www.fems-microbiology.org

FEMS Microbiology Letters 251 (2005) 59–66

LexA, a transcription regulator binding in the promoter regionof the bidirectional hydrogenase in the cyanobacterium

Synechocystis sp. PCC 6803

Paulo Oliveira *, Peter Lindblad

Department of Physiological Botany, EBC, Uppsala University, Villavagen 6, SE-752 36 Uppsala, Sweden

Received 4 June 2005; received in revised form 15 July 2005; accepted 20 July 2005

First published online 8 August 2005

Edited by E. Ricca

Abstract

The unicellular cyanobacterium Synechocystis PCC 6803 contains a single pentameric bidirectional hydrogenase encoded by hox-

EFUYH. Transcriptional experiments demonstrated that the five hox genes are part of a single transcript together with three ORFswith unknown functions. The transcription start point was localized by 5 0 RACE to 168bp upstream the hoxE ATG start codon.DNA affinity assays demonstrated a specific interaction between the hox regulatory promoter region and a protein which, usingmass spectrometry, was identified to be LexA. Overexpressed His-tagged Synechocystis LexA and EMSA showed a specific bindingto the promoter region of the hox operon. Increasing concentrations of the purified LexA resulted in two retarded LexA–DNA com-plexes, in agreement with the presence of two putative LexA binding sites upstream the determined TSP.� 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Synechocystis; Bidirectional hydrogenase; hox; Transcription regulator; LexA

1. Introduction

Hydrogenases catalyze the simple redox reactionH2 M 2H+ + 2e� and have been identified in manyorganisms, ranging from prokaryotes to eukaryotes.All cyanobacteria examined so far contain either an up-take, a bidirectional, or both Ni–Fe hydrogenases [1,2].

Synechocystis PCC 6803 is a fresh-water, unicellular,non-nitrogen fixing cyanobacterium, containing a singlebidirectional hydrogenase [3,4]. This pentameric enzymehas been purified [5] and the corresponding structuralgenes, hoxEFUYH, are clustered with three open read-ing frames of unknown function [4]. Although some sug-

0378-1097/$22.00 � 2005 Federation of European Microbiological Societies

doi:10.1016/j.femsle.2005.07.024

* Corresponding author. Tel.: +46 18 4712814; fax: +46 18 4712826.E-mail address: Paulo.Oliveira@ebc.uu.se (P. Oliveira).

gestions of possible functions for this enzyme inSynechocystis are available, i.e., being part of complexI [3], involved in fermentation [6], and functioning asan electron valve during photosynthesis [7], its in situphysiological role is still unclear. In addition, a cyano-bacterial-type, heteropentameric, NAD+-reducing NiFehydrogenase, encoded by hoxEFUYH, is also present inthe photosynthetic purple sulfur bacterium Thiocapsa

roseopersicina [8].The cyanobacterial hox genes have different molecu-

lar arrangements in different strains. In Anabaena PCC7120 [1], Synechococcus PCC 7942 [9], and Anacystis

nidulans [10] the hox genes are scattered in the respectivegenomes, while in Synechocystis PCC 6803 [4] and Ana-

baena variabilis ATCC 29413 [10] they form a singlecluster. As a consequence, in some strains they may be

. Published by Elsevier B.V. All rights reserved.

60 P. Oliveira, P. Lindblad / FEMS Microbiology Letters 251 (2005) 59–66

transcribed, and regulated, as a single operon while inother cyanobacteria they must be transcribed as at leasttwo operons with a possibility of different regulations.

The cyanobacterial hydrogen metabolism, and specif-ically the bidirectional hydrogenase, is under the controlof environmental factors such as molecular hydrogen,anaerobiosis, nickel [11,12], and nitrate and sulfur-limi-tations [2,6,13]. Specific effects on the respective tran-script levels have been observed [12,13], although notranscriptional regulator has been identified. In contrast,NtcA, a general nitrogen transcriptional regulator, hasbeen shown to be directly involved in the transcriptionalregulation of the cyanobacterial hupSL, structural genesencoding an uptake hydrogenase, in the unicellular,nitrogen-fixing strain Gloeothece ATCC 27152 [14] andin the filamentous heterocystous strain Nostoc PCC73102 [15]. In addition, both the Synechocystis hoxE

gene [16] and the hox genes in Synechococcus PCC7942 [9] are under the regulation of circadian rhythm.

