Make Your Own “Mate & Plate™” Library System User Manual · tech has developed the Mate & Plate™ Libraries, a series of ready-to-go libraries that require simple co-culturing

United States/Canada800.662.2566

Asia Pacific+1.650.919.7300

Europe+33.(0)1.3904.6880

Japan+81.(0)77.543.6116

Clontech Laboratories, Inc.A Takara Bio Company1290 Terra Bella Ave.Mountain View, CA 94043Technical Support (US)E-mail: [email protected]

Use

r M

anu

al

Make Your Own“Mate & Plate™” Library System User Manual

PT4085-1 (PR912678) Cat. No. 630490Published 15 January 2009

www.clontech.com

Make Your Own “Mate & Plate™” Library System

Protocol No. PT4085-1 www.clontech.com Clontech Laboratories, Inc. Version No. PR912678 A Takara Bio Company

2

I. Introduction & Protocol Overview ..........................................................................................4

II. List of Components ..................................................................................................................5

III. Additional Materials Required .................................................................................................7

IV. List of Abbreviations ................................................................................................................8

V. Host Strain Information ............................................................................................................9

VI. Control Experiments .............................................................................................................. 10A. General Considerations ..................................................................................................................... 10B. Protocol: Control for Homologous Recombination-Mediated Cloning Protocol ............................... 10

VII. Generating the cDNA for Your Library ................................................................................. 11A. Protocol: First Strand cDNA Synthesis ............................................................................................. 11B. Protocol: Amplify cDNA Using Long Distance PCR (LD-PCR) ......................................................13C. Protocol: Purify ds cDNA with CHROMA SPIN™ TE-400 Columns ..............................................14

VIII. Construction of a Two-Hybrid Library .................................................................................16A. General Considerations for Two-Hybrid Library Construction & Screening .....................................16B. Protocol: Creating a Mate & Plate Library ........................................................................................16

IX. References ..............................................................................................................................18

X. Troubleshooting Guide ............................................................................................................ 19

Appendix A: Library Titering .......................................................................................................21

Appendix B: Plasmid Information ..............................................................................................22

Appendix C: Yeast Growth Media & Supplements ...................................................................23

Appendix D: SMART™ Technology Overview ...........................................................................25

Table of Contents

Customer Service/Ordering

tel: 800.662.2566 (toll-free)

fax: 800.424.1350 (toll-free)

web: www.clontech.com

e-mail: [email protected]

Technical Support

tel: 800.662.2566 (toll-free)

fax: 650.424.1064

web: www.clontech.com

e-mail: [email protected]

Clontech Laboratories, Inc. www.clontech.com Protocol No. PT4085-1A Takara Bio Company Version No. PR912678

3


Table of Contents continuedList of Figures

Figure 1. Use yeast biology to construct a Mate & Plate library. ............................................................... 4Figure 2. Mate & Plate Library construction overview. ........................................................................... 11Figure 3. High-quality cDNA generated using SMART cDNA synthesis. ..............................................14Figure 4. CHROMA SPIN column and collection tubes. .......................................................................15Figure 5. Restriction Map and Cloning Sites of pGADT7-Rec. ..............................................................22

List of TablesTable I: Yeast Host Strain Genotypes ......................................................................................................... 9Table II: Phenotype Testing on Various SD Media..................................................................................... 9Table III: Relationship between Amount of RNA and Optimal Number of Thermal Cycles ...................13Table IV: Components of Yeast Media Set 2 & Yeast Media Set 2 Plus ....................................................23Table V: Individual Yeast Media Pouches for Matchmaker Gold Protocols ..............................................23Table VI: Additional Media & Media Supplements Required for a Two-Hybrid Screen ...........................24



4

I. Introduction & Protocol OverviewYeast two-hybrid systems are primarily used for screening a complete library of proteins (prey) for interaction with a specific protein of interest (bait). Since traditional library manufacture is time-consuming and labor-intensive, Clon-tech has developed the Mate & Plate™ Libraries, a series of ready-to-go libraries that require simple co-culturing of a library strain with your bait strain followed by selection on appropriate minimal medium.

Our Make Your Own “Mate & Plate™” Library System (Cat. No. 630490) enables you to “make your own Mate & Plate Library” just the way we do it using a simple and highly efficient protocol.

Library construction takes place directly in our library yeast strain Y187, utilizing the highly potent homologous recombination machinery of Saccharomyces cerevisiae (Figure 1). There is no need for labor-intensive library cloning, amplification, and harvesting in E.coli. This system uses SMART™ cDNA synthesis technology, which allows you to construct cDNA libaries from any tissue source starting with as little as 100 ng of total RNA (see Appendix D for an overview of SMART technology).

Figure 1. Use yeast biology to construct a Mate & Plate library. Mate & Plate libraries are made directly in yeast, via in vivo recombination between your cDNA and the Matchmaker prey vector pGADT7-Rec. First, use SMART cDNA synthesis technology to create a cDNA pool with end sequences homologous to the prey vector pGADT7-Rec. Then transform Y187 Yeast Strain and allow the yeast to perform a re-combination step between the linear prey vector and the cDNA. Colonies are pooled, mixed, and aliquoted into multiple vials. Each single 1 ml vial can be used for a two-hybrid screen.

About this ManualThis manual describes how to make your own library and divide it into aliquots in preparation for a yeast two-hybrid screen. For detailed procedures regarding the library screening process itself, please see our Matchmaker Gold Yeast Two-Hybrid System User Manual (PT4084-1) at www.clontech.com The Matchmaker Gold Yeast Two-Hybrid System is sold separately as Cat. No. 630489.

Matchmaker Library Construction OverviewThe library construction process consists of the following steps (see Figure 1):

Step 1.• Generate cDNA from RNA using SMART™ technology

Step 2.• Cotransform cDNA and linearized pGADT7-Rec vector into Yeast Strain Y187, and plate on SD/–Leu Agar medium

Step 3.• Wait 4–5 days, harvest yeast, and pool all colonies in rich broth medium.

Step 4.• Divide into aliquots and freeze.

Step 5.• Use a single 1 ml aliquot for each library screen [see the Matchmaker Gold Yeast Two-Hybrid System User Manual (PT4084-1)].

pGADT7-Rec

x x

In-vivo recombinationin yeast

Pool colonies andaliquot into 1 mlsingle-use vials


5


II. List of ComponentsMake Your Own “Mate & Plate” Library System (Cat. No. 630490)

This kit contains sufficient reagents (listed below) to make five two-hybrid libraries.

Store Yeast Media Pouches, deionized H2O, CHROMA SPIN™ Columns, NaCl Solution, NaOAc, LiAc, PEG, TE Buffer, and YPD Plus Medium at room temperature.

Store yeast strain, Control Poly A+ RNA, and the SMART III Oligo at –70°C.

Store all other reagents at –20°C.

