Upload
others
View
6
Download
0
Embed Size (px)
Citation preview
JPET #140335
1
Title Page
Gene expression profiles in livers from diclofenac-treated rats reveal intestinal
bacteria-dependent and -independent pathways associated with liver injury
Xiaomin Deng, Michael J. Liguori, Erica Sparkenbaugh, Jeffrey F. Waring, Eric A.G.
Blomme, Patricia E. Ganey and Robert A. Roth
Department of Biochemistry and Molecular Biology,Michigan State University, East
Lansing, MI (XD)
Department of Pharmacology and Toxicology, Michigan State University, East
Lansing, MI (ES, PG, RR)
Department of Cellular and Molecular Toxicology, Abbott Laboratories, Abbott Park,
IL (ML, JW, EB)
JPET Fast Forward. Published on September 18, 2008 as DOI:10.1124/jpet.108.140335
Copyright 2008 by the American Society for Pharmacology and Experimental Therapeutics.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
2
Running Title Page
Gene expression after diclofenac treatment
Corresponding Author:
Robert A. Roth
Department of Pharmacology and Toxicology
B347, Life Sciences Building
Michigan State University
East Lansing, MI 48824
Tel: (517)-353-9841
Fax: (517)-432-2310
e-mail: [email protected]
Text Page: 48
Number of Tables: 4
Number of Figures: 8
Number of References: 40
Abstract Words: 241
Introduction Words: 418
Discussion Words: 1778
Abbreviations:
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
3
IADR- idiosyncratic adverse drug reactions
LPS – lipopolysaccharide
PPAR – peroxisome proliferator-activated receptor
PMN - neutrophil
ALT - alanine aminotransferase
DCLF - diclofenac
PIM - pimonidazole
ROS-reactive oxygen species
NSAID-nonsteroidal anti-inflammatory drug
Recommended Section Assignment: Toxicology
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
4
Abstract
Diclofenac (DCLF) is a nonsteroidal anti-inflammatory drug (NSAID) that is
associated with idiosyncratic adverse drug reactions (IADRs) in humans. Previous
studies revealed a crucial role for intestine-derived bacteria and/or lipopolysaccharide
(LPS) in DCLF-induced hepatotoxicity. We further explored this mechanism by
conducting gene expression analysis of livers from rats treated with a hepatotoxic
dose of DCLF (100mg/kg) with or without oral antibiotic pretreatment. Genes for
which expression was altered by DCLF were divided into two groups: genes with
expression altered by antibiotic treatment and those unaffected by antibiotics. The
former group of genes represented the ones for which DCLF-induced alterations in
expression depended on intestinal bacteria. The expression of the latter group of genes
was likely changed by direct effect of DCLF rather than by intestinal bacteria.
Functional analysis of genes in the former group revealed LPS-related signaling,
further suggesting a role for bacterial endotoxin in the liver injury. Functional analysis
of genes in the latter group revealed changes in signaling pathways related to
inflammation, hypoxia, oxidative stress, the aryl hydrocarbon receptor and
peroxisome proliferator-activated receptor alpha (PPARα). Neutrophil depletion failed
to protect from DCLF-induced hepatotoxicity, suggesting that intestinal bacteria
contribute to liver injury in a neutrophil-independent manner. Hypoxia occurred in the
livers of rats treated with DCLF, and hypoxia in vitro rendered hepatocytes sensitive
to DCLF-induced cytotoxicity. These results support the hypothesis that intestinal
bacteria are required for DCLF-induced hepatotoxicity and suggest that hypoxia plays
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
5
an important role in the pathogenesis.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
6
Introduction
Diclofenac (DCLF) induces idiosyncratic hepatotoxicity in human patients with a
low incidence but high severity (Boelsterli, 2003; Banks et al., 1995). Cases of severe
hepatic injury leading to liver transplantation comprise a large portion of the reported
cases of DCLF-induced hepatotoxicity (Lewis, 2003). Due to the lack of apparent
dose dependency, the variable temporal relationship with drug exposure and the lack
of animal models, the mechanisms of DCLF-induced hepatic idiosyncratic adverse
drug reactions (IADRs) remain largely unknown (Boelsterli, 2003). Metabolic and
kinetic factors (Seitz et al., 1998;Daly et al., 2007), oxidative stress (Cantoni et al.,
2003) and mitochondrial injury (Masubuchi et al., 2002) have been suggested to be
important to the pathogenesis, but these require further evaluation, especially in vivo.
For instance, hepatocellular cytotoxicity from DCLF or its metabolites is only
observed in vitro with large concentrations of DCLF that are not achieved in vivo
(Gomez-Lechon et al., 2003a;Masubuchi et al., 2002). Similarly, polymorphisms in
enzymes that metabolize DCLF, such as UDP-glucuronosyltransferase 2B7 (UGT2B7)
and CYP2C8, and in the DCLF glucuronide transporter ABCC2, have been found in
human patients who developed DCLF hepatotoxicity (Daly et al., 2007). However, no
direct evidence has emerged to support a causal relationship between DCLF
metabolites and hepatotoxicity in vivo.
DCLF is known to cause intestinal ulceration that allows bacteria within the
intestinal tract to translocate into the circulation (Kim et al., 2005;Deng et al., 2006).
Previous studies showed that lipopolysaccharide (LPS) exposure interacted with a
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
7
small, nontoxic dose of DCLF (20mg/kg) to result in liver injury in rats (Deng et al.,
2006). Furthermore, antibiotics that eliminated gut-derived, Gram-negative bacteria
attenuated hepatotoxicity induced by a large dose of DCLF (100mg/kg) (Deng et al.,
2006). These results suggested that bacteria or LPS exposure during DCLF treatment
could be a susceptibility factor for DCLF-induced IADRs. Since such exposure during
drug treatment could be episodic and occur irregularly in human patients (Roth et al.,
2003), this could explain the variable dose and temporal relationships that
characterize DCLF IADRs. LPS exposure also interacts with other IADR producing
drugs, such as trovofloxacin and ranitidine, to cause hepatocellular injury in animals,
(Luyendyk et al., 2003; Waring et al., 2005).
The exact mechanisms by which bacteria or LPS contributes to DCLF-induced
hepatotoxicity remain unknown. Accordingly, the further exploration of factors
contributing to toxicity that are evoked directly by DCLF and independent of
bacteria/LPS is required. Here we examined gene expression profiles in livers of
DCLF-treated rats with or without antibiotic pretreatment to elucidate bacteria/LPS
dependent-and -independent pathways that are associated with DCLF hepatotoxicity.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
8
Methods
Experimental Design. Rats received humane care according to the criteria outlined in
the “Guide for the Care and Use of Laboratory Animals” prepared by the National
Academy of Sciences, and the procedures were approved by the Michigan State
University Committee on Animal Use and Care. Male, Sprague-Dawley rats (Crl:CD
(SD)IGS BR; Charles River, Portage, MI) weighing 250 to 350 grams were used for
these studies. Animals were fed standard chow (Rodent chow/Tek 8640, Harlan
Teklad, Madison, WI) and allowed access to water ad libitum. They were allowed to
acclimate for 1 week in a 12-h light/dark cycle before use.
Rats were fasted for 16 h and then given a hepatotoxic dose of DCLF (100
mg/kg, i.p.) or its vehicle saline. They remained fasted and were sacrificed 6 h after
DCLF treatment for evaluation of liver injury, histopathology and gene expression.
The rats were anesthetized with sodium pentobarbital (50 mg/kg, i.p.), blood was
collected from the dorsal aorta, and a portion of the blood was placed into a tube
containing sodium citrate (final concentration, 0.38%) for collection of plasma.