In the present work, we examine the transcription ofthe genes encoding the bidirectional hydrogenase in Syn-

echocystis PCC 6803 and present experimental datademonstrating a specific interaction between the tran-scription regulator LexA and the hox regulatorypromoter region.

2. Materials and methods

2.1. Organisms and growth conditions

Cells of Synechocystis PCC 6803 (Synechocystis) andNostoc punctiforme ATCC 29133 (Nostoc) were culturedin BG11, supplemented with 10 mM HEPES, pH 7.5,and BG110 [17], respectively. Both strains were spargedwith air and grown at 25 �C, with a continuous irradi-ance of 40 lmol of photons m�2 s�1. Escherichia coli

strains were grown in LB medium, or on LB agar plates,at 37 �C.

2.2. Nucleic acid isolation and analysis

Genomic DNA was isolated from Synechocystis cellsas described [18]. Plasmid DNA was isolated fromE. coli using GenElute Plasmid Miniprep Kit (Sigma–Aldrich). For RNA isolation, Synechocystis cells wereharvested by centrifugation, and either used immedi-ately or frozen in liquid nitrogen and stored at�80 �C. Total RNA was isolated as described [12],and resuspended in sterile water (RT-PCR experiments)or TE buffer (Northern blot hybridizations).

2.3. PCR, DNA sequencing and sequence analysis

All oligonucleotides used are listed in Table 1. PCRamplifications were carried as described [18], using

either Taq DNA polymerase (Amersham) or PhusioneDNA polymerase (Finnzymes). Obtained DNA frag-ments were isolated from the agarose gels using theGFXe PCR DNA and Gel Band Purification Kit(Amersham), following the manufacturer�s instructions.Sequencing reactions were performed at Macrogen Inc.Computer-assisted sequence analyses were performedusing CLUSTAL W [19].

2.4. Transcription analysis

RT reactions were carried out with the RevertAideFirst Strand cDNA Synthesis Kit (Fermentas), accord-ing to the instructions of the manufacturer. PCR ampli-fications of the respective hox genes were performedusing corresponding primers (Table 1). Negative con-trols included the omission of the reverse transcriptasein the RT reaction prior to the PCR, and a PCR towhich no template was added. Genomic DNA fromSynechocystis was used as a positive control. In addi-tion, in order to determine whether the genes up- anddownstream the hox cluster (ssr2227 and slr1332, respec-tively) are co-transcribed with the hox genes, an RTreaction using Random Hexamer Primers (Fermentas)was performed. The total/global cDNA populationwas subsequently used for PCR amplification using theprimer pairs ssr2227F–ShoxER, ShoxEF–ShoxFR andShoxHF–slr1332R (Table 1).

2.5. Northern blot hybridizations

Formaldehyde/denaturing gels were used to separatethe total RNA, using the protocol provided with the Hy-bond-N+ nylon membrane (Amersham). Hybridiza-tions were performed at 65 �C, using a probe obtainedby PCR and genomic DNA from Synechocystis, andthe primer pair ShoxEF–ShoxER (Table 1).

2.6. Identification of the transcription start point

The transcription start point (TSP) was located withthe 5 0 RACE System for Rapid Amplification of cDNAEnds, Version 2.0 (Invitrogen). The resulting PCR prod-uct was cloned into the pCR2.1-TOPO� vector (Invitro-gen) according to the manufacturer�s instructions beforebeing sequenced.

