APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Aug. 2006, p. 5569–5577 Vol. 72, No. 80099-2240/06/$08.00�0 doi:10.1128/AEM.00122-06

Isolation and Identification of Rickettsia massiliae fromRhipicephalus sanguineus Ticks Collected in Arizona

Marina E. Eremeeva,* Elizabeth A. Bosserman, Linda J. Demma,Maria L. Zambrano, Dianna M. Blau, and Gregory A. Dasch

Viral and Rickettsial Zoonoses Branch, Centers for Disease Control and Prevention, Atlanta, Georgia

Received 17 January 2006/Accepted 21 May 2006

Twenty Rhipicephalus sanguineus ticks collected in eastern Arizona were tested by PCR assay to establishtheir infection rate with spotted fever group rickettsiae. With a nested PCR assay which detects a fragment ofthe Rickettsia genus-specific 17-kDa antigen gene (htrA), five ticks (25%) were found to contain rickettsial DNA.One rickettsial isolate was obtained from these ticks by inoculating a suspension of a triturated tick intomonolayers of Vero E6 monkey kidney cells and XTC-2 clawed toad cells, and its cell culture and genotypiccharacteristics were determined. Fragments of the 16S rRNA, GltA, rOmpA, rOmpB, and Sca4 genes had100%, 100%, 99%, 99%, and 99%, respectively, nucleotide similarity to Rickettsia massiliae strain Bar29,previously isolated from R. sanguineus in Catalonia, Spain (L. Beati et al., J. Clin. Microbiol. 34:2688–2694,1996). The new isolate, AZT80, does not elicit cytotoxic effects in Vero cells and causes a persistent infectionin XTC-2 cells. The AZT80 strain is susceptible to doxycycline but resistant to rifampin and erythromycin.Whether R. massiliae AZT80 is pathogenic or infectious for dogs and humans or can cause seroconversion tospotted fever group antigens in the United States is unknown.

The genus Rickettsia contains a diverse and expanding num-ber of obligately intracellular gram-negative bacteria (23, 43).These bacteria vary in their antigenic and microbiological char-acteristics, as well as their distribution, ecology, pathogenicity,and association with arthropod hosts including lice, fleas, ticks,and mites, as well as nonhematophagous hosts. Molecularmethods are increasingly used to differentiate and define theirtaxonomic and phylogenetic relationships.

At least 14 well-characterized Rickettsia genotypes are rec-ognized in northern America. In the classic, highly pathogenictyphus group, the widespread agent of murine typhus, Rickett-sia typhi, is transmitted by fleas while Rickettsia prowazekii ismaintained in a sylvatic cycle by the flying squirrels, Glaucomysvolans, and its ectoparasites in the eastern United States. Theecology and pathogenicity of Rickettsia canadensis, which ex-hibits both typhus and spotted fever group characteristics, ispoorly defined, but it has been isolated from Haemaphysalisticks in Quebec and California. Rickettsia felis and Rickettsiaakari are transmitted by fleas and mites, respectively, and haveecoepidemiological characteristics different from the otherspotted fever group rickettsiae which are transmitted by ticks(13, 42). Rickettsia rickettsii, the causative agent of RockyMountain spotted fever (RMSF) is the best known speciesthroughout the Americas. R. rickettsii is transmitted by theAmerican dog tick Dermacentor variabilis and the wood tickDermacentor andersoni in the eastern and western UnitedStates, respectively, and by Amblyomma cajennense in part ofTexas and south of the United States. Rhipicephalus san-guineus, the brown dog tick, was recently implicated as a vector

of R. rickettsii in eastern Arizona (21) and has been identifiedas a vector of RMSF in Mexico (15, 16). Rickettsia parkeri wasrecently described as a cause of spotted fever rickettsioses andis transmitted by the Gulf Coast tick, Amblyomma maculatum(41). Another spotted fever group rickettsia found in Ambly-omma americanum ticks, referred to as “Rickettsia amblyom-mii,” has also been associated with a mild febrile illness andrash in the southern United States (19, 20, 58). Rickettsia mon-tanensis and Rickettsia rhipicephali have been isolated fromhuman-biting ticks, D. variabilis, D. andersoni, Dermacentoroccidentalis, R. sanguineus, and Ixodes pacificus, but these rick-ettsiae have not been proven to be pathogenic for humans (8,14, 31, 46, 47). Similarly, pathogenic potential has not beenestablished for Rickettsia bellii which is found in a wide rangeof hard and soft ticks (45) and for a R. rickettsii-like rickettsiafound in argasid ticks (36). The pathogenic potential is alsounknown for the “Cooleyi” genotype of spotted fever grouprickettsiae detected in the black-legged tick Ixodes scapularisfrom Texas (12). Similarly, the “Midichlorii” genotype found inI. scapularis and I. pacificus represents another rickettsia, but itis considered to be a transovarially maintained endosymbiont(51). The presence of apparently nonpathogenic rickettsiaewhose vector host and geographic distributions overlap withthose of pathogenic rickettsiae may interfere with the trans-mission of virulent species to humans, as has been proposedfor Rickettsia peacockii and R. rickettsii in D. andersoni in theBitterroot Valley of Montana (39).

