ISSN0036-4665 ISSN 1678-9946 on line · III Rev. Inst. Med. Trop. Sao Paulo Vol. 55 No. 6 P. 371-440 November-December, 2013 ISSN0036-4665 ISSN 1678-9946 on line ADDRESS INSTITUTO

I

ISSN 0036-4665ISSN 1678-9946 on line

Established: 1959.

The year 2013 is the 54th anniversary

of continuous publication

UNIVERSIDADE DE SÃO PAULO - BRAZILFACULDADE DE MEDICINA

Instituto de Medicina Tropical de São PauloDirector: Prof. Dr. Paulo C. Cotrim

EDITOR-IN-CHIEF EMERITUS EDITORS Prof. Dr. Thales F. de Brito Prof. Dr. Luis Rey (Founding Editor)Associate Editors: Prof. Dr. Pedro Paulo Chieffi Prof. Dr. Carlos da Silva Lacaz Prof. Dr. Thelma S. Okay

EDITORIAL BOARDAlan L. de Melo (Belo Horizonte, MG) Alberto Duarte (S. Paulo, SP) Angela Restrepo M. (Medellin, Colombia) Anna Sara S. Levin (S. Paulo, SP)Antonio A. Barone (S. Paulo, SP)Antonio Carlos Nicodemo (S. Paulo, SP) Antonio Sesso (S. Paulo, SP) Antonio W. Ferreira (S. Paulo, SP) Barnett L. Cline (New Orleans, USA) Carlos F. S. Amaral (Belo Horizonte, MG) Celso Granato (S. Paulo, SP) Cesar A. Cuba Cuba (Brasília, DF) César Naquira V. (Lima, Peru) Clarisse M. Machado (S. Paulo, SP) Claudio S. Pannuti (S. Paulo, SP) Cláudio Santos Ferreira (S. Paulo, SP) Dalton L. F. Alves (Belo Horizonte, MG) Eridan Coutinho (Recife, PE) Ernesto Hofer (Rio de Janeiro, RJ) Euclides A. Castilho (S. Paulo, SP)Eufrosina S. Umezawa (S. Paulo, SP) Fan Hui Wen (S. Paulo, SP) Fernando A. Corrêa (S. Paulo, SP)

Fernando Montero-Gei (San José, Costa Rica) Flair J. Carrilho (S. Paulo, SP)Gil Benard (S. Paulo, SP)Gioconda San-Blas (Caracas, Venezuela)Govinda Visvesvara (Atlanta, USA) Heitor F. Andrade Jr. (S. Paulo, SP) Henrique L. Lenzi (Rio de Janeiro, RJ) Hiro Goto (S. Paulo, SP)Ises A. Abrahamsohn (S. Paulo, SP) João Carlos Pinto Dias (Belo Horizonte, MG) João Renato Rebello Pinho (Sao Paulo, SP) José Eduardo Levi (S. Paulo, SP)José M. R. Zeitune (Campinas, SP) Julia Maria Costa-Cruz (Uberlândia, MG)Julio Litvoc (S. Paulo, SP) Luiz Carlos Severo (P. Alegre, RS) Luiz Jacintho da Silva (Campinas, SP) Luiz T. M. Figueiredo (Rib. Preto, SP) Lygia B. Iversson (S. Paulo, SP) Marcello Fabiano de Franco (S. Paulo, SP)Marcos A. Rossi (Ribeirão Preto, SP)Marcos Boulos (S. Paulo, SP)M. A. Shikanai-Yasuda (S. Paulo, SP)

Maria I. S. Duarte (S. Paulo, SP)Maria L. Higuchi (S. Paulo, SP)Mario Mariano (S. Paulo, SP)Mirian N. Sotto (S. Paulo, SP)Moisés Goldbaum (S. Paulo, SP)Moysés Mincis (S. Paulo, SP)Moysés Sadigursky (Salvador, BA)Myrthes T. Barros (S. Paulo, SP)Nilma Cintra Leal (Recife, PE)Paulo C. Cotrim (São Paulo, SP)Paulo M. Z. Coelho (Belo Horizonte, MG)Regina Abdulkader (S. Paulo, SP)Ricardo Negroni (B. Aires, Argentina)Robert H. Gilman (Baltimore, USA)Roberto Martinez (Rib. Preto, SP)Semíramis Guimarães F. Viana (Botucatu, SP)Silvino A. Carvalho (S. Paulo, SP)Silvio Alencar Marques (Botucatu, SP)Sumie Hoshino-Shimizu (S. Paulo, SP)Tsutomu Takeuchi (Tokyo, Japan)Venâncio A. F. Alves (S. Paulo, SP)Vicente Amato Neto (S. Paulo, SP)Zilton A. Andrade (Salvador, BA)

Executive Board - Librarians: Maria do Carmo Berthe Rosa; Sonia Pedrozo Gomes; Maria Ângela de Castro Fígaro Pinca; Carlos José Quinteiro

The Revista do Instituto de Medicina Tropical de São Paulo is abstracted and/or indexed in: Index Medicus, Biological Abstracts, EMBASE/Excerpta Medica, Hepatology/Rapid Literature Review, Tropical Diseases Bulletin, Referativnyi Zhurnal: All-Russian Institute of Scientific and Technical Information (VINITI), Periódica - Índice de Revistas Latinoamericanas en Ciencias, Helminthological Abstracts, Protozoological Abstracts, Review of Medical and Veterinary Mycology, PubMed, UnCover, HealthGate, OVID, LILACS, MEDLINE, New Jour, ExtraMED, Free Medical Journals, ISI (Institute for Scientific Information), BIOSIS Previews, Scopus, Science Citation Index Expanded (SciSearch), Journal Citation Reports/Science Edition, Current Contents®/Clinical Medicine and Index Copernicus.

ON LINE ACCESS - http://www.imt.usp.br/portal/ - FREE PDF ACCESS TO ALL PAST ISSUES, 1959-1989 (Financial support by “Alves de Queiroz Family Fund for Research).

http://www.scielo.br/rimtsp - FULL TEXT, SINCE 1984. E-mail: [email protected]

Reprints may be obtained from Pro Quest Inf. and Learning, 300 North Zeeb Road, Ann Arbor, Michigan 48106-1346 - USA.

The Revista do Instituto de Medicina Tropical de São Paulo is supported by: Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Universidade de São Paulo and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES).

This issue was financed by: CNPq Proc. 403851/2012-2.

Desktop Publishing by: Hermano - e-mail: [email protected]. Phone: 55.11.5571-8937. - Printed by: Elyon Indústria Gráfica, Phone: 55.11.3783-6527. English Revision: [email protected]

II

The purpose of the “Revista do Instituto de Medicina Tropical de São Paulo” (Journal of the São Paulo Institute of Tropical Medicine) is to publish the results of researches which contri-bute significantly to knowledge of all transmissible diseases.

REVISTA DO INSTITUTO DE MEDICINA TROPICAL DE SÃO PAULO(JOURNAL OF THE S. PAULO INSTITUTE OF TROPICAL MEDICINE).

São Paulo, SP-Brasil, 1959 -v. ilust. 28 cm

1959-2013, 1-551973-2002 (supl. 1-12)2003 (supl. 13 - on-line only)2005-2012 (supl. 14-18)

ISSN 0036-4665ISSN 1678-9946 on line

III

Rev. Inst. Med. Trop. Sao Paulo Vol. 55 No. 6 P. 371-440 November-December, 2013

ISSN 0036-4665ISSN 1678-9946 on line

ADDRESSINSTITUTO DE MEDICINA TROPICAL DE SÃO PAULO

Av. Dr. Enéas de Carvalho Aguiar, 47005403-000 São Paulo, SP - Brazil

Phone/Fax: 55.11.3062.2174; 55.11.3061-7005e-mail: [email protected]

SUBSCRIPTIONSFOREIGN COUNTRIESOne year (six issues) ........ U$ 200.00Single issue ...................... U$ 50.00

CONTENTS

MYCOLOGYFirst report on Cryptococcus neoformans in pigeon excreta from public and residential locations in the metropolitan area of Cuiabá, State of Mato Grosso, Brazil - D.T. TAKAHARA, M.S. LAZÉRA, B. WANKE, L. TRILLES, V. DUTRA, D.A.J. PAULA, L. NAKAZATO, M.C. ANZAI, D.P. LEITE JÚNIOR, C.R. PAULA & R.C. HAHN ...............................................................................................................................371

Distribution of dermatophytes from soils of urban and rural areas of cities of Paraiba State, Brazil - Z.B.V.S. PONTES, A.C. OLIVEIRA, F.Q.S. GUERRA, L.R.A. PONTES & J.P. SANTOS .....................................................................................................................................................377

Molecular typing of Candida albicans isolates from hospitalized patients - P.S. BONFIM-MENDONÇA, A. FIORINI, C.S. SHINOBU-MESQUITA, L.C. BAEZA, M.A. FERNANDEZ & T.I.E. SVIDZINSKI ..........................................................................................385

LEISHMANIASISApplicability of kDNA-PCR for routine diagnosis of American tegumentary leishmaniasis in a tertiary reference hospital - M.M. SATOW, E.H. YAMASHIRO-KANASHIRO, M.C. ROCHA, L.K. OYAFUSO, R.C. SOLER, P.C. COTRIM & J.A.L. LINDOSO ................393

PCRComparison of six commercially-available DNA polymerases for direct PCR - M. MIURA, C. TANIGAWA, Y. FUJII & S. KANEKO ...................401

PHLEBOTOMINESPhlebotomine sandflies in rural locations in the state of Parana, Southern Brazil - S.C.C.S. MELO, W. CELLA, R. MASSAFERA, N.M.M.G. SILVA, R. MARQUI, M.D.B. CARVALHO & U. TEODORO ....................................................................................................................407

PARASITOLOGYPotentially pathogenic free-living amoebae in some flood-affected areas during 2011 Chiang Mai flood - A. WANNASAN, P. UPARANUKRAW, A. SONGSANGCHUN & N. MORAKOTE ..............................................................................................................................411

MICROBIOLOGYSmqnr variants in clinical isolates of Stenotrophomonas maltophilia in Brazil - J.I. GRACIA-PAEZ, J.R. FERRAZ, I.A. FRANÇA E SILVA, F. ROSSI, A.S. LEVIN & S.F. COSTA ..................................................................................................................................417

BRIEF COMMUNICATIONOvicidal effect of Piperaceae species on Biomphalaria glabrata, Schistosoma mansoni host - L.N. RAPADO,

P.O.M. LOPES,

L.F. YAMAGUCHI & E. NAKANO ...............................................................................................................................................................................421

CASE REPORTCase study of a patient with HIV-AIDS and visceral leishmaniasis co-infection in multiple episodes - E.D. SILVA, L.D. ANDRADE, P.S.R. ARAÚJO, V.M. SILVEIRA, C.E. PADILHA, M.A.L. SILVA & Z.M. MEDEIROS ...........................................................................................425

Usefulness of kDNA PCR in the diagnosis of visceral leishmaniasis reactivation in co-infected patients - A.C. NICODEMO, V.S. AMATO, F.F. TUON, R.M. SOUZA, T.S. OKAY & L.M.A. BRAZ .............................................................................................................................................429

LETTERS TO THE EDITORDifferential diagnosis of respiratory viruses by using real time RT-PCR methodology - R.S. PAULINO, M.A. BENEGA, K.C.O. SANTOS, D.B.G. SILVA, J.C. PEREIRA, N.A. SASAKI, P.E. SILVA, S.P. CURTI, M.I. OLIVEIRA, T.R.M.P. CARVALHANAS, T. PERET, D. ERDMAN & T.M. PAIVA..........................................................................................................................................................................................432

High prevalence of hepatitis A antibodies among recyclable waste pickers, Central Brazil - H.O. SOARES, C.L.R. LOPES, N.R. FREITAS, Á.M. COSTA E SILVA, L.R. MOURA & R.M.B. MARTINS .......................................................................................................................................433

Analogies in medicine: violin strings adhesions - J.S. ANDRADE-FILHO ..................................................................................................................435

AUTHOR INDEX ......................................................................................................................................................................................................437

SUBJECT INDEX .....................................................................................................................................................................................................439

Impact Factor: 0.959

IV

ENDEREÇOINSTITUTO DE MEDICINA TROPICAL DE SÃO PAULO

Av. Dr. Enéas de Carvalho Aguiar, 47005403-000 São Paulo, SP - Brasil

Fone/Fax: 55.11.3062.2174; 55.11.3061-7005e-mail: [email protected]

Rev. Inst. Med. Trop. Sao Paulo Vol. 55 No. 6 P. 371-440 Novembro-Dezembro, 2013

CONTEÚDO

ISSN 0036-4665ISSN 1678-9946 on line

MICOLOGIAPrimeiro registro de Cryptococcus neoformans em excretas de pombos provenientes de locais públicos e residenciais de área metropolitana de Cuiabá, Estado do Mato Grosso, Brasil - D.T. TAKAHARA, M.S. LAZÉRA, B. WANKE, L. TRILLES, V. DUTRA, D.A.J. PAULA, L. NAKAZATO, M.C. ANZAI, D.P. LEITE JÚNIOR, C.R. PAULA & R.C. HAHN ...................................................................................................371

Distribuição de dermatófitos isolados de solos de cidades do Estado da Paraíba, Brasil - Z.B.V.S. PONTES, A.C. OLIVEIRA, F.Q.S. GUERRA, L.R.A. PONTES & J.P. SANTOS .....................................................................................................................................................377

Tipagem molecular de Candida albicans isoladas de pacientes hospitalizados - P.S. BONFIM-MENDONÇA, A. FIORINI, C.S. SHINOBU-MESQUITA, L.C. BAEZA, M.A. FERNANDEZ & T.I.E. SVIDZINSKI ..........................................................................................385

LEISHMANIOSEAplicação do kDNA-PCR para diagnóstico de rotina de leishmaniose tegumentar americana em um hospital de referência - M.M. SATOW, E.H. YAMASHIRO-KANASHIRO, M.C. ROCHA, L.K. OYAFUSO, R.C. SOLER, P.C. COTRIM & J.A.L. LINDOSO ..........................................393

PCRComparação de seis polimerases de DNA disponíveis comercialmente para o PCR direto - M. MIURA, C. TANIGAWA, Y. FUJII & S. KANEKO ....................................................................................................................................................................................................................401

FLEBOTOMÍNEOSFlebotomíneos em localidades rurais do Estado do Paraná, Sul do Brasil - S.C.C.S. MELO, W. CELLA, R. MASSAFERA, N.M.M.G. SILVA, R. MARQUI, M.D.B. CARVALHO & U. TEODORO ...................................................................................................................................................407

PARASITOLOGIAAmebas potencialmente patogênicas de vida livre em algumas áreas afetadas durante a inundação de 2011 em Chiang Mai - A. WANNASAN, P. UPARANUKRAW, A. SONGSANGCHUN & N. MORAKOTE ..............................................................................................................................411

MICROBIOLOGIAVariantes de Smqnr de isolados clínicos de Stenotrophomonas maltophilia no Brasil - J.I. GRACIA-PAEZ, J.R. FERRAZ, I.A. FRANÇA E SILVA, F. ROSSI, A.S. LEVIN & S.F. COSTA ..................................................................................................................................417

COMUNICAÇÃO BREVEEfeito ovicida de espécies de Piperaceae em Biomphalaria glabrata, hospedeiro do Schistosoma mansoni - L.N. RAPADO,

P.O.M. LOPES,


RELATO DE CASOEstudo de caso de paciente com múltiplos episódios da coinfecção HIV-AIDS e leishmaniose visceral - E.D. SILVA, L.D. ANDRADE, P.S.R. ARAÚJO, V.M. SILVEIRA, C.E. PADILHA, M.A.L. SILVA & Z.M. MEDEIROS ...........................................................................................425

Utilidade da kDNA PCR no diagnóstico de reativação de leishmaniose visceral em pacientes co-infetados sintomáticos - A.C. NICODEMO, V.S. AMATO, F.F. TUON, R.M. SOUZA, T.S. OKAY & L.M.A. BRAZ ......................................................................................................................429

CARTAS AO EDITORDifferential diagnosis of respiratory viruses by using real time RT-PCR methodology - R.S. PAULINO, M.A. BENEGA, K.C.O. SANTOS, D.B.G. SILVA, J.C. PEREIRA, N.A. SASAKI, P.E. SILVA, S.P. CURTI, M.I. OLIVEIRA, T.R.M.P. CARVALHANAS, T. PERET, D. ERDMAN & T.M. PAIVA..........................................................................................................................................................................................432



ÍNDICE DE AUTORES ...........................................................................................................................................................................................437

ÍNDICE DE ASSUNTOS .........................................................................................................................................................................................439

Impact Factor: 0.959

Rev. Inst. Med. Trop. Sao Paulo55(6):371-376, November-December, 2013doi: 10.1590/S0036-46652013000600001

(1) Laboratório de Micologia, Faculdade de Medicina, Universidade Federal do Mato Grosso, Cuiabá, MT, Brazil.(2) Laboratório de Micologia, Instituto de Pesquisas Clínicas Evandro Chagas, Fundação Oswaldo Cruz, Rio de Janeiro, RJ, Brazil.(3) Laboratório de Biologia Molecular Veterinária, Faculdade de Agronomia e Medicina Veterinária, Universidade Federal do Mato Grosso, Cuiabá, MT, Brazil.(4) Laboratório de Leveduras Patogênicas, Instituto de Ciências Biológicas, Universidade de São Paulo, São Paulo, SP, Brazil.Correspondence to: Profª Rosane Hahn. Laboratório de Micologia/Investigação/FM/UFMT. Av. Fernando Corrêa da Costa 2369, Bairro Boa Esperança, 78060-900 Cuiabá, MT, Brasil.

Phone: 55 65 3615-8809. E-mail: [email protected]

FIRST REPORT ON Cryptococcus neoformans IN PIGEON EXCRETA FROM PUBLIC AND RESIDENTIAL LOCATIONS IN THE METROPOLITAN AREA OF CUIABÁ,

STATE OF MATO GROSSO, BRAZIL

Doracilde Terumi TAKAHARA(1), Márcia dos Santos LAZÉRA(2), Bodo WANKE(2), Luciana TRILLES(2), Valéria DUTRA(3), Daphine Ariadne Jesus de PAULA(3), Luciano NAKAZATO(3), Mariana Caselli ANZAI(1), Diniz Pereira LEITE JÚNIOR(1), Claudete Rodrigues PAULA(4) & Rosane Christine HAHN(1)

SUMMARY

Cryptococcosis is a severe systemic mycosis caused by two species of Cryptococcus that affect humans and animals: C. neoformans and C. gattii. Cosmopolitan and emergent, the mycosis results from the interaction between a susceptible host and the environment. The occurrence of C. neoformans was evaluated in 122 samples of dried pigeon excreta collected in 49 locations in the City of Cuiabá, State of Mato Grosso, Brazil, including public squares (n = 5), churches (n = 4), educational institutions (n = 3), health units (n = 8), open areas covered with asbestos (n = 4), residences (n = 23), factory (n = 1) and a prison (n = 1). Samples collected from July to December of 2010 were seeded on Niger seed agar (NSA). Dark brown colonies were identified by urease test, carbon source assimilation tests and canavanine-glycine-bromothymol blue medium. Polymerase chain reaction primer pairs specific for C. neoformans were also used for identification. Cryptococcus neoformans associated to pigeon excreta was isolated from eight (6.6%) samples corresponding to six (12.2%) locations. Cryptococcus neoformans was isolated from urban areas, predominantly in residences, constituting a risk of acquiring the disease by immunocompromised and immunocompetent individuals.

KEYWORDS: Cryptococcus neoformans; Pigeon excreta; Urban environment; State of Mato Grosso.

INTRODUCTION

Although cryptococcosis has been studied since 1894, over the past 40 years many important advances have been achieved regarding taxonomy, epidemiology, capsular structure, virulence factors, serotypes and specific genotypes25. In Brazil, reports have been registered in most states11,16,23,29,34,39, but in the State of Mato Grosso little research has been conducted in relation to clinical and environmental isolates of the agents of cryptococcosis. The first description of these microorganisms in HIV-positive patients in Mato Grosso was reported by FAVALESSA et al., who detected 26 Cryptococcus neoformans and 10 Cryptococcus gattii isolates in distinct clinical materials from seropositive and seronegative patients10.

The genus Cryptococcus comprises more than 38 species, two of which are considered potentially pathogenic: Cryptococcus neoformans and C. gattii17,18,20. Although both are found worldwide, their main ecological niches present some differences: Cryptococcus neoformans is most commonly isolated from pigeon droppings, while C. gattii is more frequently isolated from decaying wood and soil14,24,25.

The presence of Cryptococus neoformans in soil and old dried pigeon excreta has been widely studied in several countries7,8. Poultry

manure is considered a natural substrate for C. neoformans. Pigeons can even carry it on their beaks, feathers and legs, as well as presenting colonization by this agent on the crop. They act as dispersers in the environment, generating a source of infection for humans. Regarding the primary habitat of C. neoformans, species of plants and aged woods can be considered locations where the yeasts may naturally develop their sexual state32.

Considering the complete lack of data reported in the literature to date, the present study aimed to evaluate the possible environmental distribution of C. neoformans in public places (churches, squares, educational institutions, prisons, factories and health facilities) and residences within the City of Cuiabá and the neighbor metropolitan area.

MATERIAL AND METHODS

Study periods and locations: The samples were collected between July and December of 2010 in the metropolitan area of Cuiabá.

Mato Grosso is located in the Midwest region of Brazil. The state occupies an area of 903,357km², being the third largest from Brazil and it is the only one to have three characteristic biomes, Pantanal

TAKAHARA, D.T.; LAZÉRA, M.S.; WANKE, B.; TRILLES, L.; DUTRA, V.; PAULA, D.A.J.; NAKAZATO, L.; ANZAI, M.C.; LEITE-JÚNIOR, D.P.; PAULA, C.R. & HAHN, R.C.- First report on Cryptococcus neoformans in pigeon excreta from public and residential locations in the metropolitan area of Cuiabá, State of Mato Grosso, Brazil. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 371-6, 2013.

372

(marshland), Cerrado (Brazilian savanna) and Amazon. Its capital is the City of Cuiabá, which has about 551,000 inhabitants. In its territory is situated the geodesic center of South America, at 15°35’56” South and 56°06’05” West (Fig. 1).

The climate is characterized by a mean annual rainfall of 1,469.4 mm and average annual temperature of 24 to 26 °C. Despite unequally distributed, the region is well supplied with rain and seasonality is typically tropical, with maximal temperatures in summer and minimal in winter. Over 70% of the total rainfall accumulated during the period of November to March. The winters are excessively dry, due to very scarce rainfall35. The average temperature during the collecting period was 27 °C (July to December 2010), with maximal that reached 40 °C for several times in August, September and October15.

The sites selected were characterized as follows: five public squares, four churches, three educational institutions, eight public health units, four open areas covered with asbestos, 23 residences, one factory and one prison.

Inclusion criteria: At all the sites selected, aspects related to the excreta collected were evaluated according to the following parameters: excreta presenting a dried aspect; deposited on the surfaces of public or residential environments; the presence of pigeons close to the excreta; the presence of chicks or nests; and sufficient quantity for posterior weighing (> one gram) and analysis.

Sample processing: Following homogenization, 1 g of each sample was suspended in 50 mL of sterile physiological saline with 0.4 g/L chloramphenicol, shaken for five min and allowed to settle for 30 min.

The supernatant was aspirated, inoculated onto Niger seed agar (NSA) medium (0.1 mL of supernatant per plate, 10 plates per sample), incubated at room temperature (25 ºC to 27 ºC) and observed for five to seven days.

Yeast colonies on NSA were selected by observing the shiny, smooth, and dark brown colonies (due to melanin production). The brown colonies were sub-cultivated onto Sabouraud (Merck) medium for urease test and other biochemical tests as well microscopic analysis with India ink to visualize the capsule21,22

. For the biochemical tests, auxanogram technique was used, in which the assimilation of eleven carbon sources (dextrose, lactose, maltose, sucrose, inositol, galactose, cellobiose, melezitose, melibiose, rhamnose and erythritol) and two nitrogen sources (peptone and potassium nitrate)18,22 were used to identify the cryptococcal isolates.

The dark brown colonies were also sub-cultivated onto NSA medium which is recommended to confirm phenoloxidase activity11. After passage through NSA medium, dark brown colonies were seeded on CGB medium (L-canavanine glycine bromothymol blue) for species identification19

.

No alteration in the yellow-green original color of the CGB medium confirms C. neoformans.

For molecular identification of the cryptococcal isolates, the protocol described by POETA et al.33 was used, with modifications, for DNA extraction. Yeast cells were suspended in 0.5 mL TENTS [10 mM, Tris pH 8.0, 5% sodium dodecyl sulfate (SDS)]. Then, 0.5g of 0.5-mm glass beads were added and boiled at 100 ºC for 10 min. It was then added 0.5 mL of phenol: chloroform and samples were vortexed for two min. After centrifugation for 10 min in a microfuge at 14,500 x g, the aqueous phase was transferred to a tube with one volume of isopropanol and 0.3 M of sodium acetate was added, and samples were placed at -20 ºC overnight.

Fig. 1 - Location of the City of Cuiabá, State of Mato Grosso, Brazil.


373

DNA collected was precipitated, washed with 70% ethanol, re-suspended in 50 µL of ultrapure water and stored at -20 ºC.

To confirm the species of the isolates, pairs of primers CNA70A (5’-ATTGCGTCCATGTTACGTGGC-3’) and CNA70S (5’-ATTGCGTCCACCAAGGAGCTC-3 ‘) specific for C. neoformans were used, resulting in amplification products of 695 bp2,13.

RESULTS

All the brown colonies isolated on NSA medium were encapsulated yeast forms, and have been observed in microscopy with India Ink. All were thermotolerant to 37 ºC, urease-producing and inhibited by cycloheximide. In Canavanine-glycine-bromothimol blue medium (CGB) didn’t have color change and this confirmed specie C. neoformans, as well as the assimilation of carbohydrates (glucose, maltose, sucrose, galactose, cellobiose, inositol, xylose, raffinose, trehalose, dulcitol) and no nitrate assimilation. All colonies isolated was confirmed by PCR (Polymerase Chain Reaction) from the use of specific primers. Further analysis should be performed to investigate the molecular types of these isolates.

One hundred and twenty-two dry pigeon excreta samples were chosen at random from different locations (Table 1).

The presence of excreta was detected in the eight groups evaluated. However, considering the squares, the presence of excreta was only observed in four of the eleven surveyed. Similarly, in four of the ten churches and three of the five schools the same fact was observed, concomitant presence of pigeons and excreta. According to the isolation of C. neoformans, it was possible to determine that these yeasts were mostly detected in the pigeon excreta collected from the residences assessed.

Regarding the different groups evaluated, C. neoformans was detected in one of the four churches, specifically in the tower, where the presence of both pigeons and excreta were observed. C. neoformans was isolated

in one of the three educational institutions inhabited by pigeons where excreta were also observed. Isolates of C. neoformans were similarly identified in samples from four of the 23 residences evaluated.

The presence of pigeon excreta was observed in 49 (78%) of the 63 sites visited. The presence of these substrata according to the different sites is presented in Table 1.

Isolation of C. neoformans was obtained from six (12.2%) of the 49 sites analyzed, where eight (6.6%) out of 122 samples of dried pigeon excreta collected were positive.

Two samples collected from the church were positive for C. neoformans, eight colonies were detected. In the educational institution, C. neoformans was detected in only one of the 13 samples analyzed and in this sample, four colonies were detected. Regarding the residences, five samples positive for C. neoformans were obtained and 60 colonies were detected.

The identification of C. neoformans isolates was confirmed by PCR using specific primers (Fig. 2).

DISCUSSION

The deposition of pigeon excreta (Columba livia) in public places can serve as a source of infectious agents of importance for public health, such as C. neoformans. In this study, certain facts observed during sample collection deserve attention: the amount of excreta obtained was variable, in that frequent cleaning was observed in several of the public spaces evaluated. Thus, despite the presence of pigeons, the presence of excreta was not verified at all the sites selected.

Furthermore, in the majority of the sites visited, there were no mechanical barriers to prevent access by pigeons, a resource currently used to hinder the approach of pigeons to windows, air conditioning units and other physical barriers.

Table 1Types and number of sites investigated (Groups) and positivity (%) associated with the presence of Cryptococcus neoformans in pigeon excreta of environments in

the Cuiabá City, State of Mato Grosso, Brazil

Groups/type of location NumberPresence of

excretaSample (n)

Sample positive

Isolation

absolute relative

n %

Group I: squares 11 5 12 0 0 0.0

Group II: churches 10 4 13 2 1/4 25.0

Group III: educational institutions 5 3 13 1 1/3 33.0

Group IV: health units 8 8 20 0 0 0.0

Group V: open areas* 4 4 11 0 0 0.0

Group VI: residences 23 23 44 5 4/23 17.0

Group VII: factories 1 1 3 0 0 0.0

Group VIII: prisons 1 1 6 0 0 0.0

Total 63 49 (78%) 122 8 (6.6%) 6/49 12.2

*with asbestos covering.


374

The isolation of virulent strains of the fungus from soil samples was first reported by SILVA & CAPUANO37 in Brazil as early as 1960. MACHADO et al.27also reported recovering this fungus from the soil in an attempt to correlate the clinical-epidemiological history of patients suffering from cryptococcosis in the Santa Casa of Porto Alegre, in the State of Rio Grande do Sul (RS), Brazil.

In this study, only samples of pigeon excreta were collected, soil samples were not included. However, when considering studies that examined samples of pigeon excreta, positivity rates for the isolation of the fungus in Brazil ranged from 4.3 to 31.3%3,6,9,13,16,23,27,28,29,31,34,37,39. The findings of this study show a positivity rate of 12% for C. neoformans, values that are compatible with the rates of isolation in Brazil previously reported in the literature. Most of the total samples analyzed (44/122) were from residences, sites which presented expressive positivity (17%). This finding may represent a risk for the acquisition of cryptococcosis, since in several of the evaluated residences the habit of feeding pigeons by residents was frequently observed, luring them and indirectly encouraging them to reproduce. Food scraps were also found in these places, reflecting poor hygiene care in the common areas of residential estates.

Ten churches were visited and the presence of excreta was investigated in four, though positivity for C. neoformans was demonstrated only in one. BARONI et al.3 also evaluated the presence of C. neoformans in ten churches in the City of Rio de Janeiro and C. neoformans was found in every church selected and was present in 37.8% of 219 pigeon dropping samples. Samples of excreta were obtained, in addition to air samples in church towers and from the surrounding areas. It is known that high summer temperatures can inhibit the growth of C. neoformans,

possibly due to inactivation of the yeast36,40. Cuiabá is known for its high temperatures, a factor that should be considered in relation to the low rates of detection of C. neoformans in pigeon excreta at the sites evaluated.

According to BULMER4, the problem is the long viability of C. neoformans in dried excreta, about two years. Based on this information, old buildings and towers of old churches can be considered potential sources for C. neoformans and should be periodically evaluated by public health authorities. In Cuiabá, most churches are fairly old (over 50 years-old) and are considered historical monuments of the city, which completed 292 years in 2011.

Uninfected pigeon excreta can become infected when exposed to air containing aerosolized cells of C. neoformans5. Considering all the locations where pigeon excreta might be deposited within the urban areas of Cuiabá, the aerial dispersion of cryptococcal propagules from the positive sites to the surroundings is probably occurring. The positivity (12%) rate for the isolation of C. neoformans from pigeon excreta detected in this study is in agreement with the values obtained by LOPEZ-MARTINEZ et al.26, who analyzed 711 samples from numerous environmental sources in Mexico City, including bird droppings, fruits and vegetables. They reported the presence of C. neoformans in 9.5% of excreta samples, 9.5% in fruits and 4.2% vegetables. In contrast, in another study in Bogota (Colombia), 480 samples of debris from trees and 89 excreta samples were investigated. Among the plant samples, 99% were characterized as C. gattii and 1% as C. neoformans, while in the excreta samples, only C. neoformans was isolated12.

Considering the public squares in the present study, the findings in Cuiabá contrast with those obtained in Porto Alegre, Rio Grande do Sul State, by REOLON et al.34 They affirmed that in all five squares in which the investigation of yeasts of the genus Cryptococcus was conducted, a total of 88 samples, positivity was obtained in all 88 (100%) samples. In our study, 11 squares were evaluated, but it was not possible to isolate yeasts of the genus Cryptococcus, despite the presence of excreta in five of the squares. The authors who conducted the study in Porto Alegre did not mention the period or season in which the materials were collected, making it virtually impossible to compare the factors that could interfere with the isolation of yeasts in cities with very different bioclimatic conditions, such as Cuiabá and Porto Alegre.

In the City of Pelotas, Rio Grande do Sul State, FARIA et al.9 evaluated 70 environments, including squares (n = 1), historic buildings (n = 8), church towers (n = 1), rice mills and warehouses (n = 7) and outdoor locations (n = 9). Considering all these sites, the isolation of C. neoformans was verified in 26.9% (n = 7/26). Among the 14 squares evaluated in Pelotas, only one had a mean quantity excreta from which C. neoformans was isolated. The City of Pelotas has no extreme temperatures and relative humidity is high. This contrasts with the bioclimatic conditions of Cuiabá, where temperatures in August, September and October, rise considerably and the relative humidity remains extremely low, reaching critical levels. Sun light exposure associated with the climate of Cuiaba may be critical for the survival of C. neoformans in open areas of the city. Moreover the agent was mainly isolated from protected places in Cuiabá, such as an educational institution, a church and four residences. These findings reveal the risk of exposure for immunosuppressed and even immunocompetent individuals in daily activities or living in these microenvironments. Measures are required to

Fig. 2 - PCR amplification of Cryptococcus neoformans: M, 100 pb DNA ladder, 1 negative

control (NC), 1 positive control (PC) and sample isolates A1 (church), A2 (educational

institution), A3 (residence 1) and A4 (residence 2).


375

reduce the number of birds through the maintenance of adequate hygiene, aeration, lighting and ventilation1,11. Simply performing adequate cleaning of such environments could be effective, as well as not offering food to pigeons, particularly in residential areas.

RESUMO

Primeiro registro de Cryptococcus neoformans em excretas de pombos provenientes de locais públicos e residenciais de área

metropolitana de Cuiabá, Estado do Mato Grosso, Brasil

A criptococose é micose sistêmica potencialmente grave causada por duas espécies do gênero Cryptococcus que acometem tanto homens como animais: Cryptococcus neoformans e C. gattii. São infecções cosmopolitas e emergentes, resultantes da interação do hospedeiro - humano e animal versus meio ambiente. A proposta deste trabalho foi avaliar a ocorrência de C. neoformans em 122 amostras de excretas secas de pombos coletadas em 49 locais na cidade de Cuiabá, Estado do Mato Grosso, Brasil, incluindo: praças públicas (n = 5), igrejas (n = 4), instituições de ensino (n = 3), unidades de saúde (n = 8), áreas abertas exibindo cobertura de amianto (n = 4), conjuntos residenciais domiciliares (n = 23), uma fábrica (n = 1) e um presídio (n = 1). Semeadura de suspensão de amostras em meio ágar niger (NSA), identificação fenotípica por provas bioquímicas e teste em meio de canavanina-glicina-azul de bromotimol, das colônias isoladas com pigmentação marrom escura. Foi também utilizada a técnica da reação em cadeia da polimerase com pares de iniciadores específicos para identificação de C. neoformans. As amostras foram coletadas de julho a dezembro de 2010. Cryptococcus neoformans foi isolado em oito (6,6%) de 122 amostras correspondendo a seis (12,2%) dos 49 sítios analisados. Cryptococcus neoformans associado a excretas de pombos ocorre em áreas de Cuiabá, predominando em residências nas amostras analisadas, constituindo fator de risco potencial para aquisição da doença tanto para indivíduos imunocomprometidos como imunocompetentes.

ACKNOWLEDGMENTS

Financial support for this study was provided by FAPEMAT - Fundação de Amparo à Pesquisa no Estado de Mato Grosso [State of Mato Grosso Foundation for the Support of Science].

REFERENCES

1. Abegg MA, Cella FL, Faganello J, Valente P, Schrank A, Vainstein MH. Cryptococcus neoformans and Cryptococcus gattii isolated from the excreta of psittaciformes in a southern Brazilian zoological garden. Mycopathologia. 2006;161:83-91.

2. Aoki FH, Imai T, Tanaka R, Mikami Y, Taguchi H, Nishimura NF, et al. New PCR primer pairs specific for Cryptococcus neoformans serotype A or B prepared on the basis of random amplified polymorphic DNA fingerprint pattern analyses. J Clin Microbiol. 1999;37:315-20.

3. Baroni FA, Paula CR, Silva EG, Viani FC, Rivera ING, Oliveira MTB, et al. Cryptococcus neoformans strains isolated from church towers in Rio de Janeiro City, RJ, Brazil. Rev Inst Med Trop Sao Paulo. 2006;48:71-5.

4. Bulmer GS. Twenty-five years with Cryptococcus neoformans. Mycopathologia. 1990;109:111-22.

5. Casadevall A, Perfect JR. Cryptococcus neoformans. Washington: American Society for Microbiology Press; 1998.

6. Casali AK, Goulart L, Rosa e Silva LK, Ribeiro AM, Almeida AA, et al. Molecular typing of clinical and environmental Cryptococcus neoformans isolates in the Brazilian State Rio Grande do Sul. FEMS Yeast Res. 2003;3:405-15.

7. Currie BP, Freundlich LF, Casadevall A. Restriction fragment length polymorphism analysis of Cryptococcus neoformans isolates from environmental (pigeon excreta) and clinical sources in New York City. J Clin Microbiol. 1994;32:1188-92.

8. Emmons CW. Saprophytic sources of Cryptococcus neoformans associated with the pigeon (Columba livia). Amer J Hyg. 1955;62:227-32.

9. Faria RO, Nascente PS, Meinerz ARM, Cleff MB, Antunes TA, Silveira ES, et al. Ocorrência de Cryptococcus neoformans em excretas de pombos na cidade de Pelotas, Estado do Rio Grande do Sul. Rev Soc Bras Med Trop. 2010;43:198-200.

10. Favalessa OC, Ribeiro LC, Tadano T, Fontes CJF, Dias FB, Coelho BP, et al. Primeira descrição da caracterização fenotípica e susceptibilidade in vitro a drogas de leveduras do gênero Cryptococcus spp isoladas de pacientes HIV positivos e negativos, Estado de Mato Grosso. Rev Soc Bras Med Trop. 2009;42:661-5.

11. Filiú WF, Wanke B, Agüena SM, Vilela VO, Macedo RC, Lazéra MS. Cativeiro de aves como fonte de Cryptococcus neoformans na cidade de Campo Grande, Mato Grosso do Sul, Brasil. Rev Soc Bras Med Trop. 2002;35:591-5.

12. Granados DP, Castañeda E. Isolation and characterization of Cryptococcus neoformans varieties recovered from natural sources in Bogotá, Colombia, and study of ecological conditions in the area. Microb Ecol. 2005;49:282-90.

13. Horta JA, Staats CC, Casali AK, Ribeiro AM, Schrank IS, Schrank A, et al. Epidemiological aspects of clinical and environmental Cryptococcus neoformans isolates in the Brazilian state Rio Grande do Sul. Med Mycol. 2002;40:565-71.

14. Idnurm A, Bahn Y, Nielsen K, Lin X, Fraser JA, Heitman J. Deciphering the model pathogenic fungus Cryptococcus neoformans. Nat Rev Microbiol. 2005;3:753-64.

15. Instituto Nacional de Meteorologia (INMET) [Internet]. Brasilia, DF, Brasil: INMET; [Updated 2011 January 2001; Cited 2011 October 29] Available from: http://www.inmet.gov.br/html/observacoes.php?/

16. Kobayashi CC, Souza LK, Fernandes OF, Brito SC, Silva AC, Sousa ED, et al. Characterization of Cryptococcus neoformans isolated from urban environmental sources in Goiânia, Goiás, Brazil. Rev Inst Med Trop Sao Paulo. 2005;47:203-7.

17. Kon AS, Grumach AS, Colombo AL, Penalva ACO, Wanke B, Telles FQ, et al. Consenso em criptococose - 2008. Rev Soc Bras Med Trop. 2008;41:524-44.

18. Kwon-Chung KJ, Bennet JE. Cryptococcosis. In: Kwon-Chung KJ, Bennet JE, editors. Medical Mycology. Philadelphia: Lea & Febiger; 1992. p. 426-36.

19. Kwon-Chung KJ, Bennet JE. Culture media and reagents. In: Kwon-Chung KJ, Bennet JE, editors. Medical Mycology. Appendix B. Philadelphia: Lea & Febiger; 1992. p. 816-26.

20. Kwon-Chung KJ, Boekhout T, Fell TJ, Diaz M. Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. bacillisporus (Basidiomycota, Hymenomycetes, Tremellomycetidae). Taxon. 2002;51:804-6.

21. Kwon-Chung KJ, Polacheck I, Bennett JE. Improved diagnostic medium for separation of Cryptococcus neoformans var. neoformans (serotypes A and D) and Cryptococcus neoformans var. gattii (serotypes B and C). J Clin Microbiol. 1982;15:535-7.

22. Lacaz CS, Porto E, Martins JEC, Heins-Vaccari EM, Mello NT. Criptococcose. In: Lacaz CS, Porto E, Martins JEC, Heins-Vaccari EM, Mello NT, editors. Tratado de Micologia Médica. 9th. ed. São Paulo: Sarvier; 2002. p. 416-40.

23. Lazéra MS, Wanke B, Nishikawa MM. Isolation of both varieties of Cryptococcus neoformans var. neoformans from saprophytic sources in the city of Rio de Janeiro, Brazil. J Med Vet Mycol. 1993;31:449-54.


376

24. Levitz SM. The ecology of Cryptococcus neoformans and the epidemiology of cryptococcosis. Rev Infect Dis. 1991;13:1163-9.

25. Lin X, Heitman J. The biology of the Cryptococcus neoformans species complex. Ann Rev Microbiol. 2006;8:69-105.

26. López-Martínez R, Castañón-Olivares LR. Isolation of Cryptococcus neoformans var. neoformans from bird droppings, fruits and vegetables in Mexico City. Mycopathologia. 1995;129:25-8.

27. Machado CC, Amaral AA, Severo LC. Cryptococcus neoformans var. neoformans isolado do solo. Rev Inst Med Trop Sao Paulo. 1993;35:77-9.

28. Montenegro H, Paula CR. Environmental isolation of Cryptococcus neoformans var. gattii and C. neoformans var. neoformans in the city of São Paulo, Brazil. Med Mycol. 2000;38:385-90.

29. Melo NT, Nigro RC, Pereira AD, Huggins D, Lacaz CS. Isolamento de Cryptococcus neoformans de fezes de pombos, do solo e ninhos de pombos. Rev Bras Med. 1987;44:6-9.

30. Pappalardo MC, Melhem MS. Cryptococcosis: a review of the Brazilian experience for the disease. Rev Inst Med Trop Sao Paulo. 2003;45:299-305.

31. Passoni LF, Wanke B, Nishikawa MM, Lazéra MS. Cryptococcus neoformans isolated from human dwellings in Rio de Janeiro, Brazil: an analysis of the domestic environmental of AIDS patients with and without cryptococcosis. Med Mycol. 1998;36:305-11.

32. Passoni LF. Wood, animals and human beings as reservoirs for human Cryptococcus neoformans infection. Rev Iberoam Micol. 1999;16:77-81.

33. Poeta MD, Toffaletti DL, Rude TH, Dykstra CC, Heitman J, Perfect JR. Topoisomerase I is essential in Cryptococcus neoformans: role in pathobiology and as an antifungal target. Genetics. 1999;152:167-78.

34. Reolon A, Perez LRR, Mezzari A. Prevalência de Cryptococcus neoformans nos pombos urbanos da cidade de Porto Alegre, Rio Grande do Sul, Brasil. J Bras Patol Med Lab. 2004;40:293-8.

35. Rolim GS, Camargo MBP, Lania DG, Moraes JFL. Classificação climática de Köppen e Thornthwaite e sua aplicabilidade na determinação de zonas agroclimáticas para o Estado de São Paulo. Bragantia. 2007;66:711-20.

36. Rosario I, Hermoso-de-Mendonza M, Déniz S, Soro G, Álamo I, Acosta B. Isolation of Cryptococcus species including C. neformans from cloaca of pigeons. Mycoses. 2005;48:421-4.

37. Silva JO, Capuano DM. Ocorrência de Cryptococcus spp e de parasitas de interesse em saúde pública, no excreta de pombos na cidade de Ribeirão Preto, SP, Brasil. Rev Inst Adolfo Lutz. 2008;67:137-41.