2.7. DNA affinity assays and mass spectrometry

Proteins from Synechocystis and Nostoc cells were ex-tracted using a French Press, at a pressure of 1600 psi.Streptavidin-coated magnetic beads (Dynabeads� M-280, Dynal Biotech) were used, following the instruc-tions of the manufacturer. A 462-bp (�405 to +47 –positions relative to the TSP) DNA fragment, fromnow on referred to as Shoxpr, was amplified by PCR

Table 1Oligonucleotide primers developed and used in the present study

Primer Sequence 5 0 ! 30 Position

ssr2227F TTTTCCGTTGTTTTAACGGATT 1679740–1679719ShoxEF GGGAACGGCTTGCTACGTTAAA 1678275–1678254ShoxER GCCAATACCGCTTCGTCATTCT 1678075–1678096ShoxER1 CGTCTAACACCTTAAAACGCTTGT 1678484–1678507ShoxER2 TTTAACGTAGCAAGCCGTTCCC 1678275–1678254ShoxFF CGACCAAGACCACCCTATCCAG 1677049–1677028ShoxFR TCAATCAGACCAGCGTTTTCCA 1676853–1676874ShoxUF CAATTTCCCAAGCGAGAAGTGG 1675279–1675258ShoxUR GCCACAGGAAGTACAGGCATCA 1675073–1675094ShoxYF GACGAATGGCTCATTGATCTCG 1674826–1674805ShoxYR CATTGGCGGTTACAGCACAGTC 1674622–1674643ShoxHF TGTGGACCGTTTACCAGAAGCA 1672941–1672920ShoxHR CGCGACAATATTGCCTTCACTG 1672740–1672761slr1332R GTTCTAGTCGGGCTAACCAATG 1670948–1670969ShoxprF GCAATTGGGGTTGCGACTAT 1679149–1679130ShoxprR CCTCCACAATCTTGCCCACAATAA 1678688–1678711SlexAF GGATCCGAACCTCTCACCCGAGCCCAAAAAG 1319327–1319303SlexAR AAGCTTCTAAACTCCCTGGAAATTGCGC 1318719–1318740sll1225F ATGACCAACCAAACTTCTTTCA 1674034–1674013sll1225R CTAACTACTGTTAGCAATAACT 1673585–1673606Prom1F TTTTCGGTTTGGGTGTTGTC 1679130–1679111Prom1R GATAAAAACAGCCACTTCCG 1678999–1679018Prom2F CGGAAGTGGCTGTTTTTATC 1679018–1678999Prom2R CGTAACTAAATTAATATCG 1678885–1678903Prom3F CGATATTAATTTAGTTACG 1678903–1678885Prom3R GTGAGCAAATCTTTAGCTT 1678763–1678781Prom4F AAGCTAAAGATTTGCTCAC 1678781–1678763Prom4R CCTGATTTTCACCCTTAGTC 1678651–1678670

The position of the primers is in accordance to the Cyanobase nomenclature (http://www.kazusa.or.jp/cyano/). The underlined base pairs correspondto restriction sites.

P. Oliveira, P. Lindblad / FEMS Microbiology Letters 251 (2005) 59–66 61

using the oligonucleotides ShoxprF, labeled with biotin,and ShoxprR (Table 1) and used for the DNA affinityassays. The incubation of the DNA fragment with beadsand the isolation of DNA-bound complexes were car-ried out as described elsewhere [20], except that the pro-tein–DNA incubation buffer was supplemented with0.6 mg/mL salmon sperm DNA and 5 mM MgCl2. Fi-nally, the beads were resuspended in SDS sample bufferand immediately heated up for 5 min at 95 �C . Sampleswere analyzed by SDS–PAGE and stained with Coo-massie blue.

Proteins were excised from the gels, cleaved withtrypsin by in-gel digestion and analyzed by electrosprayionization mass spectrometry according to Wilm et al.[21] on a Q-tof mass spectrometer (Waters Ltd.) usingMasslynx software. Sequence homology search was per-formed with the BLAST program [22].

2.8. Cloning of Synechocystist lexA and purification of

the gene product

Synechocystis lexA was amplified from genomicDNA using the oligonucleotides SlexAF and SlexAR(Table 1). The obtained PCR fragment was cloned intothe pCR 2.1-TOPO� (Invitrogen) vector and confirmed

by sequencing. The Synechocystis lexA was further sub-cloned into pQE-30 (QIAGEN) and introduced intoM15 (pREP4) cells (QIAGEN). After confirming byDNA sequencing that no mutations had been intro-duced, Synechocystis LexA was overexpressed and puri-fied using the Ni-NTA Superflow Resin (QIAGEN),according to the instructions of the manufacturer. Theobtained Synechocystis LexA His-tag protein was morethan 95% pure, as determined by Coomassie Blue Stain-ing of SDS–PAGE (Fig. 4).