We report here the first detection and isolation of Rickettsiamassiliae from R. sanguineus ticks collected in Arizona in anarea where R. rickettsii infection is endemic (21).

MATERIALS AND METHODS

Tick collection, identification, and processing. In June 2004, ticks were col-lected by flagging in a peridomestic environment in an area of eastern Arizonaas previously described (21). Ticks were surface disinfected using a series of

* Corresponding author. Mailing address: Viral and RickettsialZoonoses Branch, Mail Stop G-13, National Center for InfectiousDiseases, Centers for Disease Control and Prevention, 1600 CliftonRoad NE, Atlanta, GA 30333. Phone: (404) 639-4612. Fax: (404)639-4436. E-mail: MEremeeva@cdc.gov.

5569

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

washes with 10% bleach for 1 to 2 min, 70% ethanol for 3 to 5 min, and threetimes with distilled water, and excess water was blotted with filter paper. One halfof each tick was processed for DNA extraction using a QIAamp DNA Mini Kit(QIAGEN, Valencia, CA). The other half was placed in a sterile vial containing0.1 ml of sucrose glutamate buffer (0.22 M sucrose, 0.1 M potassium phosphate,0.005 M sodium L-glutamate, pH 7.0) supplemented with 5 mM MgCl2 and 1%Hypaque-76 (Nycomed, Inc., Princeton, NJ) (SRM buffer) and frozen at �80°C.

Isolation of rickettsiae. Frozen tick samples were thawed and triturated, thevolume was increased to 0.5 ml with SRM buffer, and 0.15 ml was used toinoculate a 25-cm2 flask containing a confluent monolayer of Vero E6 cells (CRL1587/Vero 76; American Type Culture Collection, Manassas, VA). Cells weremaintained in RPMI 1640 cell culture medium (GIBCO-Invitrogen Corp.,Grand Island, NY) supplemented with 2% fetal bovine serum (HyClone Labo-ratories Inc., Logan, UT), 5% tryptose phosphate broth, and 1 mM L-glutamineat 34°C in a CO2 incubator. One milliliter of a tissue culture suspension thatcontained rickettsial DNA as determined by PCR was used to infect a confluentmonolayer of XTC-2 cells (49). The flasks were incubated for 1 h at roomtemperature by rocking, supplemented with Leibovitz L-15 cell culture medium(Invitrogen) containing 2% fetal bovine serum, 5% tryptose phosphate broth,and 1 mM L-glutamine; the culture was transferred into a CO2 incubator at 28°C.The presence of rickettsiae in the cell cultures was first detected in XTC-2 cellsfollowing staining with acridine orange (35). Infected XTC-2 cultures were fur-ther passaged onto VERO cells at 34°C until sustained abundant growth of therickettsiae was established.

Preparation of rickettsial seeds, evaluation of growth characteristics, andantibiotic susceptibility of rickettsial isolate. Rickettsiae were propagated inVERO cell monolayers, the heavily infected cells were harvested with glassbeads, and the suspension was pelleted by centrifugation at 10,000 rpm (17,000 �g) for 20 min. The pellet was resuspended in 100 ml of K-36 buffer (0.05 Mpotassium phosphate, 0.1 M KCl, 0.15 M NaCl, pH 7.0) (67). It was centrifugedfor 10 min at 1,000 rpm (200 � g) in a tabletop centrifuge (Beckman GRP,Hamburg, Germany), and the supernatant containing rickettsiae was filteredthrough an AP-25 glass fiber filter (Millipore Corp., Bedford, MA). Rickettsiaewere concentrated by centrifugation for 20 min at 10,000 rpm; the pellet wasresuspended in 10 ml of SRM buffer and frozen in aliquots at �80°C. The viabletiter of purified rickettsiae was determined by plaque titration on nonirradiatedL929 mouse fibroblast cells (ATCC CCL-1) grown in Eagle’s minimal essentialmedium (Invitrogen) and M199 medium (Invitrogen) mixed at a ratio of 1:1(vol/vol), containing 2% fetal bovine serum, 5% tryptose phosphate broth, and 1mM L-glutamine as described previously (68). A second overlay of agarosecontaining 0.5 M NaF was added 3 days after primary inoculation to inhibitmetabolism and growth of the host cells (48).