Another portion was allowed to clot at room temperature, and serum was collected
and stored at -80°C until use. Representative (3-4-mm) slices of the ventral portion of
the left lateral liver lobe were collected and fixed in 10% neutral-buffered formalin
and then later processed for histological evaluation. A portion of the right medial
lobe of the liver was flash-frozen in liquid nitrogen for gene expression analysis.
Gut sterilization was achieved by treating rats with polymyxin B (150 mg/kg)
and neomycin (450 mg/kg) orally for 4 days before treatment with DCLF as described
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
9
(Deng et al., 2006). This treatment has been shown to abolish completely the
Gram-negative bacterial growth in rat fecal culture and to reduce plasma endotoxin
concentration after chronic ethanol treatment (Adachi et al., 1995). For Figure 3, rats
were treated with a nonhepatotoxic dose of LPS (2.9x107 EU/kg, i.v.), a
nonhepatotoxic (20 mg/kg, i.p.) or hepatotoxic dose (100 mg/kg, i.p.) of DCLF. The
rats were sacrificed 6 h after treatment, and RNA was prepared for microarray
analysis.
Alanine Aminotransferase (ALT) Activity and Histopathology Assessment.
Hepatic parenchymal cell injury was estimated by quantifying serum ALT activity,
which was determined spectrophotometrically using Infinity-ALT from Thermo
Electron Corp. (Louisville, CO). Formalin-fixed liver samples were routinely
processed and stained with hematoxylin and eosin (H&E). Slides were read by a
pathologist (EB) blinded to the treatment.
RNA Preparation. Each frozen liver sample (approximately 100 mg of tissue) was
immediately added to 2 mL of TRIzol reagent (Invitrogen Life Technologies,
Carlsbad, California) and homogenized using a Polytron 300D tissue grinder
(Brinkman Instruments, Westbury, NY). One mL of the tissue homogenate was
transferred to a microfuge tube, and total RNA was extracted with chloroform
followed by nucleic acid precipitation with isopropanol. The pellet was washed with
80% ethanol and resuspended in molecular biology grade water. Nucleic acid
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
10
concentration was determined spectrophotometrically at 260 nm (Smart-Spec,
Bio-Rad Laboratories, Hercules, CA), and RNA integrity was evaluated using an
Agilent bioanalyzer (Agilent Technologies, Model 2100, Foster City, CA).
Gene Array Analysis. Microarray analysis was performed using the standard
protocol provided by Affymetrix, Inc. (Santa Clara, CA). Approximately 5 μg of
total RNA were reversed transcribed into cDNA using a Superscript II Double-Strand
cDNA synthesis kit (Invitrogen Life Technologies, Carlsbad, California) according to
the manufacturer’s instructions with the exception that the primer used for the reverse
transcription reaction was a modified T7 primer with 24 thymidines at the 5’ end
(Enzo Life Science). The sequence was 5’GGCCAGTGAATTGTAATACGACTC
-ACTATAGGGAGGCGG-(dT)24-3’. cDNA was purified via phenol/chloroform/
isoamylalcohol (Invitrogen Life Technologies) extraction and ethanol precipitation.
The purified cDNA was resuspended in molecular biology grade water.
Biotin-labeled cRNA from the cDNA was synthesized according to the
manufacturer’s instructions using the Enzo RNA Transcript Labeling Kit (Affymetrix).
The labeled cRNA was then purified using RNeasy kits (Qiagen, Valencia, CA).
Subsequently, cRNA concentration and integrity were evaluated. Approximately 20
μg of cRNA were then fragmented in a solution of 40 mM Tris-acetate, pH 8.1, 100
mM potassium acetate, and 30 mM magnesium acetate at 94oC for 35 minutes.
Fragmented, labeled cRNA was hybridized to an Affymetrix rat genome RAE230A
2.0 array, which contained sequences corresponding to roughly 30,000 transcripts, at
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
11
45°C overnight using an Affymetrix Hybridization Oven 640. The array was
subsequently washed and stained twice with strepavidin-phycoerythrin (Molecular
Probes, Eugene, OR) using a Gene-Chip Fluidics Workstation 400 (Affymetrix).
The array was then scanned using the Affymetrix GeneChip Scanner 3000.
The microarray scanned image and intensity files (.cel files) were imported into
Rosetta Resolver gene expression analysis software version 7.1 (Rosetta Inpharmatics,
Seattle, WA). Error models were applied, and ratios were built for each treatment
array versus its respective vehicle control (pooled in silico). A p-value was
calculated for every fold change, using the Rosetta Resolver error model (Rajagopalan,
2003).
Statistical Filtering of Genes Changed After DCLF Treatment. Genes with
expression that changed after treatment with antibiotic/Vehicle (Veh), Veh/DCLF or
antibiotic/DCLF were identified with Veh/Veh as baseline using the following criteria:
p<0.01 in at least 2 out of 3 (antibiotic/Veh group), at least 4 out of 5 (Veh/DCLF
group); p<0.01 in at least 3 out of 4 animals (group antibiotic/DCLF). The genes for
which expression changed after Veh/DCLF treatment were analyzed further. The
expression of this group of genes in rats treated with antibiotic/DCLF and Veh/DCLF
was compared using Veh/DCLF as baseline to identify the genes differentially or
similarly expressed between these two groups. Genes were considered differentially
expressed if they met the following criterion: p<0.01 in at least 3 out of 4 animals in
antibiotic/DCLF group using Veh/DCLF as baseline. This analysis rendered two
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
12
groups of genes: those expressed differently between Veh/DCLF and
antibiotics/DCLF (bacteria-dependent genes) and those that were expressed similarly
(bacteria-independent genes). These two groups of genes were further filtered by the
criterion of degree of correlation of their expression level with plasma alanine
aminotransferase (ALT) activity. The gene expressions were considered highly
correlated with ALT if the correlation coefficient was greater than 0.6. The function of
genes with expression level highly correlated with ALT was identified as described in
Entrez Gene site (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene).
Furthermore, these two groups of genes were imported into Ingenuity Pathway
Analysis 5.5 (Ingenuity System, Inc., Redwood City, CA). This yielded a list of
pathway terms ranked by their probability of over-representation or
under-representation in a particular gene list. Functional annotations were based on
the Ingenuity System knowledge base. “Ratio” refers to the percentage of the number
of genes identified in a particular pathway found in the imported list of genes to the
total number of genes in that particular pathway. The pathways reported by Ingenuity
Pathway Analysis were ranked by p value, which illustrates the deviation of the
observed number of genes for each pathway found in the imported list of genes from
the number expected to occur by chance.
Neutrophil (PMN) Staining and PMN Depletion. PMNs accumulated in liver were
enumerated by immunohistochemical staining and quantified as described previously
(Yee et al., 2003). PMN depletion was accomplished by pretreating rats with a rabbit
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
13
anti-rat PMN serum (Intercell Technologies, Jupiter, FL) 16 h before DCLF treatment
as described before (Deng et al., 2007;Luyendyk et al., 2005). This PMN antiserum
selectively reduces circulating PMNs (Deng et al., 2007;Luyendyk et al., 2005).
Evaluation of Liver Hypoxia. Liver hypoxia was evaluated by immunohistochemical
staining for pimonidazole (PIM) adducts. PIM is a 2-nitroimidazole marker of
hypoxia and has been used to identify regions of hypoxia in liver. Unless otherwise
noted, rats were given 120 mg/kg Hypoxyprobe-1 (PIM hydrochloride; Chemicon
International, Temecula, CA) i.p. 2 hr before they were killed. PIM-adduct
immunostaining was performed as described previously (Copple et al., 2004).