2.9. Electrophoretic mobility shift assays

The different DNA fragments used for the electro-phoretic mobility shift assays (EMSA) were end-labeledwith [c-32P] ATP as described [14]. Twenty femtomole ofeach labeled DNA fragment was incubated with variousamounts of Synechocystis LexA. The sample buffer mix-ture contained (final volume, 20 lL) 4 mM Tris–HCl(pH 8.0), 12 mM HEPES (pH 7.9), 12% (v/v) glycerol,0.5 mM EDTA, 1 mM dithiothreitol, 60 mM KCl,5 mM MgCl2 and 1 lg salmon sperm DNA. After incu-bation at 30 �C for 30 min, the reaction mixtures wereseparated by electrophoresis either on a 7.5% (w/v)homogenous (Fig. 5A) or 10–15% (w/v) gradient

62 P. Oliveira, P. Lindblad / FEMS Microbiology Letters 251 (2005) 59–66

(Fig. 5B and C) native polyacrylamide gel using thePhastSystem (Amersham). The relative positions of theisotope were visualized using a BAS-2000II Bio-ImagingAnalyzer (Fuji Film).

3. Results

3.1. The hox genes in Synechocystis PCC 6803 can be

transcribed as a single operon

RT-PCR experiments, using total RNA extractedfrom the Synechocystis cells, were carried out for thetranscriptional analysis of the hoxEFUYH genes. AnRT reaction using ShoxHR as a hoxH-specific antisenseprimer was performed, and the resulting cDNA wasused as template in PCR amplifications for the detectionof the respective hox transcripts (Fig. 1A). The resultsshowed that the five hox genes are indeed transcribed to-gether (Fig. 1B). Furthermore, the genes ssr2227 andslr1332, localized upstream and downstream of hoxE

and hoxH, respectively, are not transcribed togetherwith the hox cluster (data not shown). AdditionalNorthern Blot analysis was carried out, confirming theresults obtained by RT-PCR (data not shown).

3.2. TSP and characterization of the promoter region

The TSP was localized by 5 0 RACE to 168bp up-stream the hoxE ATG start codon (Figs. 1 and 2). Aputative sigma70 promoter sequence, TTGCTC–N18–TAACAA, can be identified upstream of the TSP

Fig. 1. (A) Organization of the locus containing the genes encoding the bidirhoxE corresponds to the TSP. (B) RT-PCR analysis of the hox operon. Lannegative control without RT; M, 100 bp ladder (Amersham).

(Fig. 2). Moreover, two putative LexA binding siteswere recognized at positions �117.5 and �84.5 withrespect to the determined TSP (Fig. 2).

3.3. LexA is binding in the hox regulatory promoter

region

To address the question of possible DNA bindingproteins/transcription factors interacting in the regula-tory promoter region of the Synechocystis hox operon,DNA affinity assays were carried out. Specific proteinswere detected with the DNA fragment Shoxpr incubatedwith two different cell extracts (Fig. 3). Interestingly, thepolypeptide pattern obtained with the Nostoc proteinextract (a strain lacking the bidirectional hydrogenase[18]) was qualitatively different from the patterns ob-tained when using the Synechocystis cell extracts. Themost abundant Synechocystis protein, Sample-400(Fig. 3A), was excised from the gel and identified, usingmass spectrometry, to be LexA (Fig. 3B).

The lexA gene from Synechocystis was cloned andoverexpressed in E. coli. The purified His-tagged Syn-echocystis LexA (Fig. 4) was further used for EMSAanalysis. The data obtained from the EMSA experi-ments are in agreement with the DNA affinity assays,showing a specific binding of the Synechocystis LexAto the regulatory promoter region of the hox genesand failing to produce any shift on the mobility whenusing an unrelated DNA fragment (Fig. 5A). Moreover,increasing concentrations of the purified LexA in theEMSA resulted in two retarded LexA–Shoxpr com-plexes (Fig. 5B). When the DNA fragment Shoxpr was

ectional hydrogenase in Synechocystis PCC 6803. The arrow upstreames: 1, PCR positive control; 2, PCR negative control; 3, RT-PCR; 4,

