluputih MIX Indonesia -6.0 107.0
Rathuheenati TRJ Sri Lanka 6.6 80.0
Shannuo TEJ Japan 35.4 138.5
Tuojiangnuo5hao TEJ Sichuan,China 30.6 104.1
Dj10 AUS Bangladesh 23.7 90.4
Pashui/PASHUI TEJ
Honduras TRJ United States
Asecellaroba TRJ Indonesia -6.0 107.0
Buyagaw TRJ Philippines 15.0 121.0
Gondomono TRJ Indonesia -6.0 107.0
Aselotang TRJ Indonesia -6.0 107.0
Jianada1hao Indica I
Wuxiunuo TEJ Jiangsu,China 32.1 118.8
Shanfunuo/nonglinnuo192hao TEJ Japan 35.4 138.5
Richuhunuo TEJ Japan 35.4 138.5
Te54 TEJ Japan 35.4 138.5
Aoyu247 TEJ Japan 35.4 138.5
54
Dongshouxi1 TEJ Japan 35.4 138.5
Fengguo32hao TEJ Japan 35.4 138.5
Pinxi147 TEJ Japan 35.4 138.5
Tongjiao17hao TEJ Jilin,China 43.8 125.3
Zhuang402 TEJ Japan 35.4 138.5
Fuxi3339 TEJ Japan 35.4 138.5
Yanan12hao TEJ North Korea 40.0 127.0
Teng842 TEJ Japan 35.4 138.5
Zhuang391 TEJ Japan 35.4 138.5
Aoyum317 TEJ Japan 35.4 138.5
Zhuang616 TEJ Japan 35.4 138.5
Qiuxi116 TEJ Japan 35.4 138.5
Zhongbu49 TEJ Japan 35.4 138.5
Zhongbu46 TEJ Japan 35.4 138.5
Yuxi105 TEJ Japan 35.4 138.5
Qiuxi TEJ Japan 35.4 138.5
Zhongbu45 TEJ Japan 35.4 138.5
Qiutian36 TEJ Japan 35.4 138.5
Yuxi110 TEJ Japan 35.4 138.5
Huangkenuo(1) TEJ Japan 35.4 138.5
Zhixuan3hao Indica I Jiangsu,China 32.1 118.8
Huangjinguang/nonglin266hao TEJ Japan 35.4 138.5
Fengxu/nonglin260hao TEJ Japan 35.4 138.5
Yuzhan TEJ North Korea 40.0 127.0
74-24xuansan TEJ
Hugaiyi99 TEJ North Korea 40.0 127.0
55
Daoshanjin TEJ Japan 35.4 138.5
Shishi TEJ Japan 35.4 138.5
Fengtianzaosheng TEJ Japan 35.4 138.5
Qiutian39 TEJ Japan 35.4 138.5
72-125 TEJ
Yuxi117 TEJ Japan 35.4 138.5
Shenli TEJ Japan 35.4 138.5
K3 TEJ Japan 35.4 138.5
Kebeijisiqi TEJ North Korea 40.0 127.0
Jianongnuo8 TEJ
Kunnong8hao TEJ Jiangsu,China 32.1 118.8
Yuhong3hao TEJ
Wucangjin TEJ Japan 35.4 138.5
Dadiannanhai19hao TEJ Japan 35.4 138.5
Supplementary Table 8 Primers used for mapping, vector construction and qRT-PCR
Primers' Name Forward primer Reverse primer Aims
HAN1-Seq1 gctatctcttgggctagatg Aagtagagttgtggagcagc Sequencing of HAN1
HAN1-Seq2 ctagctccagctccacttct Agcatctccgtgtaccagtc Sequencing of HAN1
HAN1-Seq3 cttcatcgtcctgtggatct Catgaggagccagaagaacc sequencing of HAN1
HAN1-Seq4 catggtgatcagcttcatca Ccttggatctatcaaggatc sequencing of HAN1
HAN1_OX ctagaggatccccgggtaccatg
atttgcttcatggcgtgg
Gatcggggaaattcgagctctt
aactactggtcaattcccc
Construct for overexpression
HAN1_EX cagtgaagacaatttgatgatttgc
ttcatggcgtg
Cagtgctcttcaactactggtca
attcccctc
Construct for inducible expression
56
HAN1_Cas9 cagtggtctcaggcgggcgttcta
ccgcaac
Cagtggtctcaaaacgttgcgg
tagaacgccc
Construct for CRISPR/Cas9 line
HAN1_SubL cagtgaagacaacaacatggcgt
ggttcgtcgcggc
cagtgaagacaatacaactact
ggtcaattcccctc
Construct for subcellular location
HAN1_Yst cagtgtggtggaattcaacacaat
gtctgcgtggttcgtcgcggcttg
cgaagggccctctagattaacta
ctggtcaattcccctcc
Construct for expression of HAN1 in Yeasts
CYP94B3_Yst cagtgtggtggaattcaacacaat
gtctgcatttcttctgagttttttgata
cgaagggccctctagattaaac
gttgttaaggatgtgac
Construct for expression of CYP94B3 in Yeasts
HAN1_Compl aaaggatccaagagtattcgtgta
catgggctta
tttgaattctttcagtaaatcggtg
