ISOLATION, BIOINFORMATIC AND TISSUE EXPRESSION …ibic.lib.ku.ac.th/e-Bulletin/IBBU201404014.pdfbioinformatic, mRNA tissue distribution, phylogenetic analysis INTRODUCTION Butyrophilin

Buffalo Bulletin (December 2014) Vol.33 No.4

449

ABSTRACT

Butyrophilin 1a1 (BTN1A1) is a milk fat globule membrane protein and plays a crucial role in the secretion of milk lipid and milk lactation. In the present study, water buffalo BTN1A1 cDNA was isolated and characterized. The full-length CDS of BTN1A1 from the water buffalo mammary gland consists of 1581 nucleotides, which encodes 526 amino acids with a molecular weight of 49.26 kDa and a pI of 5.05. Bioinformatic prediction indicates that the protein contains one signal peptide in its N-terminal side, and belongs to a hydrophilic single-pass transmembrane protein located in the cytoplasm. The CDS sequence of BTN1A1 in water buffalo had 100%, 99%, 97% and 97% identity with that of cattle, yak, goat and sheep, respectively. There was no polymorphism found in water buffalo BTN1A1. The phylogenetic tree constructed based on the amino acid sequences of BTN1A1 from all sixteen species revealed that the water buffalo has closer genetic relationship with the species of bovidae family, which suggested that the function of water buffalo BTN1A1 is similar to that of other bovine species. Quantitative PCR (qPCR) analysis shows that the water buffalo BTN1A1 gene is mainly expressed in mammary gland, with little or no expression in other tissues,

which indicates BTN1A1 plays a crucial role in the secretion of milk lipid and milk lactation.

Keywords: water buffalo, BTN1A1 gene, bioinformatic, mRNA tissue distribution, phylogenetic analysis

INTRODUCTION

Butyrophilin 1a1 (BTN1A1) is a glycoprotein of the immunoglobulin superfamily that is highly expressed in the mammary gland (Robenek et al., 2006). Since it was fi rst isolated from bovine mammary tissue (Jack and Mather, 1990), BTN1A1 has been characterized in human, mouse and other mammalian tissues (Hare et al., 2002). BTN1A1 is a transmembrane glycoprotein with a signal peptide in N-terminal. Its gene structure and protein sequence are highly conserved in mammals (Ogg et al., 1996; Taylor et al., 1996). Many studies indicated BTN1A1 was only expressed in lactation and was closely related with the formation of milk fat globules (Bionaz and Loor, 2008; Ogg et al., 2004; Robenek et al., 2006). Compared with wild-type mice, the secretion of milk fat droplets was severely compromised in BTN1A1-defi cient mice (Ogg et al., 2004). These

ISOLATION, BIOINFORMATIC AND TISSUE EXPRESSION ANALYSIS OF A NOVEL WATER BUFFALO GENE-BTN1A1

Chunfeng Wu1, Lixian Liu2, Jinglong Huo1, Lianjun Li1 and Yongwang Miao1,*

1Faculty of Animal Science and Technology, Yunnan Agricultural University, Kunming, Yunnan, China, *E-mail: [email protected] of Husbandry and Veterinary, Yunnan Vocational and Technical College of Agriculture, Kunming, Yunnan, China

Original Article


450

data suggested the possibility that BTN1A1 directly regulated the assembly, transport, or secretion of milk fat droplets (Ogg et al., 2004).

To date, several single-nucleotide polymorphisms (SNPs) of the BTN1A1 have been found and some of them were signifi cantly associated with production traits in cattle (Bhattacharya et al., 2006; Jang et al., 2005; Komisarek et al., 2006; Muszyńska et al., 2010) and goat (Li et al., 2008; Qu et al., 2011). In addition, because the antibody (Ab) specifi c for the extracellular Ig-like domain of myelin oligodendrocyte glycoprotein (MOG) could cross-react with a homologous N-terminal domain of the bovine milk protein butyrophilin (BTN), BTN1A1 might play an important role in a wide range of animal health issues (Guggenmos et al., 2004). In fact, the research had identifi ed that BTN1A1 was an inhibitor of T cell activation (Smith et al., 2010). And furthermore, BTN1A1 was associated with functional longevity of dairy cattle (Szyda et al., 2011).