Fig. 2. Schematic representation of the Synechocystis hoxE gene and the regulatory promoter region of the hox operon. The positions of the differentDNA fragments used for the EMSA are indicated as lines above the map. Two putative LexA binding sites are boxed on the map and in the sequence:filled line, putative high affinity site; dashed line, putative low affinity site. These putative elements were selected as follows: G+C content maximum 3out of 18 nucleotides, and the ratio of T over A nucleotides at least 2 [25]. The TSP (+1) is indicated by an arrow, depicted in boldface in thesequence, and putative �10 and �35 regulating sequences underlined. The ribosomal binding site (RBS) is shown in italic. The start codon of hoxE isshown in boldface and underlined, and the deduced N-terminal amino acid sequence is given below. The primer used to identify the TSP is shown initalic and underlined.

P. Oliveira, P. Lindblad / FEMS Microbiology Letters 251 (2005) 59–66 63

amplified as four smaller fragments, it was possible tofurther identify where in Shoxpr LexA is binding. TheDNA fragment that experienced a shift in its mobility(Prom3) covers the region harboring the two putativeLexA binding sites.

4. Discussion

The present study clearly demonstrates that the fivestructural hox genes encoding the bidirectional hydrog-enase in Synechocystis PCC 6803 can be transcribed asa single operon. As a consequence, the three open read-ings frames sll1222, ssl2420 and sll1225, predicted geneswith unknown functions, are also part of the same tran-script. However, the additional presence of shorter tran-scripts covering only part of the hox operon can not beexcluded. The TSP being 168bp upstream the hoxE

ATG start codon, and the position and the sequenceof the putative sigma70 promoter sequence, as well asthe ribosomal binding site, are all in agreement withthe general molecular organization of cyanobacterialgenes.

DNA affinity assays demonstrated a specific interac-tion between the Synechocystis hox regulatory promoterregion and a protein which unexpectedly was identifiedas LexA. In general, LexA is a well-known DNA-bind-ing protein directly involved in the SOS response, one of

the first clear network of transcriptional regulation iden-tified in bacteria. The current prokaryotic model isbased on the DNA metabolism in E. coli [23,24]. It com-prises a set of coordinated physiological responses in-duced by DNA damage, which may lead to theexpression of more than 20 genes, most of them involvedin different mechanisms of DNA repair. LexA is knownas a typical transcription repressor and exists as a dimer.A palindromic DNA sequence, termed the SOS box, isrecognized by the dimeric repressor. In contrast, verylittle is known concerning DNA repair in oxygen-evolv-ing photosynthetic microorganisms, although they arestrongly exposed to DNA damage generated by solarenergy and reactive oxygen species [25]. SynechocystisLexA has been shown to be a key transcription regulatornot directly involved in the DNA damage repair/SOS re-sponse system, but instead associated with the regula-tion of genes controlled by inorganic carbon andessential to cells facing carbon starvation [25]. Theexpression and translation of the Synechocystis lexA

gene was found to be crucial for the viability of the cells,i.e., knock-out mutants are lethal, irrespective of theconditions and the duration of subcultivation, and onlynot fully segregated lexA-less mutans are possible to ob-tain [25]. Large scale analyses demonstrated that thetranscription of many genes is affected in a Synechocys-

tis lexA-depleted mutant; interestingly, it was possible toidentify genes whose expression was either activated or

Fig. 3. (A) DNA affinity assay. Lanes: 1, total Synechocystis cell protein extract (5 lg); 2–5, assays carried out with 250 lg magnetic beads andincubated with 2–150 lg Synechocystis protein extract; 3, 600 lg Synechocystis protein extract; 4, 375 lg Nostoc protein extract; 5, no proteins; M,protein molecular weight marker (Fermentas). The 11 kDa polypeptide corresponds to streptavidin which covers the magnetic beads used in theassay, single band in the negative control shown in lane 5. (B) Alignment of the deduced LexA protein sequences from A. variabilis ATCC 29413(A.29413), Anabaena PCC 7120 (A.7120), Nostoc ATCC 29133 (N.29133), Prochlorococcus marinus MIT 9313 (P.9313), Synechocystis PCC 6803(S.6803), Bacillus cereus ATCC 10987 (B. cereus) and E. coli K12 (E. coli). The residues of the E. coli LexA protein, corresponding to the three ahelices involved in DNA-binding are underlined [28]. The amino-acidic sequence obtained by mass spectrometry is highlighted in gray. The conservedregions involved in LexA auto cleavage are indicated by boxes and the differences in these sites are highlighted in boldface.