To quantify growth characteristics of the new isolate, confluent monolayers ofVero cells and XTC-2 cells were grown in 33-mm dishes and infected withrickettsiae at a multiplicity of infection (MOI) of 0.1 PFU per cell as previouslydescribed (25). Infected cells were harvested from duplicate wells immediatelyfollowing inoculation and on days 1, 3, 5, 7, 9, and 11 after inoculation. The cellculture medium and infected cells were combined and centrifuged in an Eppen-dorf vial for 10 min at 14,000 � g, and the resulting pellet was used for DNAextraction using a QIAamp DNA Mini Kit (QIAGEN). DNA was eluted with200 �l of AE (10 mM Tris-Cl, 0.5 mM EDTA, pH 9.0) buffer (QIAGEN) and

stored at 4°C. Rifampin (0.5 to 2 �g/ml), erythromycin (1 to 8 �g/ml), anddoxycycline (0.03 to 0.125 �g/ml) (Sigma, St. Louis, MO) were added in serialtwofold dilutions, and their effect was evaluated on day 5 following inoculation.VERO cells infected with R. rickettsii strain Bitterroot under the same conditionswere used as a control; preparation of R. rickettsii seeds has been describedpreviously (25). The effect of antibiotics was determined by comparing theamounts of rickettsial DNA detected and normalized to the total DNA quantityrecovered in each sample. The DNA concentration was measured using aPicoGreen double-stranded DNA quantitation kit according to the manufactur-er’s instructions (Molecular Probes, Eugene, OR). Statistical significance wasassessed by a Student’s t test.

PCR assays. No work was done with European isolates of R. massiliae in thesame facility during the time this work was done. A nested PCR assay to amplifya fragment of the 17-kDa antigen gene (htrA) was used to detect the presence ofrickettsiae in ticks as described previously (1, 64). A rompA SYBR green quan-titative PCR assay was used to measure the amount of rickettsial DNA in cellculture samples on an i-Cycler (Bio-Rad Laboratories Inc., Hercules, CA) (24).PCR amplification of the 16S rRNA, GltA, rOmpA, rOmpB, and Sca4 genesfrom the isolated rickettsiae for DNA sequencing was performed using QIA-GEN Master Mix reagents. The oligonucleotide primers used are shown in Table1; rompB and sca4 were characterized using primers published previously (54,62). The primers were made by the CDC Core Facility (Atlanta, GA) and wereused at a final concentration of 1 �M unless otherwise specified. Restrictionendonucleases, RsaI, and PstI (New England BioLabs, Beverly, MA), were usedfor restriction fragment polymorphism (RFLP) analysis (26). RFLP fragmentswere resolved on 2% agarose gels.

DNA sequencing. Sequence reactions were performed using an ABI PRISM3.0 BigDye Terminator Cycle Sequencing kit as recommended by the manufac-turer (Applied BioSystems, Foster City, CA). The sequenced products werepurified with a QIAGEN Dye Removal Kit and run on an Applied BioSystems3100 Nucleic Acid Sequence Analyzer.

Nucleotide sequence accession numbers. The nucleotide sequences generatedduring this study were deposited in the NCBI GenBank under the followingaccession numbers: DQ517444 for the 17-kDa antigen gene fragment, DQ212705for the gltA fragment, DQ212706 for the 16S rRNA gene, DQ212707 for therompA fragment, DQ503428 for rompB, and DQ503429 for sca4.

RESULTS

Tick evaluation. Twenty questing adult R. sanguineus ticks (8males and 12 females) were collected by flagging around asingle control household evaluated as a part of an investigationinto cases of RMSF in Arizona (21). By nested PCR assay,which amplifies a 220-bp fragment of the 17-kDa antigen geneof Rickettsia, five ticks (three males: AZT68, AZT69, andAZT82; two females: AZT80 and AZT81) were found positivefor the presence of rickettsial DNA. All five amplicons hadidentical nucleotide sequences that shared 99% sequence ho-

TABLE 1. Primers used in this study

Application Target Primer name Primer sequence (5� 3 3�) Reference

Nested PCR (for testing ticks) 17-kDa antigen gene (htrA) R17-122 CAGAGTGCTATGAACAAACAAGG 1, 64R17-500 CTTGCCATTGCCCATCAGGTTGTZ15 TTCTCAATTCGGTAAGGGCTZ16 ATATTGACCAGTGCTATTTC

SYBR green PCR rompA RR190.547F CCTGCCGATAATTATACAGGTTTA 24, 55RR190.701R GTTCCGTTAATGGCAGCATCT

Isolate characterization 16S rRNA gene WfD1 AGAGTTTGATCCTGGCTCAG 661073R ACGAGCTGACGACAGCCATG

gltA RpCS877F GGGGACCTGCTCACGGCGG 50RpCS1258R ATTGCAAAAAGTACAGTGAACA

rompA RR190.70F ATGGCGAATATTTCTCCAAAAA 50, 55RR190.602R AGTGCAGCATTCGCTCCCCCTRR190.701R GTTCCGTTAATGGCAGCATCT

5570 EREMEEVA ET AL. APPL. ENVIRON. MICROBIOL.

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

mology with the 17-kDa protein gene fragment from R. rhipi-cephali and the R. rhipicephali-like rickettsiae, ARANHA andATT (Fig. 1). A 602-bp fragment from the 5� region of theRickettsia rompA was amplified only from the DNA of the twosamples from AZT68 and AZT80. The PstI and RsaI restric-tion profiles of the two fragments were each the same, and theywere identical to those previously published for the strainBar29 of R. massiliae (Fig. 2).