38. Silva ME, Paula LA. Isolamento de Cryptococcus neoformans de excrementos e ninhos de pombos (Columba livia) em Salvador, Bahia. Rev Inst Med Trop Sao Paulo. 1963;5:9-11.

39. Silva ME. Ocorrência de Cryptoccocus neoformans e Microsporum gypseum em solos da Bahia, Brasil. Bol Fund Gonçalo Moniz. 1960;17:1-14.

40. Sorrell TC, Ellis DH. Ecology of Cryptococcus neoformans. Rev Iberoam Micol. 1997;14:42-3.

Received: 10 December 2012Accepted: 4 April 2013


(1) Laboratory of Mycology, Department of Pharmaceutical Sciences, Federal University of Paraíba, João Pessoa, PB, Brazil. (2) Laboratory of Ceramic, Department of Mechanical Engineering, Federal University of Paraíba, João Pessoa, PB, Brazil.(3) Department of Statistic, Federal University of Paraíba, João Pessoa, PB, Brazil.Correspondence to: Felipe Queiroga Sarmento Guerra, Tel.: 55.83.9602-1666. E-mail: [email protected]

DISTRIBUTION OF DERMATOPHYTES FROM SOILS OF URBAN AND RURAL AREAS OF CITIES OF PARAIBA STATE, BRAZIL

Zélia Braz Vieira da Silva PONTES(1), Aurylene Carlos de OLIVEIRA(1), Felipe Queiroga Sarmento GUERRA(1), Luiz Renato de Araújo PONTES(2) & Jozemar Pereira dos SANTOS(3)

SUMMARY

The dermatophytes, keratinophilic fungi, represent important microorganisms of the soil microbiota, where there are cosmopolitan species and others with restricted geographic distribution. The aim of this study was to broaden the knowledge about the presence of dermatophytes in soils of urban (empty lots, schools, slums, squares, beaches and homes) and rural areas and about the evolution of their prevalence in soils of varying pH in cities of the four mesoregions of Paraiba State, Brazil. Soil samples were collected from 31 cities of Paraiba State. Of 212 samples, 62% showed fungal growth, particularly those from the Mata Paraibana mesoregion (43.5%), which has a tropical climate, hot and humid. Soil pH varied from 4.65 to 9.06, with 71% of the growth of dermatophytes occurring at alkaline pH (7.02 - 9.06) (ρ = 0.000). Of 131 strains isolated, 57.3% were geophilic species, particularly Trichophyton terrestre (31.3%) and Mycrosporum gypseum (21.4%). M. nanum and T. ajelloi were isolated for the first time in Paraiba State. The zoophilic species identified were T. mentagrophytes var. mentagrophytes (31.3 %) and T. verrucosum (7.6 %), and T. tonsurans was isolated as an anthropophilic species. The soils of urban areas including empty lots, schools, slums and squares of cities in the mesoregions of Paraiba State were found to be the most suitable reservoirs for almost all dermatophytes; their growth may have been influenced by environmental factors, soils with residues of human and/or animal keratin and alkaline pH.

KEYWORDS: Dermatophytes; Keratinophilic fungi; Soil; pH conditions; Brazil.

INTRODUCTION

The dermatophytes (Trichophyton, Microsporum and Epidermophyton), keratinophilic fungi, represent important microorganisms of the soil microbiota, where there are cosmopolitan species and others with restricted geographic distribution1,2,6,10,17,21. There have been reports of the isolation of T. ajelloi, T. rubrum, T. mentagrophytes, T. verrucosum, T. terrestre, T. tonsurans, T. simii, T. schoenleinii, M. gypseum, M. canis, M. audouinii, M. nanum, M. cookei and/or E. floccosum, from the soils of various Brazilian states and locals around the world8,20,24,25,30,32,34.

The occurrence of fungi in the soil can also be influenced by non-biological factors such as soil temperature, humidity, rainfall, environmental light, climate, chemical composition, quantity of organic matter in the soil and pH. Some have a wide range of tolerance for acidic to alkaline soils2,7,14,16. However, studies of soil pH in relation to occurrence of dermatophytes are uncommon in Brazil.

The study of the diversity of dermatophytes in the soil is important because changes in the distribution of species of dermatophytes due to ecological factors, socio-economic, therapeutic, and migration processes

of livestock populations, reflect the epidemiology of dermatophytosis, which are one of the source infections of the soil2,3,16,18,31. Thus, the aim of this study was to broaden the study into the presence of dermatophytes from soils of urban and rural areas of cities of four mesoregions of Paraiba State and the influence of pH on fungi growth.

MATERIALS AND METHODS

The state of Paraiba is situated in the eastern portion of Northeast Brazil, with coordinates between 6º and 8º S and between 34º and 38º W; therefore, it is included in the tropical zone. It comprises an area of 56,372 km2 and is divided into four mesoregions (Mata Paraibana, Borborema, Agreste Paraibano and Sertão Paraibano) and into 23 geographic microregions, including a total of 223 cities. In the Mata Paraibana, the predominant climate is warm, humid tropical (As’) with an average annual rainfall of 1,800 mm, temperature of 26 ºC and relative humidity of 80%. The soils are sandy and muddy, which are influenced by sea water and have especially coastal vegetation of mangrove swamp, rainforest and cerrado. In Borborema, the predominant climate is semi-arid (Bsh), warm and dry with average annual rainfall of 500 mm, temperature of 26 ºC and relative humidity of 75%. The soils are shallow stony soil with caatinga

PONTES, Z.B.V.S.; OLIVEIRA, A.C.; GUERRA, F.Q.S.; PONTES, L.R.A. & SANTOS, J.P. - Distribution of dermatophytes from soils of urban and rural areas of cities of Paraiba State, Brazil. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 377-83, 2013.

378

vegetation. The climate Bsh, together with As’ are observed in Agreste Paraibano. However, in Sertão Paraibano, the predominant climate is semi-humid (Aw’) with an average annual rainfall of 800 mm, temperature of 27 ºC and relative humidity of 70%. In the two last mesoregions, a slow development of soils with caatinga vegetation (Fig. 1)28.

An ecological study was performed with a total of 212 soil samples. The sampling was non-probabilistic, as it was done by convenience and accessibility to the members of the team, taking into consideration conglomerates of cities in Paraiba mesoregions. Each mesoregion was represented by a city of great geographical and population density: João Pessoa for Mata Paraibana, Monteiro for Borborema, Campina Grande for Agreste Paraibano and Patos for Sertão Paraibano. The other cities were randomly included.

Soil samples were selected from urban (empty lots, schools, slums, squares, homes and beaches) and rural areas of cities. The sampling sites were selected on the basis of the likely presence of soil with keratin residues from humans and animals.

The collection, processing and pH of soil solutions were according to the techniques described by VANBREUSEGHEM33. Approximately 100g of soil at a depth of three to five centimeters was collected, placed in polyethylene bags and brought to be processed at the Laboratory of Mycology in the Department of Pharmaceutic Sciences and Laboratory of Ceramic, Department of Mechanical Engineering at the Federal University of Paraiba.

Using a pHmetrer, the pH of each soil sample (20 g) was measured

Fig. 1 - Location of 31 cities, according to four mesoregions, soils type, vegetation and climate of the state of Paraíba, Brazil. Adapted from RODRIGUEZ28.


379

after dilution in distilled sterile water (20 mL) with 20 minutes of agitation and decantation. Each sample was distributed in sterile Petri plates, moistened with sterile water (20 mL) and some sterile human hair strips were placed over each surface. The plates were identified and incubated (27-30 °C) and from the 5th to the 70th day the hair strips were regularly observed with magnifying glasses for signs of fungal growth. Hair strips with a development of prominent fungal growth around them, were placed between slide and cover slid, colored in lactophenol blue cotton and examined in a microscope (10X and 40X). They were cultivated in Sabouraud dextrose agar® medium with chloramphenicol (0.05 mg mL-1) and in Mycobiotic agar® and incubated at room temperature for another minimum period of two weeks.

The identification of the species was based on macromorphology and micromorphology features (slide-culturing) and physiological tests (urea hydrolysis, in vitro hair perforation, vitamin requirement and sensitive media). The classification was based on BARNETT & HUNTER5, REBELL & TAPLIN27 and HOOG et al.12.

The data were subjected to statistical analysis, which consisted of the Binomial test. The process was carried out by computing SPSS 1322, allowing to verify if the dermatophytes growth soil acidic pH is equal to alkaline pH.

RESULTS

In 31 cities of four mesoregions of the state of Paraiba (Fig. 1), 62% of the growth of dermatophytes occurred in soil with different pH. In cities from Mata Paraibana, isolations were observed in 43.5% of samples, where this rate was 84% in the capital, João Pessoa. In cities from Sertão Paraibano, the isolation rate was 20.6%, whereas 23.7% in cities from Agreste Paraibano and 12.2% in cities from Borborema (Table 1).

A total of 131 strains of dermatophytes were isolated, where 57.3% of the geophilic species were identified. T. terrestre (31.3%) was the most common species, followed by M. gypseum (21.4%), M. nanum (3%), T. ajelloi (0.8%) and Anthroderma gypsea (0.8%), a teleomorph form of M. gypseum, observed in sample soil. M. nanum and T. ajelloi were isolated for the first time in Paraiba State. The zoophilic species identified included T. mentagrophytes var. mentagrophytes (31.3%) and T. verrucosum (7.6%). T. tonsurans (3.8%) was the only anthropophilic species isolated. The growth of more than one fungal species was observed in 13 samples (Table 1).

The soils that showed the highest rates of dermatophytes were those of urban areas (95%), especially in soils of empty lots (25.2% of isolations), around schools (22.9%), in slums (21.4%) and squares (19.8%), compared to around homes (3.8%) and on beaches (2.3%) (Table 2).

Dermatophytes developed in a wide pH range: acid to alkaline (4.65 - 9.06), with 71% in alkaline pH (7.02 - 9.06). T. terrestre develops within the pH range of 5.76 - 8.90. T. mentagrophytes var. mentagrophytes and M. gypseum develop within the pH range 4.65 - 9.06 and 5.77 - 8.31, respectively and T. verrucosum was reported from urban areas at pH 6.65 - 8.05. In acid pH soil, an inhibition of growth M. nanum, A. gypsea and T. ajelloi was observed. The dermatophytes growth in soil of alkaline pH was significantly different from the acidic pH (ρ = 0.000) (Table 3).

DISCUSSION

Studies worldwide have examined various variables, such as soil type, pH, climate, temperature, moisture and organic matter content, and have revealed the presence of dermatophytes and other keratinophilic fungi in soil1,3,6,9,14,21,31. In Brazil, there are few reports on the isolation of dermatophytes in soil, specifically in the Northeast region16,26,32. In the mesoregion of Mata Paraibana, with an As’ climate and sandy and muddy soils28, dermatophytes were isolated in 43.5% of samples. A previous study reported that 55.7% of 68 soil samples from the city of João Pessoa-Paraiba State (PB), showed the growth of dermatophytes26. In Borborema, the isolation rate was 12.2%. This area has a Bsh climate and shallow rocky soil. In other mesoregions, the lack of water for prolonged periods accounts for the slow development of soil. The distribution of climates is related to the geographic localization, that is, the closer to the coast the more humid and the farther from the coast the drier. The four mesoregions of Paraiba have predominantly caatinga vegetation, except Mata Paraibana28. Although the roles of fungi in ecosystems have been well documented, knowledge about their population dynamics and community structure and of the diversity of soil fungi is still poor. Further studies of Paraiba soils are necessary to analyze the changes and influence of variables such as types of climate, soil and vegetation on the development of dermatophytes.

The pH range of 7.2 - 8.0 is favorable for the production of proteolytic enzymes (keratinases) by keratinophilic fungi, which are necessary for their growth, along with other soil conditions15. However, the results of this study indicate the growth of dermatophytes in acid and alkaline pH, where 71% of isolations were observed in the alkaline pH range between 7.02 and 9.06 (ρ = 0.000). These results, obtained with different soil samples, confirm the importance of pH in the habitat to the occurrence and distribution of dermatophytes. In acidic soils, there is growth inhibition of dermatophytes and other keratinophilic fungi, but soils that are weakly acidic to neutral or alkaline are optimal for their growth14,16,21,23. In this investigation, in acid pH soils, the growth of A. gypseum, M. nanum and T. ajelloi was inhibited. Some authors6 observed that the frequency of T. ajelloi (33%) increased with a decrease in pH, reaching a maximum in strongly acidic soil.

Eight species of dermatophytes were identified in the soils of cities in Paraiba. Of the geophilic species (57.3%), T. terrestre (31.3%) was especially found in soils from squares, empty lots, schools, slums and beaches. This variable distribution rate can be related to the sampling sites, where the presence of people and animals are frequent, providing residues of organic matter, which are essential for the growth of these fungi. The results obtained are close to those for other cities in Brazil such as: Belo Horizonte and São Paulo29 and in soils of countries such as Germany and Argentina7,21. However, the frequency of this species was low in Italy25 and India31. T. terrestre has been found to be a pathogen particularly in pets and humans including the elderly who exhibit complications related to immunological factors25.

Other geophilic species that were isolated included M. gypseum (21.4%), M. nanum (3%), T. ajelloi (0.8%) and A. gypsea (0.8%) at alkaline pH, except M. gypseum, which also showed growth at acid pH. Similar results were obtained in soils from the Brazilian states of Rio de Janeiro (31%)10, São Paulo (30%)29 and Bahia (28.8%)32. However, in Recife, Pernambuco State, 5.6% isolation was observed for this species


380

at alkaline pH16. High rates of M. gypseum were observed in soils from Rio Grande do Sul, Brazil (79%)8, Argentina (89%)13, India (64%)4, Kuwait (50%) in parks and gardens1, and Italy (39%)25.

M. gypseum has a universal distribution, and it is the etiological agent of tinea capitis and tinea corporis in humans and animals,

where dogs, horses and rodents are common reservoirs of keratin1. In this investigation, it was found in soils of empty lots, slums, schools, squares, homes and rural areas. HAYASHI & TOSHITANI11 reported, in Japan, 271 cases of human infection by this fungal species. A case of tinea capitis due to infection by this species, has been diagnosed in João Pessoa-PB18.

Table 1Dermatophytes isolated from urban and rural soil samples from 31 cities in four mesoregions of Paraiba State

Mesoregions CitiesSoil*

n

Dermatophytes**

A.gn

M.gn

M.nn

T.an

T.mn

T.ten

T.tn

T.vn

Totaln

Mata Paraibana

João Pessoa 68 1 10 - - 18 12 2 5 48

Lucena 4 - - - - - 1 1 - 2

Pilar 5 - 1 - - 1 1 - - 3

Rio Tinto 5 - - - - 1 - - - 1

Santa Rita 3 - 1 - - - 1 - 1 3

Subtotal 85 1 12 - - 20 15 3 6 57

Agreste Paraibano

Alagoa Nova 7 - 1 - - - - - 1 2

Araruna 4 - 1 1 - - 3 - - 5

Areia 3 - - - - - 1 - - 1

Boa vista 4 - 1 - - 3 - - - 4

C. Grande 6 - 1 - - - - - - 1

Cuité 4 - 2 - - 2 - - 1 5

Ingá 4 - - - - - 2 - - 2

Itabaiana 8 - - 1 - - 2 - 1 4

Soledade 3 - 1 - - - 2 - - 3

Subtotal 43 - 7 2 - 5 10 - 3 27

Borborema

Monteiro 4 - - - - 1 - - - 1

Pedra Lavrada 2 - - - - - 2 - - 2

São João Cariri 6 - - - - 3 - - 1 4

S. S.Umbuzeiro 3 - - - - - 2 - - 2

Santa Luzia 4 - - 1 - 1 1 - - 3

Sumé 12 - - - 1 2 1 - - 4

Subtotal 31 - - 1 1 7 6 - 1 16

Sertão Paraibano

Brejo Santos 7 - 1 - - - 1 1 - 3

Cajazeiras 4 - 1 - - 4 - - - 5

Catolé Rocha 5 - 3 - - - 1 - - 4

Conceição 6 - - - - - 2 - - 2

Ibiara 4 - - 1 - - - - - 1

Jericó 3 - 1 - - 3 - - - 4

Patos 4 - - - - - 1 - - 1

Princesa Isabel 6 - 1 - - 1 3 - - 5

Souza 3 - 2 - - - - - - 2

Triunfo 6 - - - - 1 2 - - 3

Uiraúna 5 - - - - - - 1 - 1

Subtotal 53 - 9 - - 9 10 2 - 31

Total 212 1 28 4 1 41 41 5 10 131* Some soil samples showed growth of more than one species of dermatophyte. ** Dermatophytes: A.g - Arthroderma gypsea; M.g - Microsporum gypseum; M.n - M. nanum; T.a - Trichophyton ajelloi; T.m - T. mentagrophytes var. mentagrophytes; T.te - T. terrestre; T.to - T. tonsurans; T.v - T. verrucosum.


381

M. nanum (3%) was isolated for the first time from soil of schools, beaches and empty lots in Paraiba State. In a study carried out on soil of a swimming resort, in Mexico, its isolation rate was 5%19.

T. ajelloi was isolated from soils of the South and Southeast regions of Brazil8,10,29. ALVAREZ et al.2 reported an isolation rate of 66% for this

fungus in soil of Argentina. In this study, the first and only isolation of this species (0.8%) was observed in soil around a school.

Among the zoophilic species, T. mentagrophytes var. mentagrophytes was the species of highest incidence in soils of various places (schools, gardens, parks, beaches, caverns, chicken coops, pens and homes) in some Brazilian states such as Amazonas, São Paulo and Goias29,34,35, as well as soils of Mexico, Iran, Nigeria and India4,19,24,30,31. In this study, this species (31.3%) was isolated from all soils of urban and rural areas, and one strain of this species was reported in highly acidic soil at pH 4.65. In Berlin, the average pH of positive keratinophilic fungal samples was 5.87, and in India, it was the most common isolated species from pH 6.5 to 9.5 soils14.

T. verrucosum is a zoophilic species cited as the agent encountered in the case of cattle, which can be transmitted to humans. It is usually highly inflammatory involving the scalp, beard or exposed area of body3,18. In this investigation, T. verrucosum was reported from urban areas at pH 6.65 - 8.05.

The isolation rate of T. tonsurans as an anthropophilic species was 3.8% in soils of schools, slums, beaches and empty lots and 80% at alkaline pH. GOULART et al.10 also reported the isolation of this species in the soil of Rio of Janeiro. In Recife, an epidemiological correlation has been observed between T. tonsurans isolated from soils of parks I (28%) and II (20%) and dermatophytosis agents16,18.

CONCLUSION

The soils of urban areas within empty lots, schools, slums and

Table 2Distribution of dermatophytes from soil samples of urban and rural areas of cities of Paraiba State

Urban AreaRural Area

nTotaln (%)School*

nSquare*

nEmpty lot*

nSlum*

nResidence

nBeach

n

Soils Samples

Negative 21 23 15 12 07 06 14 94 (44.3)

Positive 28 24 29 23 05 03 06 118 (55.7)

Dermatophytes

Trichophyton terrestre 10 12 11 07 - 01 - 41 (31.3)

T. mentagrophytes var. mentagrophytes 11 08 08 07 02 01 04 41 (31.3)

T. verrucosum 01 02 03 04 - - - 10 (7.6)

T. tonsurans 02 - 01 01 - 01 - 05 (3.8)

T. ajelloi 01 - - - - - - 01 (0.8)

Microsporum gypseum 03 03 09 08 03 - 02 28 (21.4)

M. nanum 02 01 01 - - - - 04 (3.0)

Anthroderma gypsea - - - 01 - - 01 (0.8)

Total 30 26 33 28 05 03 06 13

(%) (22.9) (19.8) (25.2) (21.4) (3.8) (2.3) (4.6) (100.0)

* Some soil samples showed growth of more than one species of dermatophytes.

Table 3Distribution of dermatophytes, with reference to soil pH

Dermatophytes

Soil pH

Acid4.65-6.65

Alkaline7.02-9.06

Totaln (%)

Trichophyton terrestre 09 32 41 (31.3)

T. mentagrophytes var. mentagrophytes

16 25 41 (31.3)

T. verrucosum 02 08 10 (7.6)

T. tonsurans 01 04 05 (3.8)

T. ajelloi - 01 01 (0.8)

Microsporum gypseum 10 18 28 (21.3)

M. nanum - 04 04 (3.1)

Anthroderma gypsea - 01 01 (0.8)

Total n (%) 38 (29%) 93 (71%) 131 (100.0)

Binomial test. H0: acid pH = alkaline pH and H

1: acid pH ≠ alkaline pH;

ρ = 0.000 ≤ 0.05, reject H0.


382

squares of cities of mesoregions of Paraiba State were found to be the most suitable reservoirs for almost all dermatophytes. Its growth may have been influenced by environmental factors such as residues of human and/or animal keratin and alkaline pH.

RESUMO

Distribuição de dermatófitos isolados de solos de cidades do Estado da Paraíba, Brasil

Os dermatófitos, fungos queratinofílicos, representam importantes microrganismos da microbiota do solo, onde existem espécies cosmopolitas e outras de distribuição geográfica restrita. Este estudo teve como objetivo ampliar o conhecimento da distribuição de dermatófitos do solo proveniente de áreas urbanas (terrenos baldios, escolas, favelas, praças, praias e residências) e rurais de quatro mesorregiões paraibanas e da influência do pH na adaptação desse grupo de fungos. Amostras de solos urbanos e rurais foram coletadas de 31 cidades do estado da Paraíba, Brasil. De 212 amostras 62% apresentaram crescimento fúngico, destacando-se a Mesorregião da Mata Paraibana (43.5%), a qual apresenta clima tropical, quente e úmido. O pH das amostras de solo variou de 4.65 a 9.06, com crescimento de 71% dos dermatófitos em pH alcalino (7.02 - 9.06) (ρ = 0.000). Das 131 cepas isoladas 57.3% eram espécies geofílicas, destacando-se Trichophyton terrestre (31.3%) e Microsporum gypseum (21.4%). M. nanum e T. ajelloi foram isolados pela primeira vez no estado da Paraíba. Entre as espécies zoofílicas foram identificadas T. mentagrophytes var. mentagrophytes (31.3%) e T. verrucosum (7.6%) e como espécie antropofílica foi isolada T. tonsurans. Os solos de terrenos baldios, escolas, favelas e praças de cidades paraibanas são os reservatórios mais adequados dos dermatófitos, cujo crescimento pode ter sido influenciado por fatores ambientais, solos com resíduos de queratina humana e ou animal e pH alcalino.

ACKNOWLEDGEMENTS

The authors would like to thank to the Laboratory of Ceramics for collecting and measuring the pH of soils samples.

REFERENCES

1. Al-Musallam AA, Al-Zarban SS, Al-Sanè NA, Ahmed TM. A report on the predominant occurrence of a dermatophytes species in cultivated soil from Kuwait. Mycopathologia. 1995;130:159-61.

2. Alvarez DP, Luque AG, Marini P. Influencia del sustrato queratinoso de suelos de Pradera sobre la colonización por dermatofitos geofílicos. Bol Micol. 1986;3:25-9.

3. Amaral CDP, Pereira DIB, Meireles MCA. Caracterização da microbiota por fungos filamentosos no tratamento hípico de bovinos de corte. Ci Rural. 2011;41:2137-42.

4. Anbu P, Hilda A, Gopinath SC. Keratinophilic fungi of poultry farm and feather dumping soil in Tamil Nadu, India. Mycopathologia. 2004;158:303-9.

5. Barnett HL, Hunter BB. Illustrated genera of imperfect fungi. 4th ed. New York: Burgess; 1986.

6. Bohacz J, Kowalska TK. Species diversity of keratinophilic fungi in various soil types. Cent Eur J Biol. 2012;7:259-66.

7. Böhme H, Ziegler W. The distribution of geophilic dermatophytes and other keratinophilic fungi in relation to the pH of the soil. Mycopathol Mycol Appl. 1969;38:247-55.

8. Fischman O, Ramos CD. Geophilic dermatophytes recovered from Rio Grande do Sul soil. Mycopathol Mycol Appl. 1967;33:157-60.

9. Ganaie MA, Sood S, Rizvi G, Khan TA. Isolation and identification of keratinophilic fungi from different soil samples in Jhansi city (India). Plant Pathol J. 2010;9:194-7.

10. Goulart EG, Lima SMF, Carvalho MA, Oliveira JA, Jesus MM, Campos RE, et al. Isolamento de fungos patogênicos do solo no município do Rio de Janeiro, RJ, Brasil. Folha Méd. 1986;93:15-20.

11. Hayashi N, Toshitani S. Human infections with Microsporum gypseum in Japan. Mykosen. 1983;26:337-45.

12. Hoog GS, Guarro J, Figueras MJ. Atlas of clinical fungi. 2nd ed. Utrecht: Centraalbureau voor Schimmelcultures; 2000. 1126p.

13. Iovannitti CA, Malliarchuk O, Casanova A, Dawson M. Estudio micológico en muestras de tierra de la ciudad de la Plata. Rev Argent Micol. 1985;8:9-11.

14. Jain N, Sharma M. Distribution of dermatophytes and other related fungi in Jaipur city, with particular reference to soil pH. Mycoses. 2011;54:52-8.

15. Kaul S, Sumbali G. Impact of some ecological factors on the occurrence of poultry soil-inhabiting keratinophiles. Mycopathologia. 1998;143:155-9.

16. Leal AFG, Macêdo DPC, Laranjeira D, Souza-Motta CM, Fernandes MJS, Magalhães OMC, et al. Correlação epidemiológica entre fungos queratinofílicos isolados do solo e agentes de dermatomicoses. Rev Soc Bras Med Trop. 2009;42:471-3.

17. Lee MJ, Park JS, Chung H, Jun JB, Bang YJ. Distribuition of soil keratinophilic fungi isolated in summer beaches of the east sea in Korea. Korea J Med Mycol. 2011;16:44-50.

18. Lima OE, Pontes ZBVS, Oliveira NMC, Carvalho MFFP, Guerra MFL, Santos JP. Freqüência de dermatofitoses em João Pessoa, Paraíba, Brasil. An Bras Dermat. 1999;74:127-32.

19. López Martínez R. Investigación de algunas fuentes de infección en las dermatofitoses: estudio de suelos, animales y hombre. Gac Méd Méx. 1986;122:167-72.

20. Mahmoudabadi AZ, Zarrin M. Isolation of dermatophytes and related keratinophilic fungi from the two public parks in Ahvaz. Jundishapur J Microbiol. 2008;1:20-3.

21. Mangiaterra ML, Alonso JM. Keratinophilic fungi in soils of Corrientes city (Argentina). Bol Micol. 1989;4:129-33.

22. Norusis MJ. SPSS for Windows-Base System User’s Guide, Release 13.0. Chicago: SPSS.

23. Ogbonna CI, Pugh GJ. Keratinophilic fungi from Nigerian soil. Mycopathologia. 1987;99:115-8.

24. Oyeka CA, Okoli I. Isolation of dermatophytes and non-dermatophytic fungi from soil in Nigeria. Mycoses. 2003;46:336-8.

25. Papini R, Mancianti F, Grassotti G, Cardini G. Survey of keratinophilic fungi isolated from city park soils of Pisa, Italy. Mycopathologia. 1998;143:17-23.

26. Pontes ZBVS, Oliveira AC. Dermatophytes from urbain soils in João Pessoa, Paraíba, Brazil. Rev Arg Microbiol. 2008;40:161-3.

27. Rebell G, Taplin D. Dermatophytes: their recognition and identification. Coral Gables; University of Miami; 1974.

28. Rodriguez JL. Atlas escolar da Paraíba. 3. ed. João Pessoa: Grafiset; 2002.

29. Rogers AL, Beneke EJ. Human pathogenic fungi recovered from Brazilian soil. Mycopathol Mycol Appl. 1964;22:15-20.


383

30. Shadzi S, Chadeganipour M, Alimoradi M. Isolation of keratinophilic fungi from elementary schools and public parks in Isfahan, Iran. Mycoses. 2002;45:496-9.

31. Sharma M. Incidence of dermatophytes and other keratinophilic fungi in the schools and college playground soils of Jaipur, India. Afr J Microbiol Res. 2010;4:2647-54.

32. Silva ME. Ocorrência de Cryptococcus neoformans e Microsporum gypseum em solos da Bahia, Brasil. Bol Fund Gonçalo Moniz. 1960;17:1-14.

33. Vanbreuseghem R. Technique biologique pour l’isolement des dermatophytes de sol. Ann Soc Belge Méd Trop. 1952;32:173-8.

34. Vilela EM, Moraes MAP. Isolamento de Microsporum gypseum e Trichophyton mentagrophytes no solo da cidade de Manaus, Amazonas (Brasil). Rev Inst Med Trop Sao Paulo. 1962;4:299-301.

35. Zampronha VCC, Oliveira IP, Monteiro MSR, Souza H, Santos KJG, Araújo AA. Isolamento e identificação de dermatófitos presentes no contínuo do solo de cerrado do campus II da Universidade Católica de Goiás. Rev Eletrôn Fac Montes Belos. 2005;1:37-46.

Received: 16 January 2012Accepted: 28 March 2013

Revista do Instituto de Medicina Tropical de São Pauloon line.

Publications from 1987 to the present data are now available on:http://www.scielo.br/rimtsp

PAST ISSUES 1959-1989 (PDF)www.imt.usp.br/portal/

SciELO – The Scientific Electronic Library OnLine - SciELO is an electronic virtual covering a selected collection of Brazilian scientific journals. The library is an integral part of a project being developed by FAPESP – Fundação de Amparo à Pesquisa do Estado de São Paulo, in partnership with BIREME – the Latin American and Caribbean Center on Health Sciences Information. SciELO interface provides access to its serials collection via an alphabetic list of titles or a subject index or a search by word of serial titles, publisher names, city of publication and subject. The interface also provides access to the full text of articles via author index or subject index or a search form on article elements such as author names, words from title, subject and words from full text.

FAPESP/BIREME Project on Scientific Electronic PublicationsLatin American and Caribbean Center on Health Sciences Information

Rua Botucatu 862 – 04023-901 São Paulo, SP – BrazilTel. (011) 5576-9863

[email protected]


(1) Laboratory of Medical Mycology, Department of Clinical Analysis and Biomedicine.(2) Laboratory of Cell Biology, Department of Cell Biology and Genetics. State University of Maringa, Parana,Brazil.Correspondence to: Terezinha Inez Estivalet Svidzinski, Departmento de Análises Clínicas e Biomedicina, Universidade Estadual de Maringá, Av. Colombo 5790, sala 203, Bloco T20,

87020-900 Maringá, PR, Brasil. Phone: +55 44 3011 48 09, FAX: +55 44 3011 49 59. E-mail: [email protected]

MOLECULAR TYPING OF Candida albicans ISOLATES FROM HOSPITALIZED PATIENTS

Patrícia de Souza BONFIM-MENDONÇA(1), Adriana FIORINI(1), Cristiane Suemi SHINOBU-MESQUITA(1), Lilian Cristiane BAEZA(1), Maria Aparecida FERNANDEZ(2) & Terezinha Inez Estivalet SVIDZINSKI(1)

SUMMARY

Introduction: The majority of nosocomial fungal infections are caused by Candida spp. where C. albicans is the species most commonly identified. Molecular methods are important tools for assessing the origin of the yeasts isolated in hospitals. Methods: This is a study on the genetic profiles of 39 nosocomial clinical isolates of C. albicans using two typing methods: random amplified polymorphic DNA (RAPD) and microsatellite, two different primers for each technique were used. Results: RAPD provided 10 and 11 different profiles with values for S

AB of 0.84 ± 0.126 and 0.88 ± 0.08 for primers M2 and P4, respectively. Microsatellite using

two markers, CDC3 and HIS3, allowed the observation of six and seven different alleles, respectively, with combined discriminatory power of 0.91. Conclusions: Although genetic variability is clear, it was possible to identify high similarity, suggesting a common origin for at least a part of isolates. It is important to emphasize that common origin was proven from yeasts isolated from colonization (urine, catheter or endotracheal secretions) and blood culture from the same patient, indicating that the candidemia must have started from a site of colonization. The combination of RAPD and microsatellite provides a quick and efficient analysis for investigation of similarity among nosocomial isolates of C. albicans.

KEYWORDS: Candida albicans; Microsatellite; RAPD; Nosocomial infection.

INTRODUCTION

The incidence of fungal infections in hospitals is increasing substantially in different parts of the world. This is due, among other factors, to the increase of immunocompromised patients undergoing invasive treatments and prolonged hospital stay27. Candida spp. is the most frequent genus of fungal infections, in the U.S. it is the fourth agent of bloodstream infections, which are considered severe and with attributed mortality rates of 30-60%4,8,18. In Brazil, the incidence of candidemia in teaching hospitals is of 2.49 cases per 1,000 admissions14, which represents the values 6.6-12.5 times higher than those reported in some European countries14. C. albicans is still the most frequently isolated species of both superficial and invasive infections in Brazil as well as in the world3,9.

Despite the evidence for transmission of Candida spp. by direct or indirect contact and evidence of cross-infection by health care workers, little is known about the origin of clinical isolates of C. albicans. Information on molecular epidemiology has great relevance for the clinical management, treatment and epidemiology of recurrent infections, especially among critically ill patients10,11,30. This context led to the proposal of a variety of molecular typing techniques aiming at distinguishing isolates of Candida spp. from different sources. Among others, the best known are: multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE), duplex PCR, restriction fragment length

polymorphisms (RFLP), randomly amplified polymorphic DNA (RAPD) and microsatellites5,13,21,26,31,34,38.

The microsatellite analysis is a technique which has been recently used for genotyping C. albicans1,6,7. It is formed by short tandem repeats of two to six nucleotides known to be highly polymorphic, generating a characteristic profile of different alleles for a given locus. Due to its high discriminatory potential, this approach allows studies of nosocomial transmission routes6,32,33. Microsatellite has been used to investigate the molecular profile of C. albicans from healthy individuals15, HIV sero-positive26 and with recurrent vulvovaginal candidiasis32.

Among the currently available to C. albicans genotyping techniques, RAPD is relatively cost-effective and it offers similar resolving power to electrophoretic karyotyping. These characteristics together with dendrograms of genetic relatedness among C. albicans isolates has significantly advanced lineage studies over progressive infective episodes or during asymptomatic carriage16,36. In addition, RAPD has been used to investigate infections caused by identical or similar strains35, emergence of resistance strains during antifungal therapy20,26, colonization patterns of yeast strains in different clinical situations, and microevolution of strains within a particular species20.

Thus, the aim of this study was to determine the genetic relatedness

BONFIM-MENDONÇA, P.S.; FIORINI, A.; SHINOBU-MESQUITA, C.S.; BAEZA, L.C.; FERNANDEZ, M.A. & SVIDZINSKI, T.I.E. - Molecular typing of Candida albicans isolates from hospitalized patients. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 385-91, 2013.

386

of C. albicans from hospitalized patients by using the RAPD and microsatellites assays.


Microorganisms: A total of 39 strains of C. albicans isolated from different sources of patients hospitalized at University Hospital of Maringa in 2009, were used in this study. The yeasts were screened in chromogenic media CHROMagar® Candida and identified by conventional phenotypic methods (germ tube, microculture in cornmeal agar supplemented with 1% Tween 80, auxanogram and zymogram test)39.

Yeasts were taken from the following sources: urine 51.5% (N = 20), blood 20.5% (N = 8), catheter tip 15.5% (N = 6), orotracheal discharge 10% (N = 4) and peritoneal fluid 2.5% (N = 1). Regarding hospital sectors, 49% (N = 19) were isolated from adult Intensive Care Unit (ICU), 18% (N = 7) medical clinic, 13% (N = 5) pediatrics, 7.5% (N = 3) Neonatal Intensive Care Unit (NICU), 5% (N = 2) surgical clinic and 7.5% (N = 3) pediatric ICU.

DNA Extraction: The yeast strains were grown overnight at 25 °C using Sabouraud Dextrose Broth (SDB, Difco, USA) and genomic DNA extracted as described by CHONG et al.12. The concentration (260 nm) and purity (260/280) of the genomic DNA obtained were determined by optical density in a spectrophotometer, the visualization was made out in agarose gel at 0.7% with 1X TBE buffer (Tris-base 90 mmol l-1, Boric acid 90 mmol l-1, EDTA 2 mmol l-1 pH 8.0).

Nested-PCR: Identification of yeasts was confirmed by Nested-PCR which comprised two amplification stages, according to LUO & MITCHELL23. Briefly, primers that amplified Internal Transcribed Spacer (ITS) fragments of DNAr and identified the genus Candida were used in the first reaction. Amplification of species specific primers was used in the second reaction.

RAPD (Random Amplified Polymorphic DNA): RAPD was performed using the kit Ready-To-Go RAPD Analysis Beads® (Amersham Biosciences Corporation, Piscataway, NJ, USA) as described by the manufacturer. The RAPD reactions were performed by adding 30 ng of genomic DNA, one µmol l-1 oligonucleotide and water for a final volume of 25 µL to each tube containing Ready-To-Go beads. The oligonucleotides used were M2 (5’-CTTGATTGCC-3’)25 and P4 (5’-AAGAGCCCGT-3’ - Analysis Kit Ready-To-Go/RAPD Beads). The reaction was conducted in a in a Eppendorf Mastercycler Gradient Thermocycler® as follows: 95 °C for five min, followed by 45 cycles consisting of 95 °C for one min,

36 °C for one min and 72 °C for five min. Control tubes without template DNA were included in each run and reproducibility of the method was checked by repeating the amplification using different DNA extractions from two isolates and at least three different days.

The PCR products were electrophoresed in 2% agarose gel (w/v) in 1X TBE buffer at 150 volts for three hours. Amplicons in the gel were stained with ethidium bromide (0.5 mg mL-1) and visualized under UV transillumination (UVP Bioimaging Systems, Upland, CA®). The RAPD profiles were analyzed using Bionumerics® software version 4.6 (Applied Maths®).

The similarity was verified by the coefficient (SAB

) between each pair of standards for A and B isolates and calculated with the formula S

AB = 2E / (2E + a + b), where E is the number of common bands in

the patterns A and B, a is the number of bands with an a pattern and no B correlated patterns, and b is the number of bands with B pattern and no correlation in pattern A. From the similarity matrix, the units were grouped by UPGMA (Unweighted Pair-Group Method with Arithmetical Average). An S

AB value of 1.00 indicates that the pattern of bands for line

A is identical to B; values between 0.80 to 0.99 represent very similar clinical isolates but not identical, and may suggest microevolution of a single strain; S

AB values less than 0.80 represent independent lines12.

Microsatellites: Samples were genotyped using two microsatellite markers, CDC3 and HIS3, whose primer sequences were shown in Table 1, and all technical procedure was performed as described by BOTTEREL et al.7. The amplification products were analyzed by electrophoresis in polyacrylamide gel at 8% (w/v) in 1X TBE buffer for five hours at 140 volts. For the determination of the sizes of the fragments we used the molecular size marker 25 bp (Invitrogen®). After the run, the gel was stained with ethidium bromide (0.5 mg mL-1) and photodocumented under UV transillumination (UVP Bioimaging Systems, Upland, CA®). The size of the amplified fragments was determined by image analysis software LabImage 1D (Loccus Biotech®).

The results were expressed according to the tested locus name and size of the two alleles observed in base pairs. The reproducibility of this step was ensured by the inclusion of analysis of a strain of C. albicans ATCC 38696 which provided repeatable and consistent results with those obtained by BOTTEREL et al.7.

RESULTS

Analysis by Nested-PCR: Amplifications with primers ITS1/ITS4

Table 1Primers used for genotyping of C. albicans isolates by Microsatellite and RAPD

Locus (GenBank access number), chromosome Primer Nucleotide sequence (forward and reverse)

Microsatellite

CDC3 (Z25869), chromosome 1 CDC35’-CAGATGATTTTTTGTATGAGAAGAA-3’5’-CAGTCACAAGATTAAAATGTTCAAG-3’

HIS3 (AF006605), chromosome 2 HIS35’-TGGCAAAAATGATATTCCAA-3’5’-TACACTATGCCCCAAACACA-3’

RAPD- P4 5’-AAGAGCCCGT-3’

- M2 5’-CTTGATTGCC-3’


387

resulted in patterns of bands with 500 bp identifying Candida spp. The species-specific primers provided amplification of fragments with approximately 272 bp, thus confirming the classic identification that the isolated are indeed C. albicans species.

RAPD profiles: Analysis using primer M2 demonstrated the formation of 10 profiles with values of 0.84 ± 0.126 for S

AB (Fig. 1). Three

groups (I, II and III) were formed with 67% similarity between them. Group I consisted of four subgroups (IA, IB, IC and ID), which clustered approximately 70% of the isolates with similarity of 80%. Primer P4 generated 11 different profiles, with a S

AB value of 0.88 ± 0.08. There

was the formation of only one cluster, containing 95% of the isolates with approximately 85% similarity (Fig. 2).

Microsatellites: For all isolates tested we obtained products characteristic of microsatellite amplification. One or two PCR fragments by locus were produced for each isolate, since C. albicans is diploid, and each fragment was defined as an allele. The observed differences in size of alleles are attributed to the different numbers of repeats of microsatellites. The strains with two PCR products were typed as heterozygous, while those who had a single amplification product were considered homozygous.

The analysis of independent 39 isolates showed that all microsatellite loci were polymorphic, evidencing between six and seven alleles, and eight and nine different genotypes for the CDC3 and HIS3 primers respectively (Table 2). The discriminatory power (DP) was calculated for each marker according to the Simpson index:

where N is the number of strains, s is the total number of different genotypes, and nj is the number of strains of genotype j22. The results showed that CDC3 was the microsatellite with the highest DP value (0.85), while HIS3 presented the lowest DP value (0.90). When the two markers are combined, the DP was 0.91. An index over or greater than 0.90 is desirable if the typing results are to be interpreted with confidence22.

The 39 samples were recovered from 34 patients because in five of them the same species was isolated from two different sites. A comparison of the genetic profile by microsatellite and RAPD (Table 3) showed total identity between these pairs.

Fig. 2 - Dendrogram generated from the amplification by primer P4 and by UPGMA grouping,

in which SAB

was calculated by the coefficient of Dice for 39 C. albicans isolates. Vertical line

divides dendrogram as from 80% similarity level, in which Group I gathers 95% of samples.

In the samples identification the equal number and different letter mean same patient. SC:

Surgery clinic; aICU: adult ICU; pICU: pediatry ICU; nICU: neonatal ICU; MC: Medical

clinic; Ped: Pediatrics.

Fig. 1 - Dendrogram generated by amplification of primer M2 and by UPGMA grouping, in

which SAB

was calculated by the coefficient of Dice for 39 C. albicans isolates. Vertical line

divides dendrogram as from the 80% similarity level; the four sub-groups (IA, IB, IC and ID)

gather almost 70% of samples. In the samples identification the equal number and different

letter mean same patient. SC: Surgery clinic; aICU: adult ICU; pICU: pediatry ICU; nICU:

neonatal ICU; MC: Medical clinic; Ped: Pediatrics.


388

Table 2Origin of 39 Candida albicans isolates and their respective genotypes determined by microsatellite analysis

SamplesOrigin of isolates Primer CDC3 Primer HIS3

N GenotypesH. U. Source

Allele 1(bp)

Allele 2(bp)

Allele 1(bp)

Allele 2(bp)

2A SC Blood 129 125 150 1942 A

2B aICU TOT 129 125 150 194

07 aICU Catheter tip 121 117 154 154 1 B

3B pICU Catheter tip 129 125 150 1622 C

3A pICU Blood 129 125 150 162

08 aICU Catheter tip 125 117 162 162

9 D

11 nICU Blood 125 117 162 162

32 MC Urine 125 117 162 162

33 aICU Urine 125 117 162 162

20 Pediatrics Catheter tip 125 117 162 162

34 aICU TOT 125 117 162 162

21 aICU Urine 125 117 162 162

19 aICU Urine 125 117 162 162

10 nICU Blood 125 117 162 162

1B Pediatrics Catheter tip 137 121 158 162

6 E

23 MC Urine 137 121 158 162

30 MC Urine 137 121 158 162

14 aICU Urine 137 121 158 162

15 aICU Urine 137 121 158 162

1A Pediatrics Blood 137 121 158 162

4A MC Blood 129 121 158 158

4 F4B MC Urine 129 121 158 158

5B aICU Catheter tip 129 121 158 158

5A aICU TOT 129 121 158 158

09 aICU Blood 117 113 150 1622 G

13 aICU Peritoneal fluid 117 113 150 162

31 aICU Urine 121 121 154 1742 H

06 nICU Blood 121 121 154 174

22 MC Urine 121 117 166 1662 I

12 aICU TOT 121 117 166 166

17 aICU Urine 125 125 166 166 1 J

16 aICU Urine 125 125 162 1622 K

18 aICU Urine 125 125 162 162

25 pICU Urine 129 121 150 150 1 L

24 MC Urine 129 121 162 162

5 M

28 aICU Urine 129 121 162 162

29 aICU Urine 129 121 162 162

27 SC Urine 129 121 162 162

26 aICU Urine 129 121 162 162

SC: Surgery clinic; aICU (Intensive Care Unit): adult ICU; pICU: pediatric ICU; nICU: neonatal ICU; MC: medical clinic. N: number of genotype. H.U.: Hospital Unit; TOT: endotracheal aspirate.