64 P. Oliveira, P. Lindblad / FEMS Microbiology Letters 251 (2005) 59–66

repressed in response to LexA depletion [25], ruling outthe suggestion that LexA is a pure repressor [24]. Inaddition, LexA has been reported to be needed forself-repression [26]. Despite the considerable similaritybetween the different deduced LexA sequences(Fig. 3B), specifically among the cyanobacterial pro-teins, two major differences can be pinpointed on thetwo core sites of this protein in Synechocystis, i.e., thecleavage site and the active site for auto hydrolysis

[23]. It is possible to verify that the Ala84 and Ser118residues are substituted by Gly and Asp (Fig. 3B). Ma-zon et al. [27] suggested that these modifications maynegatively affect the autocatalytic cleavage of this tran-scription factor in Synechocystis and thus affect theDNA recognition. Furthermore, some studies showclear evidence that, as a consequence of a variableDNA-binding domain specifically in the a3 helix whichis directly involved in DNA recognition (Fig. 3B), it is

Fig. 4. Overexpression and purification of Synechocystis LexA. Lanes:1, non-induced crude extract; 2, induced crude extract; 3, flow-through; 4, wash; 5, purified LexA.

P. Oliveira, P. Lindblad / FEMS Microbiology Letters 251 (2005) 59–66 65

possible to find a significant variability in the sequenceof the LexA-binding motif, even within the same phylo-genetic group of microorganisms [27,28].

Although the in situ physiological role of cyanobacte-rial bidirectional hydrogenase is unclear, available sug-gestions, i.e., being part of complex I [3], involved infermentation [6], and functioning as an electron valve

Fig. 5. Binding of the Synechocystis LexA to the hox regulatory region. (A) E6), or of an unrelated probe, obtained by PCR with the primers sll1225F–sll12carried out with 40, 200 and 400 nM LexA, respectively; 5 and 6, assays carriemolar excess of the corresponding unlabeled fragment as competitor DNA; 7(B) EMSA using increasing concentrations of LexA and 20 fmol of Shoxpr. L1.0, 2.0, 3.0 and 4.0 lM LexA, respectively. (C) EMSA carried out using 20Shoxpr. Lanes: 1, labeled DNA fragment only; 2–4, assays carried out with

during photosynthesis [7], are all pointing to an enzymesystem being under redox control. Synechocystis LexAand EMSA showed a specific binding to the regulatorypromoter region of the hox operon. Increasing concen-trations of the purified LexA resulted in two retardedLexA–DNA complexes, in agreement with the presenceof two putative LexA binding sites. The putative sitecentered around position �117.5 with respect to thedetermined TSP fits well with previously proposedT/a-rich motifs [25], while the second putative site cen-tered around �84.5 may have a higher hindrance. Thismay explain the presence of two LexA–DNA complexeswith increasing concentration of Synechocystis LexAwith a higher affinity to the more upstream site.

In conclusion, the hox genes in Synechocystis PCC6803 are transcribed as a single operon with the tran-scriptional regulator LexA binding in the promoter re-gion, suggesting a role for LexA in the transcriptionregulation of the Synechocystis hox genes.

Acknowledgments

We thank Hakan Larsson (Department of PlantBiology and Forest Genetics, Swedish AgriculturalUniversity, Sweden) for sequencing the proteins andJose-Luis Costa for introducing the DNA affinity assay

MSA using purified LexA and 20 fmol of either Shoxpr probe (lanes 1–25R (lanes 7 and 8). Lanes: 1, labeled DNA fragment only; 2–4, assaysd out with 200 nM LexA, in the presence of 5· (lane 5) and 50· (lane 6), labeled DNA fragment only; 8, assay carried out with 400 nM LexA.anes: 1, labeled DNA fragment only; 2–6, assays carried out with 0.5,fmol of four shorter DNA fragments together covering the fragment0.03, 0.3 and 3 lM of LexA, respectively.