Isolation of rickettsiae. Following primary inoculation ofVERO cells with suspensions of the five ticks found positive byPCR assay (AZT68, AZT69, AZT80, AZT81, and AZT82),the cultures were maintained for 4 weeks, but no obviouscytotoxic effect was observed, and inconclusive results wereobtained upon examination of slides stained with acridine or-ange. To verify the presence of any rickettsial DNA, an aliquotof each of the inoculated cell cultures was tested by PCR of the

gltA gene fragment. Samples AZT68 and AZT80 tested posi-tive for rickettsial DNA. Because the poor growth in VEROcells suggested that growth of the rickettsiae might be temper-ature sensitive, suspensions of these infected cells were inoc-ulated onto confluent monolayers of XTC-2 cells and incu-bated at 28°C. Changes in morphology of the infectedmonolayers were noticed, and the presence of rickettsia-likeorganisms in the cell culture medium infected with onlyAZT80 cell suspension was detected 10 days following inocu-lation. The cells in the supernatant were used to infect anotherflask of XTC-2 cells, and fresh medium was added to theattached cells in the original culture. The presence of rickett-sial DNA was detected in both of these cultures by PCR 3weeks following the inoculation. Another passage was per-formed in XTC-2 cells followed by inoculation of VERO cellswith the infected cell culture supernatant. An isolate of rick-

FIG. 1. Nucleotide sequence comparison of 17-kDa antigen gene fragment from AZ ticks and its nearest relatives. Reference sequences of R.rhipicephali (AF483196), ARANHA (AY360215), and ATT (AF483196) are from NCBI GenBank; sequences from AZ ticks are from this study.

1 2 3 Bar29 Mas RH RC RR 1 2 3 Bar29 Mas RH RC RR

A B

FIG. 2. RFLP typing of spotted fever group rickettsiae in R. sanguineus ticks. The 70- to 602-nucleotide fragment of the rOmpA gene wasamplified using seminested PCR, followed by restriction enzyme digestion with RsaI (A) and PstI (B). Restriction patterns of the homologousfragments from other spotted fever group rickettsiae found in R. sanguineus were published previously (25). Lanes 1, 1-kb Plus DNA molecularsize ladder (Invitrogen); lanes 2, AZT68; lanes 3, AZT80. Other abbreviations: Bar29, R. massiliae strain Bar29; Mas, R. massiliae strain Mtu1; RH,R. rhipicephali strain 3-7-6�; RC, R. conorii Malish; RR, R. rickettsii Sheila Smith. Arrows indicate positions of the 100-bp fragment of the ladder.

VOL. 72, 2006 RICKETTSIA MASSILIAE IN ARIZONA 5571

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

ettsiae designated AZT80 was obtained that could be thenstably maintained in VERO cells at 34°C.

The VERO-passaged AZT80 rickettsiae grew well in bothXTC-2 and VERO cells (Fig. 3). The VERO cell monolayer

infected with AZT80 underwent senescence at 3.5 to 4 weeksfollowing inoculation. Flasks of XTC-2 monolayers inoculatedwith AZT80 were maintained for 5.5 months as a persistent in-fection by changing the cell culture medium every 10 days to 2 weeks.

FIG. 3. Acridine orange staining of AZT80 isolate released from VERO E6 cell monolayers (A) and XTC-2 cells (B). Photographs were takenusing Zeiss fluorescent microscope with a 10� ocular and a 100� objective.

5572 EREMEEVA ET AL. APPL. ENVIRON. MICROBIOL.

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Plaque forming ability, kinetics of growth, and antibioticsusceptibility of new isolate AZT80. The ability of the AZT80isolate to form lytic plaques in confluent monolayers of VEROE6 and L929 cells was evaluated. No lytic plaques were pro-duced in L929 cells infected without NaF treatment or inVERO E6 cells with or without NaF. Small 1-mm diameterplaques were observed in L929 cultures treated with sodiumfluoride after 10 days. The PFU titer of the semipurified sus-

pension of AZT80 isolate used for this experiment was esti-mated to be 107 PFU per ml.