389

DISCUSSION

RAPD and microsatellite analysis were able to show similarity among C. albicans isolates recovered from a hospital. Microsatellite analysis supplied a good DP with markers used, it allowed formation of various genotypes grouping samples, confirming the similarity between them, which reinforces the interpretation of the data found in RAPD. Additionally, it was possible to prove the high similarity (100%) of the same yeast which was from colonization (urinary catheter, tracheal secretions) and later detected in blood cultures from the same patient.

The RAPD results showed SAB

values of 0.84 ± 0.126 for the primer M2 and S

AB 0.88 ± 0.08 for P4 (Fig. 1 and 2). It is important to highlight

that the strains that are considered identical by a primer are not always necessarily also considered identical or belong to the same cluster when analyzed by another primer. This should be referred as a limitation of the technique, nevertheless according to CHONG et al.12 the values found, in RAPD, indicate high similarity between the isolates.

In microsatellite analysis we were able to verify the presence of six different alleles with the primer CDC3 and seven alleles with primer HIS3, of which 113bp, 117bp, 125bp, 150bp, 154bp, 158bp and 162bp have already been recognized by other authors1,6,7. These primers amplify microsatellite regions highly polymorphic for C. albicans. Moreover, these regions are stable over generations and were chosen because they are located on different chromosomes, which increase the chances of finding polymorphisms7. The discriminatory power (DP) found using markers CDC3 and HIS3, was 0.85 and 0.90 respectively. These results and especially the combined value of DP (0.91) are considered by several authors as reliable studies of molecular typing7,22. The data presented in Table 2 show the prevalence of genotypes (D, E, F, M), however, there is no relation with sites of isolation of yeasts. This type of observation has already been described in another study using the same genotyping technique2. Finally, by putting together epidemiological data (Fig. 1 and 2, Table 2), it is possible to observe the formation of groups with high

similarity (90-100%). These are mostly from patients hospitalized in ICU where the evidence of common origin is of great importance. According to AL-KARAAWI et al.2, the clinical isolates of C. albicans tend to be genetically similar to each other if they were isolates from patients with a similar profile, as those interned in ICU. CHAVES et al.10 recently showed that candidemic patients had highly related microsatellites genotype in colonizing and bloodstream isolates. However, it should be noted that the detection of yeasts highly similar in our study was not associated with hospital unit. The same profile was found in various hospital areas such as pediatric and internal medicine. These data reinforce that most C. albicans infections are from endogenous sources. They should also suggest that these strains may be circulating in the various units, but not characterizing the occurrence of outbreaks.

Although the infection of different patients from different sectors with yeasts of the same genetic profile insinuates cross-transmission17,19, high similarity among samples suggests an adaptation to the environmental conditions, thus characterizing microevolutions28. Five (14.70%) of all patients enrolled in this study are particularly interesting since C. albicans were isolated from different sites. In all cases the analysis confirmed that the clinical isolates were identical to each other (Table 3) indicating the migration of yeasts from colonization (urine catheters, tracheal secretion) into the blood, suggesting the source of systemic infection. This result indicates that each isolated pair has genotypic identity, suggesting clonal origin. This fact has been demonstrated by molecular typing, in several studies10,24,29,37 and helps confirm that previous colonization is an important predisposing factor for systemic infection.

Despite the small number of samples analyzed, this study contributes with the understanding on epidemiology of fungal infections in hospitals. The analyzed data allow us to conclude that both techniques generated reproducible profiles showing similarity among the isolates. These techniques are suitable for epidemiological molecular studies of C. albicans and can be applied in larger populations. The good performance of these techniques allows its use for genotyping of outbreaks of hospital

Table 3 Similarity by Random Amplified Polymorphic DNA and genotype by Microsatellite of Candida albicans isolated in two sources from a same patient

Patient Source

Genotype RAPD

CDC3(bp)

HIS3(bp)

SAB

Primer M2 SAB

Primer P4

11B– Catheter tip 137:121 158:162 1.00 1.00

1A – Blood 137:121 158:162 1.00 1.00

22B – TOT 129:125 150:194 1.00 1.00

2A – Blood 129:125 150:194 1.00 1.00

33B – Catheter tip 129:125 150:162 1.00 1.00

3A – Blood 129:125 150:162 1.00 1.00

44B – Urine 129:121 158:158 1.00 1.00

4A – Blood 129:121 158:158 1.00 1.00

55A – TOT 129:121 158:158 1.00 1.00

5B – Catheter tip 129:121 158:158 1.00 1.00

TOT: endotracheal aspirate.


390

origin or not, and characterization of isolates from different sites, including recurrent infections such as vulvovaginal candidiasis and investigations before and after treatments. Knowledge of the relationship of clinical isolates involved in infections is extremely important for the development and application of the correct therapeutic strategy and to better understand the epidemiology of these infections.

RESUMO

Tipagem molecular de Candida albicans isoladas de pacientes hospitalizados

Introdução: A maioria das infecções fúngicas hospitalares são causadas por Candida spp. e C. albicans é a espécie mais comumente identificada. Métodos moleculares são ferramentas importantes para a avaliação da origem das leveduras isoladas em hospitais. Métodos: Este é um estudo sobre o perfil genético de 39 isolados clínicos nosocomiais de C. albicans através das técnicas de RAPD e microssatélite, foram usados dois diferentes iniciadores para cada técnica. Resultados: RAPD forneceu 10 e 11 diferentes perfis com valores de SAB 0,84 ± 0,126 e 0,88 ± 0,08 para os primers M2 e P4, respectivamente. A análise de microssatélites, usando os marcadores CDC3 e HIS3 permitiu a observação de seis e sete diferentes alelos respectivamente, com poder discriminatório combinado de 0,91. Conclusões: Embora seja clara a variabilidade genética, foi possível identificar alta similaridade, sugerindo origem comum para pelo menos parte deles. É importante enfatizar que foi comprovada origem comum de leveduras isoladas de colonização (urina, cateter ou secreção orotraqueal) e hemocultura do mesmo paciente, indicando que a candidemia deve ter iniciado a partir de um sítio de colonização. A combinação das técnicas RAPD e microssatélites fornece uma análise rápida e eficiente para investigação de similaridade entre isolados nosocomiais de C. albicans.

REFERENCES

1. Adachi H, Shimizu K, Hattori H, Tanaka R, Chibana H, Takagi Y, et al. Genotyping of Candida albicans by fragment analysis of microsatellites combined with 25S rDNA and RPS-based strategies. Nihon Ishinkin Gakkai Zasshi. 2009;50:167-74.

2. Al-Karaawi ZM, Manfredi M, Waugh ACW, McCullough MJ, Jorge J, Scully C, et al. Molecular characterization of Candida spp. isolated from the oral cavities of patients from diverse clinical settings. Oral Microbiol Immunol. 2002;17:44-9.

3. Araújo SM, Fontes CJ, Leite Júnior DP, Hahn RC. Fungal agents in different anatomical sites in public health services in Cuiabá, state of Mato Grosso, Brazil. Rev Inst Med Trop Sao Paulo. 2012;54:5-10.

4. Asmundsdottir LR, Erlendsdottir H, Haraldsson G, Guo H, Xu J, Gottfredsson M. Molecular epidemiology of candidemia: evidence of clusters of smoldering nosocomial infections. Clin Infect Dis. 2008;47:17-24.

5. Ben Abdeljelil J, Saghrouni F, Emira N, Valentin-Gomez E, Chatti N, Boukadida J, et al. Molecular typing of Candida albicans isolates from patients and health care workers in a neonatal intensive care unit. J Appl Microbiol. 2011;111:1235-49.

6. Beretta S, Fulgencio JP, Enache-Angoulvant A, Bernard C, El Metaoua S, Ancelle T, et al. Application of microsatellite typing for the investigation of a cluster of cases of Candida albicans candidaemia. Clin Microbiol Infect. 2006;12:674-6.

7. Botterel F, Desterke C, Costa C, Bretagne S. Analysis of microsatellite markers of Candida albicans used for rapid typing. J Clin Microbiol. 2001;39:4076-81.

8. Bougnoux ME, Kac G, Aegerter P, d’Enfert C, Fagon JY, CandiRea Study Group. Candidemia and candiduria in critically ill patients admitted to intensive care units in France: incidence, molecular diversity, management and outcome. Intensive Care Med. 2008;34:292-9.

9. Chang MR, Correia FP, Costa LC, Xavier PCN, Palhares DB, Taira DL, et al. Candida bloodstream infection: data from a teaching hospital in Mato Grosso do Sul, Brazil. Rev Inst Med Trop Sao Paulo. 2008;50:265-8.

10. Chaves GM, Santos FP, Colombo AL. The persistence of multifocal colonisation by a single ABC genotype of Candida albicans may predict the transition from commensalism to infection. Mem Inst Oswaldo Cruz. 2012;107:198-204.

11. Chong PP, Abdul Hadi SR, Lee YL, Phan CL, Tan BC, Ng KP, et al. Genotyping and drug resistance profile of Candida spp. in recurrent and one-off vaginitis, and high association of non-albicans species with non-pregnant status. Infect Genet Evol. 2007;7:449-56.

12. Chong PP, Lee YL, Tan BC, Ng KP. Genetic relatedness of Candida strains isolated from women with vaginal candidiasis in Malaysia. J Med Microbiol. 2003;52:657-66.

13. Chávez-Galarza J, Pais C, Sampaio P. Microsatellite typing identifies the major clades of the human pathogen Candida albicans. Infect Genet Evol. 2010;10:697-702.

14. Colombo AL, Nucci M, Park BJ, Nouér SA, Arthington-Skaggs B, Da Matta DA, et al. Epidemiology of candidemia in Brazil: a nationwide sentinel surveillance of candidemia in eleven medical centers. J Clin Microbiol. 2006;44:2816-23.

15. Dalle F, Dumont L, Franco N, Mesmacque D, Caillot D, Bonnin P, et al. Genotyping of Candida albicans oral strains from healthy individuals by polymorphic microsatellite locus analysis. J Clin Microbiol. 2003;41:2203-5.

16. Dassanayake RS, Samaranayake LP. Amplification-based nucleic acid scanning techniques to assess genetic polymorphism in Candida. Crit Rev Microbiol. 2003;29:1-24.

17. De Pinho Resende JC, Franco GR, Rosa CA, Hahn RC, Hamdan JS. Phenotypic and genotypic identification of Candida spp. isolated from hospitalized patients. Rev Iberoam Micol. 2004;21:24-8.

18. DiNubile MJ, Lupinacci RJ, Strohmaier KM, Sable CA, Kartsonis NA. Invasive candidiasis treated in the intensive care unit: observations from a randomized clinical trial. J Crit Care. 2007;22:237-44.

19. Eggimann P, Garbino J, Pittet D. Epidemiology of Candida species infections in critically ill non-immunosuppressed patients. Lancet Infect Dis. 2003;3:685-702.

20. Enger L, Joly S, Pujol C, Simonson P, Pfaller M, Soll DR. Cloning and characterization of a complex DNA fingerprinting probe for Candida parapsilosis. J Clin Microbiol. 2001;39:658-69.

21. Ge SH, Xie J, Xu J, Li J, Li DM, Zong LL, et al. Prevalence of specific and phylogenetically closely related genotypes in the population of Candida albicans associated with genital candidiasis in China. Fungal Genet Biol. 2011;49:86-93.

22. Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J Clin Microbiol. 1988;26:2465-6.

23. Luo G, Mitchell TG. Rapid identification of pathogenic fungi directly from cultures by using multiplex PCR. J Clin Microbiol. 2002;40:2860-5.

24. Marco F, Lockhart SR, Pfaller MA, Pujol C, Rangel-Frausto MS, Wiblin T, et al. Elucidating the origins of nosocomial infections with Candida albicans by DNA fingerprinting with the complex probe Ca3. J Clin Microbiol. 1999;37:2817-28.

25. Melo AS, de Almeida LP, Colombo AL, Briones MR. Evolutionary distances and identification of Candida species in clinical isolates by randomly amplified polymorphic DNA (RAPD). Mycopathologia. 1998;142:57-66.


391

26. Metzgar D, Van Belkum A, Field D, Haubrich R, Wills C. Random amplification of polymorphic DNA and microsatellite genotyping of pre-and posttreatment isolates of Candida spp. from human immunodeficiency virus-infected patients on different fluconazole regimens. J Clin Microbiol. 1998;36:2308-13.

27. Patterson TF. Advances and challenges in management of invasive mycoses. Lancet. 2005;366:1013-25.

28. Pires-Gonçalves RH, Miranda ET, Baeza LC, Matsumoto MT, Zaia JE, Mendes-Giannini MJS. Genetic relatedness of commensal strains of Candida albicans carried in the oral cavity of patients’ dental prosthesis users in Brazil. Mycopathologia. 2007;164:255-63.

29. Pittet D, Monod M, Suter PM, Frenk E, Auckenthaler R. Candida colonization and subsequent infections in critically ill surgical patients. Ann Surg. 1994;220:751-8.

30. Richards MJ, Edwards JR, Culver DH, Gaynes RP. Nosocomial infections in medical intensive care units in the United States. Crit Care Med. 1999;27:887-92.

31. Robles JC, Koreen L, Park S, Perlin DS. Multilocus sequence typing is a reliable alternative method to DNA fingerprinting for discriminating among strains of Candida albicans. J Clin Microbiol. 2004;42:2480-8.

32. Sampaio P, Gusmão L, Alves C, Pina-Vaz C, Amorim A, Pais C. Highly polymorphic microsatellite for identification of Candida albicans strains. J Clin Microbiol. 2003;41:552-7.

33. Sampaio P, Gusmão L, Correia A, Alves C, Rodrigues AG, Pina-Vaz C, et al. New microsatellite multiplex PCR for Candida albicans strain typing reveals microevolutionary changes. J Clin Microbiol. 2005;43:3869-76.

34. Schmid J, Tortorano AM, Jones G, Lazzarini C, Zhang N, Bendall M, et al. Increased mortality in young candidemia patients associated with presence of a Candida albicans general-purpose genotype. J Clin Microbiol. 2011;49:3250-6.

35. Shin JH, Kook H, Shin DH, Hwang TJ, Kim M, Suh SP, et al. Nosocomial cluster of Candida lipolytica fungemia in pediatric patients. Eur J Clin Microbiol. 2000;19:344-9.

36. Soll DR. The ins and outs of DNA fingerprinting the infectious fungi. Clin Microbiol Rev. 2000;13:332-70.

37. Tay ST, Na SL, Chong J. Molecular differentiation and antifungal susceptibilities of Candida parapsilosis isolated from patients with bloodstream infections. J Med Microbiol. 2009;58:185-91.

38. Vaz C, Sampaio P, Clemons KV, Huang YC, Stevens DA, Pais C. Microsatellite multilocus genotyping clarifies the relationship of Candida parapsilosis strains involved in a neonatal intensive care unit outbreak. Diagn Microbiol Infect Dis. 2011;71:159-62.

39. Yarrow D. Methods for the isolation, maintenance and identification of yeasts. In:. Kurtzman CP, Fell JW, editors. The yeast, a taxonomic study. New York: Elsevier; 1998. p. 77-100.

Received: 13 October 2012 Accepted: 9 April 2013

LIBRARY OF THE SÃO PAULO INSTITUTE OF TROPICAL MEDICINE

Website: www.imt.usp.br/portal Address: Biblioteca do Instituto de Medicina Tropical de São Paulo da Universidade de São Paulo

Av. Dr. Enéas de Carvalho Aguiar, 470. Prédio 1 – Andar térreo.05403-000 São Paulo, SP, Brazil.

Telephone: 5511 3061-7003 - Fax: 5511 3062-2174

The Library of the São Paulo Institute of Tropical Medicine (IMTSP Library) was created on January 15, 1959 in order to serve all those who are interested in tropical diseases. To reach this objective, we select and acquire by donation and / or exchange appropriate material to be used by researchers and we maintain interchange between Institutions thorough the Journal of the São Paulo Institute of Tropical Medicine, since the Library has no funds to build its own patrimony.

The IMTSP Library has a patrimony consisting of books, theses, annals of congresses, journals, and reference works.

The collection fo journals existing in the Library can be verified through the USP – Bibliographic Database – OPAC – DEDALUS http://dedalus.usp.br:4500/ALEPH/eng/USP/USP/DEDALUS/start of the USP network.


(1) Instituto de Medicina Tropical de São Paulo, São Paulo, SP, Brazil. E-mails: [email protected], [email protected], [email protected], [email protected], [email protected](2) Laboratório de Investigação Médica HC-FMUSP, São Paulo, SP, Brazil. (3) Departamento de Moléstias Infecciosas e Parasitárias, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP, Brazil. (4) Instituto de Infectologia Emílio Ribas, São Paulo, SP, Brazil. E-mails: [email protected]; [email protected] to: Marcela M. Satow, Instituto de Medicina Tropical de São Paulo, Av. Dr. Enéas de Carvalho Aguiar 500, 05403-000 São Paulo, SP, Brasil. E-mail: [email protected]

APPLICABILITY OF kDNA-PCR FOR ROUTINE DIAGNOSIS OF AMERICAN TEGUMENTARY LEISHMANIASIS IN A TERTIARY REFERENCE HOSPITAL

Marcela M. SATOW(1), Edite H. YAMASHIRO-KANASHIRO(1), Mussya C. ROCHA(1,2), Luiza K. OYAFUSO(4), Rita C. SOLER(4), Paulo C. COTRIM(1,2,3) & José Angelo L. LINDOSO(1,2,4)

SUMMARY

This study evaluated the applicability of kDNA-PCR as a prospective routine diagnosis method for American tegumentary leishmaniasis (ATL) in patients from the Instituto de Infectologia Emílio Ribas (IIER), a reference center for infectious diseases in São Paulo - SP, Brazil. The kDNA-PCR method detected Leishmania DNA in 87.5% (112/128) of the clinically suspected ATL patients, while the traditional methods demonstrated the following percentages of positivity: 62.8% (49/78) for the Montenegro skin test, 61.8% (47/76) for direct investigation, and 19.3% (22/114) for in vitro culture. The molecular method was able to confirm the disease in samples considered negative or inconclusive by traditional laboratory methods, contributing to the final clinical diagnosis and therapy of ATL in this hospital. Thus, we strongly recommend the inclusion of kDNA-PCR amplification as an alternative diagnostic method for ATL, suggesting a new algorithm routine to be followed to help the diagnosis and treatment of ATL in IIER.

KEYWORDS: American tegumentary leishmaniasis; Diagnostic; kDNA-PCR; Leishmania (Viannia) braziliensis.

INTRODUCTION

American tegumentary leishmaniasis (ATL) presents different clinical manifestations in Latin America, including mucosal leishmaniasis (ML), cutaneous localized leishmaniasis (CL), disseminated leishmaniasis (LCD), and diffuse leishmaniasis (DCL). These manifestations are caused by seven different species of Leishmania: Leishmania (Leishmania) amazonensis, L. (Viannia) braziliensis, L. (V.) guyanensis, L. (V.) lainsoni, L. (V.) naiffi, L. (V.) lindenberg, and L. (V.) shawi7,24. Currently, the diagnosis of ATL is based mainly on a clinical examination, epidemiological data, and complementary laboratory methods, including direct investigation (DI), Montenegro skin test (MST), and in vitro culture7. Nevertheless, these classical diagnostic methods are often time consuming; require an expert in microscopy; have low sensitivity and/or specificity and can be influenced by the age of infection and quality of sampling7. Furthermore, these methods are unable to differentiate between the seven species of parasite involved, which can be considered an important failure for the disease prognosis and choice of an appropriate treatment9,32. VOLPINI et al., 200441 described the potential of a PCR-RFLP method performed with primers specific for kinetoplast DNA (kDNA) of Leishmania genus, followed by HaeIII restriction enzyme digestion, for detection of L. (V.) braziliensis in infected DNA samples. This species is reported to be the major causative agent of ML in Latin America; and it is estimated that 3-5% of CL patients progress to ML form when infected with this species7. The specificity of these specific primers

for the Leishmania genus has been reported in previous studies and no cross-reaction was observed for paracoccidioidomycosis, histoplasmosis, cutaneous tuberculosis, and candidiasis3, squamous cell carcinoma, sporotrichosis, leprosy, lentigo, pyodermitis and vascular ulcer17.

The identification of L. (V.) braziliensis in ATL suspected patients is important for elaboration of accurate prognoses and adequate therapy to prevent the resurgence of lesions, and the progression of the disease7,24. Thus, the aim of this study was to evaluate the applicability of the kDNA-PCR followed by restriction enzyme analyze method for routine diagnosis of ATL at the IIER


Patients. The study was conducted on a convenience sample of 128 patients who attended the Instituto de Infectologia Emílio Ribas (IIER), São Paulo, Brazil from March 2007 to January 2012, with clinical signs and symptoms compatible with CL or ML. Cutaneous leishmaniasis was clinically suspected by the presence of ulcer, while mucosal leishmaniasis by the presence of nasal bleeding, drilling nasal septum or infiltrate in mucosal7,13,24. The results of the clinical examinations, Montenegro skin test, epidemiologic data, and administered drugs were obtained by reviewing the medical records. Collected samples from 128 lesions were transferred for our lab to be analyzed by Direct Investigation, in vitro culture and kDNA PCR.

SATOW, M.M.; YAMASHIRO-KANASHIRO, E.H.; ROCHA, M.C.; OYAFUSO, L.K.; SOLER, R.C.; COTRIM, P.C. & LINDOSO, J.A.L. - Applicability of kDNA-PCR for routine diagnosis of American tegumentary leishmaniasis in a tertiary reference hospital. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 393-9, 2013.

394

The study was approved by the Research Ethics Committee of IIER (Process number 326/2009), and by the Research Ethics Committee of the Instituto de Medicina Tropical de São Paulo (Process CEP-IMT 046/2009).

Montenegro skin test (MST). Montenegro skin test was performed by Instituto Adolfo Lutz, São Paulo - SP. The technique consists of application of 0.5 mL of antigen of L. (L) amazonensis (MHOM/BR/73/PH8), distributed by the Brazilian Ministry of Health. After 72 h the papule was measured using a ruler and the result is expressed in mm. It is considered positive if the test is higher than 5 mm10,31. The results of the MST were obtained by reviewing the medical records of the suspected ATL patients.

Direct investigation (DI). Lesion samples were obtained by biopsy after asepsis, and local anesthesia using a 4 mm diameter punch. The excess blood was removed from the samples and lesion imprints were collected on glass slides. After air drying, the slides were fixed in methanol, stained with Giemsa, and microscopically examined by two technicians. The results were based on the following criteria: the presence of typical Leishmania amastigotes indicated a positive result; the absence of amastigotes indicated a negative result; and the presence of atypical forms of parasite was considered to suggest a positive result.

In vitro culture and isolation of the parasites. Parts of the lesion samples were transferred to a plastic tube with a physiological salt solution with 100 U penicillin, 100 mg/mL streptomycin, and 50 µg/mL 5-fluorocytosine, and forwarded to the Instituto de Medicina Tropical (IMT-USP). Each sample was further divided for the in vitro culture of parasites and for the DNA extraction procedures. A fraction of the sample designated for parasite isolation was incubated in Media 199, (SIGMA, USA) with 10% fetal bovine serum at 26 °C in BOD and it was examined weekly for a month.

Reference strains. L. (V.) braziliensis (MHOM/BR/75/M2903), and L. (L.) amazonensis (IFLA/BR/67/PH8) promastigote forms were cultivated in Media 199 with 10% fetal bovine serum at 26 °C in BOD. The promastigotes were collected at the exponential growth phase with approximately 107 cells per mL (+/- 96 h).

DNA extraction. DNA extraction from tissue lesion samples from patients and promastigote reference strains was processed using the Wizard Genomic DNA Purification Kit (Promega, USA) following the manufacturer’s protocol. The quantification and quality control of the DNA extraction procedures were performed using a nano spectrophotometer (NanoDrop 1000, Thermo Fisher Scientific). All reactions were performed in appropriated places, following the good practice of laboratories to avoid sample contamination.

kDNA-PCR: The technique was performed based on the protocol described previously41 using the following primers that amplify a 120 bp fragment of the conserved region of a Leishmania kDNA minicircle: kDNA20 forward, 5’- GGG (G/T)AG GGG CGT TCT (G/C)CG AA- 3’, and kDNA22 reverse, 5’ (G/C)(G/C)(G/C) (A/T)CT AT(A/T) TTA CAC CAA CCC C- 3’. The reaction mixtures were prepared in a final volume of 20 µL that contained Taq DNA polymerase Buffer with KCl (10 mM Tris-HCl pH8.8, 50 mM KCl, and 0.08% (v/v) Nonidet P-40); 1.0 mM MgCl

2; 0.2 mM of each dNTP; 375 pM of each primer; 1 U

Taq DNA polymerase (recombinant) (Fermentas); and 4 µL (~ 200 ng) of DNA. Amplification was conducted using an MWG Biotech Model Primus 96 Plus Thermal Cycler with an initial denaturation step at 94 °C for four min, followed by 35 cycles at 94 °C for one min, 58 °C for one min, 72 °C for 30 s, and a final extension step at 72 °C for five min. The amplicons were visualized by electrophoresis on 2% agarose gels stained with ethidium bromide.

Positive controls that contained the DNA from the reference strains, and a negative control with no DNA were included in each reaction set. In addition, the samples that were negative according to kDNA-PCR protocol were submitted to PCR amplification with primers directed to human β-globin PCR1 to verify the quality of the DNA extraction procedure.

PCR-RFLP (kDNA- HaeIII): Finally, 10 µL microliters of the positive kDNA-PCR products were digested at 37 °C for three hours with 10 U of HaeIII enzyme (Fermentas), with specific buffer and deionized water, total volume of 15 µL, according to the manufacturer’s protocol. The restriction fragments were separated on a 10% polyacrylamide gel, and stained with ethidium bromide.

RESULTS

Analysis of the results of the traditional diagnosis methods. A total of 128 patients with clinically suspected ATL were enrolled in this study: 59 (46.1%) patients with a suspicious mucosal lesion (sML), and 69 (53.9%) patients with suspicious of cutaneous lesions (sCL). As a result of problems encountered during the data collection from medical records, which were often incomplete lacking important information, we were unable to get the results of the three traditional methods for routine diagnosis of all 128 patients. Then, tests were analyzed in the following frequencies: 89.1% by in vitro culture, 60.9% by MST, and 59.4% by DI, only kDNA-PCR was performed on all 128 collected samples (Table 1). As shown in Table 1, we observed that DI test was performed more frequently in sCL patients than for sML patients: 81.2% (56/69), and 33.9% (20/59), respectively. On the contrary, MST was performed on 71.2% (42/59) of the sML patients, and on 52.2% (36/69) of the sCL patients. The results of the DI, MST and in vitro tests were analyzed considering only the number of samples truly performed for each test (76/128 samples for DI, 78/128 for MST and 114/128 for culture (Table 1).

Evaluation of the efficiency of the kDNA-PCR method and traditional diagnostic methods. kDNA-PCR was performed on all 128 collected samples, and amplified Leishmania DNA was observed in 112/128 (87.5%) clinically suspected ATL samples (Table 1). The 16 remaining samples (12.5%) were considered negative after confirmation of DNA integrity by human β-globin PCR analysis. In addition, these samples were also negative for ATL according to the traditional methods, excluding one sample (Table 2).

Thus, we can conclude that kDNA-PCR was the most efficient test, with a positivity of 87.5%, followed by the MST with 62.8%, DI with 61.8%, and in vitro culture with 19.3%. We observed that the efficiency of DI, and MST methods was distinct for each clinical manifestation. DI test was 1.5 times more efficient for samples from sCL patients, than for samples from sML patients. The opposite was observed in the


395

MST results: an efficiency 1.5 times greater for sML patients (73.8% of positivity), than for sCL patients (50.0% of positivity).

For DI test and in vitro culture we respectively observed high frequencies of suggestive results (25.0%) and, contamination (36.0%) indicating the limitations of these techniques. Curiously, in vitro culture

contamination was 2.9 times more frequent in sML samples (30/55 or 54.5%) than in sCL samples (11/59 or 18.6%).

As only kDNA-PCR was performed on all collected samples, we can compare the efficiency of the three traditional diagnostic methods (DI test, MST and in vitro culture) with PCR. We can see in Table 2 that kDNA-PCR was able to detect the parasite in all samples that were positive for the DI test47, and for in vitro culture22. Surprisingly, from the 49 samples considered positive after the MST analysis, one was negative for kDNA-PCR (it was derived from a patient with chronic ATL presenting a recurrent lesion).

Besides that, we verified that the molecular method detected Leishmania DNA in 77 samples considered negative or contaminated by in vitro culture (41 and 36, respectively), and in the 20 samples considered negative or suggestive by the DI test (5 and 15, respectively). Interestingly, from the 29 samples considered negative by MST, 25 (or 86.2%) were positive after kDNA-PCR amplification (17 samples from sCL patients, and eight from sML patients - data not shown). From the 16 samples negative by kDNA-PCR, 15 present the same result when performed by traditional methods; just one sample presents different results for kDNA-PCR and MST, as discussed above.

The importance of the kDNA-PCR in the clinical practice. We divided the 128 DNA samples enrolled in this study into two groups: the confirmed ATL patients (CATL), that presented at least one positive result for traditional diagnosis tests (DI, MST or in vitro culture); and the non-confirmed ATL patients (NCATL), composed by samples with non positive results following the same traditional techniques (respectively with 83 and 45 DNA samples - Table 3). As expected, kDNA-PCR was able to detect parasite DNA in 98.8% of the DNA samples from the CATL group (82/83), where the diagnosis had been previously confirmed by a combination of the three traditional diagnostic methods. The exception was only the patient with chronic ATL with a recurrent lesion, already discussed. The importance of the kDNA-PCR amplification in the routine diagnosis becomes evident when we analyzed the results of the NCATL group. In this group of samples with negative results by the traditional diagnostic methods, kDNA-PCR was able to detect the parasite in 66.6% (or 30/45).

To better verify the acceptance of the kDNA-PCR results, we checked the physician follow-up through the analysis of the medical records. Out of 128 samples analyzed, only 92 records presented correct data on the conduct adopted by the physician. According to

Table 1Results of the four diagnostic methods performed with samples from patients with suspected ATL who attended the Instituto de Infectologia Emílio Ribas

(IIER) in São Paulo, Brazil

Clinical manifestationCutaneous Mucosal Total

N (%) N (%) N (%)

Patients 69 53.9% 59 46.1% 128

Direct investigation (76) Not performed (52)

Positive 38 67.9% 9 45.0% 47 61.8%

Negative 6 10.7% 4 20.0% 10 13.2%

Suggestive 12 21.4% 7 35.0% 19 25.0%

Total 56 20 76

Montenegro skin test (78)Not performed (50)

Positive (> 5 mm) 18 50.0% 31 73.8% 49 62.8%

Negative (< 5 mm) 18 50.0% 11 26.2% 29 37.2%

Total 36 42 78

In vitro culture (114)Not performed (14)

Positive 14 23.7% 8 14.5% 22 19.3%

Negative 34 57.6% 17 30.9% 51 44.7%

Contamination 11 18.6% 30 54.5% 41 36.0%

Total 59 55 114

kDNA-PCR (128)

Positive 61 88.4% 51 86.4% 112 87.5%

Negative 8 11.6% 8 13.6% 16 12.5%

Total 69 59 128

Table 2Comparison of the kDNA-PCR results with those obtained by the traditional diagnostic methods with samples from patients with suspected of cutaneous and

mucosal leishmaniasis*

kDNA-PCR

Traditional diagnostic methods

In vitro culture DI test MST

P N Cont. P N Sug. P N

Positive 22 (100%) 41 (80.4%) 36 (87.8%) 47 (100%) 5 (50%) 15 (78.9%) 48 (97.9%) 25 (86.2%)

Negative 0 10 (19.6%) 5 (12.2%) 0 5 (50%) 4 (21%) 1 (2%) 4 (13.8%)

kDNA-PCR: Polymerase chain reaction using specific primers for Leihmania’s kinetoplast DNA, DI test: Direct Investigation test, MST: Montenegro skin test. P: Positive result, N: Negative result; Sug.: Suggestive, Cont.: contamination. *The same sample could be analyzed by more than one diagnostic method.


396

the records, most of these patients, 95.7% (88/92), received specific treatment for ATL. Of these 88 treated patients, 18 were positive only by kDNA-PCR analysis, 63 presented a positive result in at least one of the traditional diagnostic methods (and also positive kDNA-PCR positive results), and seven patients were treated based exclusively on the clinical examination (when all diagnostic tests, including PCR, presented negative or inconclusive results). Interestingly, one of the seven treated patients that presented a negative result for kDNA-PCR, was later diagnosed as paracoccidioidomycosis, confirming the previous PCR result. Contrary, two patients from this same group responded clinically well to the ATL drug administration, besides the negative results in all diagnosis tests. No information concerning the response of treatment about the remaining four treated patients was found in the records. Overall, 3/92 patients were not treated even though they presented positive kDNA-PCR results (one patient presented positive results for both kDNA-PCR and MST). The remaining untreated patient was negative by kDNA-PCR analysis.

PCR-RFLP results. To verify the contribution of the PCR-RFLP method for identification of L. (V.) braziliensis, HaeIII restriction digestion was performed in all 112 amplification products of the kDNA-PCR reaction. We verified that 96/112 (or 85.7%) of these samples presented the two expected DNA fragments (80 bp and 40 bp), characteristic of the L. (V.) braziliensis electrophoresis pattern41 (Fig. 1, lanes 2 to 7). The frequency of L. (V.) braziliensis according to

the suspected clinical manifestation was 51/61(83.6%) in sCL samples, and 45/51(88.23%) in sML samples.

16/112 kDNA-PCR amplification products (10 from sCL samples and six from sML samples) did not present the cleavage of the 120 pb amplification product (Fig. 1, lane 1). Eight samples were from patients that have been in endemic regions of L. (L.) amazonensis: five from Bahia, one from Maranhão, one from Minas Gerais and one from Pernambuco, which can be an evidence of infection caused by this or other Leishmania species. One individual reported to have acquired the disease in Angola where L. (L.) infantum is the main specie that causes leishmaniasis, where specific zymodemes can be related with LC24. Four patients have not reported probable local of infection. The remaining three individuals indicated São Paulo and Paraná to be the local of infection, which are states where L. (V.) braziliensis was the only specie causative of human disease. This last result may indicate limitation of the PCR-RFLP or absence of correct information concerning the probable locals of infection.

DISCUSSION

This study evaluated the applicability and efficiency of PCR based on kDNA as a routine diagnostic method for ATL, comparing these results with the results of tests performed routinely for leishmaniasis diagnosis. The data that were obtained indicate that inclusion of the PCR-RFLP (kDNA-HaeIII) technique in the routine diagnosis of ATL would improve the accuracy of the diagnosis, support an appropriate prognosis, and ensure adequate treatment. Moreover, the data indicated that the kDNA-PCR results are in agreement with the clinical practice performance and confirmed the clinical findings (Table 3) that were negative according to the traditional methods (Table 2).

The higher efficiency of the kDNA-PCR method over the traditional methods for ATL diagnosis (Table 1) observed here is in agreement with the literature, which describes sensitivities that range from 75% - 98%, and it is attributed to the naturally amplified DNA in the kinetoplast minicircle2,4,5,6,14,17,20,30,34,35,40.

Comparative analysis between the sensitivity levels of the methods tested here and those from previous studies, was difficult to process due to a variety of the techniques and the type of biological samples that were used, the inclusion criteria of the samples and the differences among the sequences of the kDNA primers34, and the expertise of the technicians. Nevertheless, we performed a comparison of the efficiency among the kDNA-PCR and traditional methods (Tables 1 and 2) that allowed us to evaluate the limitations of each laboratory method.

The in vitro culture presented a lower percentage of positivity and/or parasite isolation (19.3%, Table 1), than those described by other authors, which ranged from 30.3% to 81.5%9,17,18,23. The low sensitivity of the in vitro culture test was evidenced in Table 2 were 77 contaminated or negative samples by this method were positive by kDNA-PCR. On the other hand, these results also indicate that the efficiency of the PCR method was not affected by secondary infections, as pointed by BOGGILD et al.6.

Concerning the DI test, several studies have demonstrated that the quality of the prepared slides, the age of the lesions, the presence of

Table 3Number of ATL suspected samples presenting none or at least one positive

result by traditional methods compared with the kDNA-PCR results

Result/group

Traditional methods

Positive*CATL

NegativeNCATL

Total

kDNA-PCRPositive 82 (98.8%) 30 (66.6%) 112

Negative 1 (1.2%) 15 (33.3%) 16

Total 83 45 128

*Positive result for at least one reference method (direct investigation, Montenegro skin test or in vitro culture). CATL: ATL DNA samples confirmed by at least one of the traditional method(s). NCATL: ATL DNA samples without confirmation by traditional method(s).

Fig. 1 - A 10% polyacrylamide gel electrophoresis representing the products of PCR-RFLP

(kDNA/HaeIII): 1- 7 samples from LTA suspected patients, Lb- DNA from L. (V.) braziliensis

(positive control).


397

secondary microorganisms6,24, and pre-treatment of the lesions can lead to atypical forms of the parasite23, resulting in a wide variation in the level of sensitivity of the DI tests ranging from 10% to 74.4%3,4,5,11,15,17. Corroborating this, we observed that 20 of the 29 samples presenting negative or suggestive results by DI test were positive when evaluated by kDNA-PCR (Table 2). Eleven of these 20 patients received treatment after the positive kDNA-PCR result which confirmed the clinical findings and may indicate the acceptance of the kDNA-PCR for diagnosis of ATL by the physicians. Thus, we suggest that samples with results that are negative or suggestive by DI test require an additional laboratory method, as kDNA-PCR to confirm the final diagnosis.

We verified that MST method was more efficient for sML patients (73.8% of positivity), than for sCL patients (50% of positivity) (Table 1). These low positivity rates are in accordance with the literature, which reports a range from 51.9%-100% for this test14,16,22,28, and could be a consequence of immunosuppression25 or even misinterpretation of the result. It is also reported that the sensitivity of the MST can vary with the presence of secondary infections6, or the age of the patient15. In our study, we also observed that 25 of the 29 samples presenting negative results by MST were positive when evaluated by kDNA-PCR amplification (Table 2). We noted that 17 of these 25 kDNA-PCR positive samples came from sCL patients, and eight samples from sML patients, which could indicate a recent infection or a weak response from the immune system of the patients12,25,29,33. In contrast, one patient that presented positive result for MST was considered negative by kDNA-PCR. This ambiguity may be due to the fact that the patient had a chronic lesion and few or no parasites might be present in the sample subjected to kDNA-PCR reaction. As proposed by DA-CRUZ et al.12 the inflammatory lesion, in this case, could be due to the activation of T-cells (CD8 +), and not due to the presence of parasites. Detection of false-positive MST results was also reported in 35% (20 of 57) of the patients with reactions up to 11 mm in diameter by GOMES et al.22 These patients had negative results for in vitro culture, stained tissue smears and PCR for Leishmania’s mini exon SL RNA gene. The authors suggested that false-positive results in MST could also be result of an allergic process to the antigen diluent, or an immune response of patients who are not sick, but have already had contact with the parasite in an endemic area22,36.

Therefore, we can infer that the limitation factors that have been observed for other laboratory methods, such as contamination by secondary microorganisms4,33, the age of infection, cross-reaction to antigens or other reagents that are used in antigen production, the intrinsic characteristics of the parasite, and the pre-treatment of patients22 does not seem to influence the kDNA-PCR results. In addition, the molecular method has several advantages: complex procedures are not required to collect and to maintain DNA samples for PCR reaction, in contrast to in vitro culture and DI test. Complementary, a wide variety of biological material can be used as sources of DNA, including material obtained by less invasive or non-invasive methods, such as blood28,34, lesion impressions on filter paper4,34, scraped, and aspirated lesions6,28, urine40, samples fixed in paraffin9 and fixed and stained material from glass slides35,37. Despite the promising results of the kDNA-PCR method, carry-over contamination must be avoided14, and in our experiments, each PCR step was always performed in separate rooms using appropriate equipment.

According to our kDNA-HaeIII PCR-RFLP data, 83.6% of sCL

patients could be infected with L. (V.) braziliensis, suggesting that these patients may be at risk of developing the mucosal manifestation or have re-activation of lesions, if they do not receive adequate treatment and clinical assistance. Although kDNA-HaeIII PCR-RFLP reaction can contribute to the identification of L. (V.) braziliensis infected samples, the confirmation of the species of the parasite by other molecular methods is recommended, once similar electrophoretic patterns may occur within related species from Viannia subgenus as reported in other PCR-RFLP studies2,38,39.

Studies describing techniques based on PCR for identification of the species from Viannia subgenus using DNA of clinical samples have been reported such as the Polymorphism-Specific PCR (PS-PCR)26, G6PD PCR8, LBF1-LBR1 PCR27. Despite the ability to identify the Leishmania’s species, the use of these techniques as routine may not be validated since they require high concentration of total DNA27 and the employment of several primers for each species8,26. On the contrary, the kDNA-HaeIII PCR-RFLP protocol used in our study was simple to execute and presented sensibility higher than the traditional routine methods.

On the other hand, most of the 128 patients analyzed here are from regions where L. (V.) braziliensis is the main causative species responsible for the severe manifestation of the disease, which supports the use of kDNA-HaeIII PCR-RFLP to assist in posterior clinical practices.

The medical reports review has shown that kDNA-PCR results contributed to the treatment of at least 18 patients who had got negative results by the traditional methods. The decision to treat these patients was also based on the clinical symptoms and epidemiological data, confirming that kDNA-PCR is important as a complementary test for the diagnosis and treatment of ATL.

Unfortunately, we failed to collect all results of the traditional diagnostic tests, as well as the response of the patients’ treatment, mainly because the medical records were incomplete or lacked important information, which made our comparative analysis difficult (Tables 1, and 3). The difficulty in establishing a gold standard method for the diagnosis of ATL based on a comparison of diagnostic methods has been reported in previous studies22. Moreover, we observed that the results of the reference diagnostic methods that were recommended by the National Council of Health of the Brazil Ministry of Health (MST for suspected ML patients, and DI for suspected CL patients) were not registered in the medical records or solicited by the physicians. The same limitations were observed in other studies that were conducted in the following states of Brazil: Pernambuco36, Mato Grosso33, and Ribeirão Preto, SP19. These findings demonstrate that standardization of the tests that are solicited for ATL diagnosis, and improvement or modernization of the medical records systems in public hospitals in Brazil is needed.

Finally, we strongly recommend the use of the kDNA-PCR to be added as routine method for diagnosis of ATL. Patients with suspicion of cutaneous lesions (sCL) after the clinical examination, must collect biopsies of the border lesion, and send for DI test. Patients with suspicion of mucosal lesions (sML) must be submitted for the MST. Patients with positive results according to the DI, and/or MST tests must be treated. kDNA-PCR can be solicited by the physician in addition to DI/MST or performed for disease confirmation when the results of the DI tests, and


398

MST were negative. Patients with positive results for kDNA-PCR can be treated. If suspected leishmaniasis patient present negative results for DI test, MST and kDNA-PCR ATL could be discharged without treatment. The complementary kDNA-HaeIII PCR-RFLP technique can be done to help L. (V.) braziliensis identification of infected samples.