First-Strand cDNA Synthesis

10 µl SMART III Oligo • (10 µM; 5’-AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCGGG-3’)

NOTE: The SMART III Oligo is a modified oligo.

10 µl CDS III Primer • (10 µM; 5’-ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30VN-3’)*

10 µl CDS III/6 Primer • (10 µM; 5’-ATTCTAGAGGCCGAGGCGGCCGACATG-NNNNNN-3’)

NOTE: N = A, G, C, or T; V = A, G, or C

10 µl SMART MMLV Reverse Transcriptase (200 U/µl)•

7 µl RNaseH•

300 µl 5X First-Strand Buffer •

165 µl DTT (100 mM)•

5 µl Control Poly A+ RNA (Human Placenta; 1 µg/µl)•

50 µl dNTP Mix (10 mM each)•

cDNA Amplification

50 µl 5’ PCR Primer • (10 µM; 5’-TTCCACCCAAGCAGTGGTATCAACGCAGAGTGG-3’)

50 µl 3’ PCR Primer • (10 µM; 5’-GTATCGATGCCCACCCTCTAGAGGCCGAGGCGGCCGACA-3’)

500 µl Melting Solution•

NOTE



6

II. List of Components continuedcDNA Purification

10 CHROMA SPIN+TE-400 Columns•

300 µl Sodium Acetate (3 M)•

Two-Hybrid Library Construction

25 µg pGADT7-Rec Cloning Vector (SmaI-linearized; 500 ng/µl)•

20 µl SV40 Large-T PCR fragment (25 ng/µl)•

0.5 ml Y187 Yeast Strain•

50 ml NaCl Solution (0.9%)•

Make Your Own “Mate & Plate” Library System User Manual (PT4085-1)•

pGADT7-Rec Vector Information (PT3530-5)•

Complimentary Yeast Media Pouches

1 x 0.5 L YPDA Broth•

1 x 0.5 L YPDA with Agar•

1 x 0.5 L SD/–Leu with Agar•

Yeastmaker™ Yeast Transformation System 2 (also available separately as Cat No. 630439)

50 ml 1 M LiAc (10X)•

50 ml 10X TE Buffer•

50 ml YPD Plus Liquid Medium•

20 µl pGBT9 (0.1 µg/µl; positive control plasmid)•

2 x 1 ml Yeastmaker Carrier DNA, denatured (10 mg/ml)•

2 x 50 ml 50% PEG 3350•

Yeastmaker Yeast Transformation System 2 User Manual (PT1172-1)•


7


III. Additional Materials RequiredAdvantage® 2 Polymerase Mix (100 rxns) (Cat. No. 639201)

Accessory KitsYeastmaker Yeast Transformation System 2• (supplied with your system—see Section II; also sold separately as Cat. No. 630439)

Easy Yeast Plasmid Isolation Kit• (50 preps; Cat. No. 630467)

Tools for Plating YeastTools for plating yeast include a sterile glass rod—and a bent Pasteur pipette or 5 mm glass beads for spread-•ing cells on plates. (Use 5–7 beads per 100 mm plate, or 15–20 beads for a 150 cm plate).

Miscellaneous Reagents & Media3 M sodium acetate, pH 5.3•

ice-cold ethanol (95–100%)•

YPDA/25% Glycerol (Freezing Medium; see Appendix C, Section C)•

Yeast Media Pouches Required for Library Construction (also see Appendix C)

YPDA Broth (10 x 0.5L) Cat. No. 630306•

YPDA with Agar (10 x 0.5L) Cat. No. 630307•

SD/-Leu with Agar (10 x 0.5L) Cat. No. 630311•

Additional Yeast Media for Two-Hybrid Screening [also see the Matchmaker Gold Yeast Two-Hybrid System User Manual (PT4084-1)]Table IV (in Appendix C) lists the components of the Yeast Media Set 2 (Cat. No. 630494) and the Yeast Media Set 2 Plus (Cat. No. 630495). These media sets contain a complete assortment of mixes for preparing eight specialized broth and agar media, designed for use with the Matchmaker™ Gold Yeast Two-Hybrid System, in convenient, “ready-mixed” foil pouches. The Yeast Media Set 2 Plus also contains the additional media supplements Aureoba-sidin A and X-a-Gal, which are required for a two-hybrid screen. Table V (in Appendix C) contains information for purchasing each of the media mixes separately, in packs of 10 pouches, and Table VI (in Appendix C) contains preparation instructions for all additional required media supplements and information for purchasing Aureobasidin A and X-a-Gal separately.

Additionally, the following should be considered when culturing yeast for a two-hybrid screen:

SD medium• (synthetically defined medium) is minimal media that is routinely used for culturing S. cerevi-siae. SD base supplies everything that a yeast cell needs to survive (including carbon and nitrogen sources). Essential amino acids, which are added to SD base to create minimal medium, are already included premixed in Clontech’s Yeast Media Pouches. The particular minimal medium that is chosen will determine which plasmids and/or activated reporters are selected for.

SD/–Leu• dropout supplement is used to select for the prey library plasmids. SD/–Leu dropout is so called because the medium includes every essential amino acid except for leucine, which is omitted from the formu-lation (or “Dropped Out”). Cells harboring Matchmaker prey plasmids are able to grow because pGADT7-Rec encodes the LEU2 leucine biosynthesis gene, which is otherwise absent from the cell.



8

IV. List of AbbreviationsAD fusion library A cDNA library (such as a Mate & Plate Library) constructed in an [or AD library] activation domain (AD) vector such that the proteins encoded by the inserts are fused to the 3’ end of the Gal4 AD

AD/library plasmid Plasmid encoding a fusion of the Gal4 activation domain and a library cDNA

AD/library protein A protein fusion comprised of the Gal4 activation domain and a polypeptide encoded by a library cDNA

AD vector Plasmid encoding the yeast Gal4 activation domain

Yeast PhenotypesAde–, or His–, or Requires adenine (Ade), or histidine (His) or leucine (Leu), or tryptophan (Trp) in the Leu–, or Trp– medium to grow; i.e., is auxotrophic for one (or more) of these specific nutrients

LacZ+ Expresses the LacZ reporter gene; i.e., is positive for ß-galactosidase (ß-gal) activity.

Mel1+ Expresses the MEL1 reporter gene; i.e., is positive for a-galactosidase (a-gal) activity

MiscellaneousSD Minimal, synthetically defined medium for yeast; is comprised of a nitrogen base, a carbon source (glucose unless stated otherwise), and a DO supplement

DO Dropout (supplement or solution); a mixture of specific amino acids and nucleosides used to supplement SD base to make SD medium; DO solutions are missing one or more of the nutrients required by untransformed yeast to grow on SD medium. For example, SD/–Leu lacks the amino acid leucine.