When XTC-2 cells were infected at an MOI of 0.1 rickettsiaeper cell, the amount of DNA fluctuated greatly initially, butAZT80 DNA did not accumulate in a significant amount perplate of XTC-2 cells during days 5 to 11 of observation (P �0.55) and did not exhibit a logarithmic increase typical forspotted fever group rickettsiae (Fig. 4A). In contrast, the

FIG. 4. Kinetics of AZT80 growth in XTC-2 cells (A) and VERO E6 cells (B) determined by the SYBR green PCR assay. Data are the averages(� standard error) of two independent measurements for each of two 33-mm dishes infected under the same conditions and are expressed asnumbers of copies of rickettsial DNA normalized to total DNA concentration in each sample (solid lines and black symbols). Broken lines andopen symbols correspond to medians of the same experimental variables.

VOL. 72, 2006 RICKETTSIA MASSILIAE IN ARIZONA 5573

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

amount of AZT80 DNA increased nearly 10-fold (P � 0.0075)in VERO cells infected under the same conditions (Fig. 4B).

VERO cells infected with AZT80 and treated with 0.03 to0.125 �g/ml of doxycycline for 5 days had a significantly lowerquantity of rickettsial DNA compared to untreated cells in-fected with isolate AZT80 (P � 0.007 to 0.01) (Fig. 5). Infectedcells grown in the presence of 1 �g/ml erythromycin had rick-ettsial DNA similar to that in untreated infected culture (P �0.55); treatment with 2, 4, and 8 �g/ml of erythromycin causeda reduction in rickettsial DNA (P � 0.016, P � 0.005, and P �0.007, respectively) compared to that detected in untreatedculture infected with AZT80. While cultures supplementedwith 0.5 to 1 �g/ml of rifampin had a similar quantity ofrickettsial DNA copy numbers as untreated infected controls(P � 0.47 and P � 0.75, respectively), cells infected withAZT80 and treated with 2 �g/ml of rifampin contained signif-icantly reduced rickettsial DNA compared to the untreatedcontrol (P � 0.01) but still a greater amount than AZT80-infected cells treated with the highest dose of doxycycline (P �0.006) and erythromycin (P � 0.04). As a control for theantibiotics, VERO cells were infected with R. rickettsii at thesame MOI as AZT80 and treated with 0.125 �g/ml doxycy-cline, 4 �g/ml erythromycin, and 1 �g/ml rifampin for 5 days(Fig. 5, inset). In these cultures, a significant decrease in rick-ettsial DNA was detected in infected cells treated with bothdoxycycline and rifampin compared to untreated infected con-trols (P � 0.023 and P � 0.024, respectively). However, therewas no significant reduction in rickettsial DNA in cultures

treated with erythromycin (P � 0.6) compared to untreatedVERO cells infected with R. rickettsii.

Sequence characterization of the new rickettsial isolateAZT80. Partial sequences of the 16S rRNA gene, gltA, andrompA genes were determined for the AZT80 isolate. The905-bp fragment of the 16S rRNA gene had 100% sequenceidentity with the homologous gene fragment of R. massiliaestrain Bar29 isolated from R. sanguineus ticks in Catalonia,Spain (7). The 334-bp fragment of gltA differed by 1 nucleotidefrom gltA of Bar29 with 99% nucleotide sequence and 100%amino acid sequence homology. The 578-bp fragment of therompA gene had 99% sequence homology with R. massiliaerompA sequences (Fig. 6A). Up to four nucleotide pairwise dif-ferences were detected in this fragment of rompA among thethree spotted fever group rickettsiae referred to as R. massiliae,including isolates Bar29, Mtu1, and GS, and the new isolateAZT80. Only one of these differences, T359, resulted in a changeof amino acid sequence (Fig. 6B).

The 4,864-bp fragment of AZT80 rompB differed by only 1nucleotide from the homologous gene of Bar29 and thatcaused a single amino acid substitution. Two nucleotide differ-ences were identified when the 2,259-bp fragment of AZT80sca4 was compared to sca4 of Bar29.

DISCUSSION

We describe the first detection and isolation of R. massiliaefrom R. sanguineus ticks in the United States. For many years,

FIG. 5. Effects of varied antibiotics on growth of AZT80 isolate. The data are shown as the average � standard error of two independentmeasurements for each of two 33-mm dishes infected under the same conditions and are expressed as numbers of copies of rickettsial DNAnormalized to total DNA concentration in each sample. The inset illustrates the effects of the antibiotics on R. rickettsii.

5574 EREMEEVA ET AL. APPL. ENVIRON. MICROBIOL.

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

only R. rhipicephali was known to be associated with brown dogticks in the continental United States (14, 31). R. sanguineuswas implicated as a vector for R. rickettsii infection in Mexico(15, 16), but precise identification of these rickettsiae has notbeen confirmed using contemporary molecular tools. In con-trast, recent studies focused on an RMSF outbreak investiga-tion in eastern Arizona clearly demonstrated the presence ofR. rickettsii in brown dog ticks (21). It was also suggested thatthis organism has been present in the area for an extendedtime, based on retrospective serological analysis of dog serumsamples collected since 1995 (38). However, we report here thedetection and isolation of another spotted fever group rickett-sia in this site that could also elicit spotted fever group anti-body responses in dogs. R. massiliae has not previously beenfound in the United States or elsewhere in the Western Hemi-sphere, thus extending the geographic distribution of this rick-ettsial species to the New World.