Quantification of immunostaining was performed using Scion Image Beta 4.0.2
software (Scion Corporation, Frederick, MD). Background was set to be the average
pixel intensity in periportal regions of Veh/Veh-treated livers (i.e., an area where no
hypoxia occurs). An increase in positive immunostaining for PIM-modified proteins
indicates hypoxia in the liver tissue.
Effects of Hypoxia on DCLF-induced Hepatocyte Death In Vitro. Primary
hepatocytes were isolated from male Sprague-Dawley rats (Charles River) weighing
150-170 g using the Invitrogen HPC Product Line (Invitrogen), including liver
perfusion medium, collagenase-containing liver digest medium, and hepatocyte wash
medium. All reagents were warmed to 37°C. Rats were anesthetized with sodium
pentobarbital (50 mg/kg ip). The liver was perfused in situ through the portal vein
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
14
with perfusion medium at a flow of 30 mL/min, followed immediately by collagenase
digestion with liver digest medium at a flow of 20 mL/min, for 7-10 minutes. After
digestion, the liver was removed from the rat’s abdomen and rinsed in warmed
phophate-buffered saline (PBS), then transferred to a sterile Petri dish containing 5
mL of liver digest medium and 40 mL of hepatocyte wash medium. The digested
liver was gently manipulated with sterile forceps to disperse the hepatocytes from the
capsule, and the resulting cell homogenate was filtered through sterile nylon gauze to
remove debris. The filtrate was centrifuged (100 x g, 30 s) and washed twice with
hepatocyte wash medium, then resuspended in complete Williams’ Medium E
(supplemented with 2 mM L-glutamine, and 0.1% gentamicin) with 10% fetal bovine
serum. Viability was assessed with trypan blue exclusion, and cells were plated if
viability was greater than 85%. Cells were plated at a density of 2.5 x 105 cells/mL
in 12-well cell culture plates (Costar, Cambridge, MA). Cells were allowed to
adhere to the plates for three hours before treatment. After this time medium was
refreshed to serum-free Williams’ Medium E, and cells were treated with DCLF.
Plates were immediately transferred to hypoxic glove boxes (Coy Laboratory
Products, Inc, Grass Lake, MI) set at 5% oxygen and 5% CO2 or incubators with
room air (approximately 20% oxygen) controlled at 5% CO2. Eight hours later, the
medium (including unattached cells) was collected, and attached cells were lysed with
1% Triton X-100 in PBS. Medium and attached cell lysates were centrifuged at
8000 g for 4 minutes. Medium supernatant was removed, and the resulting
unattached cell pellet was lysed with 1% Triton X-100.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
15
The medium, unattached cell lysates, and attached cell lysates were assessed for
ALT activity using Infinity-ALT reagent. ALT release was expressed as a
percentage of the total ALT activity (activity in medium, unattached cells and
attached cell lysate) detected in the medium and unattached cell lysates.
Statistical Analysis. All data are expressed as mean + SEM. For Fig 8, two-way
ANOVA with Tukey's posthoc test was applied using SigmaStat 3.0. For Figures 6
and 7, one-way ANOVA was applied with Tukey's posthoc test. The criterion for
statistical significance was p< 0.05.
For microarray analysis, error models were applied and ratios were built for each
treatment array versus its averaged respective vehicle control (pooled in silico) using
the Rosetta Resolver system. Gene expression was considered significantly changed if
the p-value was less than or equal to 0.01. For Fig 1, agglomerative cluster analysis
was performed using the average link heuristic criteria and the Euclidean distance
metric for similarity measure. For Fig 2, K-means clustering was performed using
cosine correlation as the metric type.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
16
Results
Liver Histopathology. Our previous study showed that antibiotic pretreatment
reduced the increase in serum ALT activity induced by DCLF treatment (100mg/kg)
(Deng et al., 2006). Accordingly, histopathology was examined 6 h after DCLF
treatment. There were no apparent histopathological changes in Veh/Veh-treated or
antibiotic/Veh-treated livers (data not shown). Histopathology revealed subcapsular
hemorrhagic coagulative necrosis in Veh/DCLF-treated livers, and this was absent in
livers from antibiotic/DCLF-treated rats (Fig. 1).
Hierarchical Clustering of Hepatic Gene Expression Profiles. Hepatic gene
expression profiles were examined 6 h after DCLF treatment. Hierarchical clustering
was performed using Euclidian distance with Veh/Veh-treated rats as baseline. There
were two major clusters: animals that were treated with DCLF and those that were not
(Fig. 2). In contrast, the antibiotic/DCLF–treated rats and Veh/DCLF-treated rats did
not separate from each other.
K-Means Clustering of Hepatic Gene Expression Profiles. NSAIDs such as DCLF
can cause intestinal damage, and thereby potentially expose the liver to bacteria or
LPS. This coupled with the observation that pretreatment with antibiotics decreased
DCLF-induced liver injury suggested that LPS might be involved in DCLF-mediated
hepatotoxicity. To explore whether a hepatotoxic dose of DCLF induced gene
expression changes similar to those induced by LPS, K-Means clustering was
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
17
performed on gene expression profiles 6 h after treatment with LPS (2.9x107 EU/kg,
i.v.), nontoxic (20 mg/kg) or toxic doses (100 mg/kg) of DCLF. K-Means clustering
inputting three distinct clusters corresponding to the three treatments (Fig. 3) revealed
greater similarity between the gene expression profiles of the LPS group and the toxic
DCLF dose group than between the nontoxic DCLF dose group and either of the other
two groups.
RT-PCR Comparison with Gene Array Results. Recent technological
improvements have increased the reproducibility and reliability of microarray results
(Raymond et al., 2006). Most microarray results are now accurate, especially for
highly regulated genes, and differences between microarray- and PCR-generated data
occur mostly in the amplitude of the detected expression change (Rajeevan et al.,
2001; Dallas et al., 2005; Bosotti et al., 2007). Nevertheless, we conducted real-time
PCR validation of some of the gene expression changes mentioned in the results
section (Supplemental Data). The results showed strong agreement between the
RT-PCR and microarray data especially regarding the direction of change in
expression.
Functional Analysis of Genes Altered by DCLF Treatment. Genes with expression
altered by DCLF treatment relative to Veh/Veh controls were classified into two
groups, those expressed differently after Veh/DCLF treatment compared to
antibiotic/DCLF treatment and those expressed similarly after Veh/DCLF treatment
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
18
and antibiotic/DCLF treatment. The former group consisted of gene expression
changes associated with DCLF-induced liver injury and dependent on intestinal
bacteria (bacteria-dependent genes), whereas the second group consisted of gene
expression changes that were independent of intestinal bacteria (bacteria-independent
genes).
The bacteria-dependent genes were further filtered by the criterion of degree of
correlation with ALT. The genes highly correlated with ALT are shown in Table 1. The
function of genes with potential importance in liver injury was also noted. These
genes include those inducible by LPS such as fibrinogen (FGA) and signal transducer
and activator of transcription 3 (STAT3). Genes also emerged that are involved in
fatty acid metabolism (e.g., aldehyde dehydrogenase 3a2 [ALDH3a2] and acyl-CoA
synthetase long-chain family member 1 [ACSl]), cell cycle regulation (e.g., NIMA
[never in mitosis gene a]-related expressed kinase 6 [NEK6] and cyclin G1) and
protein transporting/trafficking (e.g., vesicle docking protein [VDP], sec1 family
domain containing 1 [SCFD1]).
Analysis of all the bacteria-dependent genes using the Ingenuity System revealed
impacted pathways ranked by p value (Table 2). Highly impacted pathways included
LPS/interleukin1(IL1)-induced inhibition of retinoid X receptor (RXR) function, fatty
acid metabolism, farnesoid X receptor (FXR)/RXR activation and gene regulation via
proliferator-activated receptor alpha (PPARα).