The BTN1A1 gene is a key gene which has important biological functions in milk lipid droplet formation. However, the water buffalo BTN1A1 gene has not been reported yet. In this study, based on the abundant bioinformatics resources and software tools, we fi rstly isolated the full-length coding sequence (CDS) of the water buffalo BTN1A1 gene, subsequently identifi ed its polymorphisms in the population and perfoormed a bioinformatics analysis based on the data obtained. Finally we examined expression of the gene in ten tissues by qPCR. The results of this study will establish a primary foundation for understanding the formation and secretion of milk fat droplets in water buffalo.

MATERIALS AND METHODS

Animals and sample collection The fresh tissue samples were obtained from ten lactating female water buffaloes in Yunnan, China (including four Binlangjiang buffaloes, two Dehong buffaloes, two Diandongnan buffaloes and two Yanjin buffaloes). Ten tissues, viz. abomasum, intestine, pituitary, brain, mammary gland, heart, liver, lung, kidney, muscle, were immediately dissected after the buffaloes were slaughtered. The samples were frozen in liquid nitrogen until RNA extraction.

RNA isolation, cDNA synthesis The total RNA was extracted using the RNAiso Plus (TaKaRa, Dalian) according to the manufacturer’s instructions. To remove genomic DNA contamination, total RNA was digested with RNase-free DNase I (TaKaRa, Dalian). Three micrograms of RNA were reverse-transcribed with oligo (dT)18 primer and M-MLV reverse transcriptase (Invitrogen, USA). The effi ciency of reverse transcription was checked on 2% agarose gel electrophoresis containing ethidium bromide.

Isolation of the water buffalo BTN1A1 gene The BTN1A1 sequences for cattle (accession no. NM_174508), goat (accession no. EF102891) and sheep (accession no. XM_004019064) were used to design a primer pair to amplify the complete coding sequence of BTN1A1 gene by using Primer Premier 5.0 software. The primer set was: 5’- ATCTTGCTGCCCAGAAAGGTTG -3’ (forward) and 5’- TAACCCCATGCCGACCTA ACT -3’ (reverse).

The polymerase chain reaction (PCR) was performed to isolate the BTN1A1 using the pooled cDNAs obtained from the different tissues


451

mentioned above. The 25 μl reaction system was: 2.5 μl cDNA (50 ng/μl), 1.25 μl 10 mM mixed dNTPs (TaKaRa, Dalian), 12.5 μl 2xGC buffer I (TaKaRa, Dalian), 0.5 μl 10 μM forward primer, 0.5 μl 10 μM reverse primer, 0.25 μl EX Taq DNA polymerase (5 U/μl, TaKaRa, Dalian), and 7.5 μl sterile water. The PCR program of BTN1A1 initially started with 95°C denaturation for 2 min, followed by 34 cycles of 94°C /45 s, 55°C /45 s, 72°C /2 minutes, then 72°C extension for 10 min, and fi nally 4°C to terminate the reaction. The PCR products from water buffalo BTN1A1 cDNA were then sequenced bidirectionally with the commercial fl uorometric method. The complete coding sequence of the water buffalo BTN1A1 gene has been submitted in the NCBI database and was assigned accession no. KC493632.

Sequence analysis Sequence alignments were performed using online software at the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov). The base composition analysis was done by employing the MEGA 4.0 program (Kumar et al., 2008). The protein prediction and analysis were conducted using the Conserved Domain Architecture Retrieval Tool of BLAST at the NCBI server (http://www.ncbi.nlm.nih.gov/BLAST). The molecular weight and theoretical isoelectric point (pI) were calculated by Compute pI/Mw (http://us.expasy.org/tools/pi_tool.html). Signal peptides were predicted using the SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP/) (Petersen et al., 2011). PSort II (http://psort.hgc.jp/) was used to predict protein sorting signals and intracellular localization. Transmembrane helices in proteins were also predicted by TMHMM Server version 2.0 (http://www.cbs.dtu.dk/services/TMHMM/). Secondary structures of deduced

amino acid sequences were predicted by SOPMA (http://npsa-pbil.ibcp.fr/) (Geourjon and Deleage, 1995). The protein domains and functional sites were analyzed using SMART (http://smart.embl-heidelberg.de/). The position and number of SNPs as well as corresponding haplotypes were exported with Mega 4.0 (Kumar et al., 2008).