66 P. Oliveira, P. Lindblad / FEMS Microbiology Letters 251 (2005) 59–66

technique. The work was supported by the Swedish Re-search Council, the Swedish Energy Agency, the NordicEnergy Research Program and the EU/NEST ProjectSOLAR-H (Contract No. 516510).

References

[1] Tamagnini, P., Axelsson, R., Lindberg, P., Oxelfelt, F., Wunsch-iers, R. and Lindblad, P. (2002) Hydrogenases and hydrogenmetabolism of cyanobacteria. Microbiol. Mol. Biol. Rev. 66, 1–20.

[2] Schutz, K., Happe, T., Troshina, O., Lindblad, P., Leitao, E.,Oliveira, P. and Tamagnini, P. (2004) Cyanobacterial H2 produc-tion – a comparative analysis. Planta 218, 350–359.

[3] Appel, J. and Schulz, R. (1996) Sequence analysis of an operon ofa NAD(P)-reducing nickel hydrogenase from the cyanobacteriumSynechocystis sp. PCC 6803 gives additional evidence for directcoupling of the enzyme to NAD(P)H-dehydrogenase (complex I).Biochim. Biophys. Acta 1298, 141–147.

[4] Kaneko, T., Sato, S., Kotani, H., Tanaka, A., Asamizu, E.,Nakamura, Y., Miyajima, N., Hirosawa, M., Sugiura, M.,Sasamoto, S., Kimura, T., Hosouchi, T., Matsuno, A., Muraki,A., Nakazaki, N., Naruo, K., Okumura, S., Shimpo, S., Takeuchi,C., Wada, T., Watanabe, A., Yamada, M., Yasuda, M. andTabata, S. (1996) Sequence analysis of the genome of theunicellular cyanobacterium Synechocystis sp. strain PCC6803.DNA Res. 30, 185–209.

[5] Schmitz, O., Boison, G., Salzmann, H., Bothe, H., Schutz, K.,Wang, S.H. and Happe, T. (2002) HoxE – a subunit specific forthe pentameric bidirectional hydrogenase complex (HoxEFUYH)of cyanobacteria. Biochim. Biophys. Acta 1554, 66–74.

[6] Antal, T.K. and Lindblad, P. (2005) Production of H2 by sulphur-deprived cells of the unicellular cyanobacteria Gloeocapsa alpicola

and Synechocystis sp. PCC 6803 during dark incubation withmethane or at various extracellular pH. J. Appl. Microbiol. 98,114–120.

[7] Appel, J., Phunpruch, S., Steinmuller, K. and Schulz, R. (2000)The bidirectional hydrogenase of Synechocystis sp. PCC 6803works as an electron valve during photosynthesis. Arch. Micro-biol. 173, 333–338.

[8] Rakhely, G., Kovacs, A.T., Maroti, G., Fodor, B.D., Csanadi,G., Latinovics, D. and Kovacs, K.L. (2004) Cyanobacterial-type,heteropentameric, NAD+-reducing NiFe hydrogenase in thepurple sulfur photosynthetic bacterium Thiocapsa roseopersicina.Appl. Environ. Microbiol. 70, 722–728.

[9] Schmitz, O., Boison, G. and Bothe, H. (2001) Quantitativeanalysis of expression of two circadian clock-controlled geneclusters coding for the bidirectional hydrogenase in the cyano-bacterium Synechococcus sp. PCC7942. Mol. Microbiol. 41, 1409–1417.

[10] Boison, G., Bothe, H. and Schmitz, O. (2000) Transcriptionalanalysis of hydrogenase genes in the cyanobacteria Anacystis

nidulans and Anabaena variabilis monitored by RT-PCR. Curr.Microbiol. 40, 315–321.

[11] Oxelfelt, F., Tamagnini, P., Salema, R. and Lindblad, P. (1995)Hydrogen uptake in Nostoc strain PCC 73102: effects of nickel,hydrogen, carbon and nitrogen. Plant Physiol. Biochem. 33, 617–623.