The bacteria-independent genes were also filtered by the criterion of degree of
correlation with ALT. The genes highly correlated with ALT are shown in Table 3.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
19
Many of these genes are related to inflammatory responses (e.g., intercellular
adhesion molecule 1 [ICAM1], interleukin 1 beta [IL1β], tumor necrosis factor
receptor superfamily member 1a [TNFRSF1a], prostaglandin E receptor 3 [PTGER3])
and to leukocyte transmigration and activation (e.g., ICAM-1, IL1β).
Another interesting group comprised genes involved in oxidative stress,
including superoxide dismutase 2 (SOD2) and heme oxygenase 1 (HMOX1). Genes
involved in cell death and cell cycle regulation were also in the list of genes for which
expression is independent of bacteria. These genes include TNFRSF1a, tumor protein
p53 (TP53) and signal transducer and activator of transcription 1 (STAT1). Several of
these genes are known to be hypoxia-inducible. These include SOD2 (Scortegagna et
al., 2003), B-cell translocation gene 2 (BTG2) (Pacary et al., 2006), STAT1 (West et
al., 2004), ICAM-1 and TP53 (Staib et al., 2005;Zhang et al., 2007).
Analysis of all the bacteria-independent genes using Ingenuity System also
revealed impacted pathways ranked by p value (Table 4). The results further suggest
the involvement of oxidative stress and hypoxia signaling. Highly impacted pathways
also included FXR/LXR activation, PPARα signaling and aryl hydrocarbon receptor
signaling.
Lack of Role for PMNs in DCLF Hepatotoxicity. Because some of the genes for
which expression was increased after DCLF treatment are involved in PMN
trafficking and activation, liver PMN accumulation was evaluated 6 h after DCLF
treatment. In livers of DCLF-treated rats, accumulation of large numbers of PMNs in
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
20
the subcapsular region was evident (Fig 4). It is in these areas where the necrosis
occurs. The PMN accumulation was markedly reduced by antibiotic treatment (Fig 4).
To investigate the role of PMNs in hepatotoxicity, rats were pretreated with PMN
antiserum. This antiserum abolished the subcapsular PMN accumulation in livers of
DCLF-treated rats (Fig 5), but it did not significantly alter the serum ALT activity
(Fig 6) or the histopathology (data not shown).
Hypoxia after DCLF Treatment in Vivo. Since several genes altered by DCLF
treatment are regulated by hypoxia, tissue hypoxia was evaluated 6 h after DCLF
treatment using PIM adduct staining. DCLF induced a large increase in PIM-adduct
staining, indicating the presence of hypoxia (Fig 7).
Effect of Hypoxia on DCLF-induced Hepatocyte Death in Vitro. In vitro,
hepatocytes incubated in an oxygen-replete atmosphere were not injured by DCLF up
to 500 μM (Fig 8). However, hypoxia (5% O2) rendered hepatocytes more sensitive to
DCLF-induced cytotoxicity.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
21
Discussion
Although DCLF is known to cause intestinal injury and to allow bacterial
translocation to liver both in animal models and in human patients (Deng et al., 2006;
Kim et al., 2005), the contribution of intestinal bacteria to DCLF-mediated
hepatotoxicity has not been well characterized. A previous study showed that
bacteria/LPS interacted with a nontoxic dose of DCLF to induce liver injury in rats
(Deng et al., 2006). Thus, a goal of this study was to examine the role of
intestine-derived endotoxin on DCLF-induced hepatotoxicity. In this model, liver
injury as reflected by serum ALT activity did not develop until 4hrs after treatment
with an hepatotoxic dose of DCLF and was maximal by 6hrs (unpublished results).
Accordingly, we chose to examine a time shortly after the beginning of liver injury (ie,
6 hr), since we expected gene expression changes to be pronounced at that time. At
this time, there was substantial similarity in hepatic gene expression profiles between
LPS treatment and treatment with an hepatotoxic DCLF dose (Fig. 3). We did not
examine earlier times in this study, but since gut sterilization protected from the liver
injury at 6 hr, we would anticipate fewer differences between sterilized and
nonsterilized DCLF-treated rats at earlier times before injury onset.
To explore further the role of gut-derived bacteria in DCLF hepatotoxicity, gene
expression profiles in livers from rats given a hepatotoxic dose of DCLF with or
without antibiotic pretreatment were examined. Interestingly, hierarchical clustering
could not distinguish antibiotic/DCLF-treated rats from those treated with Veh/DCLF.
This suggested that gut sterilization with antibiotics altered the expression of a small
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
22
number of genes in DCLF-treated rats. However, the antibiotics markedly reduced the
hepatocellular injury resulting from DCLF, reflected by either serum ALT activity
(Deng et al., 2006) or histopathology (Fig. 1). This suggested that intestinal bacteria
might cause injury by altering the expression of relatively few genes. Alternatively,
bacteria might contribute to liver injury after DCLF treatment by a mechanism
independent of changes in gene expression.
Clustering of gene expression profiles revealed high similarity between
LPS-treated rats and rats given an hepatotoxic dose of DCLF (100mg/kg), but little
similarity to those given a nontoxic DCLF dose. In light of the previous result that
LPS interacts with a nonhepatotoxic dose of DCLF (20mg/kg) to cause liver damage
(Deng et al., 2006), this finding suggested that endotoxin contributes to the liver
injury from a hepatotoxic dose of DCLF. However, the mechanism of this
contribution remains unknown.
The genes with expression altered by DCLF treatment (100mg/kg) are of
obvious potential mechanistic interest since liver injury occurred in these animals.
Those genes can be classified into two groups: genes differentially expressed after
DCLF treatment compared to antibiotic/DCLF treatment and those similarly
expressed after DCLF treatment and after antibiotic/DCLF treatment. The former
group consists of genes that might contribute to liver injury through involvement of
intestinal bacteria. The latter group represents genes for which either the expression
was not changed due to intestinal bacteria, or the gene expression was intestinal
bacteria-dependent but the reduction of bacteria by antibiotics was not sufficient to
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
23
exert effects on their expression. However, since the antibiotics almost abolished
(97% reduction) hepatic Gram-negative bacteria after DCLF treatment (Deng et al.,
2006), the latter possibility seems less likely. Thus, the genes similarly expressed after
DCLF treatment and after antibiotic/DCLF treatment more likely represent transcripts
for which the expression is not due to intestinal bacteria, i.e., possibly resulting from a
direct effect of DCLF or its metabolites.
In the group of genes for which expression was dependent on bacteria, those
highly correlated with ALT were further categorized by their gene function. Some are
known to be LPS-inducible, including fibrinogen (FGA) and STAT3 (Lunz, III et al.,
2007). Genes encoding enzymes involved in fatty acid metabolism were reduced in
expression after DCLF treatment. This change was not due to difference in food
consumption since all rats remained fasted after the treatment until sacrifice. LPS is
known to cause inhibition of fatty acid metabolism through nuclear transcription
factors such as RXR, FXR and PPARα (Ghose et al., 2004;Kim et al., 2007). Other
than LPS-inducible genes, there were also genes involved in cell cycle regulation and
protein transporting/trafficking.
In the pathways identified by Ingenuity for bacteria-dependent genes, most of the
genes are known to be LPS inducible, such as those in groups involved with
LPS/IL-1-induced inhibition of RXR function, fatty acid metabolism, FXR/RXR
activation and gene regulation via PPARα. These altered pathways could lead to
decreased fatty acid β-oxidation metabolism and increased fatty acid accumulation in
liver. In other models of liver injury, fatty acid accumulation has been shown to be
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
24
critical in the pathogenesis, possibly through increased oxidative stress (Purohit et al.,
2004;Carmiel-Haggai et al., 2005). However, whether or not the fatty acid
accumulation contributes to hepatocellular injury in DCLF-treated rats remains to be
explored.
