780 MAMMALIA

A mitochondrial cytochrome b phylogeny confirms the paraphylyof the Dendromurinae Alston, 1896 (Muridae, Rodentia)

by E. VERHEYEN1,M. COLYNz and W. VERHEYEN'

1Section Taxonomy and Biochemical Systematics, Royal Belgian Institute of Natural Sciences,Vautierstraat 29, B-1000 Brussels, Belgium

Z CNRS URA 373, Station Biologique de Paimpont, F-35380 Plelan-le-Grand, FranceJDepartment biology, University of Antwerp (RUCA), Groenenborgerlaan 171,

B-2020Antwerp,Belgium .

The subfamily Dendromurinae has occupied various systematic positions in thedifferent classifications of the Muroidea and different genera have been attributed tothis taxon (e.g. Lindsay 1988, Chaline et al. 1977). For example, the genus Deomys(Thomas, 1888), originally believed to be a link between the cricetid and muridrodents, has subsequently been attributed to the Dendromurinae. Alston, 1896 ; to itsown subfamily Deomyinae Ellerma'n, 1941, before being reallocated to the Dendrom:u-rinae by Rosevear (1969) and Meester and Setzer (1971), (see also Musser and Carle-ton 1993).

A recent study using morphological and DNA-DNA hybridisation data concludesthat the Dendromurinae are paraphyletic and'that the status of this subfamily. has to berevised (Denys et al. 1995). The present study evaluates this hypothesis by studying asimilar set of taxa with another molecular marker. We compare an UPGMA-tree basedupon DNA-DNA hybridisation data (Denys et al. 1995) with 'a'mitochondrial DNAphylogeny based upon parsimony an'alyses of a portion of the cytOchrome b gene (cytb).

DNA was isolated from tissue samples of the collections of the department of bio-logy of the University of Antwerp (RUCA). This study concerns 10 spedes represen-ting the Murinae Illiger, 1815, Cricetomyinae Roberts, 1951, Dendromurinae Alston,1896 and Gerbillinae Gray, 1825. We sequenced a portion of the mitochondrial cyt bgene of 2 specimens/species of Arvicanthis nairobae J.A. Allen, 1909; Cricetomysgambianus Waterhouse, 1840; Lophuromys flavopunctatus Thomlls, 1888; Deomysferrugineus Thomas, 1888 and one specimen/species of Steatomys krebsii Peters,1852 ; Steatomys pratensis Peters, 1846 ; Tatera valida (Bocage, 1890) ; Taterillus gra-cilis (Thomas, 1892); Hybomys univittatus (Peters, 1876) and, one specimen of anHybomys species to be described yet.

,PCR-reactions and DNA sequencing protocols have been described elsewhere(Verheyen et al. 1995). The primers used to amplify a 402 bp long cyt b gene segmentwere L13724 (5'-cgaagcttgatatgaaaaaccatcgttg-3') and H14139 (5'-aaactgcagcccctca-gaatgatatttgtcctca-3', Kocher et al. 1989). The cyt b sequences (see annex) as well asinformation about the origin of the used specimens are available upon request.

Mammalia, t. 60, n° 4, 1996: 780-785.

NOTES 781

We analysed 357 base pairs (bp) of the mitochondrial cyt b fragment. In total 156sites are variable and 134 sites are parsimony informative (1" codon positions: 28 ; 2 adpositions: 9 ; 3 rdpositions : 97). Pairwise comparisons among the homologous sites ofthe studied cyt b fragment show that the majority of overall transition/transversion(ts/tv) ratios for intersubfamily comparisons approximate one (Verheyen et al. in prep.)and suggest that the studied rodents have diverged long ago or have undergone rapidmutation rates in comparison with other mammals (Irwin et ai. 1991; Vrana et ai.1994). In agreement with the degenerate nature of the amino acid code, third and firstcodon positions show most of the observed variation.