YPDA YPD medium supplemented with adenine hemisulfate (1X concentration = 120 µg/ml)


9


V. Host Strain InformationThe phenotype and complete genotype of Y187 Yeast Strain (the library strain) are shown in Tables I and II. For additional information on the growth and maintenance of yeast, see the supporting Matchmaker protocols at www.clontech.com. We also recommend the Guide to Yeast Genetics and Molecular Biology (Guthrie & Fink, 1991).

Table I: Yeast Host Strain Genotype

Strain Genotypea ReportersTransformation

Markers Reference

Y187b MATa, ura3-52, his3-200,ade2-101, trp1-901, leu2-3, 112,gal4Δ, gal80Δ, met–,URA3 : : GAL1UAS–Gal1TATA–LacZMEL1

MEL1, LacZ trp1, leu2 Harperet al., 1993

a The GAL1, GAL2, and MEL1 upstream activating sequences (UASs) are recognized and bound by the Gal4 BD. The trp1, his3, gal4, and gal80 mutations are all deletions; leu2-3, 112 is a double mutation.

b The LacZ reporter construct was integrated into the yeast genome by homologous recombination at the ura3-52 mutation. Recombinants were selected on SD/–Ura.

Table II: Phenotype Testing on Various SD Media

Strain SD/–Ade SD/–His SD/–Leu SD/–Trp SD/–Ura

Y187 – – – – +

Y187 [pGADT7-T] – – + – +



10

VI. Control Experiments

Please read the entire Protocol before starting Use this procedure to perform a control homologous recombination-mediated cloning in yeast before constructing and screening a two-hybrid library.

A. General ConsiderationsThe following protocol is designed to familiarize yourself with the procedures and expected results of homologous recombination mediated cloning in Yeast. Additionally it provides you with a positive control strain that you will need for subsequent yeast two-hybrid screening.

B. Protocol: Control for Homologous Recombination-Mediated Cloning Protocol1. Materials:

Yeastmaker Yeast Transformation System 2 (supplied with this system, •or sold separately as Cat. No. 630439)

Y187 Yeast Strain•

pGADT7-Rec Cloning Vector (SmaI-linearized; 500 ng/µl)•

SV40 Large-T PCR fragment (25 ng/µl)•

SD/–Leu with Agar•

Prepare2.

competent Y187 yeast cells using the Yeastmaker Yeast Transformation System 2 according to the protocol •in the accompanying user manual.

SD/-Leu agar plates (5 x 100 mm plates; see Appendix C).•

Combine the following DNA samples in two sterile microcentrifuge tubes and use to cotransform competent 3. Y187 cells:

1 µl pGADT7-Rec (SmaI Linearized)•

1 µl pGADT7-Rec (SmaI Linearized) + 3 µl SV40 large T PCR Fragment (25 ng/µl)•

Plate 100 µl of a 1/10 dilution and 100 µl of a 1/100 dilution on SD/-Leu agar plates.4.

Incubate at 30°C for 3–5 days5.

Expected results: You should see >10X more colonies when cotransforming pGADT7-Rec together with the SV40 Large-T PCR fragment compared to the vector alone. This implies that >90% of the colonies contain a pGADT7-T control plasmid created by homologous recombination.

Protocol5–7

days


11


VII. Generating the cDNA for Your Library

Please read the entire Protocol before starting detailed instructions are provided for first-strand cdna synthesis (section a), cdna amplifica-tion using long distance Pcr (ld-Pcr) (section b), and column purification of ds cdna using a chroMa sPin te-400 column (section c).

Use the following protocol for generating cDNA using Clontech’s simple and highly efficient SMART™ technology (Figure 2). For a detailed description of SMART technology, refer to Appendix D.

A. Protocol: First Strand cDNA SynthesisIt is strongly recommended that you perform a positive control cDNA synthesis reaction with Human Placenta Poly A+ RNA. This control verifies that all components are working properly and lets you compare to the yield and size range of the ds cDNA synthesized from your experimental RNA sample.

IMPORTANT: Do not increase the size (volume) of any of the reactions. All components have been optimized for the volumes specified.

The procedure consists of three steps:

First-strand cDNA synthesis•

Amplification of cDNA by long distance PCR (LD-PCR)•

Column purification of ds cDNA with a CHROMA SPIN TE-400 column•

In the protocol that follows, you have the option of priming first-strand cDNA synthesis with an oligo-dT (CDSIII) or random primer (CDSIII/6).The reaction conditions vary slightly (at Step 6), depending on the primer used.

Protocol1 day

Figure 2. Mate & Plate Library construction overview. SMART cDNA synthesis generates cDNA ends with homology to pGADT7-Rec.

AAAAAA

TTTTTT

AAAAAA

TTTTTT

Oligo dT binds to RNA template1

Reverse Transcription2

Terminal Transferase Activityadds dCTP; SMART oligo annealsto CCC overhangs

3

Template Switching incorporatesSMART oligo, resulting in knownsequences at both ends of all cDNAs

4

AAAAAA

TTTTTT

CCC

AAAAAA

TTTTTT

CCCGGG

GGG



12

VII. Generating the cDNA for Your Library continued

Prepare:1. high-quality Poly A or total RNA

Note: We recommend NucleoSpin® RNAII kits (Cat. Nos. 740955.20, 740955.50 & 740955.250) for purification of total RNA form a variety of sources, and NucleoTrap mRNA Kits (Cat. Nos. 740655 & 740656) for polyA+ mRNA enrichment from total RNA.

2. Combine and mix the following reagents in a sterile microcentrifuge tube:

1–2 µl RNA sample (0.025–1.0 µg poly A+ or 0.10–2.0 µg total RNA)

1.0 µl CDS III or CDSIII/6 Primer

1–2 µl Deionized H2O (to bring volume up to 4.0 µl).

4.0 µl total volume

NOTE: For the control reaction, use 1 µl [1 µg] of the control RNA.

CDSIII = Oligo-dT Primer

CDSIII/6 = Random Primer

Incubate at 72°C for 2 min3.

Cool on ice for 2 min only, then spin down briefly at 14,000 g for 10 sec.4.

Prepare a reaction mix containing the following components, then add this mix to the denatured, primed 5. RNA sample from Step 4, and mix by tapping:

2.0 µl 5X First-Strand Buffer

1.0 µl DTT (100 mM)

1.0 µl dNTP Mix (10 mM )

1.0 µl SMART MMLV Reverse Transcriptase

9.0 µl total volume

ONLY if using Random Primer (CDSIII/6)6. [Omit this step if using Oligo-dT (CDSIII), and continue to Step 7]

Incubate at 25°C for 10 min at room temperature.

Incubate at 42° for 10 min.7.

NOTE: Carry out the incubation in a hot lid thermal cycler. If you are using a water bath or non-hot-lid cycler, add a drop of mineral oil to prevent loss in volume due to evaporation.

Add 1 µl SMART III-modified oligo, mix and incubate at 42°C for 1 hr.8.