In the group of transcripts similarly expressed after DCLF treatment and
antibiotic/DCLF treatment, those highly correlated with ALT were further categorized
by gene function. As mentioned above, these genes represent those for which the
expression was likely changed due to a direct DCLF effect rather than from
involvement of intestinal bacteria. Many of these genes encode proteins that regulate
inflammatory responses and leukocyte transmigration and activation. Thus, it seemed
possible that bacteria or LPS induced the accumulation of leukocytes in the liver, and
that DCLF acted synergistically with bacteria or LPS to activate the leukocytes to
contribute to the killing of hepatocytes. However, PMN depletion in DCLF-treated
rats failed to reduce the liver injury. This suggests that bacteria/LPS contribute to liver
injury in this model through a PMN-independent mechanism, perhaps through
LPS-activated macrophages or other inflammatory mediators.
Other upregulated genes of interest include those involved in oxidative stress
such as SOD2 and HMOX1. SOD2 is a mitochondrial antioxidant enzyme (Hu et al.,
2005), and HMOX1 is an acute phase response gene induced by oxidative stress
(Takahashi et al., 2007). The induction of these two genes suggested oxidative stress
in the liver. This was further supported by the high ranking of oxidative stress
pathways by the Ingenuity System after importation of all bacteria-independent genes.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
25
Interestingly, the results of Cantoni and colleages (Cantoni et al., 2003) suggest that
oxidative stress might contribute to DCLF-induced hepatotoxicity in mice. In that
study, hepatic damage was enhanced by the glutathione-lowering agent buthionine
sulfoximine but was not attenuated by the antioxidant N-acetylcysteine. This finding
suggested that oxidative stress induced by DCLF might act with other deleterious
signals to promote hepatotoxicity. These signals could be from bacteria or LPS
translocated from the intestinal tract into the liver.
Genes involved in cell death and cell cycle regulation are also in the list of genes
regulated independently of bacterial influence. These genes include TNFRSF1a, TP53
and STAT1. TNFRSF1a is responsible for TNF-induced apoptosis (Shen and Pervaiz,
2006). TP53 is a tumor suppressor gene which not only regulates several apoptotic
genes but also has a direct, pro-apoptotic role by interacting with B-cell
leukemia/lymphoma 2 (BCL2) family members in mitochondria (Hussain and Harris,
2006). STAT1 is involved in inflammatory cytokine- and reactive oxygen
species-mediated apoptosis (Gorina et al., 2005;West et al., 2004). Consistent with
this is the observation that DCLF can induce hepatotycte apoptosis in vitro
(Gomez-Lechon et al., 2003b). It is possible that these DCLF-induced, pro-apoptotic
stresses superimpose on the inflammatory stresses induced by bacteria/LPS to
manifest hepatocellular injury.
Several other interesting pathways were highlighted that could contribute to liver
injury. These include FXR/LXR activation, PPARα signaling and aryl hydrocarbon
receptor signaling. Interestingly, FXR activation and PPARα signaling are also
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
26
identified in the group of genes for which expression was dependent on bacteria.
These might be potential points of interaction between DCLF induced-bacteria/LPS
exposure and a direct toxic effect of DCLF on liver.
Numerous genes regulated by DCLF in a bacteria-independent manner are
hypoxia inducible. These include SOD2 (Scortegagna et al., 2003), BTG2 (Pacary et
al., 2006), STAT1 (West et al., 2004), ICAM-1 and TP53 (Staib et al., 2005;Zhang et
al., 2007). Furthermore, Ingenuity System analysis revealed a high probability of
involvement of hypoxia-inducible factor signaling. Hypoxia can directly kill
hepatocytes in vitro (Lluis et al., 2005;Nagatomi et al., 1997). In addition, hypoxia
potentiates the damaging effects of inflammatory mediators induced by LPS in vitro,
such as macrophage- and neutrophil-derived cytotoxic factors (ie. proteases, reactive
oxygen species[ROS]) (Luyendyk et al., 2005). In vivo, hypoxia enhances the liver
lesions caused by a large, hepatotoxic dose of LPS (Shibayama, 1987). It is possible
that hypoxia interacts with these inflammatory mediators induced by LPS to cause
hepatocelluar injury in vivo after treatment with DCLF.
DCLF can kill hepatocytes directly after 24 hours of exposure in vitro
(Masubuchi et al., 2002). However, the cytotoxicity was only observed at a large
concentration (500 μM) that might not be achieved in vivo. Furthermore, the time
frame of the cell death was considerably longer than required in vivo (i.e., 6 h). This
suggests that DCLF might need a second deleterious signal to manifest the killing of
hepatocytes in vivo. Additional studies in vitro were pursued to explore this in light of
the gene array findings. DCLF did not cause hepatocyte death after 8 h of exposure
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
27
even at the concentration (500 μM) reported to kill hepatocytes at 24 h (Masubuchi et
al., 2002). However, hypoxia rendered hepatocytes sensitive to DCLF-induced
cytotoxicity. For example, in a hypoxic environment, DCLF caused hepatocyte death
even at a smaller concentration (250 μM) and in a time frame similar to that required
for hepatotoxicity in vivo. Since hypoxia occurred in livers of DCLF-treated rats (Fig.
7), it might provide a second signal in vivo that acts synergistically with DCLF to kill
hepatocytes. The mechanism by which hypoxia potentiates DCLF killing of
hepatocytes is unknown, but both hypoxia and DCLF can induce mitochondrial injury
and generation of ROS (Lluis et al., 2005;Gomez-Lechon et al., 2003b;Masubuchi et
al., 2002). Either of these might be a potential interaction point between hypoxia and
DCLF.
A large fraction of diclofenac glucuronide in humans is excreted by the kidney,
whereas in rodents the biliary route is more important. Although it is not clear that this
difference in disposition influences hepatotoxicity, it is a factor that should be
considered in extrapolating our findings to humans.