RESUMO

Aplicação do kDNA-PCR para diagnóstico de rotina de leishmaniose tegumentar americana em um hospital de referência

Este estudo avaliou a aplicabilidade do kDNA-PCR como método de rotina para diagnóstico de leishmaniose tegumentar americana (ATL) no Instituto de Infectologia Emílio Ribas (IIER), São Paulo, SP, Brasil. O método kDNA-PCR detectou DNA de Leishmania em 87,5% (112/128) dos pacientes com suspeita de ter leishmaniose e, os métodos tradicionais apresentaram as seguintes porcentagens de positividade: 62,8% (49/78) para o teste de Montenegro, 61,8% (47/76) para a pesquisa direta e 19,3% (22/114) para cultura in vitro. O método molecular confirmou a doença em amostras negativas ou inconclusivas pelos métodos laboratoriais tradicionais e, mostrou-se capaz de auxiliar na identificação de infecções causadas pela espécie Leishmania (V.) braziliensis. Além disso, a revisão dos prontuários médicos confirmou a importância do método PCR-RFLP no diagnóstico final de ATL, prognóstico e escolha do tratamento. Assim, recomendamos a inclusão do PCR como método diagnóstico de ATL na rotina hospitalar, e sugerimos um fluxograma para solicitação de exames laboratoriais.

ACKNOWLEDGMENTS

We would like to thank Marta Teixeira (Instituto de Ciências Biológicas, Universidade de São Paulo, Brazil) for the reference species of Leishmania, and Regina Maia, and Elisabete Ourique (Instituto de Medicina Tropical de São Paulo) for their technical assistance.

FINANCIAL SUPPORT

This study was supported by the Fundação de Amparo à Pesquisa do Estado de São Paulo - FAPESP (Process No.: 2010/16963-4), the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), CNPq and the Laboratório de Investigação Médica 38 e 48 (LIM 38 and 48).

REFERENCES

1. Al-Jawabreh A, Schnur L, Nasereddin A, Schwenkenbecher J, Abdeen Z, Barghuthy F, et al. The recent emergence of Leishmania tropica in Jericho (A’riha) and its environs, a classical focus of L. major. Trop Med Int Health. 2004;9:812-6.

2. Andrade RV, Massone C, Lucena MN, Talhari AC, Talhari S, Guerra JAO, et al. The use of polymerase chain reaction to confirm diagnosis in skin biopsies consistent with American tegumentary leishmaniasis at histopathology: a study of 90 cases. An Bras Dermatol. 2011;86:892-6.

3. Barrio A, Mora MC, Ramos F, Moreno S, Samson R, Basombrío MA. Short report: use of kDNA-based polymerase chain reaction as a sensitive and differentially diagnostic method of American tegumentary leishmaniasis in disease-endemic areas of northern Argentina. Am J Trop Med Hyg. 2007;77:636-9.

4. Bensoussan E, Nasereddin A, Jonas F, Schnur LF, Jaffe CL. Comparison of PCR assays for diagnosis of cutaneous leishmaniasis. J Clin Microbiol. 2006;44:1435-9.

5. Boggild AK, Ramos, AP, Espinosa D, Valencia BM, Veland N, Miranda-Verastegui C, et al. Clinical and demographic stratification of test performance: a pooled analysis of five laboratory diagnostic methods for American cutaneous leishmaniasis. Am J Trop Med Hyg. 2010;83:345-50.

6. Boggild AK, Ramos AP, Valencia BM, Veland N, Calderon F, Arevalo J, et al. Diagnostic performance of filter paper lesion impression PCR for secondarily infected ulcers and nonulcerative lesions caused by cutaneous leishmaniasis. J Clin Microbiol. 2011;49:1097-100.

7. Brasil. Manual de vigilância da leishmaniose tegumentar americana. Gentil K, Pamplona M, Assunção L, Souza F, editores. 2 nd Ed. Brasília: Editora do Ministério da Saúde; 2010.

8. Castilho T, Shaw J, Floeter-Winter L. New PCR assay using glucose-6-phosphate dehydrogenase for identification of Leishmania species. J Clin Microbiol. 2003;41:540-6.

9. Coelho LI, Paes M, Guerra J, Barbosa M, Coelho C, Lima B, et al. Characterization of Leishmania spp. causing cutaneous leishmaniasis in Manaus, Amazonas, Brazil. Parasitol Res. 2011;108:671-7.

10. Costa C, de Toledo VP, Genaro O, Williams P, Mayrink W. Montenegro skin test-evaluation of the composition and stability of the antigen preparation. Mem Inst Oswaldo Cruz. 1996;91:193-4.

11. Curti MC, Silveira TG, Arraes SM, Bertolini DA, Zanzarini PD, Venazzi E, et al. Epidemiological and clinical characteristics of cutaneous leishmaniasis and their relationship with the laboratory data, south of Brazil. Braz J Infect Dis. 2011;15:12-6.

12. Da Cruz AM, Bertho AL, Oliveira-Neto MP, Coutinho SG. Flow cytometric analysis of cellular infiltrate from American tegumentary leishmaniasis lesions. Br J Dermatol. 2005;153:537-43.

13. David CV, Craft N. Cutaneous and mucocutaneous leishmaniasis. Dermatol Ther. 2009;22:491-502.

14. Degrave W, Fernandes O, Campbell D, Bozza M, Lopez U. Use of molecular probes and PCR for detection and typing of Leishmania - a mini-review. Mem Inst Oswaldo Cruz. 1994;89:463-9.

15. Delgado O, Silva S, Coraspe V, Ribas MA, Rodriguez-Morales AJ, Navarro P, et al. American cutaneous leishmaniasis in children and adolescents from northcentral Venezuela. Trop Biomed. 2008;25:178-83.

16. Diniz J, Costa M, Gonçalves D. Mucocutaneous leishmaniasis: clinical markers in presumptive diagnosis. Braz J Otorhinolaryngol. 2011;77:380-4.

17. Fagundes A, Schubach A, Paula CC, Bogio A, Antonio L de F, Schiavoni PB, et al. Evaluation of polymerase chain reaction in the routine diagnosis for tegumentary leishmaniasis in a referral centre. Mem Inst Oswaldo Cruz. 2010;105:109-12.

18. Farahmand M, Nahrevanian H, Shirazi HA, Naeimi S, Farzanehnejad Z. An overview of a diagnostic and epidemiologic reappraisal of cutaneous leishmaniasis in Iran. Braz J Infect Dis. 2011;15:17-21.

19. Ferreira M, Roselino A, Nascimento M, Aires J, Figueiredo, J. Sensitivity of an immunoenzymatic test for the detection of anti-L. braziliensis antibodies compared to other tests used for the diagnosis of American cutaneous leishmaniasis. Rev Inst Med Trop Sao Paulo. 2006;48:215-7.

20. Garcia AL, Kindt A, Quispe-Tintaya K, Bermudez H, Llanos A, Arevalo J, et al. American tegumentary leishmaniasis: antigen-gene polymorphism, taxonomy and clinical pleomorphism. Infect Genet Evol. 2005;5:109-16.

21. Garcia L, Kindt A, Bermudez H, Llanos-Cuentas A, Doncker SD, Arevalo J, et al. Culture-independent species typing of neotropical Leishmania for clinical validation of a PCR-based assay targeting heat shock protein 70 genes. J Clin Microbiol. 2004;42:2294-97.


399

22. Gomes AHS, Armelin IMI, Menon SSZ, Pereira-Chioccola VL. Leishmania (V.) braziliensis: detection by PCR in biopsies from patients with cutaneous leishmaniasis. Exp Parasitol. 2008;119:319-24.

23. Gomes AHS, Ferreira IM, Lima ML, Cunha EA, Garcia AS, Araujo MF, et al. PCR identification of Leishmania in diagnosis and control of canine leishmaniasis. Vet Parasitol. 2007;144:234-41.

24. Goto H, Lindoso JAL. Current diagnosis and treatment of cutaneous and mucocutaneous leishmaniasis. Expert Rev Anti Infect Ther. 2010;8:419-33.

25. Lindoso JA, Barbosa RN, Posada-Vergara MP, Duarte MI, Oyafuso LK, Amato VS, et al. Unusual manifestations of tegumentary leishmaniasis in AIDS patients from the New World. Br J Dermatol. 2009;160:311-8.

26. Marco JD, Barroso PA, Mimori T, Locatelli FN, Tomatani A, Mora MC, et al. Polymorphism-specific PCR enhances the diagnostic performance of American tegumentary leishmaniasis and allows the rapid identification of Leishmania species from Argentina. BMC Infect Dis. 2012;12:191.

27. Marcussi VM, Marcussi, LM, Barbosa-Tessmann IP, Lonardoni MVC, Silveira TGV. Leishmania (Viannia ) braziliensis: new primers for identification using polymerase chain reaction. Exp Parasitol. 2008;120:300-5.

28. Marques MJ, Volpini AC, Machado-Coelho GL, Machado-Pinto J, Costa CA, Mayrink W, et al. Comparison of polymerase chain reaction with other laboratory methods for the diagnosis of American cutaneous leishmaniasis: diagnosis of cutaneous leishmaniasis. Diagn Microbiol Infect Dis. 2006;54:37-43.

29. Martins L, Alexandrino A, Guimarães G. The detection of Leishmania braziliensis DNA in American tegumentary leishmaniasis patients. Rev Saúde Pública. 2010;44:571-4.

30. Medeiros A, Rodrigues S, Roselino A. Comparison of the specificity of PCR and the histopathological detection of Leishmania for the diagnosis of American cutaneous leishmaniasis. Braz J Med Biol Res. 2002;35:421-4.

31. Melo MN, Mayrink W, Da Costa CA, Magalhaes PA, Dias M, Williams P, et al. Padronização do antígeno de Montenegro. Rev Inst Med Trop Sao Paulo. 1977;19:161-4.

32. Mitropoulos P, Konidas P, Durkin-Konidas M. New World cutaneous leishmaniasis: updated review of current and future diagnosis and treatment. J Am Acad Dermatol. 2010;63:309-22.

33. Murback ND, Hans Filho G, Nascimento RA, Nakazato KR, Dorval ME. American cutaneous leishmaniasis: clinical, epidemiological and laboratory studies conducted at a university teaching hospital in Campo Grande, Mato Grosso do Sul, Brazil. An Bras Dermatol. 2011;86:55-63.

34. Oliveira DM, Lonardoni MV, Teodoro U, Silveira TG. Comparison of different primes for PCR-based diagnosis of cutaneous leishmaniasis. Braz J Infect Dis. 2011;15:204-10.

35. Oliveira JGS, Novais FO, Oliveira CI, Cruz Junior AC, Campos LF, Rocha AV, et al. Polymerase chain reaction (PCR) is highly sensitive for diagnosis of mucosal leishmaniasis. Acta Trop. 2005;94:55-9.

36. Reis LDC, Brito ME, Almeida EL, Félix SM, Medeiros AC, Silva CJ, et al. Clinical, epidemiological and laboratory aspects of patients with American cutaneous leishmaniasis in the State of Pernambuco. Rev Soc Bras Med Trop. 2008;41:439-43.

37. Romero GAS, Noronha EF, Pirmez C, Pires FESS, Fernandes O, Nehme NS, et al. Sensitivity and reproducibility of a PCR assay for Leishmania detection using skin biopsy imprints on filter paper. Acta Trop. 2009;109:74-7.

38. Schönian G, Nasereddin A, Dinse N, Schweynoch C, Schallig HDFH, Presber W, et al. PCR diagnosis and characterization of Leishmania in local and imported clinical samples. Diagn Microbiol Infect Dis. 2003;47:349-58.

39. Silva L, De Sousa C, Da Graça G, Porrozzi R, Cupolillo E. Sequence analysis and PCR-RFLP profiling of the hsp70 gene as a valuable tool for identifying Leishmania species associated with human leishmaniasis in Brazil. Infect Genet Evol. 2010;10:77-83.

40. Veland N, Espinosa D, Valencia BM, Ramos AP, Calderon F, Arevalo J, et al. Polymerase chain reaction detection of Leishmania kDNA from the urine of Peruvian patients with cutaneous and mucocutaneous leishmaniasis. Am J Trop Med Hyg. 2011;84:556-61.

41. Volpini AC, Passos VM, Oliveira GC, Romanha AJ. PCR-RFLP to identify Leishmania (Viannia) braziliensis and L. (Leishmania) amazonensis causing American cutaneous leishmaniasis. Acta Trop. 2004;90:31-7.

Received: 3 Februarry 2013 Accepted: 13 June 2013

Revista do Instituto de Medicina Tropical de São Pauloon line.

Publications from 1987 to the present data are now available on:http://www.scielo.br/rimtsp

PAST ISSUES 1959-1989 (PDF)www.imt.usp.br/portal/

SciELO – The Scientific Electronic Library OnLine - SciELO is an electronic virtual covering a selected collection of Brazilian scientific journals. The library is an integral part of a project being developed by FAPESP – Fundação de Amparo à Pesquisa do Estado de São Paulo, in partnership with BIREME – the Latin American and Caribbean Center on Health Sciences Information. SciELO interface provides access to its serials collection via an alphabetic list of titles or a subject index or a search by word of serial titles, publisher names, city of publication and subject. The interface also provides access to the full text of articles via author index or subject index or a search form on article elements such as author names, words from title, subject and words from full text.

FAPESP/BIREME Project on Scientific Electronic PublicationsLatin American and Caribbean Center on Health Sciences Information

Rua Botucatu 862 – 04023-901 São Paulo, SP – BrazilTel. (011) 5576-9863

[email protected]


Department of Eco-epidemiology, Institute of Tropical Medicine (NEKKEN), Nagasaki University, Nagasaki, Japan.Correspondence to: Masashi Miura, Department of Eco-epidemiology, Institute of Tropical Medicine (NEKKEN), Nagasaki University, 1-12-4 Sakamoto, 852-8523 Nagasaki, Japan. Tel:

+81-95-819-7866. Fax: +81-95-819-7865. E-mail: [email protected]

COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR

Masashi MIURA, Chihiro TANIGAWA, Yoshito FUJII & Satoshi KANEKO

SUMMARY

The use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme’s resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ) in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.

KEYWORDS: Blood direct PCR; Blood pathogen; Filter paper; DNA polymerase; PCR diagnosis; Field survey.

INTRODUCTION

Mutational alteration of DNA polymerases to render them resistant to inhibition by blood components led to the development of “direct PCR” methods for the analysis of blood and soil samples5. Recently, various DNA polymerase kits have become commercially available for use in amplifying DNA directly from whole blood. During introduction of direct PCR experiments in our laboratory, we noticed a striking difference in blood-resistant performance between several kits. However, no studies have been conducted to evaluate these differences. We therefore compared the PCR performance of six commercially-available direct PCR-type DNA polymerases against a standard Taq DNA polymerase in the presence of PCR inhibitors found in blood components using a diagnostic nested PCR method for the detection of Plasmodium species genomic DNA.

Due to the limited infrastructure in many tropical countries, storage of blood samples for laboratory diagnosis is logistically complicated. Filter papers are often used as a practical means of sampling, storing, and transporting blood samples for the detection of blood pathogens such as Plasmodium falciparum2,4. The utility of filter paper blood samples for the measurement of serum antibodies and diagnostic PCR analyses has also been demonstrated3. Thus, we used blood samples eluted from

dried blood on filter papers to which was added exogenous purified P. falciparum genomic DNA to examine the PCR performance and inhibitor resistance of the commercial DNA polymerases.

METHODS

DNA polymerases for direct PCR. The six commercially-available direct PCR-type DNA polymerases examined in this study were purchased from the following suppliers: KOD FX, Toyobo (Tokyo, Japan); MightyAmp, Takara bio (Tokyo, Japan); Hemo KlenTaq, New England Biolabs (Ipswich, MA, USA); Phusion Blood II, Thermo Fisher Scientific (Hudson, NH, USA); KAPA Blood, KAPA Biosystems (Woburn, MA, USA); BIOTAQ, Bioline (London, UK). Non-direct PCR-type standard Taq DNA polymerase (Go Taq Flexi, Promega (Madison, WI, USA)) was used as a control.

Preparation of PCR inhibitory blood components. Filter papers (ADVANTECH, Tokyo, Japan) containing dried blood obtained from two healthy Japanese volunteers were cut into several 2.5-mm diameter disks. The blood was eluted by placing each disk in a tube containing 20 µL of TE buffer (10 mM Tris-HCl (pH8.0), 0.1 mM EDTA)1 or a PBS-based elution buffer containing 0.05% Tween 20 and 0.05% sodium azide as used in simultaneous serological and PCR analyses3. The tubes were then

MIURA, M.; TANIGAWA, C.; FUJII, Y. & KANEKO, S. - Comparison of six commercially-available DNA polymerases for direct PCR. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 401-6, 2013.

402

heated for 15 min at 50°C, after which the disks were pressed gently to the bottom of the tube several times using a new pipette tip for each disk, and then heated for 15 min at 97 °C. The tubes were centrifuged at 15,000 rpm for 5 min and 1~8 µL of the supernatant (5%~40% blood eluent) was used in the 20-µL PCR reaction.

PCR cycling conditions and primers. A slightly modified standard nested PCR protocol was used to detect genus-specific Plasmodium genomic DNA within the highly conserved regions of the small-subunit rRNA gene6,7. The following primers, modified to increase sensitivity, were used: rPLU1-MOD1/rPLU5-MOD2 for nest 1 and rPLU3-MOD3/rPLU4-MOD4 for genus-specific nest 2 amplifications; rPLU1-MOD1: GCTTGTCTCAMAGATTAAGCCATGCAAGTGA; rPLU5-MOD2: CACAGACCTGTTGTTGCCTTAAACTTCC; rPLU3-MOD3: TTTTTWHTATAAGGATAACTACGGAAAAKCTGTAGCTAATAC TTG; rPLU4-MOD4: TACCCGTCATAGCCATGTTAGGYCAATACC. Changes in the above nucleotide sequences are underlined. Details regarding the PCR mixture used in this study are summarized in Table 1.

To ensure maximal performance of each DNA polymerase, the PCR conditions recommended by each respective supplier were employed (Table 2). In case of PCRs using the Phusion DNA polymerase, we employed the PCR protocol for whole blood. Except in the case of negative controls, purified P. falciparum (strain 3D7) genomic DNA (2 ng) was added to the reaction mixture to serve as the template. For all DNA polymerases tested, the nest 2 reaction was performed in a

similar manner using the nest 1 product (2 µL), with the exception of the annealing temperature, which was 58 °C.

All PCR assays were performed using a DNA Thermal Cycler 9700 (Applied Biosystems, Foster City, CA) with a standard ramp mode. Nest 2 PCR products (5 µL) were analyzed by gel electrophoresis on 3% agarose gels stained with ethidium bromide. Densitometric analysis (NIH ImageJ software) was used to determine the relative level of amplified target DNA. Amplified target DNA produced at more than 80% of the relative densitometric value of the positive control (PCR without blood components) were considered indicative of blood component-resistance.

RESULTS

While the non-blood direct DNA polymerase (Go Taq Flexi, Promega) did not amplify the target gene region in the presence of blood components, all blood-direct DNA polymerases were resistant to blood components and produced the target PCR product in reaction mixtures containing as much as 10% blood eluent (Fig. 1). No prominent differences in the PCR results were observed between blood donors.

Both the KOD FX and BIOTAQ DNA polymerases were resistant to the inhibitory effects of blood components in 40% blood eluent reaction mixtures, whereas the intensity levels of the target band as compared to the positive control in each blood eluent were 83.8% and 111.1% for KOD FX and 43.0% and 85.5% for BIOTAQ, respectively.

Table 1Final composition of PCR mixtures used in this study

The concentrations of nest 1 and 2 were identical. Each 20-mL reaction mixture for nest 1 amplifications contained 2 ng of P. falciparum genomic DNA in the absence or presence of 5%, 10%, 15%, 20%, or 40% blood eluent (or 40% elution buffer). Two microliters of the nest 1 amplification product were used as the DNA template for each of the 20-mL amplifications.

KOD FX MightyAmp Hemo KlenTaq Phusion Blood KAPA Blood BIOTAQ Go Taq

5’-primer 0.3 mM 0.3 mM 0.3 mM 0.5 mM 0.5 mM 0.5 mM 0.5 mM

3’-primer 0.3 mM 0.3 mM 0.3 mM 0.5 mM 0.5 mM 0.5 mM 0.5 mM

PCR buffer 1x 1x 1x 1x ‡ 1x§ 1x

dNTP 0.4 mM * 0.2 mM * ‡ * 0.2 mM

DNA polymerase 0.02 units 0.025 units (1.6 mL)† 1 unit (10 mL)† 0.5 units 2 units

*denotes dNTPs were included in the PCR buffer. †denotes indicated volume from each supplier. ‡denotes dNTPs and PCR buffer components were included in the DNA polymerase mixture vial. §denotes that the PCR buffer was supplied by SHIMADZU Corporation.

Table 2 Nest 1 PCR conditions

KOD FX MightyAmp Hemo KlenTaq Phusion Blood KAPA Blood BIOTAQ Go Taq

Initial denaturation 94 °C, 2 min 98 °C, 2 min 95 °C, 3 min 98 °C, 5 min 95 °C, 5 min 95 °C, 10 min 95 °C, 2 min

Denaturation 98 °C, 10 sec 98 °C, 10 sec 95 °C, 20 sec 98 °C, 1 sec 95 °C, 30 sec 94 °C, 30 sec 95 °C, 45 sec

Annealing 55 °C, 30 sec 55 °C, 15 sec 55 °C, 30 sec 55 °C, 5 sec 55 °C, 30 sec 55 °C, 1 min 55 °C, 45 sec

Extension 68 °C, 45 sec 68 °C, 45 sec 68 °C, 45 sec 72 °C, 45 sec 72 °C, 45 sec 72 °C, 45 sec 72 °C, 45 sec

Final extension 68 °C, 7 min 68 °C, 7 min 68 °C, 10 min 72 °C, 1 min 72 °C, 10 min 72 °C, 7 min 72 °C, 5 min

Thirty-five cycles of PCR were performed using each DNA polymerase.


403

Fig. 1 - Analysis of the PCR performance of six commercially-available direct PCR-type DNA polymerases in the presence of 5-40% blood components in the reaction mixture. Nested PCR

cycling conditions recommended by each enzyme’s manufacturer were used. Plasmodium falciparum genomic DNA (2 ng) was detected by PCR using Plasmodium species detection primers

in the presence of various concentrations of dried blood obtained from two apparently healthy Japanese volunteers that was eluted from filter papers (Left portion of each gel: eluents of blood

from volunteer #1; right portion of each gel: eluents of blood from volunteer #2). Arrowheads indicate the target PCR product of the 18S ribosomal RNA gene region (240 bp). *Denotes elution

buffer control (without blood components). The figure shows representative results from two independent experiments.


404

Fig. 2 - Analysis of the PCR performance of six commercially-available direct PCR-type DNA polymerases in the presence of 5-40% blood components and mild detergent (0.05% Tween20).

PCR cycling conditions recommended by each enzyme’s manufacturer were used. Plasmodium falciparum genomic DNA (2 ng) was detected by nested PCR using Plasmodium species

detection primers in the presence of various concentrations of dried blood obtained from two apparently healthy Japanese volunteers that was eluted from filter papers (Left portion of each

gel: eluents of blood from volunteer #1; right portion of each gel: eluents of blood from volunteer #2). Arrowheads indicate the target PCR product of the 18S ribosomal RNA gene region (240

bp). *Denotes elution buffer control (without blood components). The figure shows representative results from two independent experiments.


405

Hemo KlenTaq DNA polymerase was resistant to blood components at concentrations up to 20%, while Mighty Amp, Phusion Blood II, and KAPA Blood DNA polymerases were resistant to blood components at concentrations up to 10% of the reaction mixture (Fig. 1). These results suggest that of the six commercially-available DNA polymerases we tested, KOD FX DNA polymerase is the most resistant to blood component inhibitors.

Although some additional high-molecular-weight bands (over 2,000 base pairs) were produced using KOD FX DNA polymerase, no primer dimers (under 100 base pairs) were detected. On the other hand, BIOTAQ DNA polymerase produced no detectable high-molecular-weight additional bands, but the formation of primer dimers was observed in the negative control (without template DNA) and 40% blood eluent samples.

It has been shown that dried blood spotted onto filter paper is suitable for laboratory diagnostic procedures involving PCR analysis combined with immunoglobulin detection3. Therefore, we also examined the performance of the six commercially-available DNA polymerases in combined diagnostic tests using a phosphate buffered saline-based elution buffer containing a mild detergent (0.05% Tween 20). As shown in Figure 2, KOD FX DNA polymerase was resistant to blood components from one of the donors at concentrations up to 20%, and from the other donor at concentrations up to 15%. A DNA band of similar intensity level (88.5% as compared to the control band) was produced in the 40% elution buffer sample without blood components, suggesting that the activity of KOD FX DNA polymerase is not affected by Tween 20. The other DNA polymerases were not resistant to the 40% elution buffer containing 0.05% Tween 20, clearly demonstrating the superiority of the KOD FX DNA polymerase for assays of this type.

DISCUSSION

It is both time-consuming and costly to determine which direct PCR DNA polymerase would be the most suitable for detecting a target gene from a specific pathogen. However, our data highlight the importance of comparing the performance of several DNA polymerases prior to establishing PCR conditions. The PCR fidelity of KOD FX DNA polymerase is reportedly more than 10-fold higher than that of standard Taq DNA polymerases, and similar to that of Pfu DNA polymerase. The high fidelity of KOD FX DNA polymerase results in more accurate PCR analyses8,9.

Our results indicate that among the commercially available polymerases we tested, KOD FX DNA polymerase has the highest potential for resistance to blood components, making it the most suitable enzyme for attempting to detect the genomic DNA of pathogens in samples containing high concentrations of blood. Theoretically, employing DNA polymerases with higher resistance to blood components would enable researchers to perform PCR assays with sensitivity high enough for large-scale epidemiological studies. In addition, because of its resistance to mild detergents such as Tween 20, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect both antibodies and DNA in eluents used in testing for antibodies.

However, KOD FX DNA polymerase retains 3’ to 5’ exonuclease activity, which potentially leads to a non-specific binding between

primers and contaminated human genomic DNA (Toyobo web site: http://www.toyobo.co.jp/seihin/xr/lifescience/products/product/jisshirei/archives/2008/04/pcr3pcr.html). Therefore, we can not exclude the possibility of 3’ to 5’ exonuclease activity of the enzymes (KOD FX) leading to the non-specific band (240 bp) in the negative control (Fig. 1) was involved. In this line, KOD FX may not be suitable for PCR using primers such as targeting the ribosomal RNA gene.

In PCR protocols, we did not employ modifications of the recommendation of the manufacturers, which might give better results. Indeed, FUEHRER et al. reported a modified protocol for Phusion Direct PCR4. Such a modification method should be applied for each PCR enzyme to achieve more improved results.

The results of the present study suggest that the increased PCR sensitivity of KOD FX DNA polymerase may aid diagnostic field research efforts that involve the analysis of large numbers of samples for the presence of P. falciparum and other Plasmodium species. Our results suggest that this enzyme could also be employed for the detection of other blood-borne pathogens.

RESUMO

Comparação de seis polimerases de DNA disponíveis comercialmente para o PCR direto

O propósito deste estudo foi avaliar 6 polimerases de DNA disponíveis comercialmente que são resistentes aos inibidores do PCR para uma amplificação potencial de DNA de amostras de sangue total. O DNA genômico do parasita humano da malária, Plasmodium falciparum, foi analisado sob condições que incluíram os componentes inibidores do sangue extraído de sangue ressacado em papel de filtro. Nossos resultados sugerem que a polimerase KOD FX DNA é superior a outras polimerases.

ACKNOWLEDGEMENTS

This work was supported in part by Strategic Funds for the Promotion of Science and Technology of MEXT (Ministry of Education, Sport, Culture, Science and Technology) of Japan and by the Global Center of Excellence (GCOE) Program at Nagasaki University. Plasmodium falciparum genomic DNA was kindly provided by Dr. H. Uemura (Institute of Tropical Medicine, Nagasaki University).

REFERENCES

1. Bereczky S, Mårtensson A, Gil JP, Färnert A. Short report: Rapid DNA extraction from archive blood spots on filter paper for genotyping of Plasmodium falciparum. Am J Trop Med Hyg. 2005;72:249-51.

2. Chaorattanakawee S, Natalang O, Hananantachai H, Nacher M, Brockman A, Krudsood S, et al. Storage duration and polymerase chain reaction detection of Plasmodium falciparum from blood spots on filter paper. Am J Trop Med Hyg. 2003;69:42-4.

3. De Swart RL, Nur Y, Abdallah A, Kruining H, El Mubarak HS, Ibrahim SA, et al. Combination of reverse transcriptase PCR analysis and immunoglobulin M detection on filter paper blood samples allows diagnostic and epidemiological studies of measles. J Clin Microbiol. 2001;39:270-3.

4. Fuehrer HP, Fally MA, Habler VE, Starzengruber P, Swoboda P, Noedl H. Novel nested direct PCR technique for malaria diagnosis using filter paper samples. J Clin Microbiol. 2011;49:1628-30.


406

5. Kermekchiev MB, Kirilova LI, Vail EE, Barnes WM. Mutants of Taq DNA polymerase resistant to PCR inhibitors allow DNA amplification from whole blood and crude soil samples. Nucleic Acids Res. 2009;37(5):e40.

6. Singh B, Bobogare A, Cox-Singh J, Snounou G, Abdullah MS, Rahman HA. A genus- and species-specific nested polymerase chain reaction malaria detection assay for epidemiologic studies. Am J Trop Med Hyg. 1999;60:687-92.

7. Snounou G, Viriyakosol S, Jarra W, Thaithong S, Brown KN. Identification of the four human malaria parasite species in field samples by the polymerase chain reaction and detection of a high prevalence of mixed infections. Mol Biochem Parasitol. 1993;58:283-92.

8. Takagi M, Nishioka M, Kakihara H, Kitabayashi M, Inoue H, Kawakami B, et al. Characterization of DNA polymerase from Pyrococcus sp. strain KOD1 and its application to PCR. Appl Environ Microbiol. 1997;63:4504-10.

9. Toyobo Co. Instruction manual KOD FX 0905. Tokyo: Toyobo Co.; 2011. 10p.

Received: 19 October 2012Accepted: 26 March 2013


Financial support given by CNPq (Proc. 410550/2006-0). (1) Universidade Estadual do Norte do Paraná Campus Luiz Meneghel. E-mails: [email protected], [email protected](2) Universidade Paranaense Campus Cianorte. E-mail: [email protected](3) Núcleo de Entomologia de Jacarezinho. Secretaria de Estado da Saúde do Paraná. E-mail: [email protected](4) Secretaria Municipal de Saúde de Bandeirantes. E-mail: [email protected](5) Universidade Estadual de Maringá. E-mails: [email protected], [email protected] to: Simone C. Castanho S. de Melo, R. São Paulo 801, Vila Paraíso, 86360-000 Bandeirantes, PR, Brasil. E-mail: [email protected]

PHLEBOTOMINE SANDFLIES IN RURAL LOCATIONS IN THE STATE OF PARANA, SOUTHERN BRAZIL

Simone Cristina Castanho Sabaini de MELO(1), Wilsandrei CELLA(2), Rubens MASSAFERA(3), Natália Maria Maciel Guerra SILVA(1), Reinaldo MARQUI(4), Maria Dalva de Barros CARVALHO(5) & Ueslei TEODORO(5)

SUMMARY

This study reports the fauna and frequency of sandflies in domestic animal shelters, residences and other ecotopes in rural areas of the municipality of Bandeirantes, Paraná State. Sandflies were collected twice in eight rural villages by using Falcon traps from 8pm to 6am in 2008. In these localities 4,790 sandflies were collected, which were represented by ten sandfly species, prevailing of Nyssomyia neivai and Nyssomyia whitmani species. It was observed that animal shelters are the domestic ecotopes where there is the greatest frequency of these insects. The localities where the collections were made had the environmental characteristics that allow the persistence of transmission of parasites from the American tegumentary leishmaniasis. Although the fauna and the behavior of sandflies species are similar in different localities, the method of controlling these insects should be adjusted to the environmental characteristics of each one of the most diverse endemic areas of American tegumentary leishmaniasis in the municipalities of Paraná State.

KEYWORDS: Sandflies; American Tegumentary Leishmaniasis; Leishmania; Animal’s shelter; Fauna; Control.

INTRODUCTION

The leishmaniasis condition is sited among the top five diseases that have a major impact on public health worldwide14. In Latin America, the cutaneous leishmaniasis (CL) has a strong impact on public health, especially in Brazil, where it occurs in every State12. In the State of Paraná, CL is an endemic disease and it has been registered in more than 300 of the 399 municipalities10 including the municipality of Bandeirantes.

In Bandeirantes municipality, 232 autochthonous cases of TL were noted, with yearly occurrences from 1990 to 2009. As a result, this research on phlebotomine fauna and frequency in domiciliary, peridomiciliary and rural localities was conducted in order to provide detailed knowledge on the areas where the leishmania transmissions have happened that could be helpful when choosing the most effective method to control the vectors.


Municipality description: The municipality of Bandeirantes is located in the North Pioneer mesoregion of Paraná and according to the Demographic Census conducted in 2010, has a population of 32,182 inhabitants, of which 28,382 are living in urban and 3,800 in rural areas. The vegetation type of the municipality is of semi-deciduous forest and the soil is a composite type (Red Podzol, Red Latosol and Red Nitosol). The climate is subtropical humid reaching in the coldest month averaged temperatures lower than 18 °C and in the warmest month averaging higher

than 22 °C. The municipality has an area of 44,527.9 hectares (ha), where only 872.9 ha are native forest. Nowadays, 80% of the municipality’s territory is occupied by grain crops (soya and maize), alfalfa and sugar cane. According to Figure 1, the rural zone of Bandeirantes is divided into 17 districts, of which eight of them (Água da Jacutinga, Água das Perobas, São Paulo, Cabiúna, Água do Cateto, Água do Caixão, Água Vermelha and Água da Boa Pastora) were selected for collection of sandflies. In these districts in Água do Caixão and Água da Boa Pastora there were no reported cases of CL.

Rural neighborhoods where the phlebotomines were collected:

1. Água da Jacutinga (23° 05’S/50° 25’W). Two farms were selected from which to collect the samples: (3 irmãos Farm and Silva Farm). In the first one, the traps were installed in the woods 984.25m from a house (E1); in a chicken coop (E2); 9.84m from a house (E3), and in a pigsty 6.56m from this same house (E4). In the second farm, the traps were installed in a pigsty 64.04m from a house (E5); in the woods, 984.25m from the same house (E6); in a house made of wood which is used as chicken coop and is 6.56m from another house (E7), and in a banana plantation (E8). In both farms there are soybean and sugar cane plantations.

2. Água das Perobas (23° 14’S/50° 18’W). Samples were collected in Peroba Farm. The traps were installed in sites (E1, E2 and E4) which were located behind the houses (E3, E5, E6, E9) where traps were also installed; in chicken coops (E7, E8) 6.56m from these houses, and in the woods, 984.25m from the same houses.

MELO, S.C.C.S.; CELLA, W.; MASSAFERA, R.; SILVA, N.M.M.G.; MARQUI, R.; CARVALHO, M.D.B. & TEODORO, U. - Phlebotomine sandflies in rural locations in the state of Parana, Southern Brazil. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 407-10, 2013.

408

3. São Paulo (23° 10’S/50° 16’W). Samples were collected in three farms: Santo Antônio, Boa Esperança and Santa Rita. In the first one, the traps were installed in a house (E1) and in a pigsty (E2) 164.04m from a house. In the second farm, the collection was taken in a chicken coop (E3) 6.56m from a house; in a pigsty (E4) 16.4m from a house; in a chicken coop (E5) 9.84m from the same house, and in a corral (E6) 16.4m from another house. In Santa Rita Farm, the samples were collected in a chicken coop (E7) 9.84m from a house; 3.8m from a pigsty (E8); in a house (E9), and in a chicken coop (E10) 6.56m from a house.

4. Cabiúna. (23° 13’S/50° 23’W). The phlebotomine collection was taken in Durval Mariquito Farm, Lazarini Farm and in Santa Maria Farm. In the first one, the collection was taken in a pigsty (E1) 16.4m from a house (E4 and E5), where traps were also installed. In the woods (E2)164.04m from these houses; in a chicken coop (E3) 9.84m from those houses. In Lazarini Farm, the samples were collected in a house (E6) and in a chicken coop (E7) 6.56m from E6 and 1,148.29 m from the woods. In Santa Maria farm, the collection was taken in a house (E8), in a pigsty (E9) 6.56m from a house and 984.25m from the woods and in a chicken coop (E10).

5. Água do Cateto (23° 12’S/50° 18’W). The collection was taken

in Cateto Nomura Farm in houses (E1, E2, E5, E8 and E9); in chicken coops close to these houses (E3, E4 and E7); in a pigsty (E6) near these same houses, and in a corral (E10). Considering all the localities where the work was done, this one has the largest residual area, which is located approximately 656.17m from the residences.

6. Água Vermelha (23° 09’S/50° 26’W). The collect was done in Boa Vista Farm in houses (E1, E2, E6 and E8); chicken coops (E3 and E9); in pigsty (E4) 196.85m from the woods (E5), in a hangar (E7), and in a dam shore (E10) 6.56m from the woods.

7. Água do Caixão (23° 06’S/50° 20’W). The collections were done in Tanaka Farm, in two houses (E1, E6); in a chicken Coop (E2); in a corral linked to a pigsty (E3); in a duck barn (E4); in canebrakes (E5, E8); in a pigsty (E7) and in hangars (E9, E10). The house (E1) was 6.56m from the chicken coop (E2) and the corral linked to the pigsty (E3). The pigsty was located 6.56m from E6.

8. Água da Boa Pastora (23° 08’S/50° 22’W). The phlebotomines collection was done in São Luiz Farm, Francisco Marques and Bela Manhã Farms. In the first one, in a chicken coop (E1) and in a house (E2). In Francisco Marques Farm, the collection was done in a goat barn (E3); in a pigsty (E4); in a house (E5) and in a chicken coop (E6). In the last one, in a pigsty (E7); in a chicken coop (E8) and in two houses (E9, E10).

Collection and phlebotomines identification: The phlebotomines were caught in 15 localities distributed between eight rural neighborhoods. During area selection, in order to implement the capture, six disease registers in humans were found in two of these areas and in two of them there was no occurrence. The collection was done with a light trap, from 8pm to 6am, from January to March and September to December of 2008, and it consisted of two collections per locality (20 hours).

The number of traps installed in each locality varied from eight to ten because of each house’s availability and other ecotopes in the peridomiciliary area. The collected specimens were sacrificed in chloroform and then kept in cardboard boxes containing mothballs. Phlebotomines were prepared and identified in the Medical Entomology Laboratory of 19th Health Dept. of Jacarezinho, Parana State. The nomenclature follows GALATI3 and abbreviation follows MARCONDES6.

RESULTS

A total of 4,790 phlebotomines, belonging to 11 species, were collected: Nyssomyia neivai, Nyssomyia whitmani, Pintomyia pessoai, Migonemyia migonei, Pintomyia fischeri, Evandromyia cortelezzii, Micropygomyia ferreirana, Expapillata firmatoi, Brumptomyia brumpti, Evandromyia sallesi and Brumptomyia cunhai. The hourly average (HA) of total phlebotomines collected was 239.5 (Table 1).

In the Água do Cateto, Água da Boa Pastora and Água das Perobas neighborhoods 79.6% (HA = 190.20) of its total was collected. The most frequent species collected were Ny. neivai (HA = 104.70), Ny. whitmani (HA = 96.95) and Pi. pessoai (HA = 26.25) (Table 1).

In its total neighborhood set 1,788 (HA = 89.40) phlebotomines were collected in 20 chicken coops, 1,350 (HA = 67.50) in 15 piggeries and 973 (HA = 48.65) in 26 house porches (Table 2).

Fig. 1 - Água da Jacutinga, Água das Perobas, São Paulo, Cabiúna, Água do Cateto, Água

Vermelha, Água do Caixão and Água da Boa Pastora localities, where Phlebotomine sandflies

were collected in the city of Bandeirantes, State of Paraná, Brazil.


409

DISCUSSION

The eleven species collected in several districts of the municipality of Bandeirantes has already been described in several municipalities of Paraná State7,11-12, including in Peroba Farm (Água das Perobas locality)8.

The Ny. neivai, Ny. whitmani, Mi. migonei, Pi. pessoai and Pi. fischeri phlebotomines have a very common occurrence in many endemic areas of CL in Paraná State1,11-12, demonstrating that these species of phlebotomine

sand flies present genetic characteristics that allow them to adapt to anthropogenic environments with distinct levels of changes and due to “a sort of” spatial, olfactory memory and/or to the host fidelity that direct them to recognize environments of blood supply, rest and reproduction2. The first four species were already marked with natural infection by protozoa of Leishmania genus in other regions of Brazil, showing the potential of vector insects in natural and anthropogenic environments4,6. The natural infection of Ny. whitmani was observed in Paraná State4 and Ny. neivai in Paraná and Santa Catarina States5,9.

Tabela 1Phlebotomine sandflies species collected in rural localities in the city of Bandeirantes, State of Paraná, from January to December of 2008

Specie/Zone/Hourly Average AJ HA AP HA SP HA CA HA AC HA AV HA AX HA AB HA Total HA

Nyssomyia neivai 104 5.20 99 4.95 112 5.60 10 0.50 1,144 57.20 192 9.60 48 2.40 385 19.25 2,093 104.70

Nyssomyia whitmani 31 1.55 135 6.75 113 5.65 21 1.05 968 48.40 210 10.50 21 1.05 440 22.00 1,939 96.95

Pintomyia pessoai 21 1.05 388 19.40 6 0.30 - - 51 2.55 16 0.80 - - 43 2.15 525 26.25

Migonemyia migonei 7 0.35 23 1.15 11 0.55 3 0.15 53 2.65 4 0.20 1 0.05 10 0.50 112 5.60

Pintomyia fischeri 6 0.30 27 1.35 2 0.10 - - 35 1.75 6 0.30 - - 1 0.05 71 3.55

Evandromyia cortelezzii 4 0.20 4 0.20 - - - - - - - - - - - - 8 0.40

Micropygomyia ferreirana 12 0.60 2 0.10 1 0.05 - - - - - - - - - - 15 0.75

Expapillata firmatoi 8 0.40 - - - - - - - - 3 0.15 - - - - 11 0.55

Brumptomyia cunhai - - 7 0.35 - - - - - - - - - - - - 7 0.35

Brumptomyia brumpti 1 0.05 - - - - - - - - - - - - - - 1 0.05

Evandromyia sallesi 1 0.05 - - - - - - - - - - - - - - 1 0.05

Total 195 9.75 685 34.25 245 12.25 34 1.70 2,251 112.55 431 21.55 70 3.50 879 43.95 4,790 239.50

AJ = Água da Jacutinga; AP = Água das Perobas; SP = São Paulo; CA = Cabiúna; AC = Água do Cateto; AV = Água Vermelha; AX = Água do Caixão; AB = Água da Boa Pastora; HA = Hourly Average.

Tabela 2Phlebotomine sandflies collected in several environments, in rural localities in the city of Bandeirantes, State of Paraná, from January to December of 2008

Environments/sites AJ HA AP HA SP HA CA HA AC HA AV HA AX HA AB HA Total HA

Hennery 49 2.45 11 0.55 76 3.80 1 0.05 1,563 78.15 14 0.70 2 0.10 85 4.25 1,788 89.40

Piggery 103 5.15 152 7.60 46 2.30 - - 292 14.60 235 11.75 31 1.55 491 24.55 1,350 67.50

Houses 15 0.75 139 6.95 3 0.15 13 0.65 391 19.55 169 8.45 - - 243 12.15 973 48.65

Woods 28 1.40 383 19.15 - - 20 1.00 - - 4 0.20 - - - - 435 21.75

Corrals - - - - 120 6.00 - - - - - - - - - - 120 6.00

Goat shelter - - - - - - - - - - - - - - 60 3.00 60 3.00

Corral/Piggery - - - - - - - - - - - - 29 1.45 - - 29 1.45

Banana tree - - - - - - - - - - - - - - - - 13 0.65

Mango tree - - - - - - - - 5 0.25 - - - - - - 5 0.25

Water reservoir margin - - - - - - - - - - 5 0.25 - - - - 5 0.25

Sheds - - - - - - - - - - 4 0.20 2 0.10 - - 6 0.30

Bamboo plantation - - - - - - - - - - - - 4 0.20 - - 4 0.20

Duck shelter - - - - - - - - - - - - 2 0.10 - - 2 0.10

Total 195 9.75 685 34.25 245 12.25 34 1.70 2,251 112.55 431 21.55 70 3.50 879 43.95 4,790 239.50

AJ = Água da Jacutinga; AP = Água das Perobas; SP = São Paulo; CA = Cabiúna; AC = Água do Cateto; AV = Água Vermelha; AX = Água do Caixão; AB = Água da Boa Pastora; HA = Hourly Average.