Before this study was initiated, the known presence of R.massiliae was restricted to several countries of southern Eu-rope and from Africa (2, 4–7, 11, 63). In these regions, strainsMtu1 and Mtu5 were isolated from Rhipicephalus bursa and R.sanguineus from southern France, respectively, (5), strain GSfrom R. sanguineus collected in central Greece (2), and strainBar29 from R. sanguineus collected in Catalonia, Spain (7). R.

massiliae was also detected by PCR/RFLP in R. sanguineusfound in Portugal (4). The presence of R. massiliae has beendetected in several other ticks of the so-called Rhipicephalusspp. complex including the Mtu5 genotype in Rhipicephalussenegalis and Mtu1 genotype in Rhipicephalus sulcatus, Rhipi-cephalus lunulatus, and Rhipicephalus mushamae in Africa(63); and the Bar29 genotype in R. sanguineus and Rhipiceph-alus turanicus in Switzerland (11). While R. massiliae AZT80possesses unique genetic characteristics that allow its simpleidentification and differentiation from other spotted feveragents found in the United States (6, 26, 30, 53–56, 62), theantigenic properties of AZT80 are currently being evaluated.R. massiliae strain Mtu1 has a unique subset of antigenicepitopes that are not expressed by Bar29 or GS strains (69),thus allowing its differentiation.

In Europe and Africa Rhipicephalus ticks are known to vec-tor other spotted fever group rickettsiae including Rickettsiaconorii, the etiologic agent of boutonneuse fever or Mediter-ranean spotted fever (MSF) (18, 27, 43, 44). In addition, R.rhipicephali, a close phylogenetic relative of R. massiliae (30,53–56, 62) has also been detected in R. sanguineus ticks inSpain (33), Portugal (4), France (22), and the African conti-nent (63). In these countries, particularly in Greece and Spain,it has been noted that a discrepancy exists between the sero-

FIG. 6. Sequence variability of the rOmpA gene fragment among isolates of R. massiliae. Differences in nucleotide sequence (A) and derivedamino acid sequence (B) are shown. The following reference sequences were from the NCBI GenBank: isolate Mtu1 (U43799), isolate Bar29(U43792), and isolate GS (U43793).

VOL. 72, 2006 RICKETTSIA MASSILIAE IN ARIZONA 5575

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

prevalence of antibodies to spotted fever group rickettsiae inlocal human populations, the incidence of reported rickettsio-ses (3, 17, 28, 32, 60), and the occurrence of severe and fatalforms of MSF (28, 29, 34, 57, 62). Similarly, there is a notice-able discrepancy in the prevalence of antibodies reactivewith virulent R. conorii in dog populations and the occur-rence of disease in different locations in Spain (32, 34, 60,61). These observations support the idea that both virulentand avirulent rickettsiae may be responsible for seroreactiv-ity to spotted fever group agents in human and canine pop-ulations (9, 10, 17).

The AZT80 isolate does not elicit pronounced cytotoxiceffects in VERO cells like R. rickettsii and R. rhipicephali (25,46). European isolates of R. massiliae, including Mtu1 andBar29, persist in HELA and VERO cells without visiblechanges in the morphology of the host cells (5–7) and exhibita limited ability to produce lytic plaques in L929 and VEROcells (52), features often attributed to nonpathogenic rickett-siae. In addition, R. massiliae appears to establish persistentinfection in its tick vector, R. turanicus (37), while both R.rickettsii and R. conorii infections are very detrimental for theirrespective vectors, D. variabilis (40) and R. sanguineus (59).

Until recently, an association of R. massiliae with illness inhumans in Europe had not been demonstrated by isolation orPCR detection of the agent in clinical specimens (44). How-ever, Catalan patients often present with mild forms of MSFcompared to cases reported from other regions of Spain (10,60). Furthermore, children diagnosed with MSF in Cataloniashowed unusual unresponsiveness to treatments to rifampin,which has been used as an alternative antibiotic when tetracy-cline is contraindicated (9). R. conorii and R. rickettsii do notexhibit resistance to rifampin (52). However, in vitro evalua-tion of antibiotic susceptibility of the R. massiliae and Catalanisolate Bar29 demonstrated resistance to rifampin (7, 52),again suggesting that this rickettsia may be responsible for mildrickettsioses in the Catalan region. The single confirmed caseinvolving infection with an R. massiliae isolate occurred inSicily and was initially described as MSF with rash and escharbut low antibody titer to R. conorii (65). Whether R. massiliaecontributes to clinical manifestations of spotted fever rickett-siosis or human and canine seroreactivity to spotted fevergroup rickettsiae in Arizona needs further evaluation. TheAZT80 strain of R. massiliae is susceptible to doxycycline butresistant to rifampin and erythromycin.