Phylogenetic analysis The neighbor-joining phylogenetic tree was constructed based on BTN1A1 amino acid sequences by employing the CLUSTAL X 2.0 and MEGA 4.0 programs (Kumar et al., 2008), which subsequently were edited manually. The statistical signifi cance of groups within phylogenetic tree was evaluated using the bootstrap method with 10,000 replications.

Expression profi le analysis by qPCR qPCR was performed with ABI 7500 Fast System (Applied Biosystems) using Power SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer’s instructions. Considering GAPDH was stably expressed in most tissues of the body, we selected the housekeeping gene GAPDH as the endogenous control. The control gene primers used were: 5’- ATCAAGAAGGTGGTGAAGCAG -3’ (forward) and 5’-GGTAGAAGAGTGAGTGTCGCTG-3’ (reverse). The primers of the BTN1A1 gene were: 5’- GAGATGGCTGAATACCGGGG -3’ (forward), 5’- ACTCCCCATCATCAGAGGCT -3’ (reverse). Relative transcript quantifi cation was performed using standard curves generated for the GAPDH and the BTN1A1 genes from a fi ve-fold serial dilution of cDNA. The cDNA obtained from the different tissues mentioned above was used to generate the standard curves. In this assay, the effi ciency of the BTN1A1 and GAPDH primers were all in the ideal


452

range from 90% to 105%. The 20 μl reaction system included 2.5 μl cDNA, 10 μl Power SYBR Green PCR Master Mix, 0.5 μl 10 μM forward primer, 0.5 μl 10 μM reverse primer, and 6.5μl sterile water. The amplifi cation conditions used were the default setting: 50 °C/2min, 95 °C/10min, 40 cycles of 95 °C/15 sec, 60 °C/1min, and followed by melting curve stage of 95 °C/15sec, 60 °C/1min, 95 °C/30 sec, 60 °C/15 sec. Optical data were collected at the end of each extension step, and relative expression of PCR products was determined by the 2-ΔΔCT method (Livak and Schmittgen, 2001).

RESULTS

PCR result for water buffalo BTN1A1 gene The PCR product amplifi ed from pooled cDNAs for the water buffalo BTN1A1 gene was 1915 bp (Figure 1).

Nucleotide sequence analysis The nucleotide sequence analysis revealed that the gene sequence obtained in this study was not homologous to any of the known water buffalo genes. The coding region for BTN1A1 was 1581 bp with an overall base composition of A 23.09%, G 28.34%, T 23.47% and C 25.11%, which encoded 526 amino acids. The complete CDS of the BTN1A1 gene and their deduced amino acids are presented in Figure 2.

Further alignment among some species of the Bovidae family revealed that the coding sequence of water buffalo BTN1A1 had 100%, 99%, 97% and 97% identity with that of cattle, yak, goat and sheep. There was no polymorphism found within water buffalo in this study (Figure 3).

Characteristics and structures of the protein BTN1A1 The pI of water buffalo BTN1A1 was 5.05 and the molecular weight was 59.26 kDa. There was one confi dently predicted signal peptide (1-MAVFPNSCLAGCLLIFILLQLPKLDS-26) (Figure 4), four high probably domains, namely IGv (45-126 AA), C2-set_2 (148- 229 AA), PRY (302-354) and SPRY (355-476AA) in the water buffalo protein BTN1A1 (Figure 5). These domains are highly conserved (Figure 6). BTN1A1 was a hydrophilic single transmembrane protein located in the cytoplasm (Figure 7). The prediction of secondary structure by SOPMA indicated that the deduced BTN1A1 of the water buffalo contained four types of secondary structures, namely alpha helix (102AA), extended strand (138AA), beta turn (35AA) and random coil (25AA) (Figure 8).

Evolutionary relationships of BTN1A1 To evaluate the evolutionary relationships of buffalo BTN1A1 with other species, we constructed the unrooted phylogenetic tree on the basis of the BTN1A1 amino acid sequences using the neighbor-joining method (Figure 9). The phylogenetic tree based on the BTN1A1 sequences showed that the buffalo had closer genetic relationship with the species of bovidae family.

Tissue expression profi le analysis of the buffalo BTN1A1 In order to examine the differential distributions of BTN1A1 in tissues of water buffalo, the brain was considered as the reference and the relative mRNA expression levels of BTN1A1 were evaluated by qPCR (Figure 10). BTN1A1 mRNA was specifi cally expressed in mammary gland, with trace expression in intestine, pituitary, brain, abomasum, kidney, liver and muscle, and non-


453

Figure 1. RT-PCR result for water buffalo BTN1A1. 1. PCR product for water buffalo BTN1A1 gene. M. DL2000 DNA ladder.