The mtDNA sequences were analysed using the parsimony method (Swofford1993, PAUP 3.1.1). We used the published cyt b sequences (Smith and Patton 1991) ofAkodon bo/iviensis Meyen, 1833 and Boiomys amoenus (Thomas, 1900) - two neotro-pical murids that belong to the neotropical subfamily Sigmodontinae - as outgroupsequences against the African murids of our dataset. The problem of potentially disin-formative mutationa~ changes in first and third codon positions was assessed throughanalyses using the "transversions only" settings, by downweighting the mutationalchanges in first and third codon positions and/or by leaving out transitional changes infirst positions of triplets coding for leucine (Meyer 1994).. The tree shown (fig. 1) is the single most parsimonious tree obtained after a heu-ristic search using conservative chartges sensu Irwin et ai. (1991) Le. considering allsubstitutions in codon position One - except leucine codons transitions - all substitu-tions in codon position two, and transversions in codon three positions. PAUP-settingswere: acctran, 10 replications, random addition of taxa, weights for 1st, 2adand 3rdcodon positions: 3, 10 and 1 and bootstrap values shown were obtained after 500 repli-cations. Additional heuristic analyses, using different transversion weightings (ts 1/ tv 5 ;ts1/tv10, transversions only) resulted in trees with the same clades than in the phylo-geny shown. . .

Arvicanthis

Arvicanthis

HybomysHypomys

Deomys ILophuromys r;lLophuromys !ill

Cricetomys ~Cricetomys ~

- 99 r Steatomys I8teatomys.Taterillus ~

Tatera ~

59

59n.s.

97 92:

96

100

o

II

Sigmodontinae

Murlnae

Dendromurinae

'acomyines'

Cricetomylnae

Dendromurinae

Gerblilinae

Fig. 1. - With regard to the affihitions between the two dendromurine taxa stiJdied here, theshown cytochrome b phylogeny is' concordant to the tree derived from DNA-DNA-hybridi.sation data (Denys et ai. 1995). The tree shown is the single most parsimonious tree (CI0.751, length = 413) obtained after parsimony analyses carried out as described in the text.Numbers above branches are % bootstrap values obtained after 500 replications. -

782

AkodonBolomys_Arvica 7631Arvica-6072

Cricet-7221Crice 11746TaterIllus

; -Deom R1323.7. Hybo-R12107

.Hybo -G10023

:Lophur 7253,_Lophur-7366SteaTM40998

SteaTM41035

Tater_11734

Akodon,-f!olomyS--Arvica 7631Arvica-6072Cricet -7221Crice 11746

'TiiterIllusDeom R13237

.Hybo-R12107

Hybo:::Gl0023Lophur 7253Lophur-7366SteaTM40998SteaTM41035Tater 11734

AkodonBolomyS--Arvica 7631Arvica-6072Cricet-7221

,Crice 11746TaterIllusDeom R13237

,Hybo-R12107

Hybo:::GI0023Lophur_7253I,ophur 7366SteaTM40998SteaTM41035

Tater_11734

AkodonBolomyS--Arvica 7631

Arvica 6072Cricet -7221

Crice 11746TaterIllusDeom R13237

Hybo:::R12107Hybo G10023Lophur 7253'Lophur-7366SteaTM40998SteaTM41035

Tater_11734

MAMMALIA

CACTCATTCATTGACCTACCAACTCCATCTAACATCTCATCCTGACATTCATTCATTGATCTTCCAACCCCATCTAACATTTCATCATGACACTCATTCATCGATCTCCCCGCTCCATCTAACATTTCATCATGACACTCATTCATCGATCTCCCCG?TCCATCTAACATTTCATCATGACACTCATTCATTGACCTCCCTACCCCATCCAACATCTCATCATGACACTCATTCATTGACCTCCCTACCCCATCCAACATCTCATCATGACACTCATTCATCGACCTACCCA~TCCCCCCAATATCTCATCATGACACTCATTCATTGACCTTCCAACCCCATCCAATATCTCATCATGACACTCATTCATTGACCTGCCCGGCCCATCCAACATCTCTTCAT~h_CACACATTCATTGACCTGCC.TACC'?TATCTAACATCCTTTCATGACACTCATTCATCGACCTTCCTGCCCCCTCCAACATCTCATCCTGACACTCATTCATCGACCTTCCTGCCCCCTCCAACATCTCATCCT~A?ACTCATTTATTG?????CCCACCCCATCAAACATCTCATCCTGAGACTCATTCATCGATCTTCCTA~CCCATCAAACATTTCATCCTGACACTCATTCATTGATCTTCCCACTCCTCQTAACATTTCATCATGA

TGAAATTTTGGATCCCTACTAGGCATATGCCTAATAATCCAAATTTGAAACTTCGGATCCTTACTAGGCATATGCCTAATAATCCAAATC

TGAAACTTTGGCTCCTTACTAGG?ATTTGCCTAATATTACAAATCTGAAACTTTGGATCCTTACTAGGTATTTGCCTAATATTACAAATC

TGAAACTTCGGCTCCATTCTAGGCATTTGTTTAATCCTGCAAATCTGAAACTTCGGCTCCATCCTAGGCATTTGTTTAATCCTACAAATC

TGAAACTTTGGATCCCTTCTTGGCATCTGTCTCATTATCCAAATT.