[12] Axelsson, R. and Lindblad, P. (2002) Transcriptional regulationof Nostoc hydrogenases: effects of oxygen, hydrogen, and nickel.Appl. Environ. Microbiol. 68, 444–447.

[13] Sheremetieva, M.E., Troshina, O., Serebryakova, L.T. andLindblad, P. (2002) Identification of hox genes and analysis oftheir transcription in the unicellular cyanobacterium Gloeocapsa

alpicola CALU 743 growing under nitrate-limiting conditions.FEMS Microbiol. Lett. 214, 229–233.

[14] Oliveira, P., Leitao, E., Tamagnini, P., Moradas-Ferreira, P. andOxelfelt, F. (2004) Characterization and transcriptional analysisof hupSLW in Gloeothece sp. ATCC 27152: an uptake hydrog-enase from a unicellular cyanobacterium. Microbiology 150,3647–3655.

[15] Lindberg, P. (2003) Cyanobacterial hydrogen metabolism –uptake hydrogenase and hydrogen production by nitrogenase infilamentous cyanobacteria. PhD thesis. Uppsala University,Uppsala, Sweden. ISBN 91-554-5708-8.

[16] Kucho, K., Okamoto, K., Tsuchiya, Y., Nomura, S., Nango, M.,Kanehisa, M. and Ishiura, M. (2005) Global analysis of circadianexpression in the cyanobacterium Synechocystis sp. strain PCC6803. J. Bacteriol. 187, 2190–2199.

[17] Stanier, R.Y., Kunisawa, P., Mandel, M. and Cohen-Bazire, G.(1971) Purification and properties of unicellular blue-gree algae(order Chrococcales). Bacteriol. Rev. 35, 171–205.

[18] Tamagnini, P., Troshina, O., Oxelfelt, F., Salema, R. andLindblad, P. (1997) Hydrogenases in Nostoc sp. strain PCC73102, a strain lacking a bidirectional hydrogenase. Appl.Environ. Microbiol. 63, 1801–1807.

[19] Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUS-TAL W: improving the sensitivity of progressive multiplesequence alignment through sequence weighting, position-specificgap penalties and weight matrix choice. Nucleic Acids Res. 22,4673–4680.

[20] Drewett, V., Molina, H., Millar, A., Muller, S., Hesler, F. andShaw, P.E. (2001) DNA-bound transcription factor complexesanalysed by mass-spectrometry: binding of novel proteins to thehuman c-fos SRE and related sequences. Nucleic Acids Res. 29,479–487.

[21] Wilm, M., Shevchenko, A., Houthaeve, T., Breit, S., Schweigerer,L., Fotsis, T. and Mann, M. (1996) Femtomole sequencing ofproteins from polyacrylamide gels by nano-electrospray massspectrometry. Nature 379, 466–469.

[22] Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J.H., Zhang,Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.Nucleic Acids Res. 25, 3389–3402.

[23] Little, J.W. and Mount, D.W. (1982) The SOS regulatory systemof Escherichia coli. Cell 29, 11–22.

[24] Wagner, R. (2000) Transcription Regulation in Prokaryotes.Oxford University Press, Oxford.

[25] Domain, F., Houot, L., Chauvat, F. and Cassier-Chauvat, C.(2004) Function and regulation of the cyanobacterial genes lexA,recA and ruvB: LexA is critical to the survival of cellsfacing inorganic carbon starvation. Mol. Microbiol. 53, 65–80.

[26] Kamei, A., Hihara, Y., Geng, X. and Ikeuchi, M. (2001)Functional analysis of lexA-like gene, sll1626 in Synechocystis

sp. PCC 6803 using DNA microarray. Plant Cell Physiol. Suppl.32, S95.

[27] Mazon, G., Lucena, J.M., Campoy, S., Henestrosa, A.R.,Candau, P. and Barbe, J. (2004) Fernandez de LexA-bindingsequences in Gram-positive and cyanobacteria are closely related.Mol. Genet. Genom. 271, 40–49.

[28] Mazon, G., Erill, I., Campoy, S., Cortes, P., Forano, E. andBarbe, J. (2004) Reconstruction of the evolutionary history of theLexA-binding sequence. Microbiology 150, 3783–3795.