Place the tube at 75°C for 10 min to terminate first-strand synthesis.9.

Cool to room temperature, add 1 µl RNase H (2 units).10.

Incubate at 37° for 20 min.11.

Proceed to LD-PCR amplification (Section VII.B).12.

NOTE: Any first -strand synthesis reaction that is not used immediately can be stored at –20°C for up to 3 months.

NOTE

Recipe

Recipe

NOTE


13



B. Protocol: Amplify cDNA Using Long Distance PCR (LD-PCR)Table III shows the optimal number of thermal cycles to use based on the amount of RNA used in the first-strand synthesis. Use the minimum number of cycles required to generate 3–6 µg of dsDNA. The optimal cycling parameters in Table III were determined using the Control Poly A+ Human Placenta RNA; these parameters may vary with differ-ent templates and thermal cyclers. This procedure has been tested and optimized only for Advantage 2 Polymerase Mix (Cat. No. 639201).

Table III: Relationship between Amount of RNA and Optimal Number of Thermal Cycles

Total RNA (µg) Poly A+ RNA (µg) Number of Cycles

1.0–2.0 0.5–1.0 15–20

0.5–1.0 0.25–0.5 20–22

0.25–0.5 0.125–0.25 22–24

0.05–0.25 0.025–0.125 24–26

Prepare1. :

First-strand cDNA (Section VII.A)•

Preheat thermal cycler•

Set up 2. TWO 100 µl PCR reactions for each experimental sample and one reaction for the placental control RNA:

2 µl First-Strand cDNA (Section VII.A)

70 µl Deionized H2O

10 µl 10X Advantage® 2 PCR Buffer

2 µl 50X dNTP Mix

2 µl 5’ PCR Primer

2 µl 3’ PCR Primer

10 µl 10X Melting Solution

2 µl 50X Advantage 2 Polymerase Mix

100 µl total volume

Begin thermal cycling using the following parameters:3.

95°C 30 sec•x Cycles• a

95°C 10 sec 68°C 6 minb

68°C 5min•a Refer to Table III to estimate the number of cycles.b Program the cycler to increase the extension time by 5 sec with each successive cycle. For example, in the second cycle, the extension should last 6

min and 5 sec; in the third, 6 min and 10 sec, and so on.

Protocol5 hr



14

VII. Generating the cDNA for Your Library continuedAnalyze a 7 µl aliquot of the PCR product from each sample alongside 0.25 µg of a 1 kb ladder DNA mo-4. lecular weight marker on a 1.2% agarose/EtBr gel.

Typical results obtained with Human Placenta Poly A+ RNA after column chromatography are shown in Figure 3.

Note:If your PCR product does not appear as expected, refer to the Troubleshooting Guide (Section X).

Proceed with Column Chromatography (Section VII.C) or store ds cDNA at –20°C until use.5. NOTE

C. Protocol: Purify ds cDNA with CHROMA SPIN™ TE-400 ColumnsIn the following protocol, a CHROMA SPIN TE-400 Column is used to select for DNA molecules >200 bp.

CHROMA SPIN Columns are packed with resin that fractionates molecules based on size. Molecules larger than the pore size are excluded from the resin. These molecules quickly move through the gel bed when the column is centrifuged, while molecules smaller than the pore size are retained and trapped inside the gel matrix. For more in-formation about CHROMA SPIN Columns, please refer to the CHROMA SPIN Columns User Manual (PT1300-1), available at our web site at www.clontech.com.

Prepare1. :

ds cDNA by LD-PCR (Section VII.B; if you do not have at least 3 µg, repeat amplification step with •more cycles)

sodium acetate (3 M)•

ice cold ethanol (95–100%)•

Protocol2 hr

Figure 3. High-quality cDNA generated using SMART cDNA synthesis. Oligo dT-primed cDNAs were generated using the Make Your Own “Mate & Plate” Library System. cDNA synthesis was carried out with or without 1 µg of human placenta polyA RNA (positive and negative controls, respectively). LD PCR was performed using the Advantage® 2 Polymerase Mix (with duplicate samples) and one set of products was purified (size-selected) using CHROMA SPIN TE 400 columns. Analysis of each respective sample on a 1% agarose gel revealed that the resulting cDNAs ranged from 300 bp to 6 kb. Lanes M: 1 kb ladder molecular weight standard. Lane 1: unpurified negative control. Lane 2: unpurified positive control. Lane 3: purified negative control. Lane 4: purified positive control. Lane 4 shows reduced abundance of cDNA below 400 bp compared to Lane 2, after size selection with CHROMA SPIN TE 400 columns.

M 1 2 3 4 Mkb

8.0 – 6.0 – 4.0 – 3.0 –

2.0 – 1.5 –

1.0 –

0.5 –


15



Prepare one CHROMA SPIN TE-400 column for each 93 µl cDNA sample (see Figure 4).2.

Invert each column several times to resuspend the gel matrix completely, until it is homogeneous.•

Remove the top cap.•

Snap off the break away from the bottom of the column.•

Place the column in a 2 ml collection tube (supplied).•

NOTE: You will use 2 columns for each library to be constructed.

Centrifuge at 700 g for 5 min to purge the equilibration buffer, then discard collection tube and buffer.3.

The matrix will appear semi-dry.

NOTE: We recommend swing bucket or horizontal rotors. Fixed angel rotors can be used but there is a risk that the sample will pass down the inner side of the columns instead of through the gel matrix, resulting in incon-sistent purification.

Replace spin column in second collection tube and apply your 93 µl sample to the CENTER of the flat 4. surface of the gel matrix.

NOTE: Do not allow sample to flow along inner wall of the column.

Centrifuge at 700 g for 5 min, your purified sample is now in the collection tube.5.

Combine your two purified samples into a single microcentrifuge tube and ethanol-precipitate the cDNA:6.

Add 1/10th vol 3 M sodium acetate.•

Add 2.5 vol of ice-cold ethanol (95–100%).•

Place in –20°C freezer for 1 hr.•

Centrifuge at 14,000 rpm for 20 min at room temperature.•

Discard the supernatant; do not disturb the pellet.•

Centrifuge briefly at 14,000 rpm and remove remaining supernatant.•

Air dry the pellet for 10 min.•

Resuspend the cDNA in 20 µl deionized water.7.

The cDNA is now ready for library construction by in vivo recombination in yeast (Section VIII).

NOTE: At this point you should have 2–5 µg of ds cDNA

NOTE

NOTE

Figure 4. CHROMA SPIN column and collection tubes. Note that a conven-tional, tapered 1.5 ml microcentrifuge tube can be substituted for the 2 ml collection tube when collecting the purified DNA. This will allow the sample to be confined to a narrower area for easier handling. However, a 2 ml collec-tion tube must be used when purging the equilibration buffer.