TGGAACTTTGGCTCCCTACTAGG? ATCTGCCTAATT?TS;CAAATC. .

TGAAACTTTGGCTCTTTACTAGGAATCTGCTTACTAG-mCAAATC.

TGAAACTTTGGCTCTTTACTAGGAATCTGCTTAATAGTACAAATCTGAAACTTTGGCTCCTTACTAGGCGTCTGCCTCATCCTTCAAATCTGAAACTTTGGCTCCTTACTAGGCGTCTGCCTCATCCTTCAAATC-TGGAATTTTGGCTCCCTACTAGGAATTTGCTTAGTAGTCCAAATTTGA?ACTTTGGTTCCCTATTAGGAGTCTGTCTAGTAGTACAAATCTGAAATTTTGGGTCACTTCTAGGCCTCTGCCTAATTATCCAAATC

T'I,'AAc:;AGGCCTATTCCTAGCCATACACTACACATCAGACACAACC .

CTAACAGGCCTATTTCTAGCAATACACTACACATCAGA?ACAACC

ATTACAGGCCTATTTCTAGCCATACACTACACATCAGACACAAC~A'j:TACAGGCCTATTTCTAGCCATACACTACACATCAGACACAACATTAACAGGATTATTTCTAGCTM'ACATTATACATCAGATACAACATTAAC~GGATTATTTCTAGCTATACATTATACATCAGATACAACA.

GCTACAGGATTATTTTTAGCAATACACTACACAGCAGACACAP,TAACTACAGGCCTATTCCTAGCTATACACTATACACCAGACACCATAATTACAGGCCTATTCCTAGcCATACACTATACATCAGACACAACA .

GTTACAGGCCTATTCCTAGCCATACACTATACATCAGATACAACAGCCACAGGCCTTTTCCTAGCTATACATTACACCTCCGACACCGCAGCCACAGGCCTTTTCCTAGCTATACATTACACCTCCGACACCGCACTCACAGGCCTATTCCTAGCAATACATTATACCTCTGACACTACTCTTACAGGTCTATTTCTAGCAATACATTACACCTCTGATACAACT

ACAACAGGATTATTTCTAGCAATACACTATACAGCCGATACAACT

ACAGCATTCTCCTCAGTAGCACATATCTGCCGAG~GTAAACTAC

ACAGCATTCTCCTCAGTCGCACATATCTGCCGAGACGTGAACTATACAGCATTCTCCTCAGTCACTCACATTTGTCGAGATGT?AATTACACAGCATTCTCCTCAGTCACTCACATTTGTCGAGATGTCAATTACACTGCATTCTCATCAGTCACCCACATCTGCCGAGACGTTAATTAC

ACTGCATTCTCATCAGTCACCCACATCTGTCGAGACGGTAATTACACAGCATTTTCATCAGTGTCCCATATCTGTCGAGACGTAAACTATACAGCATTCTCATCAGTCACCCATATTTGCCGAGATGTCAACTAT

ACAGCATTCTCATCAGTTACCCACATCTGTCGAGACGTAAACTACACAGCATTTTCATCAGTAACTCACATTTGTCGAGACGTAAACTACACAGCATTTACATCAGTCACACACATCTGCCGAGACGTAAATTAC

ACAGCATTTACATCAGTCACACACATCTGCCGAGACGTAAATTAC,

ACCGCATTCTCATCAGTTACTCATATCTGCCGAGACGTAAATTAC

ACCGCCTTTTCATCAGTTACCCACATTTGCCGGGACGTAAACTACACAGCATTTTCATCCGTATCTCATATCTGCCGAGATGTAAACTAT

Annex - Mitochondrial cytochrome b sequences used in this paper.