410

In the majority of the districts where the phlebotomine collections were made in bad hygiene condition homes the presence of humidity and organic matter in the soil (leaves, fruits, domestic animal feces, food and vegetal waste) of domestic animals shelters and residences in the neighborhoods of remaining forests was noticed in the peridomicile. These factors are crucial for the formation of phlebotomine breeding sites that invade domiciles6,10,13, increasing the vulnerability of the inhabitants to the CL.

CONCLUSION

In the neighborhoods where the collections were done, 10 phlebotomines species were found, and, among those, Ny. neivai and Ny. whitmani were the main ones. Domestic animal shelters are the ecotopes where these insects frequency occurs the most. The localities where the collections were done have environmental characteristics that allow Leishmania transmission persistence.

Even though fauna and phlebotomines species behavior are similar in many localities, the control method of these insects has to be adjusted to the environmental characteristics of each CL endemic area in Paraná municipalities.

The detailed knowledge on the localities where there is leishmaniasis transmission chain gives the public health administration the option to choose more efficient methods in order to control the spread of the disease. The municipalities have not maintained their promise when it comes to the endemic control of diseases that involve vectors, and it shows the demand for changes in Ministry of Health policies. The increase of cases of diseases related to these insects shows the need to capacitate community health agents for vector vigilance development activities.

RESUMO

Flebotomíneos em localidades rurais do Estado do Paraná, Sul do Brasil

Relatam-se, neste trabalho, a fauna e frequência de flebotomíneos em abrigos de animais domésticos, residências e outros ecótopos em áreas rurais do município de Bandeirantes, Estado do Paraná. Os flebotomíneos foram coletados em oito bairros rurais, com armadilhas de Falcão, duas vezes em cada bairro, das 20 às 6 horas, em 2008. No conjunto dos bairros coletaram-se 4.790 flebotomíneos, representados por dez espécies, com predomínio de Nyssomyia neivai e Nyssomyia whitmani. Os abrigos dos animais domésticos são os ecótopos onde há maior frequência desses insetos. As localidades onde as coletas foram realizadas têm características ambientais que permitem a persistência da transmissão de parasitos da leishmaniose tegumentar americana. Apesar da fauna e do comportamento das espécies de flebotomíneos serem semelhantes nas diversas localidades, o método de controle desses insetos deve ser ajustado às características ambientais de cada uma das mais diversas áreas endêmicas de leishmaniose tegumentar americana, nos municípios do Paraná.

ACKNOWLEDGEMENTS

To the Healthcare agents of the Entomology Group of the municipality of Jacarezinho/Secretary of Health of the State of Paraná, Mr. Hélio

Aparecido Barbosa, Nivaldo Paulino, and Valdeci Aparecido Fagundes for their assistance in collection and identification of sandflies and to the Technical in Health Surveillance, Mr. Edson Carlos Capi in supporting the orientation process of the localities where the collections were made.

REFERENCES

1. Andrade-Filho JD, Galati EAB, Falcão AL. Nyssomyia intermedia (Lutz & Neiva, 1912) and Nyssomyia neivai (Pinto, 1926) (Diptera: Psychodidae: Phlebotominae) geographical distribution and epidemiological importance. Mem Inst Oswaldo Cruz. 2007;102:481-7.

2. Freitas JS, Reinhold-Castro KR, Casanova C, Silva JP, Previdelli I, Teodoro U. Memória espacial e/ou olfativa em flebotomíneos em área endêmica de leishmaniose tegumentar americana, sul do Brasil. Rev Soc Bras Med Trop. 2009;42:151-5.

3. Galati EAB. Morfologia e taxonomia. In: Rangel EF, Lainson R, editores. Flebotomíneos do Brasil. Rio de Janeiro: Editora Fiocruz; 2003. p. 23-51.

4. Luz E, Membrive N, Castro EA, Dereure J, Pratlong F, Dedet JA, et al. Lutzomyia whitmani (Diptera: Psychodidae) as vector of Leishmania (V). braziliensis in Paraná State, Southern Brazil. Ann Trop Med Parasitol. 2000;94:623-31.

5. Marcondes CB, Bittencourt IA, Stoco PH, Eger I, Grisard EC, Steindel M. Natural infection of Nyssomyia neivai (Pinto, 1926) (Diptera: Psychodidae, Phlebotominae) by Leishmania (Viannia) spp. in Brazil. Trans R Soc Trop Med Hyg. 2009;103:1093-7.

6. Marcondes CB. A proposal of generic and subgeneric abbreviations for phlebotomine sandflies (Diptera: Psychodidae: Phlebotominae) of the world. Entomol News. 2007;118:351-6.

7. Massafera R, Silva AM, Carvalho AP, Santos DR, Galati EAB, Teodoro U. Fauna de flebotomíneos do município de Bandeirantes, no Estado do Paraná. Rev Saúde Pública. 2005;39:571-7.

8. Membrive NA, Rodrigues G, Membrive U, Monteiro WM, Neitzke HC, Lonardoni MVC, et al. Flebotomíneos de municípios do norte do Estado do Paraná, sul do Brasil. Entomol Vec. 2004;11:673-80.

9. Oliveira DM. Padronização de técnicas moleculares para o diagnóstico e epidemiologia de leishmaniose tegumentar americana. [dissertação]. Maringá: Universidade Estadual de Maringá; 2009.

10. Reinhold-Castro KR, Scodro RB, Dias-Sversutti AC, Neitzke HC, Rossi RM, Kühl JB, et al. Avaliação de medidas de controle de flebotomíneos. Rev Soc Bras Med Trop. 2008;41:269-76.

11. Silva AM, Camargo NJ, Santos DR, Massafera R, Ferreira AC, Posta C, et al. Diversidade, distribuição e abundância de flebotomíneos (Diptera: Psychodidae) no Paraná. Neotrop Entomol. 2008;37:209-25.

12. Teodoro U, Santos DR, Santos AR, Oliveira O, Poiani LP, Silva AM, et al. Informações preliminares sobre flebotomíneos do norte do Paraná. Rev Saúde Pública. 2006;40:327-30.

13. Teodoro U, Santos DR, Santos AR, Oliveira O, Santos ES, Neitzke HC, et al. Avaliação de medidas de controle de flebotomíneos no Município de Lobato, Estado do Paraná, Sul do Brasil. Cad Saúde Pública. 2006;22:451-5.

14. World Health Organization. Leishmaniasis: magnitude of the problem. [cited 2008 Nov 08]. Available from: http://www.who.int/leishmaniasis/burden/magnitude

Received: 15 August 2012Accepted: 15 April 2013


Department of Parasitology, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand.Correspondence to: Assist. Prof. Anchalee Wannasan, Department of Parasitology, Faculty of Medicine, Chiang Mai University, Chiang Mai, 50200, Thailand. Tel: 66 53 945343. Fax: 66

53 945347. E-mail: [email protected]

POTENTIALLY PATHOGENIC FREE-LIVING AMOEBAE IN SOME FLOOD-AFFECTED AREAS DURING 2011 CHIANG MAI FLOOD

Anchalee WANNASAN, Pichart UPARANUKRAW, Apichart SONGSANGCHUN & Nimit MORAKOTE

SUMMARY

The survey was carried out to investigate the presence of potentially pathogenic free-living amoebae (FLA) during flood in Chiang Mai, Thailand in 2011. From different crisis flood areas, seven water samples were collected and tested for the presence of amoebae using culture and molecular methods. By monoxenic culture, FLA were detected from all samples at 37 °C incubation. The FLA growing at 37 °C were morphologically identified as Acanthamoeba spp., Naegleria spp. and some unidentified amoebae. Only three samples (42.8%), defined as thermotolerant FLA, continued to grow at 42 °C. By molecular methods, two non-thermotolerant FlA were shown to have 99% identity to Acanthamoeba sp. and 98% identity to Hartmannella vermiformis while the two thermotolerant FLA were identified as Echinamoeba exundans (100% identity) and Hartmannella sp. (99% identity). This first report of the occurrence of FLA in water during the flood disaster will provide information to the public to be aware of potentially pathogenic FLA.

KEYWORDS: Flood; Chiang Mai; Free-living amoebae.

INTRODUCTION

Free-living amoebae (FLA) are ubiquitous in nature, mainly in soil and water. Among them, Naegleria, Acanthamoeba, Balamuthia and Sappinia are now known to cause brain infections in humans7,8,27. Moreover, Acanthamoeba, Hartmannella and Vahlkampfia can be causative agents of amoebic keratitis in humans1,17. Several FLA are also known to play a role as vectors of several intracellular pathogenic microorganisms, such as Legionella pneumophila4, Mycobacterium18 and Chlamydia-like bacterium20 as they can support the growth of those micropathogens and protect them from the harsh environment.

Surveys in Thailand showed the presence of FLA in the environment including water14,16,21. Recently, FLA were detected in soil and water samples in Chiang Mai areas34. As FLA are abundant in soil, they may be dispersed during flood and as a result human may have increased a risk of getting infected. It is therefore interesting to see if the pathogenic FLA are abundant in water during recent major floods in the country. The present study looked for the occurrence of FLA in the water during the 2011 flood disaster in Chiang Mai, Thailand. The results will provide more useful information to the public so as to have increased awareness of these FLA which can cause severe, life-threatening diseases.


Sample collection: At end of September 2011, approximately 50 mL

of water samples were collected from each of seven flood crisis areas in Chiang Mai including Pracha Sampan Intersection (cmf1), Chang Klan Road (cmf2), Nawarat Bridge (cmf3), Chiang Mai-Lampun road (cmf4), Chiang Mai Land Village (cmf5), Nong Hoi Road (cmf6) and Charoen Pratet Road (cmf7) (Fig. 1). Samples were transported to the laboratory in the Department of Parasitology, Faculty of Medicine, Chiang Mai University, and processed on the same day.

Amoebae culture: To detect free-living amoebae, 10 µL of the sediment after centrifugation (1,200g, 10 min, RT) was dropped onto the middle of NNA-E. coli plates (1.5% non-nutrient agar pre-coated with heat-inactivated Escherichia coli). The plates were incubated at 37 °C for two weeks and daily observed for the growth of amoebae using an inverted microscope. If the amoebae existed, Page’s amoeba saline solution (PAS) was applied to the culture and amoebae were harvested by scraping the agar surface with spatula. In case of fungal contamination, sub-culturing was performed by cutting the uncontaminated area of agar harboring amoebae and transferring to a new plate. Collected amoebae were subjected to trichrome staining for morphological identification and sub-culturing at 42 °C in order to examine the thermotolerance characteristics34.

Morphological identification: The morphological criteria used to identify amoebae were based on the previous publication30. Acanthamoeba cysts are characterized by a double-walled structure with an outer wrinkled wall, while its trophozoite represents fine,

WANNASAN, A.; UPARANUKRAW, P.; SONGSANGCHUN, A. & MORAKOTE, N. - Potentially pathogenic free-living amoebae in some flood-affected areas during 2011 Chiang Mai flood. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 411-6, 2013.

412

Fig. 1 - Map showing the sampling sites of flood crisis areas in Chiang Mai 2011. Whole picture of Mueang District, Chiang Mai is shown on the upper right. A: Nawarat Bridge (cmf3). B: Charoen Pratet Road (cmf7). C: Chang Klan Road (cmf2). D: Pracha Sampan Intersection (cmf1). E: Chiang Mai Land Village (cmf5). F: Nong Hoi Road (cmf6). G: Chiang Mai-Lampun

road (cmf4).


413

tapering, hyaline projections called acanthopodia, Naegleria cyst bears single layer and smooth cyst wall, where as its trophozoite possesses a large karyosome surrounded by a halo and typical blunt pseudopodia, lobopodia30,34. Morphological examination and photography were done under a light microscope (Olympus CHA) with 1,000x magnification. Acanthamoeba castellanii originated from a keratitis patient of Siriraj Hospital was used as positive control. Enflagellation experiment was done to verify the presence of Naegleria spp30. Briefly, the suspected trophozoites grown on a NNA-E. coli plate were suspended in sterile distilled water and left at room temperature for at least one hour. The presence of flagellate form containing two long flagella34 can be periodically examined under the light microscope.

Molecular identification: DNA preparation was performed by boiling method29. In brief, the amoebae were harvested from the culture plates, washed twice with PAS, and centrifuged at 5,000xg for five min at room temperature. After discarding the supernatant, the remaining cell sediment was suspended and directly heated at 95 °C for 10 min. Following brief centrifugation, 5 µL of the supernatant was freshly used for PCR. Whole sediments of the original water samples that showed no growth in culture were heated and used for PCR as described above. Two different sets of PCR employed in this study included FLA PCR designed for the detection of 18S rDNA of FLA28 and Acanthamoeba spp.-specific PCR (ACA PCR) targeted to 18S rDNA of Acanthamoeba24. All PCR reactions were done in 50 µL reactions containing 5 µL of 10x PCR buffer (Fermentas®), 1.25 units of i-TaqTM DNA polymerase (Fermentas®) and 0.2 mM of each dNTP (Applied Biosystems). The MgCl

2 concentrations were 3 and 4 mM and the primer concentrations

were 0.8 µM and 0.5 µM for FLA PCR and ACA PCR, respectively. For FLA PCR, the reactions were performed by incubation for seven min at 94 °C, followed by 40 cycles of one min at 94 °C, one min at 63 °C and three min 30 s at 74 °C, with a final extension at 74 °C for 10 min28. The reaction cycles for ACA PCR were pre-incubation step at seven min at 95 °C, followed by 20 cycles of one min at 95 °C, one min at 60 °C and two min at 72 °C. This was followed by 25 cycles of one min at 95 °C and two min at 72 °C24. The PCR was carried out using DNA engine thermal cycler PTC-100 (MJ Research, USA). PCR products were analyzed by electrophoresis on 1.5% agarose gels and purified using QIAquick PCR purification kit (QIAGEN). The purified PCR products were sent to 1st Base DNA sequencing services (Singapore) for sequencing at both directions using the same primers used in the same PCR. The obtained

sequencing data were compared with all published sequences in GenBank using BLASTn at National Center for Biotechnology Information [http://blast.ncbi.nlm.nih.gov/] and submitted to the GenBank database.

RESULTS

Agar plate culture: At 37 °C culture, all seven water samples collected from the flood affected areas showed FLA growth on the second day of incubation. The growth areas of FLA, as shown by the presence of clear zones on 1.5% NNA-E. coli plates, were then cut and sub-cultured at 42 °C. Three out of seven samples (42.8%) were able to grow at 42 °C (Table 1).

Morphological identification: The amoebae growing at 37 °C were collected and subjected to trichrome staining. Acanthamoeba and Naegleria were concurrently found in most of the flood samples (5/7, 71%) stained with trichrome. Acanthamoeba sp. (Fig. 2A) were observed in five samples (except cmf6 and cmf7), while Naegleria sp. (Fig. 2B) were detected in six samples (except cmf6). The presence of Naegleria spp. in six samples was in correspondence with positive enflagellation test (Table 1). Acanthamoeba-like trophozoites showing fine short acanthopodia were also detected (Fig. 2C). Additionally, morphologically unidentified FLA including round double-walled cysts bearing one nucleus with central karyosome (Fig. 2D, E), small round cysts with unstained nucleus (Fig. 2F), small trophozoites presenting short spiny pseudopodia resembling Echinamoeba (Fig. 2G, H) and Hartmannella-like trophozoites with elongated shape (Fig. 2I) were often seen.

Molecular identification: The amoebae growing on agar culture plate at 42 oC or 37 oC were harvested and identified by PCR. Using the FLA PCR screening, cmf1 yielded a DNA fragment of approximately 1,000 bp (Fig. 3), whereas cmf3 to cmf6 yielded a distinctive band at 800 bp. However, cmf2 and cmf7 were negative by FLA PCR. When the ACA PCR was employed, the approximately 500-bp specific band for Acanthamoeba spp. was observed only in cmf1 (Fig. 4). Purified PCR products obtained from ACA PCR (cmf1) and FLA PCR (cmf3, cmf4, cmf5 and cmf6) were used for sequencing. Results from BLASTn revealed that sequence from cmf1 belonged to Acanthamoeba sp. (99% maximum identity with Acanthamoeba sp. UNB13 from Brazil Accession No. JQ268234, followed by 96% maximum identity with Acanthamoeba castellanii Accession No. GU001160). FLA isolated from cmf4 was

Table 1FLA detected during 2011 Chiang Mai flood

Isolate Growth at 37 °C Growth at 42 °C Enflagellation test FLA-PCR ACA-PCR Sequencing data

cmf1 Ga NGb + Pos Pos Acanthamoeba sp.

cmf2 G NG + Neg Neg NDc

cmf3 G G + Pos Neg Invalid data

cmf4 G G + Pos Neg Echinamoeba sp.

cmf5 G G + Pos Neg Hartmannella sp.

cmf6 G NG - Pos Neg Hartmannella sp.

cmf7 G NG + Neg Neg NDa G: growth, b NG: no growth, c ND: not done.


414

Echinamoeba exundans (100% identity with E. exundans Accession No. AF293895), while those from cmf5 and cmf6 were most closely related to Hartmannella sp. (Accession No. HM363627) and Hartmannella vermiformis (Accession No. FJ940709) with 99 and 98% maximum identity, respectively. On the other hand, we failed to obtain unambiguous sequencing data from cmf3. It was also impossible to further analyze FLA isolated from cmf2, cmf3 and cmf7 since they were lost during culture. The sequences of FLA reported in this study were deposited in GenBank (Accession Number: JX507295-JX507297).

DISCUSSION

In Thailand, at least 17 cases of human brain infection caused by Acanthamoeba, Naegleria and Balamuthia13,25,35, 29 cases of acanthamoebic keratis6,15,33, and one case of Acanthamoeba infection of gastric ulcer26 have been reported from several provinces. Although there has never been any case of brain infection due to FLA reported from Chiang Mai, the importance of FLA cannot be neglected. In the previous survey of natural water sources in Chiang Mai in 2009, FLA frequently found were Naegleria spp. (37.5%) and Acanthamoeba spp. (18.8%). The number of positive thermotolerant FLA from water samples (62.5%) was higher than that from soil samples (37.5%)34. As far as the flood conditions are concerned, such potentially pathogenic FLA in the environment may disperse and increase during the flood. Surprisingly, neither thermotolerant Naegleria nor Acanthamoeba was found in the present survey. Although the number of samples in the present study was low, detection of thermotolerant FLA were demonstrated in three out of seven water samples analyzed.

To our knowledge, this is the first report of the occurrence of FLA during flood disaster in Thailand. It was not surprising that several amoebae including Acanthamoeba and Naegleria were detected by microscopic examination after 37 °C incubation in all flood water samples. The presence of Acanthamoeba and Naegleria in this survey is due to their abundance in nature and ability to dwell in unsanitary conditions. However, both Acanthamoeba and Naegleria isolated from the flood samples failed to grow at 42 °C. This was unexpected as the previous FLA survey in Chiang Mai showed the occurrence of both thermotolerant Acanthamoeba and Naegleria in water and soil samples34. Instead, thermotolerant Hartmannella and Echinamoeba were identified for the first time in Chiang Mai in this survey.

In the present study, five out of seven samples were successfully amplified by FLA PCR. The usefulness of FLA PCR, of which its primers are targeted at the conserved regions of Acanthamoeba 18S rDNA, was stated in some studies showing a detection range of several

Fig. 2 A-I - Trichrome staining of free-living amoebae under light microscopy (1,000x),

bar = 10 µm. A: A cyst of Acanthamoeba sp. B: A large trophozoite of Naegleria sp. C: Acanthamoeba-like trophozoites (arrow showing fine short acanthopodia). D, E: Different

sizes of unidentified double-walled cysts with distinct nuclei. F: Unidentified amoebae with

small round cysts (arrow). G, H: Small Echinamoeba-like trophozoites (arrow showing few

spiny short pseudopodia). I: An elongated cylindrical trophozoite of Hartmannella-like

amoeba (arrow).

Fig. 3 - Gel electrophoresis of amplicons from FLA PCR conditions. A: N - negative

control. Lane P (positive control) and lane 1 (cmf1) showing the specific bands (1 kb) for

Acanthamoeba. Lane 2 (cmf2) showing negative result. B: Lanes 3, 4, 5 and 6 (cmf3, cmf4,

cmf5 and cmf6, respectively) showing the bands (~800 bp) for other free-living amoebae.

Lane 7 (cmf7) showing negative result. M - 100 bp Ladder DNA (Fermentas®).

Fig. 4 - Gel electrophoresis of amplicons from ACA PCR conditions. N - negative control.

Lane P (positive control) and lane 1 (cmf1) showing the approximately specific bands (500-

bp) for Acanthamoeba. Lanes 2, 3, 4, 5, 6 and 7 (cmf2, cmf3, cmf4, cmf5, cmf6 and cmf7,

respectively) showing negative results. M - 100 bp Ladder DNA (Fermentas®).


415

FLA such as Naegleria, Acanthamoeba, Hartmannella, Vahlkampfia28, Echinamoeba, Vannella and Protacanthamoeba9 and also ciliated freshwater protozoan Tetrahymena3. The negative results of FLA PCR in two of the flood samples might in part be due to the presence of unknown FLA which could not be detected by this PCR. The discrepancy between the sequencing data and microscopic examination and enflagellation test (Table 1) might be the result of sub-culturing procedures that lead to the overgrowth of predominant FLA. Moreover, some samples used for DNA preparation were harvested from continuous sub-culturing, not from the first inoculation as done for microscopic examination. Therefore, FLA detected by PCR could be only the subset of population of the entire samples. In contrast, FLA detected by microscopic examination represented the amoebae grown on the whole culture plates. Regarding cmf3, despite a distinct band obtained by FLA PCR, we could not get the valid sequencing data. It is possible that more than one species of amoebae were present in cmf3 resulting in heterogeneous PCR products and hence ambiguous sequence. In such a failure, axenic culture or cloning by limiting dilution should be considered in future surveys.

Among the non-thermotolerant FLA, only cmf1 and cmf6 were successfully sequenced showing the close relationship to Acanthamoeba sp. and Hartmannella vermiformis, respectively. The FLA isolated from cmf1 was most similar to Acanthamoeba sp. (JG268234, 99% identity). It also had 96% identity to Acanthamoeba castellanii (GU001160). It is widely accepted that temperature tolerance is a characteristic of potential pathogenicity, particularly for Acanthamoeba10,31. It is therefore unlikely that Acanthamoeba identified in this study is virulent. As for Hartmannella, no evidence supporting correlation between thermotolerance and pathogenicity has been demonstrated but the health impact of non-thermotolerant Hartmannella could not be ignored.

Among the three thermotolerant FLA detected in this study, cmf4 and cmf5 were successfully sequenced and identified as Echinamoeba exundans and Hartmannella sp., respectively. Although Echinamoeba has been occasionally reported from aquatic sources, e.g. lake, leaf litter22, hot water systems of hospitals23, water bodies9 and hot springs2. To our knowledge this genus has never been described as a human pathogen. Hartmannella is ubiquitous in nature and has recently been associated with amoebic keratitis as it was found to co-infect with Acanthamoeba or even with Vahlkampfia1,12,17. Even if Echinamoeba and Hartmannella of thermotolerant isolates investigated in this study are not considered to be as serious as Acanthamoeba or Naegleria, their important role as potential vectors of pathogens could not be overlooked. Acanthamoeba, Echinamoeba and Hartmannella have been reported to serve as vectors harboring several human pathogenic bacteria, such as, Legionella pneumophila4,9, Exophiala dermatitidis5, Pseudomonas aeruginosa9,19, Comamonas acidovorans, Escherichia coli, Proteus mirabilis, Vibrio cholerae32 and Mycobacterium11. Thus the findings of such amoebae in this survey during flood in Chiang Mai should provide evidence for awareness of outbreaks of human infections caused by these FLA.

RESUMO

Amebas potencialmente patogênicas de vida livre em algumas áreas afetadas durante a inundação de 2011 em Chiang Mai

A pesquisa foi feita para investigar a presença de amebas de vida livre (FLA) durante a inundação em Chiang Mai, Tailândia, ano de

2011. A partir de diferentes áreas de inundação sete amostras de água foram coletadas e testadas para a presença de amebas usando métodos moleculares e de cultura. Através da cultura monoxênica, FLA foi detectada em todas as amostras após incubação a 37 °C. As FLA crescendo a 37 °C foram identificadas morfologicamente como Acanthamoeba spp, Naegleria spp e algumas amebas não determinadas. Somente três amostras (42,8%) definidas como FLA termotolerantes continuaram a crescer a 42 °C. Por métodos moleculares duas FLA termotolerantes tiveram 99% de identidade com a Acanthamoeba sp e 98% de identidade com Hartmannella vermiformis enquanto as duas FLA termotolerantes foram identificadas como Echinamoeba exundans (100% de identidade) e Hartmannella sp (99% de identidade). Este primeiro relato da ocorrência de FLA em águas durante inundações informa ao público que ele deve estar atento de FLA potencialmente patogênica.

ACKNOWLEDGEMENTS

This study was financially supported by the Faculty of Medicine Endowment Fund for Medical Research, Chiang Mai University. The authors thank Assist. Prof. Koson Roongruangchai for providing the Acanthamoeba castellanii positive control used in this study and Mr. Pathamet Khositharattanakool, Ms. Rungkanta Methanitikorn for their help in producing the map and pictures. The authors acknowledge Regional Centre for Geo-informatics and Space Technology (North), Faculty of Social Sciences, Chiang Mai University for the information and the maps of the affected areas during the 2011 Chiang Mai flood.

REFERENCES

1. Aitken D, Hay J, Kinnear FB, Kirkness CM, Lee WR, Seal DV. Amebic keratitis in a wearer of disposable contact lenses due to a mixed Vahlkampfia and Hartmannella infection. Ophthalmology. 1996;103:485-94.

2. Baumgartner M, Yapi A, Gröbner-Ferreira R, Stetter KO. Cultivation and properties of Echinamoeba thermarum n. sp., an extremely thermophilic amoeba thriving in hot springs. Extremophiles. 2003;7:267-74.

3. Behets J, Declerck P, Delaedt Y, Verelst L, Ollevier F. Survey for the presence of specific free-living amoebae in cooling waters from Belgian power plants. Parasitol Res. 2007;100:1249-56.

4. Brieland J, McClain M, LeGendre M, Engleberg C. Intrapulmonary Hartmannella vermiformis: a potential niche for Legionella pneumophila replication in a murine model of legionellosis. Infect Immun. 1997;65:4892-6.

5. Cateau E, Mergey T, Kauffmann-Lacroix C, Rodier MH. Relationships between free living amoebae and Exophiala dermatitidis: a preliminary study. Med Mycol. 2009;47:115-8.

6. Chuckpaiwong V, Vathesatokkit C, Lekhanont K, Vongthongsri A. Acanthamoeba keratitis: character and outcome of treatment in tropical area. Thai J Opthalmol. 2010;24:26-36.

7. Gelman BB, Popov V, Chaljub G, Nader R, Rauf SJ, Nauta HW, et al . Neuropathological and ultrastructural features of amoebic encephalitis caused by Sappinia diploidea. J Neuropathol Exp Neurol. 2003;62:990-8.

8. Gelman BB, Rauf SJ, Nader R, Popov V, Bokowski J, Chaljub G, et al. Amoebic encephalitis due to Sappinia diploidea. JAMA. 2001;285:2450-541.

9. Gianinazzi C, Schild M, Wuthrich F, Ben NN, Fuchslin HP, Schurch N, et al. Screening Swiss water bodies for potentially pathogenic free-living amoebae. Res Microbiol. 2009;160:367-74.


416

10. Griffin JL. Temperature tolerance of pathogenic and nonpathogenic free-living amoebas. Science. 1972;178(4063):869-70.

11. Gryseels S, Amissah D, Durnez L, Vandelannoote K, Leirs H, De Jonckheere J, et al. Amoebae as potential environmental hosts for Mycobacterium ulcerans and other mycobacteria, but doubtful actors in Buruli ulcer epidemiology. PLoS Negl Trop Dis. 2012;6:e1764.

12. Inoue T, Asari S, Tahara K, Hayashi K, Kiritoshi A, Shimomura Y. Acanthamoeba keratitis with symbiosis of Hartmannella ameba. Am J Ophthalmol. 1998;125:721-3.

13. Intalapaporn P, Suankratay C, Shuangshoti S, Phantumchinda K, Keelawat S, Wilde H. Balamuthia mandrillaris meningoencephalitis: the first case in southeast Asia. Am J Trop Med Hyg. 2004;70:666-9.

14. Jariya P, Tiewchalore S, Junne V, Lertlaituan P, Suvithayasri V. Survey of Naegleria fowleri the causative agent of primary amoebic meningoencephalitis (PAM) in stagnant waters around factory area in Thailand. Siriraj Med J. 1997;49:222-9.

15. Korriruvongs P, Wanachiwanawin D, Visvesvara GS. Treatment of Acanthamoeba keratitis with chlorhexidine.Opthalmology. 1999;106:798-802.

16. Lekkla A, Sutthikornchai C, Bovornkitti S, Sukthana Y. Free-living ameba contamination in natural hot springs in Thailand. Southeast Asian J Trop Med Public Health. 2005;36(Suppl 4):5-9.

17. Lorenzo-Morales J, Martinez-Carretero E, Batista N, Varez-Marin J, Bahaya Y, Walochnik J, et al. Early diagnosis of amoebic keratitis due to a mixed infection with Acanthamoeba and Hartmannella. Parasitol Res. 2007;102:167-9.

18. Marciano-Cabral F, Jamerson M, Kaneshiro ES. Free-living amoebae, Legionella and Mycobacterium in tap water supplied by a municipal drinking water utility in the USA. J Water Health. 2010;8:71-82.

19. Michel R, Burghardt H, Bergmann H. Acanthamoeba, naturally intracellularly infected with Pseudomonas aeruginosa, after their isolation from a microbiologically contaminated drinking water system in a hospital. Zentralbl Hyg Umweltmed. 1995;196:532-44.

20. Michel R, Müller KD, Zöller L, Walochnik J, Hartmann M, Schmid EN. Free-living amoebae serve as a host for the Chlamydia-like bacterium Simkania negevensis. Acta Protozool. 2005;44:113-21.

21. Nacapunchai D, Kino H, Ruangsitticha C, Sriwichai P, Ishih A, Terada M. A brief survey of free-living amebae in Thailand and Hamamatsu District, Japan. Southeast Asian J Trop Med Public Health. 2001;32(Suppl 2):179-82.

22. Page FC. A new family of amoebae with fine pseudopodia. Zool J Linn Soc. 1975;56:73-89.

23. Rohr U, Weber S, Michel R, Selenka F, Wilhelm M. Comparison of free-living amoebae in hot water systems of hospitals with isolates from moist sanitary areas by identifying genera and determining temperature tolerance. Appl Environ Microbiol. 1998;64:1822-4.

24. Schroeder JM, Booton GC, Hay J, Niszl IA, Seal DV, Markus MB, et al. Use of subgenic 18S ribosomal DNA PCR and sequencing for genus and genotype identification of Acanthamoebae from humans with keratitis and from sewage sludge. J Clin Microbiol. 2001;39:1903-11.

25. Siripanth C, Punpoowong B, Riganti M. Early detection and identification of amphizoic amoebae from nasal exudates of a symptomatic case. J Med Assoc Thai. 2005;88:545-9.

26. Thamprasert K, Khunamornpong S, Morakote N. Acanthamoeba infection of peptic ulcer. Ann Trop Med Parasitol. 1993;87:403-5.

27. Trabelsi H, Dendana F, Sellami A, Sellami H, Cheikhrouhou F, Neji S, et al. Pathogenic free-living amoebae: epidemiology and clinical review. Pathol Biol (Paris). 2012;60:399-405.

28. Tsvetkova N, Schild M, Panaiotov S, Kurdova-Mintcheva R, Gottstein B, Walochnik J, et al. The identification of free-living environmental isolates of amoebae from Bulgaria. Parasitol Res. 2004;92:405-13.

29. Uparanukraw P, Morakote N. Detection of circulating Trichinella spiralis larvae by polymerase chain reaction. Parasitol Res. 1997;83:52-6.

30. Visvesvara GS. Pathogenic and opportunistic free-living amoebae. In: Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH, ed. Manual of clinical microbiology. 7th ed. Washington DC: ASM Press; 1999. p. 1383-90.

31. Walochnik J, Haller-Schober E, Kolli H, Picher O, Obwaller A, Aspock H. Discrimination between clinically relevant and nonrelevant Acanthamoeba strains isolated from contact lens- wearing keratitis patients in Austria. J Clin Microbiol. 2000;38:3932-6.

32. Walochnik J, Picher O, Aspöck C, Ullmann M, Sommer R, Aspöck H. Interactions of “Limax amoebae” and gram-negative bacteria: experimental studies and review of current problems. Tokai J Exp Clin Med. 1998;23:273-8.

33. Wanachiwanawin D, Booranapong W, Kosrirukvongs P. Clinical features of Acanthamoeba keratitis in contact lens wearers and non-wearers. Southeast Asian J Trop Med Public Health. 2012;43:549-56.

34. Wannasan A, Chaiwong P, Bunchoo M, Morakote N. Occurence of thermotolerant Naegleria and Acanthamoeba in some natural water sources in Chiang Mai. Chiang Mai Med J. 2009;48:117-24.

35. Wiwanitkit V. Review of clinical presentations in Thai patients with primary amoebic meningoencephalitis. MedGenMed. 2004;6:2.

Received: 19 October 2012Accepted: 13 March 2013


(1) LIM-54, Departamento de Doenças Infecciosas e Parasitárias da Faculdade de Medicina da Universidade de São Paulo, Av. Dr. Enéas de Carvalho Aguiar 500, 1 andar, sala 112, 05403-000 Sao Paulo, SP, Brazil.

(2) Serviço de Controle de Infecção Hospitalar, Hospital do Câncer A.C. Camargo, Rua Prof. Antonio Prudente 211, 01509-010 Sao Paulo, SP, Brazil.(3) Laboratorio de Microbiologia, Hospital das Clinicas da Universidade de São Paulo, Av. Dr. Enéas de Carvalho Aguiar 155, piso 08, bloco 08, 05403-010 Sao Paulo, SP, Brazil.Correspondence to: Silvia Figueiredo Costa, MD, PhD, LIM-54 Departamento de Doenças Infecciosas e Parasitárias da Faculdade de Medicina da Universidade de São Paulo, Av. Dr. Enéas

de Carvalho Aguiar 500, 1 andar, sala 112, 05403-000 Sao Paulo, SP, Brasil. E-mail: [email protected]

Smqnr VARIANTS IN CLINICAL ISOLATES OF Stenotrophomonas maltophilia IN BRAZIL

Jorge Isaac GRACIA-PAEZ(1), Juliana Rosa FERRAZ(1), Ivan Avelino FRANÇA E SILVA(2), Flávia ROSSI(3), Anna Sara LEVIN(1) & Silvia Figueiredo COSTA(1)

SUMMARY

Stenotrophomonas maltophilia contains a novel chromosomally-encoded qnr gene named Smqnr that contributes to low intrinsic resistance to quinolone. We described Smqnr in 13 clinical isolates of S. maltophilia from two Brazilian hospitals, over a 2-year period. The strains were identified by API 20 NE (bioMérieux, France). Susceptibility by microdilution method to trimetroprim/sulfamethoxazole, ciprofloxacin, levofloxacin, minocycline, ceftazidime, chloramphenicol and ticarcillin/clavulanate was performed according to CLSI. PCR detection of Smqnr gene was carried out. The sequence of Smqnr was compared with those deposited in GenBank. Pulsed-field gel electrophoresis (PFGE) of all strains was performed. Thirteen Smqnr positives isolates were sequenced and three novel variants of Smqnr were identified. All 13 Smqnr isolates had distinguishable patterns by PFGE. This is the first report of Smqnr in S. maltophilia isolated in Brazil.

KEYWORKS: Stenotrophomonas maltophilia; Levofloxacin resistance; qnr genes.

INTRODUCTION

Stenotrophomonas maltophilia, a non-fermentative Gram-negative bacillus that is ubiquitous in the environment, has emerged as an important opportunistic pathogen2. This microorganism exhibits intrinsic and acquired resistance to a wide variety of antimicrobial agents and few options of treatment are available2,15. So far, trimethoprim/sulfamethoxazole is the drug of choice to treat infections caused by this microorganism, however, during the past few years increased resistance to this antibiotic has been reported8,15. The new fluoroquinolones such as levofloxacin and moxifloxacin showed promising in vitro activity against S. maltophilia13. Resistance to these new fluoroquinolones, among S. matophilia, is rare and needs to be further researched.

S. maltophilia contains a novel chromosomally-encoded S. maltophilia qnr gene named Smqnr with 219 amino acids with two classic pentapeptide repeat motifs separated by a glycine residue, which confers low level resistance to quinolone antibiotics as showed in vitro experiments12. The role of Smqnr on quinolones resistance, however, is controversial and there is a lack of research evaluating its association with levofloxacin resistance in S. maltophilia.

We describe the characterization of Smqnr genes in clinical isolates of S. maltophilia susceptible and resistant to ciprofloxacin and levofloxacin.


Clinical samples of S. maltophilia isolates from two Brazilian teaching

hospitals, over a 2-year period were evaluated. Isolates were identified by API 20 NE (bioMérieux, France). Susceptibility by microdilution method to trimethoprim/sulfamethoxazole, ciprofloxacin, levofloxacin, minocycline, ceftazidime, chloramphenicol and ticarcillin/clavulanate was performed according to the CLSI (CLSI 2011)4. Tigecycline MIC was interpreted following the Food and Drug Administration (FDA) recommendation for Enterobacteriaceae. Endonuclease-digested genomic DNAs were separated by pulsed-field gel electrophoresis (PFGE) using a CHEF-DR III system (Bio-Rad, USA). Genomic DNA was digested with 10U of SpeI (fermentas, USA). Running conditions were 21 h at 14 °C, with and initial switching time of one s and final time of 30 s, at 6 V/cm.

PCR for the Smqnr gene was carried out using five different set of specific sequence primers QnrM+ (5’-CTTGGCATGGAATCCC TGAT-3’)/QnrM- (5’-TGATGCCTACGGCACCAC-3’), QnrMR55+ (5’-CATGGCATGGAATCCCCGAT-3’)/QnrMR55- (5’-TGATG TCTACGGCACCAC-3’), qnrA (F:5’-CTCGAATGCCTGGCGCG TGTTT-3’) (R: 5’- AAGAGATTTCTCAGCCAGG-3’), qnrB (F: 5’-TGCCAGGCACAGATCTTGAC-3’) (R: AGGMATHGAAATTCG CCACTG-3’) and qnrS (F: 5’- TTTGCYGYYCGCCAGTCGAA-3’) (R:5’:GCAAGTTCATTGAACAGGGT-3’) and was performed in accor-dance with SANCHEZ et al. (2008) and ROBICSEK et al. (2006)10,11. We used five set of primers because the regions around qnr are different in the sequences of S. maltophilia strains K279a, R551-3 and qnr A, B, S of Enterobacteriaceae species.

The nucleotide sequences and the deduced amino acid sequence were

GRACIA-PAEZ, J.I.; FERRAZ, J.R.; FRANÇA E SILVA, I.A.; ROSSI, F.; LEVIN, A.S. & COSTA, S.F. - Smqnr variants in clinical isolates of Stenotrophomonas maltophilia in Brazil. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 417-20, 2013.

418

analyzed using the biological sequence aligment editor and CLUSTALW (www.mbio.ncsu.edu/bioedit/bioedit) (CA, USA).

This study was approved by the Ethics Committee of the two hospitals.

RESULTS

Thirteen S. maltophilia isolates harboring Smqnr were studied, eight resistant to ciprofloxacin and two to levofloxacin. QnrM gene was detected only using primers derived from S. maltophilia strain K279a; qnr A, B and S genes of Enterobacteriaceae were not detected.

All 13 isolates showed distinguishable patterns by PFGE (Table 1). The distribution of isolates occurred evenly in different units and with different clonal profiles during the study period, which ruled out the possibility of an outbreak.

Two of the 13 isolates were resistant (MIC 8 and 16 mg/L) and two showed increased MIC to levofloxacin (MIC 4 mg/L). Eight isolates were resistant and one exhibited increased MIC to ciprofloxacin (MIC ≥ 2 mg/L). Two isolates were resistant to trimethoprim/sulfamethoxazole (MIC 4 and 8 mg/L). Two isolates were resistant to tigecycline (MIC 4 and 8 mg/L) and all isolates were susceptible to minocycline (MIC < 4 mg/L) (Table 1).

The Smqnr peptide sequences of the 13 isolates were compared with the known Smqnr 1-27 subtypes in GenBank. Sequence analysis showed that seven isolates were identical to the equivalent sequence of Smqnr6 from Japan (AB430849), the other isolates were distributed as

followed: one Smqnr4 (GenBank AB430842), one Smqnr12 (GenBank AB430844) and one Smqnr1 (Genbank AB430839) identified in Japan. Three novel variants were observed, the subtype SmqnrLIM31 have six amino acid residues differences, the subtype SmqnrLIM39 have four amino acid residues differences and subtype SmqnrLIM45 showed two amino acids alteration (Fig. 1).

DISCUSSION

S. maltophilia strains display high ciprofloxacin resistance, mainly due to several efflux systems1. However, in vitro, susceptibility testing to levofloxacin is recommended by CLSI (CLSI 2009), and levofloxacin and moxifloxacin are used to treat infections caused by this pathogen. Resistance to levofloxacin and moxifloxacin is still rare among S. maltophilia5,14. Two recent studies of clinical isolates of S. maltophilia that evaluated 102 isolates of bloodstream infection and 377 isolates (majority from the respiratory tract and blood) showed respectively 92.9% and 79.6% of susceptibility to levofloxacin5,14. In our study two isolates showed resistance and two increased MIC to levofloxacin. All isolates were susceptible to minocycline and two were resistant to trimethoprim/sulfamethoxazole. Despite good activity in vitro, the experience of the clinical use of minocycline to treat infections caused by S. maltophilia is restricted to anecdotal reports7.

The Smqnr plasmid mediated genes are pentapeptides repeat proteins that confer low-level resistance to quinolone by protecting DNA gyrase. The potential source of qnr is believe to be horizontal transfer by integrons and mobile genetic elements from chromosome of aquatic or environmental bacterial, such Shewanella algae, Aeromonas spp., Psychromonas spp and Vibrionaceae14.

Table 1Characteristics and antimicrobial susceptibilities of 13 clinical isolates of S. maltophilia

Isolates Source PFGEMIC (mg/L)

SMX LEV CIP MIN TIG CAZ CLO TIC

LIM7 Blood A 0.5 1 8 <0.25 0.5 64 8 8

LIM9 Blood B 2 2 8 0.5 1 32 8 8

LIM11 Blood C 2 <0.25 1 0.25 0.25 32 8 >128

LIM14 CVC D <0.25 <0.25 0.5 0.25 0.25 >128 8 32

LIM31 CVC E <0.25 1 2 <0.25 0.5 4 32 32

LIM33 CVC F 1 16 64 2 4 16 32 64

LIM35 CVC G 0.5 0.25 4 <0.25 0.25 >128 16 128

LIM37 CVC H 0.25 0.5 8 <0.25 2 128 16 32

LIM39 CVC I 0.5 4 16 4 2 8 64 128

LIM41 CVC J 8 8 32 2 8 64 128 32

LIM45 BAL K 4 0.5 2 0.5 2 64 >128 128

LIM47 Blood L 0.5 1 1 <0.25 2 4 32 32

LIM49 Blood M 1 4 16 <0.25 1 8 128 >128

MIC, microdilutional method; BAL, Bronchoalveolar lavage; CVC, cateter venous central; PFGE, Pulsed field gel electrophoresis; SXT, trimethoprim/sulfamethoxa-zole; LEV, levofloxacin; CIP, ciprofloxacin; MIN, minocycline; TIG, tigecycline; CAZ, ceftazidime; CLO,chloramphenicol; TIC, ticarcillin/clavulanate. PFGE: 13 distinguishable patterns (letter A to M).


419

The qnr genes in S. maltophilia isolates have been studied by some authors3,6,17,18. In our study, among 13 isolates harboring Smqnr; two were resistant (MIC 8 and 16 mg/L) and two exhibited increased MIC to levofloxacin (MIC 4 mg/L) and eight isolates exhibited resistant to ciprofloxacin. Three new Smqnr variants were identified. Two (LIM31 and LIM45) of them presented high levofloxacin MIC. The isolates were polyclonal, showing that they did not have a clonal relationship. This is the first study that reports Smqnr in S. maltophilia clinical isolates in Brazil.

One important limitation of our study is that we were not able to perform cloning and transformation assays to confirm the role of Smqnr on fluorquinolone resistance in S. maltophilia.