Figure 2. The complete CDS and its deduced amino acids of water buffalo BTN1A1. Asterisk: the stop codon. The signal peptide sequence is shaded. Conserved domains are underlined. The transmembrane region is boxed.


454

Figure 3. The nucleotide differences in the coding region of the BTN1A1 gene among some species of the Bovidae family. Numbering is scored relative to the fi rst nucleotide of the start cording sequence of BTN1A1 in buffalo. Dots (·) denote identity with the buffalo reference sequence. Dashes (-) indicate the deletions of nucleotides in the sequence. Missing information in the sequence is indicated by question marks (?).The sequences cited were NM_174508 (cattle), AF037402 (cattle), Z93323 (cattle), AF005497 (cattle), EE921827 (cattle), EE921826 (cattle), JH884464 (yak), XM_004019064 (sheep), GW998890 (sheep), EF102891 (goat).


455

Figure 6. The putative conserved domain of the protein encoded by water buffalo BTN1A1.

Figure 4. Prediction of signal peptide of buffalo BTN1A1 by TMHMM. C-score: raw cleavage site score, S-score: signal peptide score, Y-score: combined cleavage site score.

Figure 5. Predicted functional domains of water buffalo BTN1A1 by SMART. The red region: signal peptide, IGv: Immunoglobulin V-Type, C2-set_2: CD80-like C2-set immunoglobulin domain, the blue region: transmembrane helix region, PRY: associated with SPRY domain, SPRY: Domain in SPla and the RYanodine Receptor.


456

Figure 7. Prediction of transmembrane regions of buffalo BTN1A1 by TMHMM.

Figure 8. Predicted secondary structures of the water buffalo BTN1A1 protein by SOPMA. Alpha helices, extended strands, beta turns, random coils are indicated, respectively, with the longest, the second longest, the third longest and the shortest vertical lines.


457

Figure 9. Phylogenetic tree based on the amino acid sequences of BTN1A1 among water buffalo and other species. The tree was constructed with the neighbor-joining method; the numbers on the branches represent bootstrap values for 10,000 replications.

Figure 10. Tissue expression profi le of water buffalo BTN1A1 gene. The horizontal axis and vertical axis indicate different tissues and 2-ΔΔCt value (mean ± SE), respectively. Each sample was repeated three times.


458

expression in heart and lung.

DISCUSSION

BTN1A1 is the most abundant milk fat globule membrane protein and it is mainly expressed in lactating mammary tissue (Robenek et al., 2006). It constitutes more than 40% of the dry weight of the total protein associated with the fat globule membrane of bovine milk (Banghart et al., 1998). BTN1A1 is produced in the end of pregnancy and maintained to the termination of the lactation (Franke et al., 1981). Accumulating studies also showed BTN1A1 played a crucial role in the formation and secretion of milk fat globules (Aoki, 2006; Robenek et al., 2006; Bionaz and Loor, 2008; Li et al., 2008) and might have an important effect on a wide range of animal health issues (Guggenmos et al., 2004; Smith et al., 2010; Szyda et al., 2011). In this study, the full-length coding sequence of the BTN1A1 was isolated from water buffalo. It contains 1581 nucleotides encoding a protein of 526 residues with a molecular weight of 49.26 kDa and a pI of 5.05. This study will provide a molecular basis for unfolding the genetic variation characteristics about BTN1A1 and the primary foundation for understanding the mechanisms of the formation and secretion of milk fat droplets in water buffalo.

The CDS sequence of BTN1A1 in water buffalo had 100%, 99%, 97% and 97% identity with that of cattle, yak, goat and sheep. There is no polymorphism existing in the BTN1A1 gene of water buffalo. The results suggested the BTN1A1 gene was highly conserved in the Bovidae family. Furthermore, the evolutionary relationships based on BTN1A1 amino acid sequences also revealed that water buffalo had closer genetic relationships

with the species of bovidae. This implied that the BTN1A1 protein of water buffalo has minor divergence functionally with that of other bovidae species and may have large function differences from other mammal species. Therefore, the results of water buffalo BTN1A1 study can be used as a reference for understanding possible functions of BTN1A1 in other bovidae species.