AkodonBolomyS-Arvica 7631

_Arvica-6072C.ricet=7221Crice 11746TaterIllusDeom Rl3237Hybo=R12107Hybo G10023

.Lophur 7253Lophur-7366.5teaTM40998SteaTM41035

:I'ater_11734

AkodonBolomyS-Arvica 7631Arvica-6072Cricet -7221Crice 11746TaterIllus

.Deom R13237

Hybo=R12107Hybo_G10023

Lophur_7253Lophur 7366SteaTM40998SteaTM41035

Tater_11734

AkodonBolomyS-Arvica 7631.Arvica-6072

Cricet -7221Crice 11746TaterIllusDeom R13237

Hybo-R12107

Hybo=G10023Lophur 7253Lophur-7366SteaTM40998

SteaTM41035

Tater_11734

AkodonBolomyS-Arvica 7631Arvica-6072Cricet -7221

Crice 11746TaterIllus

Deom R13237

Hybo-R12107

Hybo=G10023Lophur 7253

Lophur-7366SteaTM40998SteaTM41035Tater 11734

NOTES 783

GGATGATTAATCCGCTACTTGCACGCTAATGGAGCCTCCATATTCGGATGATTAATCCGCTACtTACACGCCAACGGAGCCTCCATATTCGGATGACTAATTCGATACATACATGCAAACGGAGCCTCAATATTCGGATGACTAATTCGATACATACATGCAAACGGGGCCTCAATATTCGGATGACTAATCCGTTATTTACACGCAAACGGAGCCTCAATATTCGGATGACTAATCCGTTATTTACACGCAAACGGAGCCTCAATATTC'GGATGA?TTATTcGATATATACATGCAMCGGAGCTTCAATATTCGGCTGATTAATCCGATATCTCCATGCAAATGGAGCTTCTATATTCGGATGACTAATCCGATATATACACGCAAATGGAGCCTCAATATTCGGATGATTAATCCGATATATACACGCAMCGGGGCCTCAATATT?GGCTGACTAATCCGCTATCTCCACGGAAACGGAGCCTCCATATTTGGCTGACTAATCCGCTATCTCCACGGAAACGGAGCCTCCATATTTGG?TGACTAATCCGCTATGTTCACG?CAATGGGGCCTCCATATTTGGATGACTAATCCGTTATCTTCATGCCMCGGAGCTTCCATATT?

GGATGATTMTTC:~ATATATACATGCA¥CGGAGCTTCCATATTT

TTTATCTGCCTCTTCATCCACGTAGGcCGAGGTATTTACTATGGTTTCATCTGTCT'i'TTcATCCATGTAGGCCGAGGAATTTACTATGGCTTTATCTGCCTATTCCTACATGTAGGACGAGGCATATACTACGGATTTATCTGCCTATTCCTACATGTAGGGCGAGGCATATACTACGG?TTCATTTGCCTATTTATCCACGTAGGACGAGGCATCTACTACGGCTTCATTTGCCTATTTATCCACGTAGGACGAGGCATCTACTACGGCTTCATTTGTCTATTTATTCATATCGGACGGOOAATCTACTATGGATT?ATTTGCCTAT?TCTACACGTAGGTCGJ\~ATTTATTACGGTTTCATTTGCTTGTTTGTTcATGTAGGACGAGGAATATACTATGGATT?ATTTGCCTGTTCCTCCATGTAGGACG¥GGATATACTATGGATTCATTTGC1TATTCCTACACGTAGGCCGAGGGATTTACTACGGCTTCATTTGC?TATTCCTACACGTAGyCCGAGGGATTTACTACGGC 'TTCATTTGCCTTTTTATCCATGTAGGCCGAGGAATTTATTATGGA???ATTTGTCTATTTATTCATGTAGGCCGAGGAATTTACTACGGA

TTTA~::~T~~~~C_~~~~~A~ATTTATTATGGC

TCCTATACCCTCTCAGAAACCTGMACATTGGCATCATCTTATTCTCCTATGTCCTATCAGMACCTGAAATATTGGTaTTATCTTATTTTCCTATACATTTCTAGAGACATGAAACATTGGTGTAGCATTACTATCCTATACATTTCTAGAGACATGAAACATTGGTGTAGCATTACTATCTTTCACCTCAATAGAAACATGGMCGTAGGcATCATCCTACTATCTTTCACCTCAATAG1\AACATOOAACGTAc;(;cATCATCCTACTATCATATATTTT?ACCGAAACAT<;AAACATCGGAGTTTTACTACTATCATATACCTTCATAGAAACCTGAAATATTooTATTATTCTACTATCCTATACATT.TCTAGAAACATGAAATATCGGAGTTATCCTACTATCCTATACATTTGTAGAAACATGACACATTGGGATTATTCTACTATCCTACACCATGATTGAAACATGAAACATCGGAATTATCCTACTATCCTACACCATGATTGAAACATGAAACATCGGAATTATCCTACTATCATTTACATCAGTAGAAACATGAAACGTTGGCATTATCTTACTGTCATTTACATCAGTAGAAACATGAAATGTTGGCATTATTTTATTG