CHROMA SPIN Column main body

2-ml Collection Tubes

Break-away end

White-end cap

Clear top cap

Matrix



16

VIII. Construction of a Two-Hybrid Library

Please read the entire Protocol before starting detailed instructions are provided for constructing a “Mate & Plate” yeast two-hybrid library (section b).

A. General Considerations for Two-Hybrid Library Construction & ScreeningThere are two ways to use this kit to make and screen a Matchmaker Two-Hybrid Library.

Recommended Protocol 1.

Make a Mate & Plate library in Y187 Yeast Strain (see Section VIII.B, below) and screen against the bait •by yeast mating [see the Matchmaker Gold Yeast Two-Hybrid System User Manual (PT4084-1)]. You will note that the mating procedure is very easy—simply mix a concentrated bait culture with 1 ml of your Mate & Plate library constructed using the protocol and incubate overnight before plating on SD-Leu/-Trp/X-a-Gal/AbA selective media.

See the Matchmaker Gold Yeast Two-Hybrid System User Manual (PT4084-1) for instructions on screen-•ing a library using yeast mating at www.clontech.com

Alternative Protocol 2.

Simultaneously make and screen a library by library-scale cotransformation of Bait and Prey. Prepare •ds cDNA according to the protocol in Section VII and cotransform together with your bait directly into Y2HGold competent cells. Visit www.clontech.com for a support protocol.

The advantage of the recommended protocol is that it provides frozen stocks of the library to screen multiple baits. The alternative protocol will not result in a frozen library stock but is a quicker procedure. You can follow this pro-tocol if you do not plan to screen a library multiple times.

B. Protocol: Creating a Mate & Plate Library1. Prepare:

competent Y187 yeast cells using the Yeastmaker Yeast Transformation System 2 according to the protocol •in the accompanying user manual.

20 µl ds cDNA (Section VII)— The amount of ds cDNA should be 2–5 µg.•

The following SD Agar Plates (Appendix C)•

SD/–Leu with Agar (100 x 150 mm plates) –

SD/–Leu with Agar (5–10 x 100 mm plates) –

YPDA/25% Glycerol (Freezing Medium; see Section C of Appendix C)•

NOTE: Kanamycin sulfate can be added to all yeast media at a final concentration of 50 µg/ml to stop bacterial contamination (see Appendix C, Section D).

sterile glass beads (5 mm)•

Follow the library-scale transformation protocol in the Yeastmaker Yeast Transformation System 2 User 2. Manual to cotransform the following into competent Y187 yeast cells.

20 µl ds cDNA (Section VII)— The amount of ds cDNA should be 2–5 µg•

6 µl pGADT7-Rec (0.5 µg/µl))•

As specified in the transformation protocol in Step 2, resuspend the transformed cells in 15 ml of 0.9% (w/v) 3. NaCl.

Protocol5–7

days

NOTE


17


VIII. Construction of a Two-Hybrid Library continuedSpread 100 µl of 1/10 and 1/100 dilutions on SD/–Leu 100 mm agar plates, incubate at 30°C for 3–4 days, 4. and determine the number of independent clones in your library. The number of independent clones is an indication of library complexity.

Refer to Section X to improve your transformation efficiency.

Number of Independent Clones = No. of cfu/ml on SD/–Leu x resuspension volume (15ml)

This value will determine the transformation efficiency.•

If you have made a library of 2 million independent clones, you will have 133 colo-•nies on the 1/100 dilution plate.

Only proceed to Step 6 if you have determined that you have >1 million independent •clones

If your library does not have >1 million independent clones, refer to the Section X to •learn how to improve transformation efficiency and the quality of your cDNA.

Spread the remainder on 150 mm SD/–Leu Plates5.

150 µl per plate on ~100 plates•

Incubate at 30°C for 3–4 days)•

Harvest and Pool Transformants from Step 5.6.

Chill plates at 4°C for 3–4 hr.a.

Add 5 ml of Freezing Mediumb.

Use sterile glass beads to detach the colonies from the plate.c.

Combine all liquids in a single sterile flask (you should have a combined total of 0.5 L)d.

Using a hemocytometer, estimate the cell density. If the cell density is <2 x 10e. 7 per ml, reduce the volume of the suspension by centrifugation.

Aliquot your library into several 1 ml aliquots for short-term use and a few 50 ml aliquots for long-term f. storage. Store at –80°C.

Use a single 1ml aliquot for library screening using the Matchmaker Gold Yeast Two-Hybrid System User 7. Manual (PT4084-1).

NOTE: When thawing libraries from storage, always recalculate the titer to confirm that the titer remains >1x107 cfu/ml

NOTE



18

• Forgeneralreviewsonyeasttwo-hybridsystems,seeAllenet al., 1995; Bartel et al., 1993a, 1993b; Bartel & Fields, (1997); Fields, 1993; Fields & Sternglanz, 1994; Fritz & Green, 1992; Guarente, 1993; Hopkin, 1996; Luban & Goff, 1995; McNabb & Guarente, 1996; Mendelsohn & Brent, 1994.

• AnextensivelistofMatchmakerSystemcitationscanbeobtainedfromourwebsite(www.clontech.com).

• Foradditionaltwo-hybridreferences,seetheGolemislabWebSite(http://www.fccc.edu:80/research/labs/golemis)oruse MedLine (http://www.ncbi.nlm.nih.gov/PubMed/medline.html) and search under key words "two-hybrid.”

Allen, J. B., Wallberg, M. W., Edwards, M. C. & Elledge, S. J. (1995) Finding prospective partners in the library: the yeast two-hybrid system and phage display find a match. TIBS 20:511–516.

Barnes, W. M. (1994) PCR amplification of up to 35-kb DNA with high fidelity and high yield from l bacteriophage templates. Proc. Natl. Acad. Sci. USA 91:2216–2220.

Bartel, P. L. & Fields, S. (1997) The Yeast Two-Hybrid System (Oxford University Press, Oxford).

Bartel, P. L., Chien, C.-T., Sternglanz, R. & Fields, S. (1993a) Using the two-hybrid system to detect protein-protein interactions. In Cellular Interactions in Development: A Practical Approach., ed. Hartley, D. A. (Oxford University Press, Oxford) pp. 153–179.

Bartel, P. L, Chien, C.-T., Sternglanz, R. & Fields, S. (1993b) Elimination of false positives that arise in using the two-hybrid system. BioTechniques 14:920–924.

Chenchik, A., Diatchenko, L., Chang, C. & Kuchibhatla, S. (1994). Great Lengths cDNA Synthesis Kit for high yields of full-length cDNA. Clontechniques IX(1):9–12.

Chenchik, A., Zhu, Y. Y., Diatchenko, L., Li, R., Hill, J. & Siebert, P. D. (1998) Generation and use of high-quality cDNA from small amounts of total RNA by SMART PCR. In Gene Cloning and Analysis by RT-PCR (BioTechniques Books, MA), pp. 305–319.