Bioinformatic analysis indicated that BTN1A1 was a hydrophilic single transmembrane protein located in the cytoplasm and there was one confi dently predicted signal peptide and four high probably domains, namely IGv, C2-set_2, PRY and SPRY. This is consistent with a previous study (Ogg et al., 1996). IGv and C2-set_2 are immunoglobulin-related domains; we speculate the function of these two domains are to regulate the health of the water buffalo. The function of the PRY and SPRY domain has always been obscure. Considering the cytoplasmic domain of BTN1A1 was a major component of the protein complex, which is formed between the surface of outer membrane bilayer and the lipid droplets as the droplets emerge from cell (Guggenmos et al., 2004), we think that the PRY and SPRY domain might play a critical role in formation or secretion of the milk fat droplets, although the specifi c mechanism is unclear.

The expression pattern of water buffalo BTN1A1 in ten tissues was analyzed by qPCR and abundant expression of this gene was found in mammary gland, trace expression in intestine, pituitary, brain, abomasum, kidney, liver and muscle, and non-expression in heart and lung. This seems to differ from the known fi ndings in cattle, in which BTN1A1 was only detected in mammary gland and not detected in heart, liver, kidney or intestine of cattle (Jack and Mather, 1990). For a long time, researchers believed that BTN1A1


459

only expressed in lactating mammary gland (Aoki, 2006; Robenek et al., 2006; Bionaz and Loor, 2008; Li et al., 2008). In fact, the transcription of BTN1A1 was expressed not only in lactating mammary glandbut also in the non-lactating breast and even in the spleen and thymus (Smith et al., 2010). At the same time, we also noticed that cattle BTN1A1 gene is only expressed in mammary gland and salivary gland (http://www.ncbi.nlm.nih.gov/UniGene). Compared with the tissue distribution in mice and cattle, it can be seen that the gene was obviously expressed in different patterns for some tissues in water buffalo. To explain these differential expressions of the gene, further research based on these primary results is needed.

In summary, we have isolated the water buffalo BTN1A1 gene for the fi rst time and performed necessary polymorphism detection, bioinformatics analysis and tissue expression profi le analysis. This will provide a primary foundation for further investigations of water buffalo BTN1A1 gene.

ACKNOWLEDGMENT

This study was fi nancially supported by the Natural Science Foundation Key Project of Yunnan Province, China (No. 2007C0003Z), the National Natural Science Foundation of China (No.30660024), the Applied and Basic Research Foundation of Yunnan Province, China (No. 2006C0034M and 2010ZC243) and the Foundation of Yunnan Department of Finance, China (Study on the germplasm characteristics of Binglangjiang water buffalo).

REFRENCES

Aoki, N. 2006. Regulation and functional relevance of milk fat globules and their components in the mammary gland. Biosci. Biotech. Bioch.,70: 2019-2027.

Banghart, L.R., C.W. Chamberlain, J. Velarde, I.V. Korobko, S.L. Ogg, L.J. Jack, V.N. Vakharia and I.H. Mather. 1998. Butyrophilin is expressed in mammary epithelial cells from a single-sized messenger RNA as a type I membrane glycoprotein. J. Biol. Chem., 73: 4171-4179.

Bhattacharya, T., S. Misra, F.D. Sheikh, S. Sukla, P. Kumar and A. Sharma. 2006. Effect of butyrophilin gene polymorphism on milk quality traits in crossbred cattle. Asian. Austral. J. Anim., 19: 922.

Bionaz, M., and J.J. Loor. 2008. Gene networks driving bovine milk fat synthesis during the lactation cycle. BMC Genomics, 9: 366.

Franke, W.W., H.W. Heid, C. Grund, S. Winter, C. Freudenstein, E. Schmid, E.D. Jarasch and T.W. Keenan. 1981. Antibodies to the major insoluble milk fat globule membrane-associated protein: specifi c location in apical regions of lactating epithelial cells. J. Cell. Biol., 89: 485-494.

Geourjon, C. and G. Deleage. 1995. SOPMA: signifi cant improvements in protein secondary structure prediction by consensus prediction from multiple alignments. Comput. Appl. Biosci., 11: 681-684.

Guggenmos, J., A.S. Schubart, S. Ogg, M. Andersson, T. Olsson, I.H. Mather and C. Linington. 2004. Antibody cross-reactivity between myelin oligodendrocyte glycoprotein and the milk protein butyrophilin in multiple sclerosis. J. Immunol., 172: 661-668.