In summary, both bacteria-dependent and bacteria-independent changes in gene
expression occurred after DCLF treatment in rats. Microarray analysis and additional
studies revealed that bacteria/LPS contribute to DCLF hepatotoxicity in a
PMN-independent manner. DCLF may interact with bacteria or LPS through inducing
oxidative stress, apoptotic signaling or changing fatty acid metabolism. Results in
vitro suggest that hypoxia might provide a secondary signal that interacts with DCLF
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
28
to kill hepatocytes, which is further supported by the observation that hypoxia
occurred in vivo after DCLF treatment.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
29
References
Adachi Y, Moore LE, Bradford BU, Gao W, Thurman RG (1995) Antibiotics prevent
liver injury in rats following long-term exposure to ethanol. Gastroenterology
108:218-224
Banks AT, Zimmerman HJ, Ishak KG, Harter JG (1995) Diclofenac-associated
hepatotoxicity: Analysis of 180 cases reported to the food and drug administration as
adverse reactions. Hepatology 22:820-827
Boelsterli UA (2003) Diclofenac-induced liver injury: a paradigm of idiosyncratic
drug toxicity. Toxicology and Applied Pharmacology 192:307-322
Bosotti R, Locatelli G, Healy S, Scacheri E, Sartori L, Mercurio C, Calogero R and
Isacchi A (2007) Cross platform microarray analysis for robust identification of
differentially expressed genes. BMC Bioinformatics 8 Suppl 1:S5
Cantoni L, Valaperta R, Ponsoda X, Castell JV, Barelli D, Rizzardini M, Mangolini A,
Hauri L, Villa P (2003) Induction of hepatic heme oxygenase-1 by diclofenac in
rodents: role of oxidative stress and cytochrome P-450 activity. Journal of Hepatology
38:776-783
Carmiel-Haggai M, Cederbaum AI, Nieto N (2005) A high-fat diet leads to the
progression of non-alcoholic fatty liver disease in obese rats. FASEB J 19: 136-138
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
30
Copple BL, Rondelli CM, Maddox JF, Hoglen NC, Ganey PE, Roth RA (2004)
Modes of cell death in rat liver after monocrotaline exposure. Toxicol Sci 77:172-182
Dallas PB, Gottardo NG, Firth MJ, Beesley AH, Hoffmann K, Terry PA, Freitas JR,
Boag JM, Cummings AJ and Kees UR (2005) Gene expression levels assessed by
oligonucleotide microarray analysis and quantitative real-time RT-PCR -- how well do
they correlate? BMC Genomics 6:59
Daly AK, Aithal GP, Leathart JBS, Swainsbury RA, Dang TS, Day CP (2007) Genetic
Susceptibility to Diclofenac-Induced Hepatotoxicity: Contribution of UGT2B7,
CYP2C8, and ABCC2 Genotypes. Gastroenterology 132:272-281
Deng X, Stachlewitz RF, Liguori MJ, Blomme EA, Waring JF, Luyendyk JP, Maddox
JF, Ganey PE, Roth RA (2006) Modest inflammation enhances diclofenac
hepatotoxicity in rats: role of neutrophils and bacterial translocation. J Pharmacol Exp
Ther 319:1191-1199
Deng X, Luyendyk JP, Zou W, Lu J, Malle E, Ganey PE, Roth RA (2007) Neutrophil
Interaction with the Hemostatic System Contributes to Liver Injury in Rats Cotreated
with Lipopolysaccharide and Ranitidine. J Pharmacol Exp Ther 322:852-861
Ghose R, Zimmerman TL, Thevananther S, Karpen SJ (2004) Endotoxin leads to
rapid subcellular re-localization of hepatic RXRalpha: A novel mechanism for
reduced hepatic gene expression in inflammation. Nucl Recept 2:4
Gomez-Lechon M, Ponsoda X, O'Connor E, Donato T, Jover R, Castell JV (2003a)
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
31
Diclofenac induces apoptosis in hepatocytes. Toxicology in Vitro 17:675-680
Gomez-Lechon MJ, Ponsoda X, Connor E, Donato T, Castell JV, Jover R (2003b)
Diclofenac induces apoptosis in hepatocytes by alteration of mitochondrial function
and generation of ROS. Biochemical Pharmacology 66:2155-2167
Gorina R, Petegnief V, Chamorro A, Planas AM (2005) AG490 prevents cell death
after exposure of rat astrocytes to hydrogen peroxide or proinflammatory cytokines:
involvement of the Jak2/STAT pathway. Journal of Neurochemistry 92:505-518
Hu Y, Rosen DG, Zhou Y, Feng L, Yang G, Liu J, Huang P (2005) Mitochondrial
manganese-superoxide dismutase expression in ovarian cancer: role in cell
proliferation and response to oxidative stress. J Biol Chem 280:39485-39492
Hussain SP, Harris CC (2006) p53 biological network: at the crossroads of the
cellular-stress response pathway and molecular carcinogenesis. J Nippon Med Sch
73:54-64
Kim JW, Jeon WK, Kim EJ (2005) Combined effects of bovine colostrum and
glutamine in diclofenac-induced bacterial translocation in rat. Clinical Nutrition
24:785-793
Kim MS, Sweeney TR, Shigenaga JK, Chui LG, Moser A, Grunfeld C, Feingold KR
(2007) Tumor necrosis factor and interleukin 1 decrease RXRalpha, PPARalpha,
PPARgamma, LXRalpha, and the coactivators SRC-1, PGC-1alpha, and PGC-1beta in
liver cells. Metabolism 56:267-279
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
32
Lluis JM, Morales A, Blasco C, Colell A, Mari M, Garcia-Ruiz C, Fernandez-Checa
JC (2005) Critical role of mitochondrial glutathione in the survival of hepatocytes
during hypoxia. J Biol Chem 280:3224-3232
Lunz JG, III, Specht SM, Murase N, Isse K, Demetris AJ (2007) Gut-derived
commensal bacterial products inhibit liver dendritic cell maturation by stimulating
hepatic interleukin-6/signal transducer and activator of transcription 3 activity.
Hepatology 46:1946-1959
Luyendyk JP, Shaw PJ, Green CD, Maddox JF, Ganey PE, Roth RA (2005)
Coagulation-mediated hypoxia and neutrophil-dependent hepatic injury in rats given
lipopolysaccharide and ranitidine. J Pharmacol Exp Ther 314:1023-1031
Luyendyk JP, Maddox JF, Cosma GN, Ganey PE, Cockerell GL, Roth RA (2003)
Ranitidine treatment during a modest inflammatory response precipitates
idiosyncrasy-like liver injury in rats. J Pharmacol Exp Ther 307:9-16
Masubuchi Y, Nakayama S, Horie T (2002) Role of mitochondrial permeability
transition in diclofenac-induced hepatocyte injury in rats. Hepatology 35:544-551
Nagatomi A, Sakaida I, Matsumura Y, Okita K (1997) Cytoprotection by glycine
against hypoxia-induced injury in cultured hepatocytes. Liver 17:57-62
Pacary E, Legros H, Valable S, Duchatelle P, Lecocq M, Petit E, Nicole O, Bernaudin
M (2006) Synergistic effects of CoCl2 and ROCK inhibition on mesenchymal stem
cell differentiation into neuron-like cells. J Cell Sci 119:2667-2678
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
33
Purohit V, Russo D, Coates PM (2004) Role of fatty liver, dietary fatty acid
supplements, and obesity in the progression of alcoholic liver disease: introduction
and summary of the symposium. Alcohol 34:3-8
Rajeevan MS, Vernon SD, Taysavang N and Unger ER (2001) Validation of
array-based gene expression profiles by real-time (kinetic) RT-PCR. J Mol Diagn
3:26-31
Raymond F, Metairon S, Borner R, Hofmann M and Kussmann M (2006) Automated
target preparation for microarray-based gene expression analysis. Anal Chem
78:6299-6305
Roth RA, Luyendyk JP, Maddox JF, Ganey PE (2003) Inflammation and drug
idiosyncrasy--Is there a connection? J Pharmacol Exp Ther 307:1-8
Scortegagna M, Ding K, Oktay Y, Gaur A, Thurmond F, Yan LJ, Marck BT,
Matsumoto AM, Shelton JM, Richardson JA, Bennett MJ, Garcia JA (2003) Multiple
organ pathology, metabolic abnormalities and impaired homeostasis of reactive
oxygen species in Epas1-/- mice. Nat Genet 35:331-340
Seitz S, Kretz-Rommel A, Oude Elferink RP, Boelsterli UA (1998) Selective protein
adduct formation of diclofenac glucuronide is critically dependent on the rat
canalicular conjugate export pump (Mrp2). Chem Res Toxicol 11:513-519
Shen HM, Pervaiz S (2006) TNF receptor superfamily-induced cell death:
redox-dependent execution. FASEB J 20:1589-1598
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
34
Shibayama Y (1987) Enhanced hepatotoxicity of endotoxin by hypoxia. Pathol Res
Pract 182:390-395
Staib F, Robles AI, Varticovski L, Wang XW, Zeeberg BR, Sirotin M, Zhurkin VB,
Hofseth LJ, Hussain SP, Weinstein JN, Galle PR, Harris CC (2005) The p53 Tumor
suppressor network is a key responder to microenvironmental components of chronic
inflammatory stress. Cancer Res 65:10255-10264
Takahashi T, Shimizu H, Morimatsu H, Inoue K, Akagi R, Morita K, Sassa S (2007)
Heme oxygenase-1: a fundamental guardian against oxidative tissue injuries in acute
inflammation. Mini Rev Med Chem 7:745-753
Waring JF, Liguori MJ, Luyendyk JP, Maddox JF, Ganey PE, Stachlewitz RF, North C,
Blomme EAG, Roth RA (2005) Microarray analysis of LPS potentiation of
trovafloxacin-induced liver injury in rats suggests a role for proinflammatory
chemokines and neutrophils. J Pharmacol Exp Ther 316: 1080-1087
West DA, Valentim LM, Lythgoe MF, Stephanou A, Proctor E, van Der Weerd L,
Ordidge RJ, Latchman DS, Gadian DG (2004) MR image-guided investigation of
regional signal transducers and activators of transcription-1 activation in a rat model
of focal cerebral ischemia. Neuroscience 127:333-339
Yee SB, Hanumegowda UM, Hotchkiss JA, Ganey PE, Roth RA (2003) Role of
neutrophils in the synergistic liver injury from monocrotaline and bacterial
lipopolysaccharide exposure. Toxicol Sci 72:43-56
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
35
Zhang L, Subarsky P, Hill RP (2007) Hypoxia-regulated p53 and its effect on
radiosensitivity in cancer cells. Internat J Rad Biol 83:443-456
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
36
Footnotes
This work was supported by NIH grants ES04139 and GM 075865.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
37
Legends For Figures
Fig. 1. Liver histopathology after DCLF treatment. Rats pretreated with antibiotics
or vehicle (saline) were treated with DCLF (100mg/kg), and liver histopathology was
examined 6 h later. Subcapsular hemorrhagic coagulative necrosis (arrows) was noted
in Veh/DCLF-treated livers, and this was absent in livers from
antibiotic/DCLF-treated rats.