The role of Smqnr on quinolones resistance among S. maltophilia, remains controversial, and appears to be associated with the clonality of strains and varies with the hospital and country. A recent study conducted in China, evaluated 442 clinical isolates of S. maltophilia from nine hospitals. The resistance against co-trimoxazole was 48.6%, and a high susceptibility was shown to levofloxacin, only 6.1% of strains were resistant to levofloxacin18. Smqnr genes were detected in 114 (26%) isolates in similar frequency in both quinolones sensitive and nonsensitive strains. Twenty new variants of Smqnr genes were identified and called Smqnr (28-47)18. An in vitro study, showed that overexpression of Smqnr upon deletion increased modestly the MIC of nalidixic acid and moxifloxacin3. And finally, a study conducted in the UK, identified two new variants of Smqnr that when expressed in E. coli top10 showed reduced susceptibility to several quinolone including levofloxacin and moxifloxacin16.

In conclusion, this is the first report of the presence of Smqnr in isolates of S. matophilia resistant or with high levofloxacin MIC in Brazil. Three new Smqnr variants were identified. These findings alert the clinicians to the emergence of resistance to this antibiotic that is widely used in the treatment of infections by this agent, and strengthens the role of Smqnr with levofloxacin resistance. In addition, minocycline presented good activity in vitro against multidrug resistant strains of S. maltophilia and, in the future, may be an option for the treatment of infections caused by this agent.

RESUMO

Variantes de Smqnr de isolados clínicos de Stenotrophomonas maltophilia no Brasil

S. maltophilia contem um novo gene qnr cromossômico denominado Smqnr que contribui para baixa resistência intrínseca a quinolonas. Descrevemos Smqnr em 13 isolados clínicos de S. maltophilia de dois hospitais brasileiros, ao longo do período de dois anos. Os isolados foram identificados pela API 20 NE (bioMérieux, França). Susceptibilidade pelo método de microdiluição dos seguintes antibióticos trimetroprim/sulfametoxazol, ciprofloxacina, levofloxacina, minociclina, ceftazidima, cloranfenicol e ticarcilina/clavulanato foi realizada segundo o CLSI. Detecção do gene de Smqnr foi realizada por PCR. A sequência de Smqnr foi comparada com aquelas depositadas no GenBank. Foi realizada eletroforese em gel de campo pulsado (PFGE) de todos os isolados. Treze isolados contendo Smqnr foram sequenciados e identificados três variantes do gene Smqnr. Todos os 13 isolados de Smqnr apresentaram diferentes padrões por PFGE. Este é o primeiro relato de Smqnr em isolados de S. maltophilia no Brasil.

Fig. 1 - Aminoacid sequence alignments of 13 SmQnr proteins from Brazil, SmQnr1

(SHIMIZU et al.) and SmQnr 13 (GORDON et al). Asterisks, identical aminoacids, colons,

strongly similar aminoacids (conserved substitutions); full stops, weakly similar amino

acids (semi-conserver substitutions); spaces, variable aminoacids. Amino acid differences

are shown in redbold.


420

FUNDING

This study was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) number: 2009/022844.

TRANSPARENCY DECLARATIONS

None to declare.

CONFLICT OF INTEREST

The authors declare that they have no conflict of interest with the organization that sponsored the research.

REFERENCES

1. Alonso A, Martínez JL. Cloning and charecterization of SmeDEF, a novel multidrug efflux pump from Stenotrophomonas maltophilia. Antimicrob Agents Chemother. 2000;44:3079-86.

2. Brooke JS. Stenotrophomonas maltophilia: an emerging global opportunistic pathogen. Clin Microbiol Rev. 2012;25:2-41.

3. Chang YC, Tsai MJ, Huang YW, Chung TC, Yang TC. SmQnrR, a DeoR-type transcriptional regulator, negatively regulates the expression of Smqnr and SmtcrA in Stenotrophomonas maltophilia. J Antimicrob Chemother. 2011;66:1024-8.

4. Clinical and Laboratory Standards Institute. Performance standars for antimicrobial susceptibility testing. CLSI. 2011;3:M100-S21.

5. Garazi M, Singer C, Tai J, Ginocchio CC. Bloodstream infections caused by Stenotrophomonas maltophilia: a seven-year review. J Hosp Infect. 2012;81:114-8.

6. Gordon NC, Wareham DW. Novel variants of the Smqnr family of quinolone resistance

genes in clinical isolates of Stenotrophomonas maltophilia. J Antimicrob Chemother. 2010;65:483-9.

7. Harada N, Soejima Y, Taketomi A, Yoshizumi T, Uchiyama H, Maehara Y. Stenotrophomonas maltophilia bacteremia after living donor liver transplantation: report of a case. Surg Today. 2008,38:469-72.

8. Hu LF, Chang X, Ye Y, Wang ZX, Shao YB, Shi W, et al. Stenotrophomonas maltophilia resistance to trimethoprim/sulfamethoxazole mediated by acquisition of sul and dfrA genes in a plasmid-mediated class 1 integron. Int J Antimicrob Agents. 2011;37:230-4.

9. Nordmann P, Poirel l. Emergency of plasmid-mediated resistance of quinolones in Enterobacteriaceae. J Antimicrob Chemother. 2005;56:463-9.

10. Robicsek A, Strahilevitz J, Sahm DF, Jacoby GA, Hooper DC. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob Agents Chemother. 2006;50:2872-4.

11. Sánchez MB, Hernández A, Rodríguez-Martínez JM, Martínez-Martínez L, Martínez JL. Predictive analysis of transmissible quinolone resistance indicates Stenotrophomonas maltophilia as a potential source of a novel family of Qnr determinants. BMC Microbiol. 2008;8:148-52.

12. Sánchez MB, Martinez JL. Smqnr contributes to intrinsic resistance to quinolones in Stenotrophomonas maltophilia. Antimicrob Agents Chemother. 2010;54:580-1.

13. Saugel B, Eschermann K, Hoffmann R, Hapfelmeier A, Schultheiss C, Phillip V, et al. Stenotrophomonas maltophilia in the respiratory tract of medical intensive care unit patients. Eur J Clin Microbiol Infect Dis. 2012;31:1419-28.

14. Shimizu K, Kikuchi K, Sasaki T, Takahashi N, Ohtsuka M, Ono Y, et al. Smqnr, a new chromosome-carried quinolone resistance gene in Stenotrophomonas maltophilia. Antimicrob Agents Chemother. 2008;52:3823-5.

15. Toleman MA, Bennett PM, Bennett DMC, Jones RN, Walsh TR. Global emergence of Trimethoprim/sulfamethoxazole resistance in Stenotrophomonas maltophilia mediated by acquisition of sul genes. Emerg Infect Dis. 2007;13:559-65.

16. Wareham DW, Gordon NC, Shimizu K. Two new variants of and creation of a repository for Stenotrophomonas maltophilia quinolone protection protein (Smqnr) genes. Int J Antimicrob Agents. 2011;37:89-90.

17. Wu H, Wang JT, Shiau YR, Wang HY, Lauderdale TL, Chang SC, et al. A multicenter surveillance of antimicrobial resistance on Stenotrophomonas maltophilia in Taiwan. J Microbiol Immunol Infect. 2012;45:120-6.

18. Zhang R, Sun Q, Hu YJ, Yu H, Li Y, Shen Q, et al. Detection of the Smqnr quinolone protection gene and its prevalence in clinical isolates of Stenotrophomonas maltophilia in China. J Med Microbiol. 2012;61(Pt 4):535-9.

Received: 1 April 2013Accepted: 3 July 2013


(1) Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, SP, Brazil. E-mail: [email protected](2) Lab. Parasitologia, Instituto Butantan, São Paulo, SP, Brazil. E-mails: [email protected]; [email protected](3) Lab. Química e Produtos Naturais, Universidade de São Paulo, São Paulo, SP, Brazil. E-mail: [email protected] to: Ludmila Nakamura Rapado, E-mail: [email protected]

BRIEF COMMUNICATION

OVICIDAL EFFECT OF PIPERACEAE SPECIES ON Biomphalaria glabrata, Schistosoma mansoni HOST

Ludmila Nakamura RAPADO(1,2), Priscila Orechio de Moraes LOPES(2), Lydia Fumiko YAMAGUCHI(3) & Eliana NAKANO(2)

SUMMARY

Schistosomiasis is a neglected disease with public health importance in tropical and subtropical regions. An alternative to the disease control is the use of molluscicides to eliminate or reduce the intermediate host snail population causing a reduction of transmission in endemic regions. In this study nine extracts from eight Piperaceae species were evaluated against Biomphalaria glabrata embryos at blastula stage. The extracts were evaluated in concentrations ranging from 100 to 10 mg/L. Piper crassinervium and Piper tuberculatum extracts were the most active (100% of mortality at 20 mg/L and 30 mg/L respectively).

KEYWORDS: Schistosomiasis; Biomphalaria glabrata; Embryos; Crude extracts; Piperaceae; Molluscicide.

INTRODUCTION

Schistosomiasis is one of the most prevalent, debilitating and neglected diseases of tropical and subtropical regions, such as Africa, Asia and South America. This disease is a relevant health and social-economic problem with more than 390-600 million people estimated to have been infected worldwide, while 800 million people remain under infection risk11,29.

Currently, the main strategy to control schistosomiasis is based on the periodic treatment of people living in risk areas with anti-schistosomicidal drugs in order to reduce morbidity and transmission28. However, evidence indicates that resistance and tolerance to praziquantel, a main drug used in Schistosoma mansoni treatment, have been increasing6,9.

Freshwater snails of Biomphalaria genus play a major role as intermediate hosts in the transmission of S. mansoni because an intense multiplication of parasites occurs in these snails. Thus, any strategy to control snail populations for reduction of schistosomiasis transmission in endemic regions should consider some treatment at this critical stage15.

Currently, niclosamide marketed as Bayluscide® is the most important molluscicide recommended by World Health Organization (WHO) to control the host of schistosomiasis32. However, niclosamide, has plenty of adverse factors, such as, non-selective toxicity, that harms other aquatic organisms; high cost; instability in sunlight, which in addition requires frequent reapplication due to the permanence of surviving snails after its

application1,10,32. Thus, novel natural molluscicidal should be investigated as a possible alternative to synthetic products16,17,18,25.

The genus Piper belongs to the Piperaceae family and includes more than 2000 species widely distributed in the tropical and subtropical regions of the world13. Piper species are important plants used in Chinese medicine, in the Indian Ayurvedic system and folk medicine practices of Latin America and West Indies. Furthermore, studies with plants from the Piperaceae family have shown a great diversity of secondary metabolites with biological activity14.

Recently, schistosomicidal and molluscicidal activities of Piperaceae species have been described and this family is considered promising for studies of schistosomiasis prevention and control19,20,25.

In this work, nine crude extracts of eight Piperaceae species were assessed for ovicidal activity against Biomphalaria glabrata (Say, 1818) embryos.


Ovicidal assay was performed according to the methodology recommended by the WHO30,31 and the experimental procedures were according to the accepted principles of animal welfare in experimental science.

Embryos were obtained from Biomphalaria glabrata snail originally

RAPADO, L.N.; LOPES, P.O.M.; YAMAGUCHI, L.F. & NAKANO, E. - Ovicidal effect of Piperaceae species on Biomphalaria glabrata, Schistosoma mansoni host. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 421-4, 2013.

422

from Belo Horizonte, MG, Brazil, and kept in a laboratory under light, temperature and feeding controlled.

Plant material: Fresh material of each Piperaceae species (Table 1) was collected by Dr Massuo Jorge Kato from Universidade de São Paulo (Chemical Institute) and identified by Dr Elsie F. Guimarães from Instituto de Pesquisas Jardim Botânico do Rio de Janeiro. Vouchers were deposited in the Herbarium of Jardim Botânico do Rio de Janeiro, Brazil.

Preparation of extracts and samples: Selected parts of freshly collected plant material were separated, immediately air dried and finally dried in an oven at 45 ºC for 24 h (Table 1). Material was ground and extracted with ethyl acetate: methanol (2:1) at room temperature (25-28 ºC) three times and filtered. Extracts were concentrated to dryness under vacuum in a rotary evaporator and stored at -20 ºC.

A stock solution containing 1 g/L of each extract was prepared by suspending 10 mg of extract in 0.1 mL of 99.9% dimethylsulphoxide (DMSO: Aldrich, Milwaukee, WI, USA) and making up to 10 mL with dechlorinated water. Stock solutions were diluted with dechlorinated water in order to provide assay solutions

.

Assay for ovicidal activity: Egg masses with embryos at blastula stage5 were exposed to Piperaceae extracts (Table 1) firstly at 100 mg/L for 24 hours and observed for seven days. Inactive extracts at this concentration were not further investigated since crude preparation of plant material should be active at 100 mg/L or less, according to WHO31.

Tests were carried out with egg masses laid on small pieces of plastic sheet that had been left floating on the aquaria water. The pieces of plastic sheets with adhered egg masses were carefully transferred to Petri dishes, where they were further exposed to testing solutions. For each concentration, five egg masses were used and assays were repeated three times. The number of snail embryos to each concentration is indicated in Tables 2 and 3. At the end of exposure (24 hours), egg masses were washed with dechlorinated water. Petri dishes containing egg masses were kept within climatic chambers under controlled temperature (25 °C ± 1 °C). All egg masses were examined daily under a stereomicroscope up to the 7th day. Embryos were considered as dead whenever disintegrating embryonic forms were noted within the egg and or, at later developmental stages and no heartbeats were detected. A negative control group was maintained in 1% DMSO on dechlorinated

water under the same experimental conditions. Bayluscide WP70® was used as a positive control2.

The LC50

(50% lethal concentration) and the 95% confidence intervals for active extracts were estimated using Trimmed Spearman-Karber Method12.

RESULTS AND DISCUSSION

Three extracts from Piperaceae species were active with 100% of embryo mortality at 100 mg/L: P. crassinervium inflorescence extract and P. tuberculatum inflorescence and leaf extracts (Table 2). Both species showed 100% of lethality at 100 mg/L during the 24 h exposure period (Table 2, Fig. 1). These extracts were also evaluated at lower concentrations and inflorescence extract of P. crassinervium was more active than P. tuberculatum inflorescence and leaf extracts (100% of mortality at 20 mg/L and 30 mg/L respectively) (Table 3).

No increase of embryolethality was observed in embryos exposed to leaf extracts of P. solmsianum, P. callosum, P.oreophylla, P. tretraphylla, P. mallacophyllum and P. glabella at 100 mg/L (Table 2). Percentage of dead embryos in control groups during all the study was not higher than 1.2%.

RAPADO et al. (2011) evaluated the molluscicidal effect of P.

Table 1Piperaceae species screened for ovicidal activity in B. glabrata embryos

Species Collecting sites Selected part Voucher

Piper callosum Ruiz & Pav. São Paulo, SP leaf K-161

Piper crassinervium Kunth Apiaí, SP inflorescence K-091

Peperomia glabella (Sw.) A. Dietr. Apiaí, SP leaf K-856

Piper mallacophyllum (C.Presl).C.DC. Capão Bonito, SP leaf K-447

Peperomia oreophylla Hensch Extrema, MG leaf K-579

Piper solmsianum C.DC São Paulo, SP leaf K-487

Peperomia tetraphylla G. Forst Apiaí, SP leaf K-370

Piper tuberculatum Jacq. São Paulo, SP leaf and inflorescence K-169SP- São Paulo; MG- Minas Gerais.

Table 2Ovicidal effect of Piperaceae extracts at blastula stage at 100 mg/L

Species Part No. embryosMortality in 7

days (%)

P. callosum leaf 99 5.05

P. crassinervium* inflorescence 106 100

P. glabella leaf 102 73.01

P. malacophyllum leaf 143 5.59

P. oreophyllla leaf 108 0

P. solmsianum leaf 103 1.78

P. tetraphylla leaf 89 0

P. tuberculatum* leaf 101 100

inflorescence 98 100* Death during the 24 h exposure period.


423

crassinervium leaf extract in B. glabrata adult and embryos at blastula stage obtained 100% of mortality at 60 mg/L and 50 mg/L respectively. This species has flavonoids and prenylated benzoic acid as major compound in leaf, classes of compounds with molluscicide activities already described8,24. Nevertheless is not known if those compounds are responsible for the molluscicidal activity obtained in this study using inflorescence extract.

The P. tuberculatum is largely used in folk medicine as a sedative and antidote for snake bite. It has been shown that extracts and amides isolated from P. tuberculatum fruit and seeds have also a potent antifungal activity against Cladosporium sphaerospermum (100% active in 5 µg) and parasitic activity in Trypanosoma cruzi (IC

50 = 17.2 µg/mL in

epimastigote), Leishmania donovani (IC50

= 7.5 µg/mL in promastigote) and S. mansoni (100% mortality in 9.5 µM)4,7,19,21,22,27. In this study, leaves and inflorescences extract showed ovicidal activity in equal concentrations, suggesting the possible presence of active compounds in both parts of the plant.

Studies with molluscicides compounds show that it is usual to obtain the death of B. glabrata snail but not the embryos18,23,25. The

lack of ovicidal activity allows the permanence of the snail host in the environment, maintaining the transmission of schistosomiasis.

The Euphorbiaceae species are known for producing latex with molluscicidal activity restricted to B. glabrata adults (100% mortality at 1.5 mg/L)3,26. Different from this, Piper species are lethal to B. glabrata adults and embryos in concentrations recommended by WHO as Piper cuyabanum (100% lethal for adults and embryos at 20 mg/L), Piper aduncum (100% lethal in adults at 10 mg/L and embryos at 50 mg/L) and Piper hostmannianum (100% lethal in adults at 40 mg/L and embryos at 20 mg/L)25.

In this work, three extracts from two Piperaceae species were lethal to B. glabrata embryos under concentrations recommended by WHO31. Thus P. tuberculatum and P. crassinervium extracts were active at 30 mg/L and 20 mg/L respectively which make them species targets for isolation and identification of ovicidal compounds since these species are also active in B. glabrata adult25.

RESUMO

Efeito ovicida de espécies de Piperaceae em Biomphalaria glabrata, hospedeiro do Schistosoma mansoni

A esquistossomose é uma doença negligenciada de importância para a saúde pública em regiões tropicais e subtropicais. Uma alternativa para o controle da doença é o uso de moluscicidas para eliminar ou reduzir a população de caramujo hospedeiro, acarretando uma redução da transmissão da doença nas regiões endemicas. Neste estudo, nove extratos vegetais provenientes de oito espécies de Piperaceae foram expostos a embriões de Biomphalaria glabrata no estágio de blástula. Os extratos foram avaliados em concentrações que variaram entre 100 e 10 mg/L, sendo Piper crassinervium e Piper tuberculatum os extratos mais ativos (100% de mortalidade a 20 mg/L e 30 mg/L respectivamente).

Table 3Species with ovicidal activity at the blastula stage in concentrations lower than 100 mg/L

Species Selected partConcentration

(mg/L)No. embryos Mortality (%)

LC50

(mg/L)

P. crassinervium inflorescence

5101520

94108113105

021.2962.83 100

12.39 [11.75-13.07]

P. tuberculatum

leaf

1015202530

11012598107101

05.6

31.6355.14100

22.15 [21.41-22.92]

inflorescence

51015202530

11710991102116120

077.09 78.4294.1196.68100

9.07 [8.57-9.60]

[ ] 95% confidence intervals; Mortality obtained in 7 days.

Fig. 1 - Embryos of B. glabrata at blastula stage during the exposure period. A- Dead embryos

exposure to leaf extract of P. tuberculatum at 100 mg/L and B- Normal embryo (control group).


424

ACKNOWLEDGEMENTS

This article is dedicated to the memory of Dr. Toshie Kawano, a researcher who initially coordinated this work and devoted her studies to schistosomiasis control.

This work was supported by grants from FAPESP (Project number 09/51850-9) coordinated by Prof. Dr Massuo Jorge Kato.

The authors are grateful to Dr Massuo Jorge Kato for providing access to the Piperaceae extracts.

REFERENCES

1. Abreu FC, Goulart MOF, Brett AMO. Detection of the damage caused to DNA by niclosamide using an electrochemical DNA-biosensor. Biosens Bioelectron. 2002;17:913-9.

2. Andrews P, Thyssen J & Lorke D. The biology and toxicology of molluscicides, Bayluscide. Pharmacol Ther. 1983;19:245-95.

3. Baptista DF, Vasconcellos MC, Lopes FE, Silva IP, Schall VT. Perspectives of using Euphorbia splendens as a molluscicide in schistosomiasis control programs. Southeast Asian J Trop Med Public Health. 1994;25:419-24.

4. Bodiwala H, Singh G, Singh R, Dey CS, Sharma SS, Bhutani KK, et al. Antileishmanial amides and lignans from Piper cubeba and Piper retrofractum. J Nat Med. 2007;61:418-21.

5. Camey T, Verdonk NH. The early development of the snail Biomphalaria glabrata (Say) and the origin of the head organs. Netherlands J Zool. 1969;20:93-121.

6. Cioli D. Praziquantel: is there real resistance and are there alternatives? Curr Opin Infect Dis. 2000;13:659-63.

7. Cotinguiba F, Regasini LO, Bolzani VS, Debonsi HM, Passerini GD, Cicarelli RMB, et al. Piperamides and their derivatives as potential anti-trypanosomal agents. Med Chem Res. 2009;18:703-11.

8. Danelutte AP, Lago JHG, Young MCM, Kato MJ. Antifungal flavanones and prenylated hydroquinones from Piper crassinervium Kunt. Phytochemistry. 2003;64:555-9.

9. Doenhoff MJ, Cioli D, Utzinger J. Praziquantel: mechanisms of action, resistance and new derivatives for schistosomiasis. Curr Opin Infect Dis. 2008;21:659-67.

10. Giovanelli A, Silva CL, Medeiros L, Vasconcellos MC. The molluscicidal activity of niclosamide (Bayluscide WP70®) on Melanoides tuberculata (Thiaridae), a snail associated with habitats of Biomphalaria glabrata (Planorbidae). Mem Inst Oswaldo Cruz. 2002;97:743-5.

11. Gray DJ, McManus DP, Li Y, Williams GM, Bergquist R, Ross AG. Schistosomiasis elimination: lessons from the past guide the future. Lancet Infect Dis. 2010;10:733-6.

12. Hamilton MA, Russo RC, Thurston RV. Trimmed Spearman-Karber method for estimating median lethal concentrations in toxicity bioassays. Environ Sci Technol. 1977;11:714-8.

13. Jaramillo MA, Manos PS, Zimmer EA. Phylogenetic relationships of the perianthless Piperales: reconstructing the evolution of floral development. Int J Plant Sci. 2004;165:403-16.

14. Kato M, Furlan M. Chemistry and evolution of the Piperaceae. Pure Appl Chem. 2007;79:529-38.

15. Lardans VD, Dissous C. Snail control strategies for reduction of schistosomiasis transmission. Parasitol Today. 1998;14:413-7.

16. Luna JS, Santos AF, Lima MRF, Omena MC, Mendonça FAC, Bieber LW, et al. A study of the larvicidal and molluscicidal activities of some medicinal plants from northeast Brazil. J Ethnopharmacol. 2005;97:199-206.

17. Mello-Silva CC, Vilar MM, Bezerra JCB, Vasconcellos MC, Pinheiro J, Rodrigues ML. Reproductive activity alterations on the Biomphalaria glabrata exposed to Euphorbia splendens var. hislopii latex. Mem Inst Oswaldo Cruz. 2007;102:671-4.

18. Miyasato PA, Kawano T, Freitas JC, Berlinck RGS, Nakano E, Tallarico LF. Molluscicidal activity of some marine substances against the snail Biomphalaria glabrata (Mollusca, Planorbidae). Parasitol Res. 2012;110:1873-9.

19. Moraes J, Nascimento C, Lopes PO, Nakano E, Yamaguchi LF, Kato MJ, et al. Schistosoma mansoni: in vitro schistosomicidal activity of piplartine. Exp Parasitol. 2011;127:357-64.

20. Moraes J, Nascimento C, Yamaguchi LF, Kato MJ, Nakano E. Schistosoma mansoni: in vitro schistosomicidal activity and tegumental alterations induced by piplartine on schistosomula. Exp Parasitol. 2012;132:222-7.

21. Navickiene HMD, Alécio AC, Kato MJ, Bolzani VS, Young MC, Cavalheiro AJ, et al. Antifungal amides from Piper hispidum and Piper tuberculatum. Phytochemistry. 2000;55:621-6

22. Navickiene HMD, Bolzani VS, Kato MJ, Pereira AM, Bertoni BW, França SC, Furlan M. Quantitative determination of anti-fungal and insecticide amides in adult plants, plantlets and callus from Piper tuberculatum by reverse-phase high-performance liquid chromatography. Phytochemical Anal. 2003;14:281-4.

23. Oliveira-Filho EC, Geraldino BR, Coelho DR, De-Carvalho RR, Paumgartten FJ. Comparative toxicity of Euphorbia milii latex and synthetic molluscicides to Biomphalaria glabrata embryos. Chemosphere. 2010;81:218-27.

24. Orjala J, Erdelmeier CAJ, Wright AD, Rali T, Sticher O. Five new prenylated p-hydroxybenzoic acid-derivatives with antimicrobial and molluscicidal activity from Piper aduncum leaves. Planta Med. 1993;59:546-51.

25. Rapado LN, Nakano E, Ohlweiler FP, Kato MJ, Yamaguchi LF, Pereira CA, et al. Molluscicidal and ovicidal activities of plant extracts of the Piperaceae on Biomphalaria glabrata (Say, 1818). J Helminthol. 2011;85:66-72.

26. Schall VT, Vasconcellos MC, Souza CP, Baptista DF. The molluscicidal activity of crown of christ (Euphorbia splendens var. hislopii) latex on snails acting as intermediate hosts of Schistosoma mansoni and Schistosoma haematobium. Am J Trop Med Hyg. 1998;58:7-10.

27. Silva RV, Navickiene HM, Kato MJ, Bolzani VS, Méda CI, Young MC, et al. Antifungal amides from Piper arboreum and Piper tuberculatum. Phytochemistry. 2002;59:521-7.

28. World Health Organization. Working to overcome the global impact of neglected tropical diseases. First WHO report on neglected tropical diseases. Geneva: WHO; 2010. [WHO/HTM/NTD/2010.1].

29. World Health Organization. Schistosomiasis: population requiring preventive chemotherapy and number of people treated in 2010. Wkly Epidemiol Rec. 2012;4:37-44.

30. World Health Organization. Molluscicide screening and evaluation. Bull World Health Organ. 1965;334:567-81.

31. World Health Organization. Report of the scientific working group on plant molluscicides. Bull World Health Organ.1983;12:1-11.

32. World Health Organization. The role of mollusciciding in schistosomiasis control. Geneva: WHO; 1992. [WHO/SCHISTO/92.107;1992].

Received: 27 January 2013Accepted: 2 April 2013


(1) Postgraduate Course of Biology applied to Health, Federal University of Pernambuco, PE, Brazil. E-mail: [email protected](2) Graduate Course on Biological Sciences, Institute of Biological Sciences, University of Pernambuco, PE, Brazil.(3) Parasitology Department, Aggeu Magalhães Research Center, Oswaldo Cruz Foundation, PE, Brazil. E-mails: [email protected], [email protected] (4) Tropical Medicine Department, Clinical Hospital, Federal University of Pernambuco, PE, Brazil. E-mails: [email protected], [email protected] (5) Service of Infectious and Parasitic Diseases, Clinical Hospital, Federal University of Pernambuco, Brazil. E-mail: [email protected](6) Pathology Department, Institute of Biological Sciences, University of Pernambuco, PE, Brazil. E-mail: [email protected] Correspondence to: Zulma M. Medeiros, Centro de Pesquisas Aggeu Magalhães CPqAM/Fiocruz, Av. Professor Moraes Rego s/n, 50670-420 Cidade Universitária, Recife, PE, Brazil. E-mail:

[email protected]

CASE STUDY OF A PATIENT WITH HIV-AIDS AND VISCERAL LEISHMANIASIS CO-INFECTION IN MULTIPLE EPISODES

Elis Dionísio da SILVA(1,2,3), Luiz Dias de ANDRADE(3), Paulo Sérgio Ramos de ARAÚJO(3,4), Vera Magalhães SILVEIRA(4), Carlos Eduardo PADILHA(5), Maria Almerice Lopes da SILVA(3) & Zulma Maria de MEDEIROS(3,6)

SUMMARY

Report of a 45-year-old male farmer, a resident in the forest zone of Pernambuco, who was diagnosed with human immunodeficiency virus (HIV) in 1999 and treated using antiretroviral (ARV) drugs. In 2005, the first episode of visceral leishmaniasis (VL), as assessed by parasitological diagnosis of bone marrow aspirate, was recorded. When admitted to the hospital, the patient presented fever, hepatosplenomegaly, weight loss, and diarrhea. Since then, six additional episodes of VL occurred, with a frequency rate of one per year (2005-2012, except in 2008). In 2011, the patient presented a disseminated skin lesion caused by the amastigotes of Leishmania, as identified by histopathological assessment of skin biopsy samples. In 2005, he was treated with N-methyl-glucamine-antimony and amphotericin B deoxycholate. However, since 2006 because of a reported toxicity, the drug of choice was liposomal amphotericin B. As recommended by the Ministry of Health, this report emphasizes the need for HIV patients living in VL endemic areas to include this parasitosis in their follow-up protocol, particularly after the first infection of VL.

KEYWORDS: Co-infection; Visceral leishmaniasis; HIV infection; AIDS.

INTRODUCTION

Cases of visceral leishmaniasis (VL) co-infection with human immunodeficiency virus (HIV) and acquired immune deficiency syndrome AIDS (VL/HIV-AIDS) have been registered in 35 countries, mainly in southwestern Europe. VL/HIV-AIDS co-infections increase in areas where these two diseases coexist, as observed in Asian, African, and Latin American countries. In the latter group, Brazil has the highest number of cases¹.

In 2011, in Brazil, VL appeared in 22 of the 27 Brazilian states, covering urban and suburban areas. Between 1998 and 2009, the annual average was 3,349 cases7. From 1980 to 2011 in Brazil, 608,230 cases of AIDS were reported. This epidemic tends to spread to poorly inhabited macro-regions as well as to medium and small cities8. When AIDS and VL databases were correlated, 176 cases of VL/HIV-AIDS co-infection were detected among the Federal States7.

Several episodes of VL are frequent in cases of VL/HIV-AIDS co-infection. According to BOURGEOIS et al., 2010, these patients present a novel nosological entity called ‘active chronic visceral leishmaniasis’. This condition may be termed ‘chronic’ because of the presence of relapses over a period of several years and ‘active’ because of the continuous blood circulation of the parasite. On the other hand,

it’s impossible to know if repeated episodes are relapses or reinfections by using conventional parasitological and immunological methods15. Some studies show that individuals with HIV/AIDS and infected with VL often present atypical clinical manifestations and high incidence of relapse5,22,24,25. Molecular methods confirm that more than 90% of these cases are relapses, rather than reinfections27. The discrimination between relapses and reinfection can be made by molecular techniques based on restriction fragment length polymorphism (RFLP) analysis. The use of this technology may provide the physician with more information to determine Leishmania infections in patients who do not respond to treatment20.

Professionals, who treat patients with HIV/AIDS, report that this co-infection was not prioritized because of the variety of diseases related to immunosuppression, in addition to not being included among the AIDS-defining conditions11. To alert healthcare professionals about this association, we describe the case of a patient presenting multiple VL/HIV-AIDS co-infections during the seven years of evolution of this disease.

CASE REPORT

In 1999, a 31-year-old male farmer, who was a resident in the forest zone of Pernambuco, was admitted to the Clinics Hospital of the Federal University of Pernambuco. At the time of admission, he presented with

SILVA, E.D.; ANDRADE, L.D.; ARAÚJO, P.S.R.; SILVEIRA, V.M.; PADILHA, C.E.; SILVA, M.A.L. & MEDEIROS, Z.M. - Case study of a patient with HIV-AIDS and visceral leishmaniasis co-infection in multiple episodes. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 425-8, 2013.

426

asthenia and headache, and had diarrhea for at least 30 days. He was diagnosed with HIV, and began receiving antiretroviral therapy (ART) with stavudine, lamivudine, and efavirenz. Meanwhile, his 25-year-old partner and 9-month-old daughter were diagnosed with HIV infection.

Five years after initiating ART, the patient presented virological failure; after genotyping, his treatment was changed to tenofovir, lamivudine, and lopinavir/ritonavir. In 2005, he was diagnosed with VL as assessed by directly testing Leishmania in the bone marrow aspirate and initially treated with N-methyl-glucamine-antimony. However, because of pancreatitis, the patient began receiving amphotericin B, which was then replaced by a liposomal formulation because of the onset of renal failure.

In 2011, the patient presented disseminated cutaneous lesions caused by Leishmania, as assessed by histopathological analysis of skin biopsy samples. In July 2012, the patient was readmitted for presenting febrile disease with splenomegaly and pancytopenia, in addition to showing

positive results for laboratory tests for leishmaniasis (Table 1). After administration of liposomal amphotericin B deoxycholate, the patient’s condition improved, and he was discharged upon recommendation of a secondary prophylaxis by administering liposomal amphotericin B twice a week. Between 2005 and 2012, seven VL infections occurred, as shown in the Table 1.

DISCUSSION

This case describes some of the many clinical, diagnostic, and epidemiologic aspects of VL/HIV-AIDS co-infection. Immunosuppression caused by HIV might lead to the development of symptomatic VL14. In turn, VL might promote the clinical progression of HIV and of AIDS-defining conditions, thus, reducing the possibility of recovery after treatment and increasing the incidence of relapse11. This report showed that individuals with HIV/AIDS and living in endemic areas of VL should include VL assessment in their follow-up protocol. After the first co-infection, by means of clinical and laboratory support, a follow-up

Table 1 Description of clinical events, additional diagnostics, and treatment for the case of co-infection from Pernambuco, between 1999 and 2012

Period (month/year)

Clinical eventsCD4+ T cells (cells/mm3)

Viral load (copies/mL)

Laboratory diagnosis TreatmentProphylactic

treatment

09/99 Positive for HIV N.A. N.A. N.A. d4T + 3TC + EFV N.A.

05/04 24 208,000 N.A. TDF + 3TC + LPVr N.A.

03/05 154 29,000 N.A. TDF + 3TC + LPVr N.A.

06/05

Visceral leishmaniasis (Hepatosplenomegaly/

diarrhea/fever/ cachexia/pancytopenia)

N.A. N.A. B.M. aspirate

TDF + 3TC + LPVr N-methyl-glucamine-

antimonya, amphotericin Bb, liposomal amphotericin

N.A.

11/05 58 87,800 N.A. TDF + 3TC + LPVr N.A.

02/06Visceral leishmaniasis

(Second infection)170 <50 B.M. aspirate

TDF + 3TC + LPVr liposomal amphotericin

N-methyl-glucamine-antimony


(Third infection)72 N.A. B.M. aspirate


N.D

06/08 113 <50 N.A. TDF + 3TC + LPVrAmphotericin

B


(Fourth infection)141 <50 B.M. aspirate


Amphotericin B


(Fifth infection)83 <50 B.M. aspirate


Amphotericin B

05/11

Skin lesions on the forehead/right forearm; Visceral leishmaniasis (Sixth

infection)

120 <50

Skin biopsy, rK39 rapid test, DAT, latex agglutination test, and

PCR


Liposomal amphotericin

07/12

Visceral leishmaniasis (Seventh infection)

(Splenomegaly/diarrhea/fever/cachexia/pancytopenia)

114 <50rK39 rapid test , DAT,

latex agglutination test, and PCR

TDF + 3TC + LPVr amphotericin Bb, liposomal

amphotericin

Liposomal amphotericin

HIV, human immunodeficiency virus; N.A., not available; N.D., not done; B.M. aspirate, bone marrow aspirate; d4T, stavudine; 3TC, lamivudine; EFV, efavirenz; TDF, tenofovir; LPVr, lopinavir/ritonavir; DAT, direct agglutination test; PCR, polymerase chain reaction. aDeveloped acute pancreatitis. bDeveloped renal failure.


427

protocol of the patient should be created for early detection of relapse and re-infection.

One of the common features of co-infection is the increased tendency of relapse, observed in 37-80% of the patients22. Additionally, in some cases a chronic course with multiple occurrences might take place. This can be attributed not only to immunodeficiency but also to re-infection, host deficiencies correlating with ART, secondary prophylaxis, and CD4+ lymphocyte count16,18. CD4+ lymphocyte count is one of the most significant prognostic factors for survival11,22. VL usually appears as an opportunistic disease in HIV patients when CD4+ cell count is less than 200 cells/mm3 (1,6,12,13,17,25). During the seven years of follow-up, the patient presented a CD4+ cell count ≤ 170 cells/mm3. This represents an important predictor of relapse. Relapses of VL are suggested to occur mainly in individuals with poor responses to antiretroviral treatment who have no improvement in CD4+ counts with a few exceptions3,9.

Based on clinical and biological [polymerase chain reaction (PCR)-based] follow-up, an ‘active chronic visceral leishmaniasis’5 has been proposed by BOURGEOIS et al. (2010). In our case, only the 6th and 7th episodes were able to have the peripheral blood (PB) analyzed by PCR, which showed positive results for Leishmania spp. As PCR-RFLP was only found in the 7th sample episode, the etiological agent is Leishmania chagasi, according to the pattern of bands defined by SCHONIAN et al. (2003)26. Due to the absence of PB samples in previous episodes, the analysis by PCR-RFLP was not made. Therefore, it wasn’t possible to distinguish between relapse and reinfection or characterize the case as ‘chronic visceral leishmaniasis’. Despite the medical importance of a clinical and laboratory monitoring of coinfected patients, this practice is still little used12,19,20.

ART plays an important role in reducing the effect of opportunistic diseases and in recent studies has shown a reduction in the incidence of VL. Studies in individuals with HIV/AIDS treated using ARV drugs showed a similar incidence of VL relapse when compared to studies of the pre-highly active antiretroviral therapy (HAART) era11,14. The increased survival resulting from ART might partially explain the high incidence of relapse observed in this population18. In the present study, during the eight years of follow-up, we observed seven VL infections, despite the patient receiving ART before the first infection.

VL manifestations associated with HIV infection might appear in a classical form, particularly in patients from VL-endemic areas, as well as with relatively aggressive symptoms that are sometimes non-specific and difficult to clinically diagnose11. In individuals with HIV/AIDS and presenting symptoms such as asthenia, anorexia, and weight loss, VL might be responsible for 7-23% of instances of fever of unknown origin11. This patient presented classic clinical manifestations during the study period, although in 2011, we observed the formation of skin lesions because of the parasite, as assessed by histopathological analysis.

Among the previously treated VL cases, several patients present a skin condition characterized by macular, popular, or nodular lesions, called Post-kala-azar dermal Leishmaniasis (PKDL) caused by the amastigotes of Leishmania donovani on the Indian subcontinent (India, Nepal, Bangladesh) and east Africa (Sudan, Ethiopia, Kenya) and caused by Leishmania chagasi in South America where it is rarely reported, as well as its presence in HIV positives2,4,23,28. It is worth noticing that

exclusive involvement of the skin is an unusual condition, because the simultaneous appearance of skin lesions along with other VL manifestations was more frequently observed21. In this case, the skin lesion suggests a clinical PKDL, which developed five years after the first VL episodes, administration of multiple therapeutic regimens, and treatments of discontinuous secondary prophylaxis. Although it has been viewed amastigotes in biopsy specimens obtained from skin lesions, the hypothesis of PKDL can be suggested but not stated categorically because there was no characterization of Leishmania species involved in the cutaneous lesions, and may have been an infection of some sort cutaneous Leshmania endemic to the region as L. braziliensis.

Several studies on co-infected individuals show that they present a decrease in anti-Leishmania antibody levels in the peripheral blood11; that is, in only 40-50% of VL/HIV-AIDS cases, specific antibodies are detected1. Conversely, assessment of Leishmania antigen in urine by latex agglutination test showed a sensitivity of 85-100%1. Polymerase chain reaction (PCR) in peripheral blood and bone marrow is a useful tool to diagnose, for follow-up, and detect relapses22. Although the literature shows that serological analyses are not the most convenient in patients presenting co-infection1,6, two serological tests (direct agglutination test and rK39-based rapid immunochromatographic test) performed enabled the diagnosis of such cases in 2011 and 2012. In the same years, latex agglutination test and PCR test showed positive results, thus, confirming the data in the literature. Similar to the finding in our study, CAVALCANTI et al. (2012), described a series of case studies of co-infection in the main hospitals of Recife, Brazil10.

There is currently sufficient evidence suggesting that secondary prophylaxis provides some protective effect but does not completely prevent the occurrence of relapse11. A meta-analysis study described that the average incidence of relapse in patients who did not receive secondary prophylaxis was 67%, whereas in those who received it was 31%16. Current recommendations from the Ministry of Health of Brazil2 for the diagnosis, treatment, and follow-up of patients presenting co-infection state that the “efficacy of the secondary prophylaxis after the first successfully treated VL infection, was not completely established.” The suggested secondary prophylaxis (Table 1) was poorly adopted, thus, compromising the clinical follow-up. Based on this case study and literature review, it is evident that co-infection presents typical clinical, diagnostic, and therapeutic features, and can be observed in the prognosis of the disease. Therefore, prospective studies are required to clarify gaps such as the efficacy of secondary prophylaxis and need for clinical and laboratory monitoring tools for the early assessment of relapse or re-infection.

RESUMO

Estudo de caso de paciente com múltiplos episódios da coinfecção HIV-AIDS e leishmaniose visceral

Relato de caso de paciente masculino de 45 anos, agricultor, residente na zona da mata do Estado de Pernambuco, diagnosticado com HIV em 1999 e em uso de ARV. Em 2005 foi registrada a primeira ocorrência de LV através do diagnóstico parasitológico a partir do aspirado da medula óssea. À admissão no hospital apresentava-se com febre, hepatoesplenomegalia, perda de peso e diarréia. Desde então houve a ocorrência de mais sete episódios de LV, tendo ocorrido em media, um


428

evento a cada ano (2005-2012 exceto em 2008). O paciente apresentou, em 2011, um quadro cutâneo disseminado, sendo realizada biopsia de pele que evidenciou formas amastigotas de Leishmania no exame histopatológico. Em 2005, o tratamento foi realizado com antimoniato de N-metil-glucamina e anfotericina B desoxicolato, mas desde 2006, devido à toxicidade, o medicamento de escolha foi a anfotericina B lipossomal. Como recomendado pelo Ministério da Saúde, esse relato reforça a necessidade de que os casos de HIV residentes em área endêmica de LV deverão ter inserido em seu protocolo de acompanhamento essa parasitose, principalmente após o primeiro episódio.

ACKNOWLEDGEMENTS

This study was supported by the FACEPE/MS/CNPq Programme for Research and priority development to unified health system - SUS/PCT Saúde II (project 03/2004) and CNPq/PIBIC/Fiocruz (process 139172/2012-2).

REFERENCES

1. Alvar J, Cañavate C, Gutiérrez-Solar B, Jiménez M, Laguna F, López-Vélez R, et al. Leishmania and human immunodeficiency virus coinfection: the first 10 years.Clin Microbiol Rev. 1997;10:298-319.

2. Badaró R, Carvalho EM, Rocha H, Queiroz AC, Jones TC. Leishmania donovani: an opportunistic microbe associated with progressive disease in three immunocompromised patients. Lancet. 1986;1(8482):647-8.

3. Berenguer J, Cosin J, Miralles P, López JC, Padilla B. Discontinuation of secondary anti-Leishmania prophylaxis in HIV-infected patients who have responded to highly active antiretroviral therapy. AIDS. 2000;14:2946-8.

4. Bittencourt A, Silva N, Straatmann A, Nunes VL, Follador I, Badaró R. Post kala-azar dermal leishmaniasis associated with AIDS. Braz J Infect Dis. 2002;6:313-6.

5. Bourgeois N, Bastien P, Reynes J, Makinson A, Rouanet I, Lachaud L. ‘Active chronic visceral leishmaniasis’ in HIV-1-infected patients demonstrated by biological and clinical long-term follow-up of 10 patients. HIV Med. 2010;11:670-3.

6. Bourgeois N, Lachaud L, Reynes J, Rouanet I, Mahamat A, Bastien P. Long-term monitoring of visceral leishmaniasis in patients with AIDS: relapse risk factors, value of polymerase chain reaction, and potential impact on secondary prophylaxis. J Acquir Immune Defic Syndr. 2008;48:13-9.