460

Hare, M.P., F. Cipriano and S.R. Palumbi. 2002. Genetic evidence on the demography of speciation in allopatric dolphin species. Evolution, 56: 804-816.

Jack, L.J. and I.H. Mather. 1990. Cloning and analysis of cDNA encoding bovine butyrophilin, an apical glycoprotein expressed in mammary tissue and secreted in association with the milk-fat globule membrane during lactation. J. Biol. Chem., 265: 14481-14486.

Jang, G., K. Cho, T. Kim, S. Oh, I. Cheong and K. Lee. 2005. Association of candidate genes with production traits in Korean dairy proven and young bulls. Asian Austral. J. Anim., 18: 165-169.

Komisarek, J., K. Waskowicz and Z. Dorynek. 2006. Analysis of the relationship between two single nucleotide polymorphisms of the butyrophilin (BTN1A1) gene and milk production traits in Jersey cattle. Ann. Anim. Sci., 6: 45-52.

Kumar, S., M. Nei, J. Dudley and K. Tamura. 2008. MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform., 9: 299-306.

Li-Juan, Z., W. Hui-Juan, L. Jun, L. Jun-Xia, Z. Ning, W. Hai-Bing, S. Cui-Yan and Y. Gang. 2008. Screening, cloning and sequence analysis of gBTN1A1 gene in mammary gland of Xinong Saanen goat. Chin. J. Arg. Bio., 5: 19-26.

Livak, K.J. and T.D. Schmittgen. 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2− ΔΔCT Method. Methods, 25: 402-408.

Muszyńska, M., I. Szatkowska, W. Grzesiak, A. Dybus and D. Zaborski. 2010. Two single nucleotide polymorphisms within bovine

butyrophilin gene (BTN/HaeIII and BTN/SchI) and their association with milk performance traits in Jersey cattle. Arch. Tierzucht., 53: 501-509.

Ogg, S.L., M.V. Komaragiri and I.H. Mather. 1996. Structural organization and mammary-specifi c expression of the butyrophilin gene. Mamm. Genome, 7: 900-905.

Ogg, S.L., A.K. Weldon, L. Dobbie, A.J. Smith and I.H. Mather. 2004. Expression of butyrophilin (Btn1a1) in lactating mammary gland is essential for the regulated secretion of milk-lipid droplets. P. Natl. Acad. Sci. USA., 101: 10084-10089.

Petersen, T.N., S. Brunak, G. von Heijne and H. Nielsen. 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods, 8: 785-786.

Qu, Y., Y. Liu, L. Ma, S. Sweeney, X. Lan, Z. Chen, Z. Li, C. Lei and H. Chen. 2011. Novel SNPs of butyrophilin (BTN1A1) and milk fat globule epidermal growth factor (EGF) 8 (MFG-E8) are associated with milk traits in dairy goat. Mol. Biol. Rep., 38: 371-377.

Robenek, H., O. Hofnagel, I. Buers, S. Lorkowski, M. Schnoor, M.J. Robenek, H. Heid, D. Troyer and N.J. Severs. 2006. Butyrophilin controls milk fat globule secretion. P. Natl. Acad. Sci. USA., 103: 10385-10390.

Smith, I.A., B.R. Knezevic, J.U. Ammann, D.A. Rhodes, D. Aw, D.B. Palmer, I.H. Mather, and J. Trowsdale. 2010. BTN1A1, the mammary gland butyrophilin, and BTN2A2 are both inhibitors of T cell activation. J. Immunol., 184: 3514-3525.

Szyda, J., M. Morek-Kopec, J. Komisarek and A. Zarnecki. 2011. Evaluating markers in selected genes for association with functional longevity of dairy cattle. BMC.


461

Genet., 12: 30.Taylor, M.R., J.A. Peterson, R.L. Ceriani and J.R.

Couto. 1996. Cloning and sequence analysis of human butyrophilin reveals a potential receptor function. Biochim. Biophys. Acta, 1306: 1-4.

Documents

ISOLATION, BIOINFORMATIC AND TISSUE EXPRESSION …ibic.lib.ku.ac.th/e-Bulletin/IBBU201404014.pdfbioinformatic, mRNA tissue distribution, phylogenetic analysis INTRODUCTION Butyrophilin