TCCTACCTCTACACAGAAACATGAAATAT!=GGAATCATCTTACTT

CTCACAACTATAGCAACAGCATTTGTAGGATATGTACTCCCATTTACAACTATAGCAACAGCATTCGTAGGATATGTCCTTCCATTTGCAGTCATAGCTACAGCATTCATAGGTTATGTACTTCCATTTGCAGTCATAGCTACAGCATTCATAGGTTATGTACTTCCATTCACAGTAATAGCAACCGcATTCATAGGCTACGTTCTTCCATTCACAGTAATAGCAACCGCATTCATAGGCTACGTTCTTCCATTTTCCGTTATAGCCACTGCCTTTATAGGGTATGTACTTCCATTTGCTGTCATAGCCACCGcATTCATAGGATATGTCCTTCCATTCACAGTTATAGCTACTGCATTTATAGGCTATGTACTTCCATTTACAGTTATAGCCACCGCATTTATAGGATATGTACTTCCATTCACTGTAATAGCAACTGCATTCATAGGTTATGTACTTCCATTCACTGT?ATAGCAACTGCATTCATAGG?TATGTACTTCCATTTACAGTTATAGCAACAGCATTCATAGGTTATGTTCTCCCATTTACAGTTATAGCCACAGCATTTATAGGTTATGTTCTCCCATTTTCCGTAATAGCTACTGCATTCATAGGTTATGTTCT????

Annex (suite)

784 MAMMALIA

Except for the position of the Gerbillinae in our dataset (not supported by signifi-cant-bootstrap values), our cyt b phylogeny agrees with the UPGMA tree derived fromDNA-DNA hybridisation data (Denys et al. 1995). Also in our cyt b phylogeny thedendromurines are paraphyletic, e.ven in parsimony trees obtained using different ts/tvsettings and weighting schemes. Whereas in trees obtained without differential' weigh-ting for different codon positions the Steatomys-Cricetomys clade is absent,' the Deo-mys-Lophuromys clade was always.present.' _' .

We suggest that the clustering pf Deomys with the Lophuromys clade may be less .'

. surprising than has been suggested elsewhere (Denys etal. 1995). The Deomys Skull is " '

not only very-distinct from that of other dendromurines; but' its .zygomatic plate and'internal organs (stomach) have been reported -to resemble the same features ih Lophu-.romys (Rosevear 1969, Dieterlen 1976). .

It is reassuring to conclude that the presented cyt b phylDgeny confirms the para-phyly of the Dendromurinae as has been suggested based.upon a tree derived from the.DNA-DNA hybridisation data (Denys et al. 1995). However, in view of the discrepan-cies between the trees derived from molecular and morphological data from Denys etal. (1995), it is clear that additional molecular and morphological data will be requiredto establish the "true" interrelations among the dendromurines. Finally, as has beensuggested earlier, partial cyt b sequ~nces are not the most suitable ctataset for phyloge-netic studies 'of rodents (e.g. Verheyen et al. 1995). Early saturation of 3rd positionchanges and limited variation in 1st and 2nd position changes seem to result in toolittle phylogenetic information to yield conclusive answers concerning inter(sub) familyquestions in rodents. ' .

. We appreciate the comments of T. Backeljau and two anonymous referees on this manus-cript. EV and WV were supported by program 2.90004.90 of the FKFO. We thank K. Bteugel-mans and J.M. Timmermans for excellent technical assistance during this project.

Bibliography.

CHALlNE,J., P. MEINand F. PEllER, 1977. - Les grandes \ignes d'une classification evolutivedes Muroidea. Mammalia, 41 : 245-253.

DENYS,C., J. MICHAUX,F. CATZEFLIS,S. DUCROCQand P. CHEVRET,1995. - Morphologicaland molecular data against the monophyly of Dendromurinae (Muridae: Rodentia).Bonn. Zool. Beitr., 45: 173-190.

DIETERLEN;F., 1976. - Die Atrikanische Muridengattung Lophuromys Peters, 1874. Stuttgarter:Beitrage zur Naturkunde, Ser. A, 285 : 1-96.