Fields, S. (1993) The two-hybrid system to detect protein-protein interactions. METHODS: A Companion to Meth. Enzymol. 5:116–124.

Fields, S. & Sternglanz, R. (1994) The two-hybrid system: an assay for protein-protein interactions. Trends Genet. 10: 286–292.

Fritz, C. C. & Green, M. R. (1992) Fishing for partners. Current Biol. 2:403–405.

Golemis, E. A., Gyuris, J. & Brent, R. (1996) Analysis of protein interactions; and Interaction trap/two-hybrid systems to identify interacting proteins. In Current Protocols in Molecular Biology (John Wiley & Sons, Inc.), Sections 20.0 and 20.1.

Guarente, L. (1993) Strategies for the identification of interacting proteins. Proc. Natl. Acad. Sci. USA 90:1639–1641.

Guthrie, C. & Fink, G. R. (1991) Guide to yeast genetics and molecular biology. In Methods in Enzymology (Academic Press, San Diego)194:1–932.

Harper, J. W., Adami, G. R., Wei, N., Keyomarsi, K. & Elledge, S. J. (1993) The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75:805–816.

Hopkin, K. (1996) Yeast two-hybrid systems: more than bait and fish. J. NIH Res. 8:27–29.

James, P., Halladay, J. & Craig, E. A. (1996) Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144:1425–1436.

Kellogg, D. E., Rybalkin, I., Chen, S., Mukhamedova, N., Vlasik, T., Siebert, P. & Chenchik, A. (1994) TaqStart Antibody: Hot start PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase. BioTechniques 16:1134–1137.

Luban, J. & Goff, S. P. (1995) The yeast two-hybrid system for studying protein-protein interactions. Current Opinion in Biotechnol. 6:59–64.

McNabb, D. S. & Guarente, L. (1996) Genetic and biochemical probes for protein-protein interactions. Curr. Opin. Biotechnol. 7(5):554–559.

Mendelsohn, A. R. & Brent, R. (1994) Biotechnology applications of interaction traps/two-hybrid systems. Curr. Opinion in Biotechnol. 5:482–486.

Zhu, Y. Y., Machleder, E. M., Chenchik, A., Li, R. and Siebert, P. D. (2001) Reverse transcriptase template switching: A SMART™ approach for full-length cDNA library construction. Biotechniques 30:892–897.

IX. References


19


IX. References X. Troubleshooting Guide PROBLEM CAUSE SOLUTION

Low yield of ds cDNA One or more essential reagents may have been inadvertently omitted from the first-strand or ds cDNA synthesis steps.

Repeat both steps, being careful to check off every item as you add it to the reaction.

Low yields of ds cDNA may be due to PCR undercycling.

If you suspect undercycling, incubate the PCR •reaction mixture for two more cycles and recheck the product.

If you already used the maximum recom-•mended number of cycles, increase by three more cycles.

If additional cycles do not improve the yield •of PCR product, repeat the PCR using a fresh aliquot of the first-strand product.

A low yield of ds cDNA may also be due to a low yield of first-strand cDNA. Possible problems with the first-strand reaction include:

a mistake in the procedure •(such as using a suboptimal incubation temperature or omit-ting a component), or insuffi-cient RNA in the reaction.

It is also possible that the RNA •has been partially degraded (by contaminating RNases) before the first-strand synthesis

Problems with the first-strand cDNA syn-•thesis can be more easily diagnosed if you perform parallel reactions using the control RNA provided in the kit.

If good results were obtained with the control •RNA but not with your experimental RNA, then there may be a problem with your RNA.

Size distribution of ds cDNA is less than expected

your RNA starting material may be degraded, very impure, or too dilute.

Check the quality and quantity of your RNA by •running a sample on a gel. If the RNA seems too dilute, but otherwise of good quality, restart the experiment using more RNA.

If the RNA seems degraded, restart the experi-•ment using a fresh lot or preparation of RNA.

Also, check the stability of your RNA by incu-•bating a small sample at 37°C for 2 hr. Run it on a gel, parallel to a fresh (unincubated) sample. If the RNA appears to be unstable, it will yield poor results. If this is the case, re-isolate the RNA using a different method (see Related Products).

Problems with your RNA are easily diagnosed •if you perform parallel reactions using the control RNA provided in this kit.



20

X. Troubleshooting Guide continued

PROBLEM CAUSE SOLUTION

Presence of low mo-lecular weight (<0.1 kb) material in the ds cDNA product

The raw cDNA (e.g., before size •fractionation) is expected to contain some low-molecular-weight DNA contaminants, in-cluding unincorporated primers, SMART oligonucleotides, and very short PCR products.

However, these small fragments •are generally removed from the ds cDNA preparation in the size fractionation step using the columns provided.

Note that a preponderance of •low-molecular-weight (<0.1 kb) material in the raw PCR product may be indicative of overcy-cling.

If you suspect overcycling, then the PCR step must be repeated with a fresh sample of first-strand cDNA, using 2–3 fewer cycles.

Presence of low molec-ular weight (<0.1 kb) in the size-fractionated ds cDNA

CHROMA SPIN columns are de-signed to remove low-molecular-weight cDNA fragments, small DNA contaminants, and unincorporated nucleotides from the cDNA. The resolving function of the column will be diminished if the gel matrix becomes dry. In drying, the matrix body may shrink away from the inner wall of the column casing. The ds cDNA mixture can then flow down the sides of the column, allowing small contaminants to elute with the cDNA.

The column should be stored and used at room temperature. If it is chilled at 4°C and then warmed to room temperature for use, bubbles may form, which interfere with the proper functioning of the column.

Extreme, uneven deposition of the ds cDNA mix-ture on the surface of the column can cause inef-ficient separation of ds cDNA from low-molecular-weight contaminants.

Low transformation efficiency

DNA is not sufficiently pure Check the purity of the DNA and, if necessary, repurify by ethanol precipitation.

The fusion protein encoded by the DNA-BD/bait plasmid (Two-Hybrid System) may be toxic.

Try using a vector that expresses lower levels of the fusion, such pGBT9.

Improper media preparation Remake media and test with control transforma-tions. Check the efficiency using the pGBT9 Control Plasmid. Plate on SD/–Trp. The transformation should yield ≥1 x 105 colonies/µg DNA.

Slow-growing Y187 yeast cells Streak to single colonies, innoculate 4 large colo-nies into YPDA broth, and select the fastest grow-ing to make competent cells.

Yeast two-hybrid screening problems

See Matchmaker Gold Yeast Two-Hybrid System User Manual (PT4084-1) at www.clontech.com


21


Appendix A: Library TiteringA. General Considerations:

Diluted libraries are always less stable than undiluted libraries. Therefore, once the library dilutions are made, •plate them within the next hour, before misleading reductions in titer can occur.