Our findings demonstrate that the noncytotoxic AZT80strain of R. massiliae is present in R. sanguineus ticks in thesame geographic area where pathogenic R. rickettsii has beenidentified as a cause of fatal RMSF (21). There is no informa-tion available now on the prevalence of R. massiliae in Arizonaor other areas of the United States where R. sanguineus tickscan be found. Since R. massiliae shares the tick vector R.sanguineus with R. rickettsii in eastern Arizona and since thistick can bite humans, its presence has to be taken into consid-eration when epidemiological surveillance for RMSF based onserology is conducted.

ACKNOWLEDGMENT

The findings and conclusions in this report are those of the authorsand do not necessarily represent the views of the Department ofHealth and Human Services.

REFERENCES

1. Anderson, B. E., and T. Tzianabos. 1989. Comparative sequence analysis ofa genus-common rickettsial antigen gene. J. Bacteriol. 171:5199–5201.

2. Babalis, T., Y. Tselentis, V. Roux, A. Psaroulaki, and D. Raoult. 1994.Isolation and identification of a rickettsial strain related to Rickettsia mas-siliae in Greek ticks. Am. J. Trop. Med. Hyg. 50:365–372.

3. Babalis, T., H. T. Dupont, Y. Tselentis, C. Chatzichristodoulou, and D.Raoult. 1993. Rickettsia conorii in Greece: comparison of a microimmuno-fluorescence assay and Western blotting for seroepidemiology. Am. J. Trop.Med. Hyg. 48:784–792.

4. Bacellar, F., R. L. Regnery, M. S. Nuncio, and A. R. Filipe. 1995. Genotypicevaluation of rickettsial isolates recovered from various species of ticks inPortugal. Epidemiol. Infect. 114:169–178.

5. Beati, L., J.-P. Finidori, B. Gilot, and D. Raoult. 1992. Comparison ofserologic typing, sodium dodecyl sulfate-polyacrylamide gel electrophoresisprotein analysis, and genetic restriction fragment length polymorphism anal-ysis for identification of rickettsiae: characterization of two new rickettsialstrains. J. Clin. Microbiol. 30:1922–1930.

6. Beati, L., and D. Raoult. 1993. Rickettsia massiliae sp. nov., a new spottedfever group rickettsia. Int. J. Syst. Bacteriol. 43:839–840.

7. Beati, L., V. Roux, A. Ortuno, J. Castella, F. Segura Porta, and D. Raoult.1996. Phenotypic and genotypic characterization of spotted fever grouprickettsiae isolated from Catalan Rhipicephalus sanguineus ticks. J. Clin.Microbiol. 34:2688–2694.

8. Bell, E. J., G. M. Kohls, H. G. Stoenner, and D. B. Lackman. 1963. Non-pathogenic rickettsiae related to the spotted fever group isolated from ticks,Dermacentor variabilis and Dermacentor andersoni from eastern Montana.J. Immunol. 90:770–781.

9. Bella, F., E. Espejo, S. Uriz, J. A. Serrano, M. D. Alegre, and J. Tort. 1991.Randomized trial of 5-day rifampin versus 1-day doxycycline therapy forMediterranean spotted fever. J. Infect. Dis. 164:433–434.

10. Bernabeu-Wittel, M., M. D. del Toro, M. M. Nogueras, M. A. Muniain, N.Cardenosa, F. Segura, and J. Pachon. 2006. Presence of human past infec-tions due to the Bar29 rickettsial strain in Southern Spain. J. Infect. 52:e117–119.

11. Bernasconi, M. V., S. Casati, O. Peter, and J.-C. Piffaretti. 2002. Rhipiceph-alus ticks infected with Rickettsia and Coxiella in southern Switzerland (Can-ton Ticino). Infect. Gen. Evol. 2:111–120.

12. Billings, A. N., G. J. Teltow, S. C. Weaver, and D. H. Walker. 1998. Molec-ular characterization of a novel Rickettsia species from Ixodes scapularis inTexas. Emerg. Infect. Dis. 4:305–309.

13. Bouyer, D. H., J. Stenos, P. Crocquet-Valdes, C. G. Moron, V. L. Popov, J. E.Zavala-Velazquez, L. D. Foil, D. R. Stothard, A. F. Azad, and D. H. Walker.2001. Rickettsia felis: molecular characterization of a new member of thespotted fever group. Int. J. Syst. Evol. Microbiol. 51:339–347.

14. Burgdorfer, W., D. J. Sexton, R. K. Gerloff, R. L. Anacker, R. N. Philip, andL. A. Thomas. 1975. Rhipicephalus sanguineus: vector of a new spotted fevergroup rickettsia in the United States. Infect. Immun. 12:205–210.