aacatctct
Construct for complementation
HAN1_Prom1 tacgaattcgagctcggtaccggt
catatatcccagaactacag
ttaccctcagatctaccatgggct
tctcctctctctcgatccctc
Construct for promoter activity (GUS) of HAN1
HAN1_Prom2 acgacggccagtgccaagcttgg
tcatatatcccagaactacag
tgtttttggcgtcttccatgggaa
gcaaatcatgcttctcctct
Construct for promoter activity (LUC) of HAN1
GP2010-1955 ccttgtggtggtgatggtga gacgttgaagatgcccatgc Genotyping for CRISPR/Cas9 line, han1
TvexF gctcgactctaggatcttcg atctccgtgtaccagtccag Genotyping for pER8::HAN1 transgenic plants
Tv303F caggtcgactctagaggatc atctccgtgtaccagtccag Genotyping for 35S::HAN1 transgenic plants
Tv1300F ggcgattaagttgggtaacg agttcggtgttcagtcatcg Genotyping for pHAN1::HAN1 transgenic plants
Tv1301GusR ggcgattaagttgggtaacg tcatcatcatagacacacg Genotyping for pHAN1::GUS transgenic plants
001709F/R gttggtgagtttagggttag ctttccctacacaaaccctc Genotyping for the wild type of CYP94B3
001709F/pROK2LBa1 gttggtgagtttagggttag gttcacgtagtgggccatcg Genotyping for the mutant of CYP94B3
RM518 ctcttcactcactcaccatgg atccatctggagcaagcaac SSR marker (2034709bp)
RM261 ctacttctccccttgtgtcg tgtaccatcgccaaatctcc SSR marker (6578953bp)
RM332 gcgaaggcgaaggtgaag catgagtgatctcactcaccc SSR marker (2840213bp)
RM536 tctctcctcttgtttggctc acacaccaacacgaccacac SSR marker (8990534bp)
57
RM5857 acagcttgtctttatttcctg gatggtaatccaggttgttg SSR marker
RM26652 caatccattgctggttgatgc caagatctccaaggtgctgagg SSR marker
RM287 ttccctgttaagagagaaatc gtgtatttggtgaaagcaac SSR marker
RM229 cactcacacgaacgactgac cgcaggttcttgtgaaatgt SSR marker
R11ID443 ccctgcatcataagggactt cgcttatcttggcatgatcag InDel marker
R11ID542 ccctgcatcataagggactt cgcttatcttggcatgatcag InDel marker
R11ID722 ccagcagccacaatgctata gagagtatggtgtccattag InDel marker
R11ID807F aagcttctgttcacaagctc gaatgggtgctatcactcag InDel marker
R11ID1551 tgttatgccaccatctttgc gggagagaaacccttcatcc InDel marker
R11ID1646 ctcattatgactcaatgttcc tttatccgacgtatgatccac InDel marker
R111ID1677 ccttcaagacctgaattgtg actgtacacacctcacagac InDel marker
R11ID1693 ccattgtttcctgcactagtt gaggctttgttgatggtatac InDel marker
R11ID1699 tggttgctaacatggcctga tgtgagtgatgattggtgcc InDel marker
R11ID1711 agaggagacgaggagataag gcctcttaactaaccgtcag InDel marker
R11ID1733 ataccaacggttgatgtgatg cactagatcaaagaggcagc InDel marker
R11ID1764 tcagctaccattgcaagctg aactaccaacaagtcgcctc InDel marker
HAN1_qPCR cttgtggtggtgatggtgag gcatctccgtgtaccagtcc RT-qPCR
OsDREB1F aggacgccatcttcgacat gtcgagagatctcccaatcg RT-qPCR
OsDREB1G aacagtacggcagtggcagtc agatggcttcttcgtccatg RT-qPCR
OsDREB1I cccgtactacgaggtcatgg gctacctacggcaggatcac RT-qPCR
OsDREB1E gaattcgaaatgcaggggta ctcgcagtcgtagtcctcct RT-qPCR
OsDREB1C caaagcttatcagcagtagc ggttagtagcagaaagacttg RT-qPCR
OsDREB1D caacatggacttcgaccagc tagctccagagtgtgacgtc RT-qPCR
OsDREB1B gatggcgacgaagaagaaga gaacctgaacccgtcgtc RT-qPCR
OsDREB1H cttcatcgatcgacggaacg cgtagtacgtgtcgtagtcc RT-qPCR
58
OsDREB1A acctgtactacgcgagcttg tagtagctccagagtgggac RT-qPCR
Ubiquitin 5 accacttcgaccgccactact acgcctaagcctgctggtt RT-qPCR
Actin tggcatctctcagcacattcc tgcacaatggatgggtcaga RT-qPCR
GUS caagagtatcagtgtgcatgg cgaagttcatgccagtccag RT-qPCR