Use proper sterile technique when aliquoting and handling libraries.•

Design and use appropriate controls to test for cross-contamination.•

Always use the recommended concentration of antibiotic (i.e., kanamycin) in the medium to suppress •growth of contaminating bacteria.

B. Library TiteringMaterials1.

YPDA Broth (Appendix C)•

SD/–Leu (100 mm plates) (Appendix C)•

Sterile glass spreading rod, bent Pasteur pipette, or 5 mm glass beads for spreading culture on plates.•

Transfer the 10 µl library aliquot (reserved from Section VIII) to 1 ml of YPDA Broth in a 1.5 ml microcen-2. trifuge tube. Mix by gentle vortexing. This is Dilution A (dilution factor = 10–2).

NOTE: Matchmaker Gold Libraries are extremely viscous, so pay special attention during aliquoting.

Remove 10 µl from Dilution A, and add it to 1 ml of YPDA Broth in a 1.5 ml microcentrifuge tube. Mix by 3. gentle vortexing. This is Dilution B (dilution factor = 10–4).

Add 10 µl from Dilution A to 50 µl of YPDA Broth in a 1.5 ml microcentrifuge tube. Mix by gentle vortex-4. ing. Spread the entire mixture onto an SD/–Leu plate.

Remove 50 µl aliquots from Dilution B and spread onto separate SD/–Leu plates as above.5.

Invert the plates and incubate at 30°C for 3–5 days. 6.

NOTE: Colony size will vary, depending on the insert.

Count the number of colonies on plates having 30–300 colonies. 7.

Calculate the titer (cfu/ml) as follows: 8.

Number of colonies = cfu/mlplating volume (ml) x dilution factor

NOTE: Due to slight variability in pipettes and pipetting techniques, a 2–5-fold range in titer calculations is not unusual.

Example calculation:•

No. of colonies on plate = 100 •

Plating volume = 0.05 ml •

Dilution factor = 10• –4

100 = 2 x 107 cfu/ml 0.05 ml x 10–4

Attention

Protocol4–6

days

NOTE



22

Appendix B: Plasmid Information

Figure 5. Restriction Map and Cloning Sites of pGADT7-Rec. A unique restriction site (Sma I) is shown in bold. The Make Your Own “Mate & Plate” Library System (Cat. No. 630490) contains the Sma I-linearized form of this vector, the form used for recombination-mediated cloning in yeast.

HA epitope tag

pGADT7-Rec8.0 kb

LEU2

Ampr

2 μori

GAL4 AD

pUCori

PADH1

PT7

TADH1

SV40 NLS

Hind III(1480)

SMART III Sequence

CDS III SequenceSma I (2038)

Hind III(2351)

CTA TTC GAT GAT GAA GAT ACC CCA CCA AAC CCA AAA AAA GAG ATC TTT AAT ACG ACT

CAC TAT AGG GCG AGC GCC GCC ATG GAG TAC CCA TAC GAC GTA CCA GAT TAC GCT

CAT ATG GCC ATG GAG GCC AGT GAA TTC CAC CCA AGC AGT GGT ATC AAC GCA GAG TGG

CCA TTA TGG CCC

T7 Promoter

HA Epitope Tag

1915•

1969•

START in vitro

MATCHMAKER 5' AD LD-Insert Screening Amplimera.a.881GAL4

Activation Domain

1858•

T7 Sequencing Primer

SMART IIITM terminus

2026•

SMART III Primer

STOP2095•

2152•

3' AD Sequencing Primer

MATCHMAKER 3' AD LD-Insert Screening Amplimer

GGG AAA AAA CAT GTC GGC CGC CTC GGC CTC TAG AGG GTG GGC ATC GAT ACG GGA TCC

ATC GAG CTC GAG CTG CAG ATG AAT CGT AGA TAC TGA AAAACCCCGCAAGTTCACTTC

AACTGTGCATCGTGCACCATCT

CDS III terminus

2038•

CDS III Primer


23


Appendix C: Yeast Growth Media & SupplementsA. Ready-to-go Media Pouches Available from Clontech

Clontech offers media sets with a complete assortment of mixes in convenient, “ready-mixed” foil pouches, for use with the Matchmaker Gold Yeast Two-Hybrid System. See Table IV for a list of the components of the Yeast Media Set 2 (Cat. No. 630494) and the Yeast Media Set 2 Plus (Cat. No. 630495). The Yeast Media Set 2 Plus also contains the additional media supplements Aureobasidin A and X-a-Gal, which are required for yeast two-hybrid screening using the Matchmaker Gold Yeast Two-Hybrid System, but not with this user manual.

See Table V for information for purchasing each of the media mixes separately, in packs of 10 pouches, •

See Table VI for information on preparing all additional required media supplements and purchasing •Aureobasidin A and X-a-Gal separately.

Table IV: Components of Yeast Media Set 2 & Yeast Media Set 2 Plus

Media Pouch Quantity of Pouches Supplied Volume of Media Each Pouch Makes

YPDA Broth 2 0.5 L

YPDA with Agar 1 0.5 L

SD/–Leu Broth 1 0.5 L

SD/–Leu with Agar 1 0.5 L

SD/–Trp Broth 1 0.5 L

SD/–Trp with Agar 1 0.5 L

SD/–Leu/–Trp with Agar 10 0.5 L

SD/–Ade/–His/–Leu/–Trp with Agar 1 0.5 L

Additional Components in Yeast Media Set 2 Plus

X-alpha-Gal 250 mg —

Aureobasidin A 1 mg —

Table V: Individual Yeast Media Pouches for Matchmaker Gold Protocols

Yeast Media Pouches Clontech Cat. No.

Quantity of Pouches Supplied

Volume of Media Each Pouch Makes.

Rich Media (for Routine Culturing of Untransformed Yeast)

YPDA Broth

YPDA with Agar

630306

630307

10

10

0.5 L

0.5 L

Minimal Media Single Dropouts (SDO)

SD–Trp Broth

SD–Trp with Agar

SD–Leu Broth

SD–Leu with Agar

630308

630309

630310

630311

10

10

10

10

0.5 L

0.5 L

0.5 L

0.5 L

Minimal Media Double Dropouts (DDO)

SD–Leu/–Trp Broth

SD–Leu/–Trp with Agar

630316

630317

10

10

0.5 L

0.5 L

Minimal Media Triple Dropouts (TDO)

SD–His/–Leu/–Trp Broth

SD–His/–Leu/–Trp with Agar

630318

630319

10

10

0.5 L

0.5 L

Minimal Media Quadruple Dropouts (QDO)

SD–Ade/–His/–Leu/–Trp Broth

SD–Ade/–His/–Leu/–Trp with Agar

630322

630323

10

10

0.5 L

0.5 L



24

Appendix C: Yeast Growth Media & Supplements continued

Table VI: Additional Media & Media Supplements Required for a Two-Hybrid Screen

Freezing Medium Preparation Instructions

YPDA Medium & 25% glycerol see Section C of Appendix C

Supplement Name Clontech Cat. No. 1 Stock Solution Concentration

Aureobasidin A 630466 500 µg/ml

X-a-Gal (250 mg) 630463 20 mg/ml in dimethyl formamide

Kanamycin sulfate — 50 mg/ml stock solution

Dimethyl formamide — —

1 Unless otherwise specified

B. General Media Preparation InstructionsPrepare media by dissolving pouch contents in 500 ml ddH• 20, autoclave for 15 min at 121˚C, and allow to cool before use (or filter-sterilize broth media). Do not over-autoclave.