Fig. 2. Hierarchical clustering of hepatic gene expression profiles. Hepatic gene
expression profiles were examined 6 h after DCLF treatment in rats pretreated with
antibiotics or vehicle. Hierarchical clustering was performed using Euclidian distance
with expression data from Veh/Veh-treated rats as baseline.
Fig. 3. K-means clustering of hepatic gene expression profiles. K-Means clustering
was performed on gene expression profiles 6 h after treatment with LPS (2.9x107
EU/kg, i.v.), or nontoxic (20 mg/kg) or toxic doses (100 mg/kg) of DCLF (mpk =
mg/kg). Cosine correlation was used as the metric type.
Fig. 4. Hepatic PMN staining after DCLF treatment. PMN accumulation was
evaluated using immunohistochemistry 6 h after DCLF treatment in rats pretreated
with antibiotics or vehicle. In livers of DCLF-treated rats, accumulation of large
numbers of PMNs (red staining) was evident in the subcapusular region. The PMN
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
38
accumulation was markedly reduced by the antibiotic treatment.
Fig. 5. Hepatic PMN staining after treatment with PMN antiserum. PMN
antiserum (NAS) or control serum (CS) was administered 16 h before DCLF
treatment. PMN accumulation was evaluated using immunohistochemistry 6 h after
DCLF treatment. This antiserum abolished the subcapuslar PMN accumulation in
livers of DCLF-treated rats.
Fig. 6. Serum ALT activity after treatment with PMN antiserum. Rats were
treated as described in Fig. 5 and serum ALT activity was evaluated 6 h after DCLF
treatment. n=5-6. Values are not significantly different.
Fig. 7. PIM adduct staining after DCLF treatment. Rats were treated with DCLF
(100 mg/kg), and PIM adduct staining was evaluated 6 h later. n=5-6; *significantly
different from Veh treatment group.
Fig. 8. Effect of hypoxia on DCLF-induced hepatocyte death in vitro. Primary rat
hepatocytes were isolated and incubated at 20% or 5% O2 atmosphere. At the same
time, they were treated with DCLF at the indicated concentrations. n= three separate
hepatocyte isolations; *significantly different from the respective group without
DCLF treatment. #significantly different from the respective group at 20% O2
atmosphere.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
39
Table 1. DCLF-induced Gene Expression Changes Correlated with Serum ALT
Activity and Altered by Antibiotic Treatment
Primary Sequence Name
Veh/DCLF Fold Change
Antibiotic/DCLF Fold Change
Gene function
Fabp5 7.61 2.34 LPS inducible Adh4 -5.74 -2.26 Fatty acid metabolism Nek6 4.52 2.71 Cell cycle and proliferation Srm 4.26 2.25
Alas1 -3.71 -2.69 LPS inducible Stat3 3.58 2.67 LPS inducible Fga 3.30 2.48 LPS inducible
Sh3bp5 -3.23 -1.90 Amigo3 2.84 0.80 Ccng1 2.70 0.79 Cell cycle and proliferation
Ssr3 2.49 1.44 Protein transport and
trafficking Stch 2.42 1.58
Rraga 2.41 1.62
Stch 2.41 1.65 Protein transport and
trafficking
Scfd1 2.34 1.58 Protein transport and
trafficking Cyp4f4 -2.18 -1.24 Fatty acid metabolism
Vdp 2.07 1.50 Protein transport and
trafficking
Ssr3 2.03 1.37 Protein transport and
trafficking Sec61a1 2.00 1.57 Selenbp1 -1.96 -1.25
Aldh3a2 -1.94 -0.72 LPS inducible, fatty acid
metabolism Sord -1.94 -0.73 Litaf 1.90 0.82
Ndrg2 -1.89 -1.29 Prkaa2 -1.89 -1.23 Galm -1.83 -0.62 Preb 1.77 0.62
Sec61a1 1.76 0.81 Sord -1.71 -0.74
Acsl1 -1.62 -1.17 LPS inducible, fatty acid
metabolism
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
40
Genes for which expression changed after Veh/DCLF treatment and that were
expressed differently after antibiotic/DCLF treatment and Veh/DCLF treatment were
further filtered by the degree of correlation of their expression value with ALT. Genes
with high correlation along with their respective expression ratio after Veh/DCLF and
antibiotic/DCLF treatment are listed in the table. The function of genes (as described
in Entrez Gene site http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene) with
potential importance in liver injury is also noted.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
41
Table 2. Pathways Associated with DCLF-induced Gene Expression Changes
Altered by Antibiotic Treatment
Pathway -log(p) Ratio (%) Genes
LPS/IL-1 Mediated Inhibition of RXR
Function 3.80 4.8
SULT2B1, ALDH3A2, SULT1C3, ALAS1, SLCO1B3, ACSL1,
SLC10A1, FABP5, RXRA
Fatty Acid Metabolism 3.37 5.4 ADH4, ALDH3A2,
CYP4F8, EHHADH, ACAA1, HADH, ACSL1
FXR/RXR Activation 2.82 6.3 IL1A, G6PC, SLCO1B3,
SLC10A1, RXRA Positive Acute Phase
Response Proteins 2.27 8.8 ORM2, SERPINA3, FGA
Mechanism of Gene Regulation by Peroxisome Proliferators via PPARα
1.75 4.2 IL1A, EHHADH, APOA2,
RXRA
LXR/RXR Activation 1.45 4.4 IL1A, HADH, RXRA TR/RXR Activation 1.41 6.7 FGA, RXRA
PXR/RXR Activation 1.35 6.3 ALAS1, RXRA
The genes differentially expressed between antibiotic/DCLF and Veh/DCLF
groups were imported into Ingenuity Pathway Analysis 5.5. Functional annotations
were based on the Ingenuity System knowledge base. “Ratio” refers to the percentage
of the total number of genes in a particular pathway found in the imported list of
genes. The pathways reported by Ingenuity Pathway Analysis were ranked by p value
which illustrates the deviation of the observed number of genes for each pathway