7. Brasil. Ministério da Saúde. Secretaria de Vigilância em Saúde. Manual de recomendações para diagnóstico, tratamento e acompanhamento de pacientes com a coinfecção Leishmania-HIV. Brasília: Ministério da Saúde; 2011.

8. Brasil. Ministério da Saúde. Secretaria de Vigilância em Saúde. Aids no Brasil. Epidemia concentrada e estabilizada em populações de maior vulnerabilidade. Bol Epidemiol AIDS/DST. 2011;8(1):10-5.

9. Casado JL, Lopez-Velez R, Pintado V, Quereda C, Antela A, Moreno S. Relapsing visceral leishmaniasis in HIV-infected patients undergoing successful protease inhibitor therapy. Eur J Clin Microbiol Infect Dis. 2001;20:202-5.

10. Cavalcanti ATA, Medeiros Z, Lopes F, Andrade L, Ferreira VM, Magalhães V, et al. Diagnosing visceral leishmaniasis and HIV/AIDS co-infection: a case series study in Pernambuco, Brazil. Rev Inst Med Trop Sao Paulo. 2012;54:43-7.

11. Cota GF, Sousa MR, Rabello A. Predictors of visceral leishmaniasis relapse in HIV patients: a systematic review. PLoS Negl Trop Dis. 2011;5(6):e1153.

12. Cruz I, Nieto J, Moreno J, Cañavate C, Desjeux P, Alvar J. Leishmania/HIV co- infections in the second decade. Indian J Med Res. 2006;123:357-88.

13. Daher EF, Fonseca PP, Gerhard ES, Leitão TM, Silva Júnior GB. Clinical and epidemiological features of visceral leishmaniasis and HIV co-infection in fifteen patients from Brazil. J Parasitol. 2009;95:652-5.

14. Fernández Cotarelo MJ, Abellán Martínez J, Guerra Vales JM, Martínez Sánchez P, Rodrigo Gómez De La Bárcena M, Salto Fernández E. Effect of highly active antiretroviral therapy on the incidence and clinical manifestations of visceral leishmaniasis in human immunodeficiency virus-infected patients. Clin Infect Dis. 2003;37:973-7.

15. Hailu A. Pre- and post-treatment antibody levels in visceral leishmaniasis. Trans R Soc Trop Med Hyg. 1990;84:673-5.

16. Kubar J, Marty P, Lelièvre A, Quaranta JF, Staccini P, Caroli-Bosc C, et al. Visceral leishmaniosis in HIV-positive patients: primary infection, reactivation and latent infection. Impact of the CD4+ T-lymphocyte counts. AIDS. 1998;12:2147-53.

17. Lopez-Velez R, Perez-Molina JA, Guerrero A, Baquero F, Villarrubia J, Escribano L, et al. Clinicoepidemiologic characteristics, prognostic factors, and survival analysis of patients coinfected with human immunodeficiency virus and Leishmania in an area of Madrid, Spain. Am J Trop Med Hyg. 1998;58:436-43.

18. Maia-Elkhoury AN, Alves WA, Sousa-Gomes ML, Sena JM, Luna EA. Visceral leishmaniasis in Brazil: trends and challenges. Cad Saúde Pública. 2008;24:2941-7.

19. Marfurt J, Niederwieser I, Makia ND, Beck HP, Felger I. Diagnostic genotyping of Old and New World Leishmania species by PCR- RFLP. Diagn Microbiol Infect Dis. 2003;46:115-24.

20. Morales MA, Cruz I, Rubio, JM, Chicharro C, Cañavate C, Laguna F, et al. Relapses versus reinfections in patients coinfected with Leishmania infantum and human immunodeficiency virus type 1. J Infect Dis. 2002;185:1533-7.

21. Orsini M, Silva M, Luz ZM, Disch J, Fernandes O, Moreira D, et al. Identification of Leishmania chagasi from skin in Leishmania/HIV co-infection: a case report. Rev Soc Bras Med Trop. 2002;35:259-62.

22. Pintado V, Martín-Rabadán P, Rivera ML, Moreno S, Bouza E. Visceral leishmaniasis in human immunodeficiency virus (HIV)-infected and non-HIV infected patients. Medicine (Baltimore). 2001;80:54-73.

23. Prata A, Domingues A. Leishmanióide dérmico. O Hospital. 1955;50:93-113.

24. Rosenthal E, Marty P, del Giudice P, Pradier C, Ceppi C, Gastaut JA, et al. HIV and Leishmania coinfection: a review of 91 cases with focus on atypical locations of Leishmania. Clin Infect Dis. 2000;31:1093-5.

25. Russo R, Laguna F, López-Vélez R, Medrano FJ, Rosenthal E, Cacopardo B, et al. Visceral leishmaniasis in those infected with HIV: clinical aspects and other opportunistic infections. Ann Trop Med Parasitol. 2003;97(Suppl 1):S99-S105.

26. Schonian G, Nasereddin A, Dinse N, Schweynoch C, Schallig HD, Presber W, et al. PCR diagnosis and characterization of Leishmania in local and imported clinical samples. Diagn Microbiol Infect Dis. 2003;47:349-58.

27. World Health Organization. 5th Consultative Meeting on Leishmania/HIV Coinfection; 2007 Mar 20-22; Addis Ababa, ET. Geneva: World Health Organization; 2007.

28. Zijlstra EE, Musa AM, Khalil EA, el-Hassan IM, el-Hassan AM. Post kala-azar dermal leishmaniasis. Lancet Infect Dis. 2003;3:87-98.

Received: 7 November 2012Accepted: 15 April 2013


(1) Department of Infectious and Parasitic Diseases, School of Medicine, University of São Paulo, São Paulo, SP, Brazil.(2) Laboratory of Parasitology (LIM46), Institute of Tropical Medicine, University of São Paulo, São Paulo, SP, Brazil. (3) Division of Infectious Diseases, Clinics Hospital, Federal University of Paraná, Curitiba, Paraná, Brazil.(4) Seroepidemiology Laboratory, Institute of Tropical Medicine, University of São Paulo, São Paulo, SP, Brazil.Correspondence to: Antonio Carlos Nicodemo. Phone: +55 11 3214-4251; Fax +55 11 3259-1318. E-mail: [email protected]

CASE REPORT

USEFULNESS OF kDNA PCR IN THE DIAGNOSIS OF VISCERAL LEISHMANIASIS REACTIVATION IN CO-INFECTED PATIENTS

Antonio Carlos NICODEMO(1), Valdir Sabbaga AMATO(1,2), Felipe Francisco TUON(3), Regina Maia de SOUZA(2), Thelma Suely OKAY(4) & Lúcia Maria Almeida BRAZ(2)

SUMMARY

It is important to develop new methods for diagnosing relapses in the co-infection of visceral leishmaniasis (VL) and HIV to enable earlier detection using less invasive methods. We report a case of a co-infected patient who had relapses after VL treatment, where the qualitative kDNA PCR showed a good performance. The kDNA PCR seems to be a useful tool for diagnosing VL and may be a good marker for predicting VL relapses after treatment of co-infected patients with clinical symptoms of the disease.

KEYWORDS: Visceral Leishmaniasis; Polymerase Chain Reaction; Diagnosis; Co-infection Visceral Leishmaniasis-HIV.

INTRODUCTION

Visceral leishmaniasis(VL) is a vector-borne disease caused by the L. donovani complex (L. donovani and L. infantum or its syn. L. chagasi). It currently affects around 12 million individuals in 88 countries, although more than 90% of the global VL cases occur in only six countries, namely India, Bangladesh, Sudan, South Sudan, Ethiopia and Brazil1,9. In Brazil the disease has expanded following a process of rural-to-urban-transmission, and this urbanization has paralleled ruralization of the HIV infection. The VL/HIV co-infection has emerged as a serious disease pattern with a reduction in therapeutic response and a high relapse rate2. Both pathogens have the same target cell (macrophage), thus worsening the outcome of both diseases. Therefore, it is essential to improve and make diagnostic techniques available, including molecular tools, which could replace invasive techniques.

Laboratory diagnosis can be reached by serological techniques, such as indirect immunofluorescence [IFI], enzyme-linked immunosorbent assay [ELISA], or immunochromatography [IC]. The diagnosis can also be performed by demonstration of amastigotes in stained bone marrow aspirate which has a sensitivity of 58%-85% and even by culture in Novy-MacNeal - Nicolle [NNN]/BHI medium; the latter can additionally improve sensitivity10 and molecular tests such as kDNA PCR. Serological tests have limited sensitivity and, as a general rule, should not be used to exclude the diagnosis of VL in HIV-infected patients3. The microscopic examination requires an invasive procedure and is extremely subjective and time consuming. Culture has low sensitivity and takes from one to

four weeks to give results. Molecular techniques, such as kDNA PCR, in which preserved sequences in Leishmania kinetoplast mini-circle DNA are amplified, have shown promise6,11. Even when they only allow for diagnosis of the genus, it is possible to diagnose recurrence early since the molecular method can produce a positive result for VL/HIV several weeks before the clinical onset of disease2. Consequently, the tests based on DNA detection in peripheral blood (PB) or in bone marrow (BM) aspirates can provide an important approach to the diagnosis of VL reactivation in co-infected VL/HIV patients.

METHODS

PCR kDNA Methodology

DNA extraction: The DNA from PB and BM samples collected with EDTA anticoagulant was extracted according to the manufacturer’s protocol of the RBC (Real Biotech Corporation) Genomic DNA Mini Kit and eluded in 25 µL of elution buffer (TE). The quantity and the purity of the DNA in the samples were determined using the Nanodrop Thermo Scientific 1000 spectrophotometer. The samples were subsequently stored in a freezer at 20 oC for later use.

The polymerase chain reaction (PCR): In the PCR reaction, kDNA 20 (5’GGG KAG GGG CGT TCT SCG AA 3’) and kDNA 22 (5’ SSS WCT ATW TTA CAC CAA CC CC3’) were used to target the amplification of the conserved region of kDNA mini circles of Leishmania sp, producing a fragment of 120 base pairs5. According to the amount of

NICODEMO, A.C.; AMATO, V.S.; TUON, F.F.; SOUZA, R.M.; OKAY, T.S. & BRAZ, L.M.A. - Usefulness of kDNA PCR in the diagnosis of visceral leishmaniasis reactivation in co-infected patients. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 429-31, 2013.

430

DNA from the extracted material, volumes between 2 and 4 µL (100 ng) of sample were added to 20 µL of reaction buffer containing 50 mM of KCl, 10 mM of Tris-HCl (pH 8.0), 0.2 mM of dNTPs, 1.0 mM of MgCl

2, 0.4 µM of each primer and one unit of Taq DNA polymerase

(Fermentas, Canada). Two negative controls were employed containing all of the components of the reaction together with milli-Q water. The positive control was obtained from the culture material of the Leishmania infantum strain (reference M6445). Each reaction was performed at an initial denaturation temperature of 94 °C for five minutes followed by 35 cycles of denaturation at 94 °C for one minute, annealing at 58 °C for one minute, extension at 72 °C for 30 seconds, and a final extension of 72 °C for five minutes. Reactions were performed in a thermocycler (Mini Cycler MJ Research/USA). PCR products were visualized on 2% agarose gel. Immediately after electrophoresis, the gel was stained with 0.5 µg/mL of ethidium bromide. The amplified products were visualized by UV light over a transilluminator (AlphaImager) (Fig. 1).

CASE REPORT AND RESULTS

Herein, we report a case of a co-infected (HIV/VL) 32-year-old female, who was hospitalized six times over a period of one year and a half with clinical suspicion of VL reactivation.

The patient has had the HIV infection since she was 19 years old. The highly active antiretroviral therapy (HAART) has been used irregularly and the count of CD4+ T cell never exceeded 100 cells/mm3. The first diagnosis of VL was made in 2008.

In the patient’s first admission to the hospital, she clinically presented chills, fever, anorexia, and enlargement of liver and spleen. Leishmania was found in samples from smear examination of BM, and kDNA PCR was positive in the PB. She received liposomal amphotericin B, 4 mg/kg/day for five days. At this time, the NNN/BHI culture medium from BM was negative. She was discharged without symptoms.

In a second hospitalization, six months later, the patient had fever and asthenia. Laboratory diagnosis of leishmaniasis was established through PB samples only; evaluation of smear and culture yielded negative results, but PCR turned out positive, allowing the patient to receive the same treatment as on the first admission.

The patient was hospitalized a third time five months later due to fever, prostration, and dyspnea. Once more, using only PB samples, smear

microscopy, culture examination, and kDNA PCR were carried out. Again, only the kDNA PCR yielded positive results. This led to a diagnosis of reactivation and the patient underwent an additional treatment.

Yet another time, five months later, the patient was hospitalized with symptoms of headache, fever, liver and spleen enlargement, and pancytopenia. Samples of BM and PB were obtained to perform microscopic examination of smear, culture, and kDNA PCR. The smear from PB only suggested the presence of amastigotes; the culture was negative. Once again, because of the positivity of kDNA, the patient was treated. One month later, the patient was admitted to the hospital once more, this time due to anemia and again to pancytopenia. In the culture of BM aspirate, promastigotes were observed by microscopy. The microscopic examination of smear after panoptic staining revealed the presence of amastigotes. Only at this time PCR was not performed. Finally, in the patient’s last hospitalization two months later, positive results were obtained in samples of both BM and PB using kDNA PCR, and in BM alone using smear. The PB smear only suggested the presence of amastigotes; cultures were negative. The patient received the same treatment as before and was well when discharged.

DISCUSSION AND CONCLUSION

Leishmania/HIV co-infection emerges as a serious disease, demanding a fast diagnostic method for detecting active disease and relapse so as to enable prompt treatment. The patient herein reported had several predictors of recurrence, such as CD4+ cell count below 100 cells/mL at the time of the primary diagnosis of VL, failure to recover the number of CD4+ lymphocytes after the first episode of VL, and previous episodes of failure4. Significantly, the patient was always a poor adherent to antiviral therapy. However, even patients who use HAART regularly and have a recovery of the CD4+ cell count and an undetectable viral load ,and who also receive secondary prophylaxis can suffer VL relapses.

Since co-infection favors a poor outcome, amastigotes can be found in PB1. Hence, it is possible to avoid invasive and painful techniques, such as bone marrow aspiration, by replacing them with others that use peripheral blood. The kDNA PCR assay can be a useful technique especially when PB is utilized. In a study comparing PCR with parasitological and serological techniques, PIARROUX et al. obtained a sensitivity of 82% for PCR7. In our report, kDNA PCR investigation produced positive results in all five molecular diagnoses in the patient’s total of six hospitalizations, suggesting the hypothesis of VL reactivation. Only once was PCR not performed. In three of her six hospital stays, when both BM and PB were investigated, PCR was always positive. In two of the six hospitalizations, only PB was examined, and only kDNA PCR was positive. Amastigotes were observed by microscopic smear examination four times, and in three of these, the sample was obtained from BM, necessarily using an invasive technique. On the sixth admission, the NNN/BHI culture medium was positive in a sample proceeding from BM. Considering these findings and our aim to apply a non-invasive technique for obtaining samples, in order to avoid unnecessary pain and to prevent time-consuming techniques and subjective test interpretations, it is a priority to improve molecular tools for monitoring patients who are liable to VL reactivation, which is usual in HIV/VL co-infected patients.

It is important to emphasize that co-infected patients do not clear Leishmania DNA from peripheral blood nor can they show a rapid

Fig. 1 - Detection of kDNA-120 bp amplification in the sample from bone marrow (BM) and

peripheral blood (PB) of the patient with LV.

NICODEMO, A.C.; AMATO, V.S.; TUON, F.F.; SOUZA, R.M.; OKAY, T.S. & BRAZ, L.M.A. - Usefulness of kDNA PCR in the diagnosis of visceral leishmaniasis reactivation in co-infected patients. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 429-31, 2013.

431

reappearance of Leishmania DNA after therapy and these situations can or cannot be associated with clinical disease.

A negative result is strongly indicative of successful control of infection and efficacy of treatment, whereas a positive PCR result could be indicative only of the presence of the parasite, but not necessarily of relapse during an asymptomatic period8. Therefore, qualitative PCR testing positive in the absence of clinical symptoms of the disease is not always related to VL reactivation in co-infected patients.

The kDNA PCR seems to be a useful tool for diagnosing VL, and it may be a good marker for predicting VL relapses after treatment in co-infected patients with clinical symptoms of the disease.

RESUMO

Utilidade da kDNA PCR no diagnóstico de reativação de leishmaniose visceral em pacientes co-infectados sintomáticos

É importante a pesquisa de novos métodos laboratoriais para o diagnóstico de recidivas em casos de co-infecção leishmaniose visceral (LV) e vírus da imunodeficiência humana (HIV), que permitam o diagnóstico precoce das recidivas, utilizando métodos menos invasivos. Descrevemos aqui, o caso de paciente co-infectada que apresentou recidivas após o tratamento da LV e onde a PCR qualitativa demonstrou bom desempenho. A kDNA PCR parece ser ferramenta útil para o diagnóstico de recidivas de LV após o tratamento em pacientes co-infectados com sintomas clínicos da doença.

FUNDING

This study was supported by São Paulo Research Foundation (Fundação de Amparo à Pesquisa do Estado de São Paulo - FAPESP, Proc. 2010 50304-8).

CONFLICTS OF INTEREST STATEMENT

The authors have no associations or commercial relationships which might represent conflicts of interest.

REFERENCES

1. Alvar J, Vélez ID, Bern C, Herrero M, Desjeux P, Cano J, et al. Leishmaniasis worldwide and global estimates of its incidence. PLoS One. 2012;7:e35671.

2. Alvar J, Aparicio P, Aseffa A, Den Boer M, Cañavate C, Dedet JP, et al. The relationship between leishmaniasis and AIDS: the second 10 years. Clin Microbiol Rev. 2008;21:334-59.

3. Cota GF, de Sousa MR, Demarqui FN, Rabello A. The diagnostic accuracy of serologic and molecular methods for detecting visceral leishmaniasis in HIV infected patients: meta-analysis. PLoS Negl Trop Dis. 2012;6:e1665.

4. Cota GF, de Sousa MR, Rabello A. Predictors of visceral leishmaniasis relapse in HIV-infected patients: a systematic review. PLoS Negl Trop Dis. 2011;5:e1153.

5. Degrave W, Fernandes O, Campbell D, Bozza M, Lopes U. Use of molecular probes and PCR for detection and typing of Leishmania - a mini review. Mem Inst Oswaldo Cruz. 1994;89:463-9.

6. Nasreen SA, Hossain MA, Paul SK, Mahmud MC, Ahmed S, et al. PCR-based detection of Leishmania DNA in skin samples of post kala-azar dermal leishmaniasis patients from an endemic area of Bangladesh. Jpn J Infect Dis. 2012;65:315-7.

7. Piarroux R, Gambarelli F, Dumon H, Fontes M, Dunan S, Mary C, et al. Comparison of PCR with direct examination of bone marrow aspiration, myeloculture, and serology for diagnosis of visceral Leishmaniasis in immunocompromised patients. J Clin Microbiol. 1994;32:746-9.

8. Riera C, Fisa R, Ribera E, Carrió J, Falcó V, Gállego M, et al. Value of culture and nested polymerase chain reaction of blood in the prediction of relapses in patients co-infected with Leishmania and human immunodeficiency virus. Am J Trop Med Hyg. 2005;73:1012-5.

9. Srivastava A, Sweat JM, Azizan A, Vesely B, Kyle DE. Real-time PCR to quantify Leishmania donovani in hamsters. J Parasitol. 2013;99:145-50.

10. van Griensven J, Diro E. Visceral leishmaniasis. Infect Dis Clin North Am. 2012;26:309-22.

11. Volpini AC, Passos VM, Oliveira GC, Romanha AJ. PCR-RFLP to identify Leishmania (Viannia) braziliensis and L. (Leishmania) amazonensis causing American cutaneous leishmaniasis. Acta Trop. 2004;90:31-7.

Received: 15 April 2013Accepted: 26 June 2013

Rev. Inst. Med. Trop. Sao Paulo55(6):432, November-December, 2013doi: 10.1590/S0036-46652013000600012

LETTER TO THE EDITOR

DIFFERENTIAL DIAGNOSIS OF RESPIRATORY VIRUSES BY USING REAL TIME RT-PCR METHODOLOGY

São Paulo, August 8, 2013

Dear Editor

The emergence of new respiratory viruses including: the Severe Acute Respiratory Syndrome; the coronavirus in 2003 (SARS-CoV); influenza A(H1N1)pdm09, in the human population in the past ten years; the emergence of a new coronavirus identified in a patient presenting severe acute respiratory syndrome who travelled to Saudi Arabia (June, 2012), denominated as Middle East Respiratory Syndrome (MERS-CoV); and laboratory confirmation of three human infections with an avian influenza A(H7N9) virus not previously reported in humans on March 29, 2013, has encouraged scientists to develop diagnostic tests to identify these viruses1,2,3,4. The Adolfo Lutz, a Public Health Institute, has been improving its methodology tools in order to provide a timely answer to public health authorities facing acute respiratory disease outbreaks.

To apply the Centers for Disease Control and Prevention (CDC) Real Time RT-PCR as respiratory viruses’ differential diagnosis in clinical specimens, a total of 252 respiratory secretions were collected from patients presenting influenza-like syndrome by the three Brazilian National Influenza Surveillance Network - Sentinel Units: Hospital Menino Jesus; Hospital Vila Maria; Hospital Geral de Guarulhos; during influenza season 2010. These samples presented negative results for influenza virus A(H1N1), A(H1N1)pdm09, A(H3N2) and B strains by CDC rRT-PCR ; and were also proven negative by differential diagnosis by the use of respiratory monoclonal panel to investigate: influenza A and B viruses, respiratory syncytial virus, adenovirus and parainfluenza 1, 2 and 3 viruses by Indirect Immunofluorescence (IFI). The differential diagnosis in samples presenting negative results, by both methodologies, was submitted to the CDC Real RT-PCR containing primers and probes for adenovirus (ADV), rhinovirus (RVs), respiratory syncytial virus (RSV), human metapneumovirus (hMPV ), parainfluenza 1, 2, 3, 4(PV1, PV2, PV3, PV4), kindly provided by Dr. Dean Erdman. Of the 252 clinical specimens presenting negative results by using differential monoclonal respiratory panel IFI, 60 (23.80%) were positive by Real Time RT-PCR, the following etiologic agents have been identified: RSV 20 (33.40%); PV1 3 (5%); PV2 7 (11.60%); PV3 9 (15%) RVs 10 (16.60%); ADV 11 (18.40%).

This study demonstrates the high sensitivity of Real Time RT-PCR in respiratory differential diagnosis, by the National Influenza Surveillance Network, sponsored by Brazilian Ministry of Health.

In addition, fast, accurate and sensitive detection of respiratory viruses in clinical specimens through the use of this methodology would also increase our understanding of the epidemiology of both new emerging viruses such as influenza A (H1N1) pdm09, and conventional viruses such as the common cold viruses, including rhinovirus and coronavirus.

Taking into account the development of vaccines and antiviral drugs,

successful measures of prevention and control of the disease can be warranted as soon as the etiology of the disease is revealed.

Renato de Souza PAULINO (1) Margarete Aparecida BENEGA (1)

Katia Corrêa de Oliveira SANTOS (1)Daniela Bernardes Borges da SILVA (1)

Juliana Cristina PEREIRA (1)Norio Augusto SASAKI (1)

Patricia Evelin SILVA (1) Suely Pires CURTI (1)

Maria Isabel OLIVEIRA (1) Telma R.M.P. CARVALHANAS (2)

Teresa PERET (3)Dean ERDMAN (3)

Terezinha Maria de PAIVA (1)(1) Respiratory Disease Centre, Virology Center,

Instituto Adolfo Lutz, São Paulo, SP, Brazil (2) Epidemiologic Surveillance Center of the State of São Paulo,

São Paulo, SP, Brazil(3) Centers for Disease Control and Prevention, Division of Viral

DiseasesCorrespondence to: Terezinha Maria de Paiva

Núcleo de Doenças Respiratórias, Centro de Virologia, Instituto Adolfo Lutz

Av. Dr. Arnaldo 355, 01246-902 São Paulo, SP, BrasilPhone: +55 11 30682913, Fax + 55 11 3085-3505

E- mail: [email protected]

Supported by: Institute Adolfo Lutz/SES/SP, National Influenza Surveillance Network

Sponsored by: Ministry of Health of Brazil, Centers for Diseases Control and Prevention.

REFERENCES

1. Gao R, Cao B, Hu Y, Feng Z, Wang D, Hu W, et al. Human infection with a novel avian - origin influenza A (H7N9) virus. N Engl J Med. 2013;368:1888-97. doi: 10.1056/NEJMoa1304459. Epub 2013 Apr 11.

2. Paiva TM, Kisielius JJ, Benega MA, Ueda M, Sugahara TKN, Santos CLS, et al. Severe acute respiratory syndrome - a global concern - influenza virus isolated from suspected cases in Brazil from April to June 2003. In: Proceedings of the International Conference on Options for the Control of Influenza V. Okinawa, October 7-13, 2003. Netherlands: Elsevier; 2004. p. 422.

3. Rota PA, Oberste MS, Monroe SS, Nix WA, Campagnoli R, Icenogle JP, et al. Characterization of a novel coronavirus associated with severe acute respiratory syndrome. Science. 2003;300:1394-9.

4. Zaki AM, van Boheemen S, Bestebroer TM, Osterhaus AD, Fouchier RA. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. N Engl J Med. 2012;367:1814-20.



HIGH PREVALENCE OF HEPATITIS A ANTIBODIES AMONG RECYCLABLE WASTE PICKERS, CENTRAL BRAZIL

April 26, 2013

Dear Editor,

In South America, a shift has been observed from high to intermediate endemicity for hepatitis A virus (HAV) infection in several countries, including Brazil, which has generally been explained by improvements in public health programs and sanitary conditions in most parts of these areas3,13. A multicentric population-based study conducted in Brazilian capital cities classified the North, Northeast and Central-West regions as having an intermediate endemicity for HAV infection, while South and Southeast regions as having a low endemicity8. Furthermore, seroprevalence rates may vary by age, socio-economic status, urbanization level and access to clean water as sanitation facilities3.

In Brazil, recyclable waste pickers collect, separate, classify and sell all types of recyclable waste materials. These individuals are autonomous workers who may or may not belong to recyclable cooperatives or associations. In 2002, this job became regulated by the Brazilian Occupational Classification. The number of recyclable waste pickers has increased significantly in urban areas, and it is estimated that there are one million recyclable waste pickers in Brazil1. They have a lifestyle that makes this group highly vulnerable to unfavorable socioeconomic and environmental factors. Additionally, their occupation is associated with poor health and high levels of risk of acquiring infectious diseases occupationally 5,9,11,12. However, the epidemiological status of HAV infection in recyclable waste pickers remains unknown.

A seroprevalence survey for HAV was conducted among recyclable waste pickers in Goiânia City (population 1,300,000), the capital of the state of Goiás, Central Brazil. Since 2008, Goiânia has been engaged in the implementation of the Programa Goiânia Coleta Seletiva recycling program. This program focuses on integrating actions between the municipal government that provides collection of recyclables for every household. The rise in household recyclable waste collection has led to the creation of 15 cooperatives.

Between April 2010 and May 2011, 431 individuals from all recycling cooperatives were enrolled. Participation was voluntary. Written informed consent was obtained from all participants prior to the start of the study. Participants were interviewed to collect data on their sociodemographic characteristics, professional information, and other risk behaviors. Blood was collected from all participants and serum samples tested by enzyme-linked immunosorbent assay (ELISA) for the presence of total antibodies against HAV (Eti-Ab-HAVK Plus, Diasorin, Italy). Anti-HAV positive samples were assayed for IgM anti-HAV (Eti-HA-IgMK Plus, Diasorin). The protocol used in the present study was approved by the Ethical Committee of the Federal University of Goiás (No. 002/2010).

Almost all recyclable waste pickers were positive for total anti-HAV antibodies (429/431). By contrast, none were IgM anti-HAV positive, indicating that 99.5% of the study population had previously been exposed to HAV since no participants in this population were vaccinated against HAV. The population ranged in age from 18 to 80 years (mean 36.9 years). There were 269 females (62.4%) and 162 males (37.6%). Most of the participants had low educational (78.7% had received eight years or less of education, corresponding to primary or elementary school level of education) and socioeconomic levels (60% reported an income of ≤1 Brazilian minimum wage/month, approximately US $300 or less). Regarding the locations of their residences, 11.2% reported living in waste deposits, 4.1% lived on the streets, and 84.7% either rented or owned their residence in periphery areas where environmental conditions are still poor (crowded conditions and lack of sewage system). The majority of recyclable waste pickers reported consumption of non-filtered water (60%) and had eaten food from the garbage (73.6%). Most participants reported having contact with human stools present on diapers (85.8%) and toilet paper (95.3%), among other wastes, as well as inconsistent glove use (63.6%) and other personal protective equipment.

This letter represents the first investigation designed to estimate the prevalence of HAV in a population of recyclable waste pickers in Brazil. Although no similar reports are available for direct comparison, the anti-HAV prevalence found among recyclable waste pickers was higher than those reported in waste collectors in Greece and Thailand (62.5%, 61% and 89.2%)2,6,10. It should be stressed that recyclable waste pickers are in closer contact with garbage than waste collectors who handle waste products using gloves. Furthermore, garbage is kept in a closed plastic bag that is seldom opened by waste collectors. In addition, the prevalence of anti-HAV found in this study was in agreement with other high rates reported in low socioeconomic Brazilian groups4,7. Thus, despite a shift in the endemicity of HAV infection in Brazil from high to intermediate or low8,13, pockets of highly exposed individuals may co-exist within this country.

In conclusion, a high prevalence for past infection of hepatitis A was found among recyclable waste pickers in Central Brazil. Most of these workers reported having contact with human stools, indicating a potential risk of occupational exposure to HAV infection. These findings highlight

SOARES, H.O.; LOPES, C.L.R.; FREITAS, N.R.; COSTA E SILVA, A.M.; MOURA, L.R. & MARTINS, R.M.B. - High prevalence of hepatitis A antibodies among recyclable waste pickers, Central Brazil. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 433-4, 2013.

434

the importance of having a public health policy that addresses this population which should be aimed at improving education, hygiene practice, and safer equipments for collecting selective waste. In addition, vaccination against HAV could also be considered.

Helen de Oliveira SOARESCarmen Luci Rodrigues LOPES

Nara Rúbia de FREITASÁgabo Macêdo da COSTA E SILVA

Ludimila Rispoli de MOURARegina Maria Bringel MARTINS

Universidade Federal de Goiás (UFG), Goiânia, Goiás, Brasil. Correspondence to: Regina Maria Bringel Martins,

Instituto de Patologia Tropical e Saúde Pública/UFG, Caixa Postal 131, 74605-050 Goiânia, Goiás, Brazil

Phone: +55 62 32096129; Fax: +55 62 32096363E-mail: [email protected]

Supported by: Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Fundação de Amparo à Pesquisa do Estado de Goiás (FAPEG)

REFERENCES

1. Compromisso Empresarial para Reciclagem. CEMPRE. Política Nacional de Resíduos Sólidos. Agora é lei: Novos desafios para poder público, empresas, catadores e população. [Cited 2012 December 14]. Available from: http://www.cempre.org.br/download/pnrs_002.pdf

2. Dounias G, Rachiotis G. Prevalence of hepatitis A virus infection among municipal solid-waste workers. Int J Clin Pract. 2006;60:1432-6.

3. Franco E, Meleleo C, Serino L, Sorbara D, Zaratti L. Hepatitis A: epidemiology and prevention in developing countries. World J Hepatol. 2012;4:68-73.

4. Gomes MA, Ferreira A de S, da Silva AA, de Souza ER. Hepatitis A: seroprevalence and associated factors among schoolchildren of São Luís (MA), Brazil. Rev Bras Epidemiol. 2011:14:548-55.

5. Gutberlet J, Baeder AM. Informal recycling and occupational health in Santo André, Brazil. Int J Environ Health Res. 2008;18:1-15.

6. Luksamijarulkul P, Sujirarat D, Charupoonphol P. Risk behaviors, occupational risk and seroprevalence of hepatitis B and A infections among public cleansing workers of Bangkok Metropolis. Hepat Mon. 2008;8:35-40.

7. Matos MA, Reis NR, Kozlowski AG, Teles SA, Motta-Castro AR, Mello FC, et al. Epidemiological study of hepatitis A, B and C in the largest Afro-Brazilian isolated community. Trans R Soc Trop Med Hyg. 2009:103:899-905.

8. Ministério da Saúde. Brasil. Secretaria de Vigilância em Saúde. Departamento de DST, AIDS e Hepatites Virais. Brasília: Ministério da Saúde; 2011. Bol Epidemiol Hepat Virais. 2011; II(1). Available from: http://www.aids.gov.br/sites/default/files/anexos/publicacao/2011/50073/boletim_hepatites2011_pdf_64874.pdf

9. Porto MF, Juncá DC, Gonçalves R de S, Filhote MI. Lixo, trabalho e saúde: um estudo de caso com catadores em um aterro metropolitano no Rio de Janeiro, Brasil. Cad Saude Publica. 2004;20:1503-14.

10. Rachiotis G, Papagiannis D, Thanasias E, Dounias G, Hadjichristodoulou C. Hepatitis A virus infection and the waste handling industry: a seroprevalence study. Int J Environ Res Public Health. 2012;9:4498-503.

11. Rozman MA, Alves IS, Porto MA, Gomes PO, Ribeiro NM, Nogueira LA, et al. HIV infection and related risk behaviors in a community of recyclable waste collectors of Santos, Brazil. Rev Saúde Pública. 2008;42:838-43.

12. Silva MC, Fassa AG, Siqueira CE, Kriebel D. World at work: Brazilian ragpickers. Occup Environ Med. 2005;62:736-40.

13. Vitral CL, Ospina FL, Artimos S, Melgaço JG, Cruz OG, de Paula VS, et al. Declining prevalence of hepatitis A virus antibodies among children from low socioeconomic groups reinforces the need for the implementation of hepatitis A vaccination in Brazil. Mem Inst Oswaldo Cruz. 2012:107:652-8.



ANALOGIES IN MEDICINE: VIOLIN STRINGS ADHESIONS

Belo Horizonte, August, 2013

Dear Sir

Brief history of the violin. The emergence of the violin in Upper Italy: The violin evolved from the viola da braccio family between 1520-1550, the Upper Italian towns of Milan, Brescia, Cremona and Venice being the most important centers. The term “violin” (from the Italian word violino) is derived from the word viola and had the general meaning “small stringed instrument” rather than “small viola”. The earliest surviving violins are those made by the Cremonese violin maker Andrea Amati (1500-1576) in the year 1542. They still have only three strings: G3, D4 and A4. It was probably not until after 1550 that Amati made the first violins with four strings. Andrea Amati was therefore in all likelihood the first instrument maker to produce instruments with those characteristics that justified the appellation “violin”.

The violin proved an enormous success in Italy, very quickly supplanting all the other “small stringed instruments” in the soprano register which were played in the "da braccio position" (arm position). No other instrument which had undergone the major part of its development before 1650 was accepted so readily as an essential part of musical practice; this was due to the limitless range of means of expression that it offered. The subsequent development of Western music history is linked closely to the further development of the violin’s playing techniques and possibilities for expression. Whereas violins – and later, other members of the violin family – have always been played exclusively by professional musicians, the viol remained an instrument also adopted by educated lay musicians such as noblemen and merchants and as such was endowed with a certain social standing. Italian players introduced the new instrument to a wider audience at European courts.

The Golden Age (1600-1750): The violin’s popularity led to the emergence of the most famous schools of violin-making: The Cremonese School was led by Amati’s sons until Nicola Amati (1596-1684). The Brescian School produced master craftsmen such as Gasparo da Salò (1540-1609) and his pupil Giovanni Paolo Maggini (1580-1632). The Cremonese School continued with Nicola Amati’s pupil Andrea Guarnieri (1626-1698) and later Antonio Stradivari (1644-1737), who was presumably a pupil of Guarnieri’s. Antonio Stradivari, who made around one thousand instruments during his career of which 600 are said to be still in existence, is still regarded as the apogee of the art of violin-making. Despite repeated attempts, which continue today and make use of the most modern technology, it has proved impossible to reproduce the sheer brilliance of timbre of a Stradivarius. The dimensions of Stradivari’s model were accepted as definitive by later generations.

Giuseppe Guarnieri, known as “del Gesù” (1698-1744), made instruments that were appreciated chiefly on account of their sustaining tone. Niccolò Paganini (1782-1840), the greatest violin virtuoso of all time, played a Guarnieri 1.

Dr. Malcom M. Stanley3: “Peritonitis of the upper part of the abdomen in young women occurring during the course of gonorrhea was first described as a definite syndrome in 1919 by Carlos Stajano, in a paper

read before the Society of Obstetrics and Gynecology of Montevideo, Uruguay. In his subsequent publications the clinical features of the acute stage of the disease were completely and graphically depicted. Little information of a clinical nature has been added since. Unfortunately, none of his work, printed in Spanish and French, was widely circulated in the United States. Hence it was not until 1930 that Curtis called attention to the frequent coexistence of gonococcic salpingitis and violin string adhesions between the anterior surface of the liver and the anterior abdominal wall discovered at operation – conditions indicating, presumably, a chronic, healing or healed perihepatitis. Fitz-Hugh, in 1934, described three cases in the acute stage, including one in which laparotomy was performed; in smears of the draining secretions from the wound Gram-negative intracellular diplococci were seen. Since then numerous articles have appeared in the literature, and the clinical entity has been well documented”3.

Pelvic inflammatory disease (PID) is a disorder characterized by pelvic pain, adnexal tenderness, fever and vaginal discharge; it results from infection by one or more of the following organisms: gonococci, chlamydiae, and enteric bacteria. The gonococcus continues to be a common cause of PID, the most serious complication of gonorrhea in women. Chlamydia infection is another well-recognized cause of PID2.

Fig. 1 - Laparoscopic view of violin string adhesions. Diagnostic picture tests in sexually

transmitted diseases - Taylor, PK, 1995. Bristol Royal Infirmary, Bristol, England.

ANDRADE-FILHO, J.S. - Analogies in Medicine: violin strings adhesions. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 435-6, 2013.

436

In about one half of infected women, gonorrhea remains asymptomatic. The other infected women initially exhibit endocervicitis, with a vaginal discharge or bleeding. Infection often extends to the fallopian tubes, where it produces acute and chronicle salpingitis and eventually PID.

From the fallopian tubes, gonorrhea spreads to the peritoneum, healing as fine “violin string” adhesions between the liver capsule and the parietal peritoneum (Stajano - Fitz-Hugh - Curtis syndrome) (Fig. 1).

José de Souza ANDRADE-FILHOFaculdade de Ciências Médicas de Minas Gerais

Belo Horizonte, Minas Gerais, Brasil E-mail: [email protected]

REFERENCES

1. History of the violin. In: Vienna Symphonic Library. Available from: <http://www.vsl.co.at/en/70/3189/3190/5620.vsl#top>

2. Kumar V, Abbas AK, Fausto N. Robbins & Cotran pathologic basis of disease. 7th ed. Philadelphia: Elsevier Saunders; 2005. p. 1064-5.