IRWIN,D.M., T.D. KOCHERand AC. WILSON,1991. - Evolution of the cytochrome b gene ofmammals.J. Mol.Evol.,32: 128-144. .

KOCHER,T.D., W.K. THOMAS,A MEYER,S.V. EDWARDS,S.PAABO,F'x. VILLABLANCA~ndAC. WILSON,1989.- Dynamics of mitochondrial DNA evolution in animals: Amplifi-cation and sequencing with conserved primers. Proc. Natl. Acad. Sci. USA, 86: 6~96-6200. .

LINDSAY,E.A, 1988. - Cricetid rodents from Siwalik deposits near Chinji village. Part I.: Mega-cricetodontinae, Myocricetodontinae and Dendromurinae. Palaeo vertebrata, 18: 95-154.

MEESTER,J. and H. SETZER,1971. - The Mammals of Africa. An Identification Manual. Smith-sonian Inst. Press, Washington DC.

MEYER,A, 1994. - Shortcomings of the cytochrome b gene as a molecular marker. TREE, 9 :278-280.

r

NOTES 785

MUSSER,G.G. and M.D. CARLETON,1993. - Family Muridae, pp. 501-755. In: "Mammal Spe-cies of the World: A Taxonomic. and-Geographic-Reference". Don E. Wilson and DeeAnnM.Reeder(eds.). ' ,

ROSEVEAR,n.R., 1969. - Rodents of West Africa. ,London: British Museum (Nat. Hist.).SMITH,M.F. and J.L. PATTON,1991. - Variation in the ~itochondr1al cytochrome b sequence in

natural populations of South American .akodontine rodents (Muridae: Sigmodontinae).Mol. Bioi. Evol., 8: 85-103. . ". '.~ '., . -, .

... ~ .' .. ':"

SWOFFORD,D.L., 1993. - PAUP : Phylogenetic Ahalysis .Us[ng'Pr;iI;simony, version 3.1.1. Com-o puter program distributed by.thdllingiS Nawial History ~rVey, Champaign, Illinois.

VERHEYEN;E., M. COLYN and W. VERtlEYEt'/: 1995. - The, phyiogeny of some Mrican muroids" '(Rodentia) based upon partial mitochondii,a! ~cytoctJrome b gene sequences. Belg.:/.Zool., 125 : 403-407. . 0 ',' .:,-

VRANA;P.B., M.C. MIUNKOVITCH, J.R.:POWELL.ind W,C. 'WHEeLER, 1994. - Higher level rela-tionships of the arctoid carnivora based on sequence data and "total evidence". Mol..Phyl. Evol., 3 : 47-58.

o "

" "

'I .'

. . ". \ - ".

The effects of additional food 'on tbe demography of rodentsin a subtropical grassland in Swaziland

" .. -~.:. - .' .~. _ '::-";'<0". .'... ._

1 Department of Biological Sciellces,l!niversiiy of Swaziland,P/Bag 4.. K»!alus.eni, S.waziland. "

1 Departmentof ZoologyandEntomology,UniversityofNataJ;P/BagX01, Scottsville,3209, Pietermariizburg, South Afr~ca

Manipulated increases in food supply have resulted in: 1) extension of the bree-ding season (Hubert et at. 1981, Zubaid and Gorman 1993), 2) increases in populationsize (Doonan and Slade 1995, Flowerdew,1972), 3) decreases in home range (Taitt1981), and 4) increases in body weight (~irs et at. 1990, Neal and AIibhai 1991).

The objectives of this study were to experimentally ascertain the effect of additionof supplemental food on a population of rodents in a grassland habitat in Swaziland.

Three permanently marked grids (100 m x 100 m) were established, in May 1995,on an unutilized natural grasslandsite ,in0t,he Swaziland middleveld, near Matsapha(26°33'S 31°16'E). One plot served as the c()~troI.The experimental plots received 8 kgof food, consisting of equal amounts of rolled oats and rabbit pellets, in opened 340 mlcoke cans from July (immediately after the July sampling period) until November.Rodents were trapped monthly on all three plots from June until November. One hun-dred Elliot and Sherman live-traps were set 10 m apart on each grid on three consecu-tive nights per month. Each trapped rodent was uniquely toe-clipped, sexed, weighed

Mammalia, t. 60, nO 4, 1996: 785.789.