found in the imported list from the number expected to occur by chance.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
42
Table 3. DCLF-induced Gene Expressions Changes Correlated with Serum ALT
Activity but Not Altered by Antibiotic Treatment
Primary Sequence Name
Veh/DCLF Fold Change
Antibiotic/DCLF Fold Change
Gene function
Usp2 -16.18 -14.08 S100a9 14.60 12.20
Icam1 10.77 10.47 Inflammation, hypoxia
inducible Slc9a3r1 10.04 6.77 Hsd17b2 -7.60 -1.80 Serpinb5 -5.77 -3.18
Ak3l1 -4.90 -3.07 Ptger3 -4.73 -2.88 Inflammation Ptpns1 4.69 2.97
Il1b 4.55 3.62 Inflammation
Sod2 4.46 3.25 Oxidative stress, hypoxia
inducible Nr1i3 -4.31 -2.25 Acacb -4.19 -2.09 Nol5 3.90 1.94 Tns -3.88 -3.98
Frag1 -3.85 -2.70 Hmox1 3.84 2.46 Oxidative stress Pdk2 -3.82 -1.65 Gas6 3.63 2.85 Cell cycle and cell death Tns -3.26 -2.54
Pbef1 3.25 2.28 Cell cycle and cell death Lbp 3.20 2.81 Inflammation
Slco2a1 -3.19 -1.54
Btg2 3.13 1.40 Cell cycle and cell death,
hypoxia inducible Sult1c2 -3.12 -1.70 Mir16 -3.04 -1.40 Il13ra1 3.01 3.02 Inflammation Pdp2 -3.00 -2.38 Nr1i2 -2.97 -1.98 Galm -2.95 -2.03 Pspla1 2.94 2.08 Inflammation Plrg1 2.92 1.73
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
43
Cth -2.89 -2.07
Tnfrsf1a 2.89 2.61 Inflammation, cell cycle
and cell death Lkap -2.81 -1.91
Enpp2 -2.81 -2.25 Ptpn2 2.81 2.05 Inflammation
Mybbp1a 2.75 1.71 Inflammation Slc9a3r1 2.73 1.94
Abat -2.72 -2.18 Sgk 2.68 0.79 Cell cycle and cell death Tars 2.67 2.19
Nolc1 2.66 1.61 Smoc1 -2.66 -1.82 Pfkfb1 -2.64 -1.74 Klf15 -2.62 -1.57 Fmo1 -2.54 -1.94
Slc16a7 -2.50 -1.55 Foxa3 2.49 1.51 Ssr3 2.47 1.70
Ddx39 2.41 1.37 Slco2a1 -2.38 -0.84 Prkar2a 2.36 1.88 Timp1 2.35 1.41 Mcl1 2.35 1.65 Pbef1 2.29 1.75 Cell cycle and cell death Lgals3 2.26 1.60 Inflammation Faah -2.25 -1.59
Slc37a4 -2.23 -1.41 Akr7a2 -2.12 -1.64
Stat1 2.11 2.00 Inflammation, cell cycle and cell death, hypoxia
inducible Arfip2 2.07 1.51 Inflammation Gclm -2.04 -1.34
Ptpns1 2.03 1.67
Tp53 2.01 1.66 Cell cycle and cell death,
hypoxia inducible Sfpq 2.00 1.42
Slc16a1 1.99 0.98 Galnt11 -1.96 -0.78 Mtac2d1 -1.94 -1.40 Il13ra1 1.91 1.77 Inflammation Mic2l1 -1.91 -1.43
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
44
Acsl1 -1.91 -1.36 Gpr48 -1.87 -1.41 Eif4a1 1.86 1.43 Gpr48 -1.82 -1.26 Rdx -1.81 -1.41 Khk -1.75 -1.37
Stat1 1.67 1.82 Inflammation, cell cycle and cell death, hypoxia
inducible Hnrpa3 1.54 1.35
Fga 1.53 1.43 Nedd4a -1.52 -1.38
Genes for which expression changed after Veh/DCLF treatment and that were
expressed similarly after antibiotic/DCLF treatment and after Veh/DCLF treatment
were further filtered by the degree of correlation of their expression value with plasma
ALT activity. The genes with high correlation along with their respective expression
ratio are listed in the table. The function of genes (as described in Entrez Gene site
http://www.ncbi.nlm.nih.gov/entrez/ query.fcgi?db=gene) with potential importance in
liver injury is also noted.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
45
Table 4. Pathways Associated with DCLF-induced Gene Expressions but Not
Altered by Antibiotic Treatment
Pathway list -log(p) Ratio(%) Genes
Positive Acute Phase Response Proteins
9.48 32.4 C9, FGB, CP, A2M, SOD2, FGG, CRP, FGA, HMOX1,
LBP, HPX
Oxidative Stress 9.00 22.8
S100A9, ICAM1, TP53, GSTM3, DUSP1, FOS,
SOD2, MAPK14, PRDX4, GCLM, XDH, NQO1, GSS
LPS/IL-1 Mediated Inhibition of RXR
Function 4.73 8.5
MAOB, TNFRSF1A, NR1I3, NR1I2, SULT1C2, NR0B2,
HMGCS2, IL1R1, LIPC, FMO1, GSTM3, ALDH9A1, ACSL1, LBP, MAOA, IL1B
FXR/RXR Activation 4.55 12.5
IL1A, MLXIPL, BAAT, NR1I2, FOXO1, NR0B2, CYP8B1, PON1, LIPC,
IL1B
Oxidative Stress Response Mediated by Nrf2
3.21 6.8
JUNB, FMO1, HMOX1, GSTM3, MAF, NQO2, TXNRD1, FOS, SOD2,
MAPK14, AKR7A2, GCLM, NQO1, PPIB
Aryl Hydrocarbon Receptor Signaling
2.81 7.2 ALDH9A1-, IL1A, NQO2, NFIC, FOS, NR0B2, TP53,
NQO1, NFIB, GSTM3, IL1B
Hypoxia-Inducible Factor Signaling
2.76 10.0 LDHA, CSNK1D, EIF2S2,
EIF2S1, TP53, NQO1, UBE2G1
Mechanism of Gene Regulation by Peroxisome
Proliferators via PPARα 2.60 8.4
IL1A, DUSP1, TNFRSF1A, FOS, PRKAR2A, NR0B2,
IL1R1, IL1B
Hepatic Fibrosis 2.28 8.2 IL1A, TIMP1, COL1A2, ICAM1, A2M, IGFBP3,
IL1B
Hepatic Cholestasis 2.18 6.7 IL1A, NR1I2, TNFRSF1A, PRKAR2A, NR0B2, IL1R1,
CYP8B1, LBP, IL1B
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
JPET #140335
46
LXR/RXR Activation 2.13 8.7 IL1A, TNFRSF1A, IL1R1,
APOA4, LBP, IL1B CAR/RXR Activation 1.46 10.3 NR1I3, MCL1, CES1
The genes similarly expressed between antibiotic/DCLF and Veh/DCLF groups were
imported into Ingenuity Pathway Analysis 5.5. Functional annotations were based on
the Ingenuity System knowledge base. “Ratio” refers to the percentage of the total
number of genes in a particular pathway found in the imported list of genes. The
pathways reported by Ingenuity Pathway Analysis were ranked by p value, which
illustrates the deviation of the observed number of genes in one pathway of the
Ingenuity System database found in the imported list from the number expected to
occur by chance.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335
at ASPE
T Journals on July 8, 2020
jpet.aspetjournals.orgD
ownloaded from