3. Stanley MM. Gonococci peritonitis of the upper part of the abdomen in young women: phrenic reaction, or subcostal syndrome of Stajano; Fitz-Hugh - Curtis syndrome. Report of cases of three patients treated successfully with penicillin and a summary of the literature. Arch Intern Med (Chic). 1946;78:1-3. doi:10.1001/archinte.1946.00220010011001

437

AUTHOR INDEX - VOLUME 55

ACARDI, S.A., 239ACOSTA, M.M., 239ADAMI, C., 189AFONSO, A.M.S., 292AFONSO, L.A., 329 ALBUQUERQUE, P.L.M.M., 295, 347ALFONSO, Y., 65ALMEIDA, A.B.P.F., 287ALMEIDA FILHO, G.L., 329ALVAREZ, R.R.A., 173 ALVES, G.B.B., 105AMARAL, C.T., 315AMATO, V.S., 429ANDRADE, G.B., 113ANDRADE, L.D., 425ANDRADE-FILHO, J.S., 68, 218,

290, 435ANDRADE Jr., D.R., 341ANDRADE Jr., H.F., 55ANGELO, A.L.D., 323ANZAI, M.C., 371 AQUINO, V.R., 145ARAÚJO, C.W., 213 ARAÚJO, J.S.V., 145ARAUJO, N., 75ARAÚJO, P.S.R., 425ARAUJO, S.M., 189ARIAS, E., 167ARRUDA, L.B., 91ASSIS, D.C., 149AVILA, L.F.C., 363AZEVEDO, M.C.V.M., 61BACILIO, M.L., 31BAEZA, L.C., 385 BARRETO, W.T.G., 113BARROS, M.J., 69BASTOS, M.C., 323BATISTA, J.F., 105BELTRÃO, E.I.C., 213BENEGA, M.A., 432BERROZPE, P., 239BERRUETA, L., 31BEZERRA, F.S., 261BIONDO, A.W., 335BISORDI, I., 45BIZAI, M.L., 167BONFIM-MENDONÇA, P.S., 385BRASIL, R.A., 45BRAZ, L.M.A., 429BRILHANTE, R.S.N., 261BRITES, C., 323BRONZONI, R.V.M., 275BUSATTI, H., 69CABRINE-SANTOS, M., 149CADEMARTORI, B.G., 25CALDEIRA, T.D.M., 315CAMARGO, J.A.S.A., 193CAMARGO, L.M.A., 193 CAMPOS, A.P., 105CANELLO, T.B., 55CARESTIATO, F.N., 329CARISSIMI, M., 353CARNEIRO, J.A., 283

CARVALHANAS, T.R.M.P., 432CARVALHO, C.M.E., 113CARVALHO, M.D.B., 407CASTRO, A.C., 323CATISTI, R., 185CAVALCANTI, M.S.M., 213CAVALCANTI, S.D.B., 7CAVALCANTI, S.M.B., 329 CECI, L., 323CELLA, W., 407 CESETTI, M.V., 173CHANDRASHEKAR, R., 335CHIEFFI, P.P., 51, 141, 291CHIPPAUX, J.P., 13COELHO, P.M.Z., 39, 75COIMBRA, T.L.M., 45COLOMBO, T.E., 275CONCEIÇÃO, F.R., 363CORBELLINI, V.A., 353CORRAL, M.A., 141, 291CORREIA, D., 149 CORRENTE, J.E., 245COSTA E SILVA, A.M., 433COSTA, F.A.L., 105COSTA, R.T., 101COSTA, S.F., 417COSTA-CRUZ, J.M., 309COTRIM, P.C., 393COURA, J.R., 205COUTO, J.M., 39COX, R., 65CRUZ, C., 197CRUZ, L.E.A.A., 275CRUZ, R.A.S., 287CRUZ, R.C.B., 125CUNHA, M.J.R., 19CUNHA, V.O., 117CUNHA FILHO, N.A., 25CURSINO, A.E., 137CURTI, S.P., 292, 432CURY, A.A.F., 275CURY, M.C., 19DABOIT, T.C., 353DAHER, E.F., 295, 347DAL BELLO, A.G., 209DAMAZIO, S.M., 179DAS NEVES, B.C., 31DAVILA, D.F., 31DE ROODT, A.R., 13DE TITTO, E., 13 DEL NEGRO, G.M.B., 1, 7DELGADO-MURCIA, L.G., 357DENNER, S., 167DESHPANDE, P.S., 79DIAS, A.L.T., 117DOLAB, J.A., 13DONIS, J.H., 31DORINI, A.A., 245 DRACZ, R.M., 229DUARTE, R.J., 137DUTRA, V., 371ERDMAN, D., 432ESPÍRITO-SANTO, M.C.C., 129

FABBRO, D., 167FAÇANHA, M.C., 261FAGUNDES, A., 101FALAVIGNA, D.L.M., 189FALAVIGNA-GUILHERME, A.L., 189FALAVIGNA-GUILHERME, G., 189FARIA, E.S.M., 19FARIAS, N.A.R., 25FELICIANO, J.P.O., 283 FERNANDES, O., 101FERNANDEZ, M.A., 385FERNÁNDEZ, M.S., 239FERRAZ, J.R., 417FERREIRA, I.B., 155 FERREIRA, M.R., 61FERRY, F.R.A., 61FIGUEIREDO, C.A., 292FIGUEIREDO, H.R., 113FIORINI, A., 385FONSECA, C., 75FONSECA, T.V., 315FONTES, G., 193 FRANÇA E SILVA, I.A., 417FREITAS, N.R., 433 FUJII, Y., 401 FUKUMOTO, A.E.C.G., 267GHAFFARIFAR, F., 79GIL, F.F., 69GIROTTO, K.G., 19 GLAESER, T.A., 363GODOY, G., 197 GOLKAR, M., 79GOMES, C.M., 173GOMES, M.A., 69GÓMEZ, A., 239GÓMEZ-GALINDO, A.M., 357GONÇALVES, C.V., 315GONÇALVES, R., 315GOTO, R.L., 245GOTTARDI, M., 141, 291GOULD, I.T., 239GRACIA-PAEZ, J.I., 417GRAMA, D.F., 19GRENFELL, R., 75GRYSCHEK, R.C.B., 129, 141, 291GUAZZELLI, L.S., 145GUERRA, F.Q.S., 377GUILHEM, D., 159 GUILHERME, E.V., 189HADDAD Jr., V., 125HAHN, R.C., 371 HALLAL Jr., R.J., 209HENRIQUES, R.M.S., 245HOCHHEGGER, B., 121, 209HONER, M.R., 113HORA, V.P., 315 INOCÊNCIO, L.A., 323JACINTO, C.N., 295, 347JAUNE, F.W., 287JÚNIOR, C.G.E., 69JUNIOR, R.S., 323KAISER, J., 185KANEKO, S., 401

KAPOOR, S., 124KARIM, I.Z.A., 79KAWAKUBO, E.M., 91KAWASATO, K.H., 1KOTRESHA, D., 79KRAWCZAK, F.S., 335KUMAR, P., 303LABRUNA, M.B., 335LAZÉRA, M.S., 371LEITÃO, T.M.J.S., 261LEITE, F.P.L., 363LEITE-JÚNIOR, D.P., 371LEMOS, J.A.R., 323LEMOS, X.R.M.R., 292LESCANO, S.A.Z., 51LEVIN, A.S., 417LI, T., 217, 293, 366LI, X., 366LIMA, C.B., 347LIMA, C.B.C., 341LIMA, J.B., 295, 347LIMA, M.S., 179LIMA, W.S., 229LIMA Jr., O.A., 185LIMEIRA, O.M., 173LIMONGI, J.E., 19, 85, 155LINDOSO, J.A.L., 393LOPES, C.L.R., 433LOPES, P.O.M., 421 LÓPEZ, L., 197LUNA, E.J.A., 55MACEDO, N.A., 69MACIEL, E., 39MADEIRA, M.F., 287MAEDA, A.Y., 45MAGALHÃES, P.P., 137MALAFAIA, G., 159MALTA, F.M., 141MARCHIORO, A.A., 189MARCIANO, M.A.M., 232MARCONDES, M., 335MARQUES, D.P.A., 39MARQUI, R., 407 MARTINEZ, A.M.B., 91, 315 MARTINS, L.H.R., 363MARTINS, R.M.B., 433MARTINS, T.F., 335MARTINS, W., 75MASSAFERA, R., 407MATI, V.L.T., 133MAUCH, R.M., 117MEDEIROS, Z.M., 425MELO, A.L., 133MELO, S.C.C.S., 407MENDES, E.N., 137MENDONÇA, A.J., 287MIGUEL, R.B., 205MIURA, M., 401MONDINI, A., 275MONZOTE, L., 65MORAIS, O.O., 173MORAKOTE, N., 411MOREIRA, F.G., 155

438

MORENO, E.S., 45MOTA, D.J.G., 129MOTA, R.M.S., 261MOTTA, R.N., 61MOURA, L.R., 433 MOYSÉS, N., 329MOZZER, L.R., 229NAKANO, E., 421NAKAZATO, L., 287, 371NASCIMENTO, D.A.G., 335NASSAU, D.C., 283NAVARRO, E.C., 245NAVES, M.M., 309NEGRÃO-CORRÊA, D.A., 39NEHME, N., 101NETTO, E.M., 323NEVES, S.L., 245NICODEMO, A.C., 429NOGUEIRA, M.L., 275NOORDIN, R., 79NUNES, J.S., 193 NUÑEZ, T.J., 31OKAY, T.S., 1, 429OLIVEIRA, A.C., 377OLIVEIRA, C.C., 267OLIVEIRA, E., 75OLIVEIRA, F.H., 275OLIVEIRA, F.M., 121, 209OLIVEIRA, G.R., 315OLIVEIRA, L.C., 1OLIVEIRA, M.I., 292, 432OLIVEIRA-SILVA, M.B., 149OLIVERA, V., 167OSMAN, S., 79OTTON, M.L.P., 287OYAFUSO, L.K., 393PADILHA, C.E., 425PAIVA, T.M., 432 PAJUABA NETO, A.A., 85 PALMA, P.V.B., 323PAPA, C.H.G., 51PASQUALOTTO, A.C., 145PAULA, C.R., 371PAULA, D.A.J., 287, 371PAULA, F.M., 141, 291PAULA, M.B.C., 85 PAULINO, R.S., 432PENNA, F.J., 137PEREIRA, J.C., 432PEREIRA, L.E., 45, 155PEREIRA, P.A.R., 137PEREIRA, P.C.M., 245

PERES, J.B., 155PERET, T., 432PÉRET-FILHO, L.A., 137PESCADOR, C.A., 287 PETERSON, D.L., 31PETRELLA, S., 45PINTO, H.A., 133PINTO, P.L.S., 129PINTO, R.M.C., 19, 155PIRES, K.L., 61 PONTES, L.R.A., 377PONTES, Z.B.V.S., 377POSWAR, F.O., 283PRATA, A., 101PRAVIA, C., 167PRIANTI, M.G., 105QUEIROZ, M.L., 51RAMOS, A.P.G., 261RAMOS Jr., A.N., 261RAPADO, L.N., 421REDOAN, R., 69RÊGO, M.J.B.M., 213REIS, A.A., 85 REIS, A.F.N., 275RESENDE, D.V., 149RIBEIRO, L.M., 229RICOBONI, I.S., 245RIGO, L., 113RIGO, R.S., 113ROBLEDO, S.M., 197ROCCO, I.M., 45ROCHA, E.M.M., 193ROCHA, M.C., 393RODRIGUES, E.A.S., 85RODRIGUES, V., 101RODRÍGUEZ, M., 65ROMERO, H.D., 101ROSA, F.M., 39ROSSETTO, A.L., 125 ROSSI, F., 417RUBINSKY-ELEFANT, G., 189RUIZ, A.M., 167SAADATNIA, G., 79SALMEN, S., 31SALOMON, O.D., 239SAMUDIO, F., 205 SANTINI, M.S., 239SANTOS, C.A.M.L., 219SANTOS, F.L.N., 233SANTOS, J.B., 39SANTOS, J.F.G., 69SANTOS, J.P., 377

SANTOS, K.C.O., 432SANTOS, M., 91SANTOS, R.V., 193SANTOS, S.A., 341SASAKI, N.A., 432SATOW, M.M., 393SCAINI, C.J., 363SCROFERNEKER, M.L., 353SEVERO, C.B., 145, 209SEVERO, L.C., 121, 145, 209SHINOBU-MESQUITA, C.S., 385SICILIANO, M.M., 45SILVA, D.B.G., 432SILVA, E.D., 425SILVA, F.G., 45SILVA, G.A.R., 61SILVA, I.S., 113SILVA, L.A., 101 SILVA, L.S., 105SILVA, M.A.L., 425SILVA, M.O., 323SILVA, M.S.A.C., 137SILVA, N.M.M.G., 407SILVA, P.E., 432SILVA Jr., G.B., 295, 347SILVA-MORAES, V., 75SILVEIRA, V.M., 425SILVEIRA, V.R., 45SINGH, D.K., 251, 303SINGH, V.K., 251, 303SIQUEIRA, M.M., 292SITTA, R.B., 141SOARES, A.R., 179SOARES, D.C.S., 61SOARES, H.O., 433SOARES, N.M., 233SOLER, R.C., 393SONGSANGCHUN, A., 411SOUSA, M.G.T., 7SOUSA, V.R.F., 287SOUZA, A.A., 85 SOUZA, A.M.G.C., 233 SOUZA, D.F., 323SOUZA, L.R., 267SOUZA, M.A.A., 179SOUZA, R.M., 429SOUZA, R.P., 45, 155SPINOLA, R., 45STEFANI, V., 353STOPIGLIA, C.D.O., 353STUART, J.M., 283 SUÁREZ-MUTIS, M.C., 205

SUNITA, K., 303SUZUKI, A., 45, 155SVIDZINSKI, T.I.E., 385TAKAHARA, D.T., 371TALVANI, A., 159TAN, S., 366TANG, Z.-H., 144TANIGAWA, C., 401TASCA, K.I., 267TELES, H.M.S., 39TELMO, P.L., 363 TENGAN, C.H., 45TEODORO, U., 407TOME, A.C.N., 55TORRES, A.J.L., 323TRILLES, L., 371TUON, F.F., 429UNIS, G., 121UPADHYAY, A., 251UPARANUKRAW, P., 411VEDOVELLO, D., 275VELARDE, L.G.C., 329VELAZQUEZ, E., 167VÉLEZ, I.D., 197VELHO, P.E.N.F., 1VERAS, M.S.B., 295, 347VIDAL, M.S.M., 7VIDOTTO, O., 335VIEIRA, R.F.C., 335VIEIRA, R.H.S.F., 219VIEIRA, T.S.W.J., 335VIEIRA-DE-MELLO, G.S., 213VIEL, T.A., 51WANG, M., 293WANKE, B., 261, 371WANNASAN, A., 411WEBER, L.I., 91WIWANITKIT, V., 216XAVIER, G.A., 25XAVIER, M.O., 145XAVIER, P.C.N., 148YAMAGUCHI, L.F., 421YAMAMOTO, L., 1YAMASHIRO-KANASHIRO, E.H., 393YANG, Z., 293YU, A.L.F., 292YU, Y.-S., 144YUNUS, M.H., 79ZANCOPÉ-OLIVEIRA, R.M., 261ZANG, G.-Q., 144ZANINI, J.M., 245ZHANG, Y., 144

439

SUBJECT INDEX - VOLUME 55

Africanized honeybees, 61 Envenoming syndrome, 61

Amer.Tegum.Leishmaniasis, 393, 407 kDNA-PCR, 393 Phlebotomine, 407

Animal envenomation, 13,61,295,347 Africanized honeybees, 61 Bothrops, 295,347 Crotalus, 295 Micrurus, 13

AIDS, 261, 283 Histoplasmosis, 261, 283

Angyostrongylus cantonensis, 129 Eosinophilic meningitis, 129 São Paulo, Br., 129

Aspergillosis, 145 Diagnosis, 145

Bacillus Calmette-Guérin, 173 Leprosy prophylaxis, 173

Bacterial infections, 219 Seafood, 219

Bartonella henselae, 1 Cat scratch disease, 1

Biomphalaria glabrata, 421 Piperaceae, 421 Ovicidal effect, 421

Biomphalaria tenagophila, 39 Breeding, 39

Blood donation, 245 Chagas disease, 245

Bothrops, 295 Kidney injury, 295

Candida albicans, 385 Molecular typing, 385

Cat scratch disease, 1

Centrocestus formosanus, 133 Swiss and AKR/J mice, 133

Chagas disease, 31,68,159,167,245 Analogies, 68 Blood donation, 245 ELISA-F29 test, 167 Chronic infections, 167 Ethical principles, 159 Infection in young, 245 S.Paulo, Br., 245 Muscarinic receptors, 31 Valsalva maneuver, 25

Chagasic infection, 245 Young, 245 S. Paulo, Br., 245

Coccidioides spp, 7 Culture collection, 7 Molecular authentication, 7

Crotalus, 295 Kidney injury, 295

Cryptococcus neoformans, 117, 371 Copper interference, 117 Pigeon excreta, 371 Cuiabá, MG, Br., 371

Cryptosporidium, 149 HIV patients, 149

Cutaneous leishmaniasis, 197 Colombia, 197 Miltefosine, 197 Thermotherapy, 197

Cystoisospora belli, 149 HIV patients, 149

Cytomegalovirus 148 Neonatal patients, 148

Dengue, 275 Co-infection, 275 Serotypes 1 and 4, 275

Dermatophytes, 377 Soils, 377 Paraíba State, Br., 377

Diptera:Psychodidae, 85 Minas Gerais State, Br., 85

DNA extraction methods, 205 Malaria, 205

DNA polymerases, 401 Direct PCR, 401

ELISA-F29 test, 167 Chagas disease, 167 Chronic infections, 167

Enteroparasites, 179 Quilombola community, 179

Eosinophilic meningitis, 129 Angyostrongylus cantonensis, 129 São Paulo, Br., 129

Ehrlichia spp, 335 Dogs, horses, humans, 335 Serological survey, 335

Entamoeba histolytica, 193 Occurrence, 193 Rondonia, Br., 193

Ethics in research, 159 Chagas disease, 159

Eumycetoma, 121 Scedosporium apiospermum, 121

Fascioliasis, 303 Active larvicides, 303

Free-living amoebae, 411 Chiang Mai flood, 411

Giardiasis, 185 Landless farm workers, 185 Araras, SP, Br., 185

Gp41, 91 HIV-1, 91

Hantavirus, 155 Rodents, 155 Uberlandia, MG, Br., 155

Hepatitis A, 433 Recyclable waste pickers, 433

Herpesvirus-2, 315 PCR, 315 Risk factors, 315

Histoplasmosis, 261,209,283 AIDS, 283 Septic shock, 283 HIV patients, 261 Northeastern Brazil, 261 Metastatic lesions, 209 Pulmonary nodules, 209

HIV/AIDS, 25, 267, 425, 429 Antiretroviral therapy, 267 Toxoplasmosis, 25 Visceral leishmaniasis, 425,429

HIV-1, 91 South Brazil, 91

HIV patients, 149, 261 Cryptosporidium, 149 Cystoisospora belli, 149 Histoplasmosis, 261 Northeastern Brazil, 261

Hookworm, 233 Eosinophilia, 233

Intestinal parasitism, 69,179,369 Hemodialysis patients, 69 Quilombola community, 179 Intestinal Protozoa, 19 Elderly, 19

kDNA-PCR, 393, 429 Amer.Tegum.Leishman., 393 Visceral leishmaniasis, 429

440

Klebsiella pneumonia, 144 Liver abscess, 144

Leishmania infection, 101 PCR, 101

Leishmania (V.) panamensis, 357 Hamsters, 357

Leishmaniasis, 85,239 Insect vectors, 85

Leprosy, 173 Mycobacterium leprae, 173 Prevention, diagnosis, 173

Lymnaea acuminata, 251, 303 Fascioliasis, 303 Momordica charantia, 251 Moringa oleifera, 251

Malaria, 205 DNA extraction methods, 205

Malassezia furfur, 218

Malignant tumors, 124 Staurosporine, 124

Measles virus, 292 Molecular epidemiology, 291

Micrurus, 13 Argentina, 13

Momordica charantia, 251 Molluscicidal, 251 Lymnaea acuminata, 251

Moringa oleifera, 251 Molluscicidal, 251 Lymnaea acuminata, 251

Nosocomial infections, 385 Candida albicans, 385

P16INK4A, 329 Methylation, 329

Papillomavirus, 329 Cervical cancer, 329 16INK4A, 329

PCR, 1,91,101,315,401 Bartonellosis, 1 DNA polymerases, 401 Herpesvirus-2, 315 HIV-1, 91 Leishmania infection, 101

Phlebotomines, 85, 239, 407 Argentina-Brazil-Paraguay, 239 Minas Gerais State, Br., 85 Rural locations, 407 Paraná State, Br., 407

Phytotherapy, 303,421 Piperaceae, 421 Biomphalaria glabrata, 421 Ovicidal effect, 421 Snail control, 303

Plasmodium infection, 205 DNA extraction methods, 205

Rattus norvegicus, 51 Behavior, 51 Toxocara canis, 51 Toxoplasma gondii, 51

Renal alterations, 105 Visceral leishmaniasis, 105

Renal histopathology, 113 Visceral leishmaniasis, 113

Rotavirus, 137 Belo Horizonte, Br., 137

RT-PCR, 432 Respiratory viruses, 432 Saccharomyces boulardii, 363 Toxocara canis, 363

Saxophone penis, 290

Scedosporium apiospermum, 121 Voriconazole, 121

Schistosomiasis, 75, 213, 421 Lectin histochemistry, 213 Ovicidal effect, 421 Piperaceae, 421 Serological diagnosis, 75 Schistosomula antigens, 75

Scrub typhus, 293 Guangzhou, China, 293

Seafood safety, 219 Risk factors, 219

Serological diagnosis, 75 Schistosomula antigen, 75

Shigella flexneri, 341 Hypoxia, 341

Smqnr variants, 417 Stenotrophomonas maltophilia, 417

Snakebite accidents, 347 Northeast Brazil, 347

Soil contamination, 229 Dogs parasites, 229

Sporothrix schenckii, 353 Enzymatic activity, 353

Stenotrophomonas maltophilia, 417 Smqnr variants, 417

Strongyloides stercoralis, 233,291,309 Agarplate culture, 291 Elderly, 309 Eosinophilia, 233

Strongyloides venezuelensis, 141 Molecular diagnosis, 141

Tinea nigra plantaris, 125 Antifungal agents, 125 Double-blind study, 125

Tinea verscolor, 218

T lymphocytes, 323 Reference values, 323

Toxocara canis, 51, 363 Larvicidal action, 363 Rattus norvegicus, 51

Toxocariasis, 189 Children, 189 Paraná, Br., 189

Toxoplasma gondii, 51,65,79,232 IgG, 232 IgG avidity, 79 Protease inhibitors, 65 Rattus norvegicus, 51

Toxoplasmosis, 25 HIV/AIDS patients, 25

Traveler’s disease, 55, 216 Epidemiology, 55

Trypanosoma cruzi, 287 Dog, 287 Cuiabá, Br., 287

Tuberculosis infection, 366 Guangzhou, China, 366

Varicella vaccination, 217 Guangzhou, China, 217

Violin strings adhesion, 435 Laparoscopy, 435

Visceral leishmaniasis, 101,105,113,425,429 Co-infection, 425 HIV-AIDS, 425 HIV co-infection, 429 kDNA PCR, 429 PCR, 101 Renal alterations, 105 Dogs, 105 Renal histopathology, 113 Dogs, 113 Western blot, 79 Toxoplasma gondii, 79

Yellow fever, 45 Non-human primates, 45 São Paulo State, Br., 45

REVISTADO

INSTITUTO DE MEDICINA TROPICALDE SÃO PAULO

VOLUME 552013

Rev. Inst. Med. Trop. Sao Paulo, vol. 55 n. 1-6 p. 1-440 January-December, 2013

II

CONTENTS OF VOLUME 55

No. 1 - January/February, 2013MICROBIOLOGYDetection of Bartonella henselae DNA in clinical samples including peripheral blood of immune competent and immune compromised patients by three nested amplifications - K.H. KAWASATO, L.C. OLIVEIRA, P.E.N.F. VELHO, L. YAMAMOTO, G.M.B. DEL NEGRO & T.S. OKAY ..................................................................................................................................................................................1

MYCOLOGYViability and molecular authentication of Coccidioides spp. isolates from the Instituto de Medicina Tropical de São Paulo culture collection, Brazil - S.D.B. CAVALCANTI, M.S.M. VIDAL, M.G.T. SOUSA & G.M.B. DEL NEGRO ...........................................................................................7

ANIMAL ENVENOMATIONEnvenoming by coral snakes (Micrurus) in Argentina, during the period between 1979-2003 - A.R. de ROODT, E. DE TITTO, J.A. DOLAB & J.-P. CHIPPAUX .....................................................................................................................................................................................13

EPIDEMIOLOGYPrevalence and risk factors for intestinal protozoa infection in elderly residents at Long Term Residency Institutions in Southeastern Brazil - K.G. GIROTTO, D.F. GRAMA, M.J.R. CUNHA, E.S.M. FARIA, J.E. LIMONGI, R.M.C. PINTO & M.C. CURY ....................................................19

TOXOPLASMOSISEvaluation of seroepidemiological toxoplasmosis in HIV/AIDS patients in the south of Brazil - G.A. XAVIER, B.G. CADEMARTORI, N.A. CUNHA FILHO & N.A.R. FARIAS........................................................................................................................................................................25

CHAGAS DISEASEMuscarinic antibodies and heart rate responses to dynamic exercise and to the Valsalva maneuver in chronic chagasic patients - B.C. DAS NEVES, M.L. BACILIO, L. BERRUETA, S. SALMEN, D.L. PETERSON, J.H. DONIS, T.J. NUÑEZ & D.F. DAVILA ..........................31

SCHISTOSOMIASISBreeding of Biomphalaria tenagophila in mass scale - F.M. ROSA, D.P.A. MARQUES, E. MACIEL, J.M. COUTO, D.A. NEGRÃO-CORRÊA, H.M.S. TELES, J.B. SANTOS & P.M.Z. COELHO ............................................................................................................39

YELLOW FEVERYellow fever epizootics in non-human primates, São Paulo State, Brazil, 2008-2009 - E.S. MORENO, R. SPINOLA, C.H. TENGAN, R.A. BRASIL, M.M. SICILIANO, T.L.M. COIMBRA, V.R. SILVEIRA, I.M. ROCCO, I. BISORDI, R.P. SOUZA, S. PETRELLA, L.E. PEREIRA, A.Y. MAEDA, F.G. SILVA & A. SUZUKI .............................................................................................................................................45

BRIEF COMMUNICATIONBehavioral changes in Rattus norvegicus coinfected by Toxocara canis and Toxoplasma gondii - M.L. QUEIROZ, T.A. VIEL, C.H.G. PAPA, S.A.Z. LESCANO & P.P. CHIEFFI ..................................................................................................................................................................................51

PRELIMINARY REPORTHealth problems awareness during travel among faculty members of a large university in Latin America. Preliminary report - A.C.N. TOME, T.B. CANELLO, E.J.A. LUNA & H.F. ANDRADE JUNIOR .........................................................................................................................................55

CASE REPORTRRH: envenoming syndrome due to 200 stings from Africanized honeybees - G.A.R. SILVA, K.L. PIRES, D.C.S. SOARES, M.R. FERREIRA, F.R.A. FERRY, R.N. MOTTA & M.C.V.M. AZEVEDO ...................................................................................................................61

TECHNICAL REPORTAntiretroviral activity of protease inhibitors against Toxoplasma gondii - L. MONZOTE, M. RODRÍGUEZ, Y. ALFONSO & R. COX .....................65

LETTER TO THE EDITORAnalogies in medicine: Gimlet in Chagas disease - J.S. ANDRADE FILHO ..................................................................................................................68

No. 2 - March/April, 2013PARASITOLOGYPrevalence of intestinal parasitism and associated symptomatology among hemodialysis patients - F.F. GIL, M.J. BARROS, N.A. MACEDO, C.G.E. JÚNIOR, R. REDOAN, H. BUSATTI, M.A. GOMES & J.F.G. SANTOS ..........................................................................................................69

SCHISTOSOMIASISThe schistosomula tegument antigen as a potential candidate for the early serological diagnosis of schistosomiasis mansoni - R. GRENFELL, W. MARTINS, V. SILVA-MORAES, N. ARAUJO, E. OLIVEIRA, C. FONSECA & P.M.Z. COELHO. ......................................................................75

TOXOPLASMOSISIgG avidity Western blot using Toxoplasma gondii rGRA-7 cloned from nucleotides 39-711 for serodiagnosis of acute toxoplasmosis - P.S. DESHPANDE, D. KOTRESHA, R. NOORDIN, M.H. YUNUS, G. SAADATNIA, M. GOLKAR, S. OSMAN, I.Z.A. KARIM & F. GHAFFARIFAR ............................................................................................................................................................................................................79

III

EPIDEMIOLOGYSurvey of sandfly fauna (Diptera: Psychodidae) in Uberlândia, Minas Gerais State, Brazil, 2003 - 2004 - M.B.C. PAULA, A.A. SOUZA, A.A. REIS, J.E. LIMONGI, A.A. PAJUABA NETO & E.A.S. RODRIGUES ................................................................................................................85

HIVTesting a subtype-specific gp41 amplification method for genotyping individuals infected by human immunodeficiency virus type-1 in the Brazilian population of Itajaí, South Brazil - L.B. ARRUDA, L.I.WEBER, M. SANTOS, E.M. KAWAKUBO & A.M.B. MARTÍNEZ .....................91

LEISHMANIASISUse of polymerase chain reaction for the diagnosis of asymptomatic Leishmania infection in a visceral leishmaniasis-endemic area - L.A. SILVA, H.D. ROMERO, A. FAGUNDES, N. NEHME, O. FERNANDES, V. RODRIGUES, R.T. COSTA & A. PRATA ..................................101

The serum-conversion and evaluation of renal alterations in dogs infected by Leishmania (Infantum) chagasi - G.B.B. ALVES, L.S. SILVA, J.F. BATISTA, A.P. CAMPOS, M.G. PRIANTI & F.A.L. COSTA ............................................................................................................105

Renal histopathological findings in dogs with visceral leishmaniasis - R.S. RIGO, C.M.E. CARVALHO, M.R. HONER, G.B. ANDRADE, I.S. SILVA, L. RIGO, H.R. FIGUEIREDO & W.T.G. BARRETO .................................................................................................................................113

MYCOLOGYThe copper interference with the melanogenesis of Cryptococcus neoformans - R.M. MAUCH, V.O. CUNHA & A.L.T. DIAS ................................117

CASE REPORTScedosporium apiospermum eumycetoma successfully treated with oral voriconazole: report of a case and review of the Brazilian reports on scedosporiosis - F.M. OLIVEIRA, G. UNIS, B. HOCHHEGGER & L.C.SEVERO ................................................................................................121

Double-blind study with topical Isoconazole and Terbinafine for the treatment of one patient with bilateral Tinea nigra plantaris, and suggestions for new differential diagnosis - A.L. ROSSETTO, R.C.B. CRUZ & V. HADDAD JUNIOR.....................................................................125

First case of Angiostrongylus cantonensis eosinophilic meningitis diagnosed in the city of São Paulo, Brazil - M.C.C. ESPÍRITO-SANTO, P.L.S. PINTO, D.J.G. MOTA & R.C.B. GRYSCHEK ....................................................................................................................................................129

BRIEF COMMUNICATIONExperimental infection of Swiss and AKR/J mice with Centrocestus formosanus (Trematoda: Heterophyidae) - V.L.T. MATI, H.A. PINTO & A.L.MELO ......................................................................................................................................................................................................................133

Shift in human rotavirus distribution in Belo Horizonte, Brazil detected by ribonucleic acid electrophoresis - M.S.A.C. SILVA, F.J. PENNA, R.J. DUARTE, P.A.R. PEREIRA, A.E. CURSINO, L.A. PÉRET-FILHO, E.N. MENDES & P.P. MAGALHÃES .....................................................137

Parasitological and molecular diagnosis in experimental Strongyloides venezuelensis infection - F.M. PAULA, R.B. SITTA, F.M. MALTA, M. GOTTARDI, M.A.CORRAL, R.C.B. GRYSCHEK & P.P. CHIEFFI .......................................................................................................................141

LETTERS TO THE EDITORStaurosporine and its evolving role in inhibition of growth in malignant tumors – S. KAPOOR ..................................................................................124

Fatal gas-forming pyogenic liver abscess due to Klebsiella pneumoniae - Y. ZHANG, G.-Q. ZANG, Z.-H. TANG & Y.S. YU ..................................144

No. 3 - May/June, 2013ACKNOWLEDGEMENT TO REVIEWRS ......................................................................................................................................................................V

MYCOLOGYVariability in Galactomannan detection by platelia Aspergillus EIATM according to the Aspergillus species - M.O. XAVIER, J.S.V. ARAUJO, V.R. AQUINO, C.B. SEVERO, L.S. GUAZZELLI, L.C. SEVERO & A.C. PASQUALOTTO .........................................................145

HIVPrevalence and genetic characterization of Cryptosporidium spp. and Cystoisospora belli in HIV-infected patients - D.C. ASSIS, D.V. RESENDE, M. CABRINE-SANTOS, D. CORREIA & M.B. OLIVEIRA-SILVA ...............................................................................................149

VIROLOGYSerological survey of hantavirus in rodents in Uberlandia, Minas Gerais, Brazil - J.E. LIMONGI, F.G. MOREIRA, J.B. PERES, A. SUZUKI, I.B. FERREIRA, R.P. SOUZA, R.M.C. PINTO & L.E. PEREIRA ...............................................................................................................................155

ETHICSDo Brazilian scientific journals promote the adherence of Chagas disease researchers to international ethical principles? - G. MALAFAIA, D. GUILHEM & A. TALVANI .......................................................................................................................................................................................159

CHAGAS DISEASEEvaluation of the Elisa-F29 test as an early marker of therapeutic efficacy in adults with chronic Chagas disease - D. FABBRO, E. VELAZQUEZ, M.L. BIZAI, S. DENNER, V. OLIVERA, E. ARIAS, C. PRAVIA & A.M. RUIZ ..........................................................................167

LEPROSYActive search for leprosy cases in Midwestern Brazil: a serological evaluation of asymptomatic household contacts before and after prophylaxis with Bacillus Calmette-Guérin - O.M. LIMEIRA, C.M. GOMES, O.O. MORAIS, M.V. CESETTI & R.R.A. ALVAREZ .........................................173

IV

PARASITOLOGYIntestinal parasites in a quilombola community of the Northern State of Espírito Santo, Brazil - S.M. DAMAZIO, M.S. LIMA, A.R. SOARES & M.A.A. SOUZA .................................................................................................................................................................................179

High occurrence of giardiasis in children living on a ‘landless farm workers’ settlement in Araras, São Paulo, Brazil - O.A. LIMA Jr., J. KAISER & R. CATISTI ..............................................................................................................................................................................................185

Toxocariasis in children attending a Public Health Service Pneumology Unit in Paraná State, Brazil - E.V. GUILHERME, A.A. MARCHIORO, S.M. ARAUJO, D.L.M. FALAVIGNA, C. ADAMI, G. FALAVIGNA-GUILHERME, G. RUBINSKY-ELEFANT & A.L. FALAVIGNA-GUILHERME .................................................................................................................................................................................189

High occurrence of Entamoeba histolytica in the municipalities of Ariquemes and Monte Negro, State of Rondônia, Western Amazonia, Brazil - R.V. SANTOS, J.S. NUNES, J.A.S.A. CAMARGO, E.M.M. ROCHA, G. FONTES & L.M.A. CAMARGO ............................................................193

LEISHMANIASISThermotherapy effective and safer than miltefosine in the treatment of cutaneous leishmaniasis in Colombia - L. LÓPEZ, C. CRUZ, G. GODOY, S.M. ROBLEDO & I.D. VÉLEZ ................................................................................................................................................................197

TECHNICAL REPORTEvaluation of three different DNA extraction methods from blood samples collected in dried filter paper in Plasmodium subpatent infections from the Amazon region in Brazil - R.B. MIGUEL, J.R. COURA, F. SAMUDIO & M.C. SUÁREZ-MUTIS ............................................................205

CASE REPORTHistoplasmosis presenting with multiple pulmonary nodules. A case mimicking radiological features of pulmonary metastasis - A.G. DAL BELLO, C.B. SEVERO, F.M. OLIVEIRA, R.J. HALLAL JUNIOR, B. HOCHHERGGER & L.C. SEVERO .........................................209

BRIEF COMMUNICATIONEvaluation of WGA and Concanavalin A (Con A) lectin as biomarkers of hepatosplenic schistosomiasis in human biopsies with no evidence of egg-granuloma system - M.J.B.M. RÊGO, G.S. VIEIRA-DE-MELLO, C.W. ARAÚJO, M.S.M. CAVALCANTI & E.I.C. BELTRÃO ................213

LETTERS TO THE EDITORHealth problems awareness during travel among faculty members - V. WIWANITKIT ................................................................................................216

Varicella emergency vaccination seemed instrumental in declining chickenpox incidence in Guangzhou, southern China - L. TIEGANG ................217

Analogies in medicine: spaghetti and meatballs - J. S. ANDRADE FILHO ..................................................................................................................218

SUMMARY OF THESISCytomegalovirus infection in neonatal patients in units of Campo Grande, MS, Brazil - P.C.N. XAVIER ...................................................................148

No. 4 - July/August, 2013REVIEWBacteriological hazards and risks associated with seafood consumption in Brazil - C.A.M.L. SANTOS & R.H.S.F. VIEIRA ....................................219

PARASITOLOGYSoil contamination in public squares in Belo Horizonte, Minas Gerais, by canine parasites in different developmental stages - L.M. RIBEIRO, R.M. DRACZ, L.R. MOZZER & W.S. LIMA .....................................................................................................................................229

Hookworm and threadworm infections and their association with hemoglobin and eosinophil concentrations in residents of Salvador-Bahia, Brazil - F.L.N. SANTOS, A.M.G.C. SOUZA & N.M. SOARES ........................................................................................................233

PHLEBOTOMUSSpatial distribution of Phlebotominae in Puerto Iguazú-Misiones, Argentina-Brazil-Paraguay border area - M.S. SANTINI, I.T. GOULD, M.M. ACOSTA, P. BERROZPE, S.A. ACARDI, M.S. FERNÁNDEZ, A. GÓMEZ & O.D. SALOMON .............................................239

CHAGAS DISEASESeroprevalence of chagasic infection in young individuals in a blood center in the state of São Paulo, Brazil - E.C. NAVARRO, R.L. GOTO, I.S. RICOBONI, J.E. CORRENTE, R.M.S. HENRIQUES, S.L. NEVES, J.M. ZANINI, A.A. DORINI & P.C.M. PEREIRA ..............245

MOLLUSCICIDESCharacterization of molluscicidal component of Moringa oleifera leaf and Momordica charantia fruits and their modes of action in snail Lymnaea acuminata - A. UPADHYAY, V.K. SINGH & D.K. SINGH...................................................................................................................251

HIV/AIDSHistoplasmin survey in HIV-positive patients: results from an endemic area in Northeastern Brazil - F.S. BEZERRA, R.M. ZANCOPÉ-OLIVEIRA, R.S.N. BRILHANTE, B. WANKE, R.M.S. MOTA, A.P.G. RAMOS, A.N. RAMOS Jr., M.C. FAÇANHA & T.M.J.S. LEITÃO ...........................................................................................................................................................................261

Evolution of patients with AIDS after cART. Clinical and laboratory evolution of patients with AIDS after 48 weeks of antiretroviral treatment - A.E.C.G. FUKUMOTO, C.C. OLIVEIRA, K.I. TASCA & L.R. SOUZA ...................................................................................................267

V

CASE REPORTSCo-infection of dengue virus by serotypes 1 and 4 in patient from medium sized city from Brazil - T.E. COLOMBO, D. VEDOVELLO, A. MONDINI, A.F.N. REIS, A.A.F. CURY, F.H. OLIVEIRA, L.E.A.A. CRUZ, R.V.M. BRONZONI & M.L. NOGUEIRA .....................................275

Septic shock in patient with disseminated histoplasmosis associated with AIDS: a case report - F.O. POSWAR, J.A. CARNEIRO, J.M. STUART, J.P.O. FELICIANO & D.C. NASSAU ...................................................................................................................................................283

Natural infection by Trypanosoma cruzi in one dog in Central Western Brazil: a case report - A.B.P.F. ALMEIDA, D.A.J. PAULA, M.L.P. OTTON, F.W. JAUNE, R.A.S. CRUZ, M.F. MADEIRA, L. NAKAZATO, A.J. MENDONÇA, C.A. PESCADOR & V.R.F. SOUSA ...........287

LETTERS TO THE EDITORAnalogies in medicine: saxophone penis - J.S. ANDRADE-FILHO ..............................................................................................................................290

Is the agar plate culture a good tool for the diagnosis of Strongyloides stercoralis in candidates for transplantation? - F.M. PAULA, M. GOTTARDI, M.A. CORRAL, P.P. CHIEFFI & R.C.B. GRYSCHEK ......................................................................................................................291

Molecular epidemiology of a measles virus in Sao Paulo, Brazil: an imported case - M.I. OLIVEIRA, C.A. FIGUEIREDO, A.M.S. AFONSO, M.M. SIQUEIRA, X.R.M.R. LEMOS, A.L.F. YU & S.P. CURTI ...................................................................................................292

Scrub typhus rapidly increased in Guangzhou, Southern China, 2007-2012 - T. LI, Z. YANG & M. WANG ...............................................................293

SUMMARY OF THESISResearch of IgG anti-Toxoplasma gondii in exudate meat juice for monitoring the cattle beef quality - M.A.M. MARCIANO ..................................232

No. 5 - September/October, 2013REVIEWAcute kidney injury caused by Crotalus and Bothrops snake venom. A review of epidemiology, clinical manifestations and treatment - P.L.M.M. ALBUQUERQUE, C.N. JACINTO, G.B. SILVA JUNIOR, J.B. LIMA, M.S.B. VERAS & E.F. DAHER ...................................................295

PARASITOLOGYIn vitro phytotherapy of vector snails by binary combinations of larvicidal active components in effective control of fascioliasis - K. SUNITA, P. KUMAR, V.K. SINGH & D.K. SINGH ......................................................................................................................................................................303

High prevalence of Strongyloides stercoralis infection among the elderly in Brazil - M.M. NAVES & J.M. COSTA-CRUZ ......................................309

VIROLOGYPrevalence of herpes simplex virus type 2 and risk factors associated with this infection in women in Southern Brazil - T.D.M. CALDEIRA, C.V. GONÇALVES, G.R. OLIVEIRA, T.V. FONSECA, R. GONÇALVES, C.T. AMARAL, V.P. HORA & A.M.B. MARTINEZ ............................315

IMMUNOLOGYEstablishing the reference range for T lymphocytes subpopulations in adults and children from Brazil - A.J.L. TORRES, A.L.D. ANGELO, M.O. SILVA, M.C. BASTOS, D.F. SOUZA, L.A. INOCÊNCIO, J.A.R. LEMOS, R.S. JUNIOR, A.C. CASTRO, P.V.B. PALMA, L. CECI, E.M. NETTO & C. BRITES ...........................................................................................................................................................................................323

HPVAn upward trend in DNA P16INK4A methylation pattern and high risk HPV infection according to the severity of the cervical lesion - F.N. CARESTIATO, L.A. AFONSO, N. MOYSÉS, G.L. ALMEIDA FILHO, L.G.C. VELARDE & S.M.B. CAVALCANTI....................................329

MICROBIOLOGYSerological survey of Ehrlichia species in dogs, horses, and humans: zoonotic scenery in a rural settlement from southern Brazil - R.F.C. VIEIRA, T.S.W.J. VIEIRA, D.A.G. NASCIMENTO, T.F. MARTINS, F.S. KRAWCZAK, M.B. LABRUNA, R. CHANDRASHEKAR, M. MARCONDES, A.W. BIONDO & O. VIDOTTO ....................................................................................................................................................335

Hypoxic stress, hepatocytes and Caco-2 viability and susceptibility to Shigella flexneri invasion - C.B.C. LIMA, S.A. SANTOS & D.R. ANDRADE JÚNIOR ..............................................................................................................................................................................................341

ANIMAL ENVENOMATIONEpidemiological profile of snakebite accidents in a metropolitan area of Northeast Brazil - P.L.M.M. ALBUQUERQUE, G.B. SILVA JUNIOR, C.N. JACINTO, C.B. LIMA, J.B. LIMA, M.S.B. VERAS & E.F. DAHER ...................................................................................................................347

MYCOLOGYApplication of 6-nitrocoumarin as a substrate for the fluorescent detection of nitroreductase activity in Sporothrix schenckii - C.D.O. STOPIGLIA, M. CARISSIMI, T.C. DABOIT, V. STEFANI, V.A. CORBELLINI & M.L. SCROFERNEKER ..............................................353

LEISHMANIASISBody weight as a determinant of clinical evolution in hamsters (Mesocricetus auratus) infected with Leishmania (Viannia) panamensis - A.M. GÓMEZ-GALINDO & L.G. DELGADO-MURCIA ...........................................................................................................................................357

BRIEF COMMUNICATIONProtective effect of the probiotic Saccharomyces boulardii in Toxocara canis infection is not due to direct action on the larvae - L.F.C. AVILA, P.L. TELMO, L.H.R. MARTINS, T.A. GLAESER, F.R. CONCEIÇÃO, F.P.L. LEITE & C.J. SCAINI .......................................................................363

VI

LETTER TO THE EDITOR Males, ages ≥ 45 years, businessperson, floating population, and rural residents may be considered high-risk groups for tuberculosis infection in Guangzhou, China: a review of 136,394 TB confirmed cases - X. LI, T. LI & S. TAN ..............................................................................366

CORRESPONDENCE .............................................................................................................................................................................................369

No. 6 - November/December, 2013MYCOLOGYFirst report on Cryptococcus neoformans in pigeon excreta from public and residential locations in the metropolitan area of Cuiabá, State of Mato Grosso, Brazil - D.T. TAKAHARA, M.S. LAZÉRA, B. WANKE, L. TRILLES, V. DUTRA, D.A.J. PAULA, L. NAKAZATO, M.C. ANZAI, D.P. LEITE JÚNIOR, C.R. PAULA & R.C. HAHN ...............................................................................................................................371

Distribution of dermatophytes from soils of urban and rural areas of cities of Paraiba State, Brazil - Z.B.V.S. PONTES, A.C. OLIVEIRA, F.Q.S. GUERRA, L.R.A. PONTES & J.P. SANTOS .....................................................................................................................................................377

Molecular typing of Candida albicans isolates from hospitalized patients - P.S. BONFIM-MENDONÇA, A. FIORINI, C.S. SHINOBU-MESQUITA, L.C. BAEZA, M.A. FERNANDEZ & T.I.E. SVIDZINSKI ..........................................................................................385

LEISHMANIASISApplicability of kDNA-PCR for routine diagnosis of American tegumentary leishmaniasis in a tertiary reference hospital - M.M. SATOW, E.H. YAMASHIRO-KANASHIRO, M.C. ROCHA, L.K. OYAFUSO, R.C. SOLER, P.C. COTRIM & J.A.L. LINDOSO ................393

PCRComparison of six commercially-available DNA polymerases for direct PCR - M. MIURA, C. TANIGAWA, Y. FUJII & S. KANEKO ...................401

PHLEBOTOMINESPhlebotomine sandflies in rural locations in the state of Parana, Southern Brazil - S.C.C.S. MELO, W. CELLA, R. MASSAFERA, N.M.M.G. SILVA, R. MARQUI, M.D.B. CARVALHO & U. TEODORO ....................................................................................................................407

PARASITOLOGYPotentially pathogenic free-living amoebae in some flood-affected areas during 2011 Chiang Mai flood - A. WANNASAN, P. UPARANUKRAW, A. SONGSANGCHUN & N. MORAKOTE ..............................................................................................................................411

MICROBIOLOGYSmqnr variants in clinical isolates of Stenotrophomonas maltophilia in Brazil - J.I. GRACIA-PAEZ, J.R. FERRAZ, I.A. FRANÇA E SILVA, F. ROSSI, A.S. LEVIN & S.F. COSTA ..................................................................................................................................417

BRIEF COMMUNICATIONOvicidal effect of Piperaceae species on Biomphalaria glabrata, Schistosoma mansoni host - L.N. RAPADO,

P.O.M. LOPES,


CASE REPORTCase study of a patient with HIV-AIDS and visceral leishmaniasis co-infection in multiple episodes - E.D. SILVA, L.D. ANDRADE, P.S.R. ARAÚJO, V.M. SILVEIRA, C.E. PADILHA, M.A.L. SILVA & Z.M. MEDEIROS ...........................................................................................425

Usefulness of kDNA PCR in the diagnosis of visceral leishmaniasis reactivation in co-infected patients - A.C. NICODEMO, V.S. AMATO, F.F. TUON, R.M. SOUZA, T.S. OKAY & L.M.A. BRAZ .............................................................................................................................................429

LETTERS TO THE EDITORDifferential diagnosis of respiratory viruses by using real time RT-PCR methodology - R.S. PAULINO, M.A. BENEGA, K.C.O. SANTOS, D.B.G. SILVA, J.C. PEREIRA, N.A. SASAKI, P.E. SILVA, S.P. CURTI, M.I. OLIVEIRA, T.R.M.P. CARVALHANAS, T. PERET, D. ERDMAN & T.M. PAIVA..........................................................................................................................................................................................432



AUTHOR INDEX ......................................................................................................................................................................................................437

SUBJECT INDEX .....................................................................................................................................................................................................439

Documents

ISSN0036-4665 ISSN 1678-9946 on line · III Rev. Inst. Med. Trop. Sao Paulo Vol. 55 No. 6 P. 371-440 November-December, 2013 ISSN0036-4665 ISSN 1678-9946 on line ADDRESS INSTITUTO