This media does not usually require pH adjustment, but if your source water is particularly acidic, you may •need to adjust the pH of the media to 5.8.

For additional information on preparing media from the pouches, please see the Clontech Yeast Media •Protocol-at-a-Glance (PT4057-2) at www.clontech.com

C. Freezing MediumMix 100 ml YPDA (sterile) and 50 ml 75% glycerol (sterile).

D. Kanamycin Supplement to Yeast MediaKanamycin sulfate can be added to all yeast media at a final concentration of 50 µg/ml to stop bacterial contamina-tion. Please note that kanamycin does not stop contaminating fungal growth, so proper sterile technique must still be used. Also note that this antibiotic does not select for any plasmids in yeast.


25


Appendix D: SMART™ Technology OverviewA. SMART TechnologyMessenger RNA transcripts are efficiently copied into ds cDNA using SMART™ (Switching Mechanism at 5’ end of RNA Transcript) technology (Zhu, Y.Y., et al., 2001). This cDNA synthesis and amplification system is particularly well suited for two-hybrid library construction because it consistently delivers high yields of cDNA while maintaining sequence representation. By maintaining the complexity of the original tissue, the SMART procedure provides you with the best opportunity to detect rare and potentially novel interactions during yeast two-hybrid screening..

B. Mechanism of cDNA SynthesisIn the first-strand cDNA synthesis step, MMLV (Moloney Murine Leukemia Virus) Reverse Transcriptase (RT) is used to transcribe RNA into DNA. To prime RNA for cDNA synthesis, you may use either a modified oligo(dT) primer (our CDS III Primer) or a random primer (our CDS III/6 Primer).

The composition of the resulting cDNA library may differ depending on which primer you choose. If you use the CDS III Primer, which hybridizes to the 3’-end of poly A+ RNA, sequences close to the 5 ’-end of the transcript may be slightly under-represented. If instead you use the CDS III/6 Primer, a random primer that can hybridize to many different sequences on the RNA template, your library should contain a variety of 5’- and 3’-end sequences, which are represented in near equal proportions.

When MMLV RT encounters a 5’-terminus on the template, the enzyme’s terminal transferase activity adds a few additional nucleotides, primarily deoxycytidine, to the 3’ end of the cDNA. The SMART III Oligonucleotide, which has an oligo(G) sequence at its 3’ end, base-pairs with the deoxycytidine stretch, creating an extended template (Figure 2). RT then switches templates and continues replicating to the end of the oligonucleotide. In the majority of syntheses, the resulting ss cDNA contains the complete 5’ end of the mRNA as well as the sequence complementary to the SMART III Oligo, which then serves as a universal priming site (SMART anchor) in the subsequent amplification by long-distance PCR (LD PCR; Chenchik et al., 1998). Only those ss cDNAs having a SMART anchor sequence at the 5’ end can serve as a template and be exponentially amplified by long-distance PCR (LD PCR).

In the second step, ss cDNA is amplified by LD PCR to produce a ds cDNA library. We recommend using the Advan-tage 2 PCR Polymerase Mix (Cat. No. 639201) to generate and amplify ds cDNA. The Advantage® 2 Polymerase Mix consists of TITANIUM™ Taq DNA Polymerase (a nuclease-deficient N-terminal deletion of Taq DNA polymerase), TaqStart Antibody to provide automatic hot-start PCR (Kellogg et al., 1994), and a minor amount of a proofreading polymerase. This polymerase system lets you amplify cDNA (as large as 20 kb) with a fidelity rate significantly higher than that of conventional PCR (Barnes, 1994).



26

Notes

Notice to Purchaser

Clontech products are to be used for research purposes only. They may not be used for any other purpose, including, but not limited to, use in drugs, in vitro diagnostic purposes, therapeutics, or in humans. Clontech products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to third parties without written approval of Clontech Laboratories, Inc.

Matchmaker™ Two-Hybrid System

Practice of the two-hybrid system is covered by U.S. Patent Nos. 5,283,173, 5,468,614, and 5,667,973 assigned to the Research Foundation of the State University of New York. Purchase of any Clontech two-hybrid reagent does not imply or convey a license to practice the two-hybrid system covered by these patents. Commercial entities purchasing these reagents must obtain a license from the Research Foundation of the State University of New York before using them. Clontech is required by its licensing agreement to submit a report of all purchasers of two-hybrid reagents to SUNY Stony Brook. Please contact the Office of Technology Licensing & Industry Relations at SUNY Stony Brook for license information (Tel: 631.632.9009; Fax: 631.632.1505).

Reverse Two-Hybrid Technology

This product is sold under license from Invitrogen IP Holdings, Inc, Carlsbad, CA, for use only in research conducted by the buyer of the product. The buyer is not authorized to use this product or its components for any therapeutic, diagnostic or prophylactic purposes and is not authorized to use this product or its components for any commercial purpose. The buyer is not authorized to sell this product or its components, is not authorized to sell any products made using this product or its components, and is not authorized to perform a service with this product or its components.

SfiI Cloning Strategy

Use of the SfiI cloning strategy is licensed under U.S. Patent No. 5,595,895.

SMART™ Amplification Products

SMART Amplification Products are covered by U.S. Patent Nos. 5,962,271 and 5,962,272. For-Profit and Not-For-Profit purchasers of SMART Amplification Products are entitled to use the reagents for internal research. However, the following uses are expressly prohibited:

(1) performing services for third parties;

(2) identifying nucleic acid sequences to be included on nucleic acid arrays, blots, or in libraries or other cDNA collections which are then sold to third parties. Reproduction, modification, reformulation, or resale of the reagents provided in SMART Amplification Products is not permitted.

For information on licensing SMART Technology for commercial purposes, please contact a licensing representative by phone at 650.919.7320 or by e-mail at [email protected].

DH5a™ is a trademark of Invitrogen Corporation.

Parafilm® is a registered trademark of Pechiney Plastic Packaging, Inc..

Clontech, the Clontech logo and all other trademarks are the property of Clontech Laboratories, Inc. unless otherwise noted. Clontech is a Takara Bio Company. ©2009 Clontech Laboratories, Inc.

Documents

Make Your Own “Mate & Plate™” Library System User Manual · tech has developed the Mate & Plate™ Libraries, a series of ready-to-go libraries that require simple co-culturing