15. Bustamante, M. E., and G. Varela. 1947. IV. Estudios de fiebre manchada enMexico: papel del Rhipicephalus sanguineus en la transmission de la fiebremanchada en la Republica Mexicana. Rev. Inst. Salubr. Enferm. Trop.8:139–141. [In Spanish.]

16. Bustamante, M. E., G. Varela, and C. O. Mariotte. 1946. Estudios de fiebremanchada en Mexico: fiebre manchada en la Laguna. Rev. Inst. Salubr.Enferm. Trop. 7:39–49. [In Spanish.]

17. Cardenosa, N., F. Segura, and D. Raoult. 2003. Serosurvey among Mediter-ranean spotted fever patients of a new spotted fever group rickettsial strain(Bar29). Eur. J. Epidemiol. 18:351–356.

18. Cardenosa, N., V. Roux, B. Font, I. Sanfeliu, D. Raoult, and F. Segura. 2000.Short report: isolation and identification of two spotted fever group rickett-sial strains from patients in Catalonia, Spain. Am. J. Trop. Med. 62:142–144.

19. Dasch, G. A., D. J. Kelly, A. L. Richards, J. L. Sanchez, and C. C. Rives.1993. Western blotting analysis of sera from military personnel exhibitingserological reactivity to spotted fever group rickettsiae, abstr. 242. In Pro-gram and abstracts of the joint annual meeting of the American Society ofTropical Medicine and Hygiene and the American Society of Parasitologists,Atlanta, Ga., 1993. Am. J. Trop. Med. Hyg. 49(Suppl. 3):220.

20. Dasch, G. A., A. Highbaugh, and W. L. Nicholson. 2001. Direct binding andcompetition enzyme-linked immunosorbent assays for identifying the etio-logic agents of spotted fever group, abstr. 8, p. 22. In Program and abstractsof the American Society for Rickettsiology-Bartonella as an EmergingPathogen Group, 2001 Joint Conf., Big Sky, Montana, 17 to 22 August.American Society for Rickettsiology, Tampa, Florida.

21. Demma, L. J., M. S. Traeger, W. L. Nicholson, C. D. Paddock, D. M. Blau,M. E. Eremeeva, G. A. Dasch, M. L. Levin, J. Singleton, Jr., S. R. Zaki, J. E.Cheek, D. L. Swerdlow, and J. H. McQuiston. 2005. Rocky Mountain spottedfever from an unexpected tick vector in Arizona. N. Engl. J. Med. 353:587–594.

22. Drancourt, M., R. L. Regnery, and D. Raoult. 1991. Identification of tickisolates by centrifugation shell-vial assay followed by polymerase chain re-action and restriction endonuclease length polymorphism analysis, p. 232–

5576 EREMEEVA ET AL. APPL. ENVIRON. MICROBIOL.

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

238. In J. Kazar, and D. Raoult (ed.), Rickettsiae and rickettsial diseases.Proceedings of the Fourth International Symposium, 1990. Slovak Academyof Sciences, Bratislava, Slovakia.

23. Eremeeva, M. E., and G. A. Dasch. 2000. Rickettsiae, pp.140–179. In J.Lederberg (ed.), Encyclopedia of microbiology, vol. 4. Academic Press, NewYork, N.Y.

24. Eremeeva, M. E., G. A. Dasch, and D. J. Silverman. 2003. Evaluation of aPCR assay for quantitation of Rickettsia rickettsii and closely related spottedfever group rickettsiae. J. Clin. Microbiol. 41:5466–5472.

25. Eremeeva, M. E., and D. J. Silverman. 1998. Effects of the antioxidant�-lipoic acid on human umbilical vein endothelial cells infected with Rick-ettsia rickettsii. Infect. Immun. 66:2290–2299.

26. Eremeeva, M., X.-J. Yu, and D. Raoult. 1994. Differentiation among spottedfever group rickettsiae species by analysis of restriction fragment lengthpolymorphism of PCR-amplified DNA. J. Clin. Microbiol. 32:803–810.

27. Espejo-Arenas, E., and D. Raoult. 1989. First isolates of Rickettsia conorii inSpain using a centrifugation-shell vial assay. J. Infect. Dis. 159:1158–1159.

28. Espejo-Arenas, E., B. Font-Creus, M. D. Alegre-Segura, F. Segura-Porta,and F. Bella-Cueto. 1990. Seroepidemiological survey of Mediterraneanspotted fever in an endemic area (“Valles Occidental,” Barcelona, Spain).Trop. Geogr. Med. 42:212–216.

29. Font-Creus, B., F. Bella-Cueto, E. Espejo-Arenas, R. Vidal-Sanahuja, T.Munoz-Espin, M. Nolla-Salas, A. Casagran-Borrell, J. Mercade-Cuesta, andF. Segura-Porta. 1985. Mediterranean spotted fever: a cooperative study of227 cases. Rev. Infect. Dis. 7:635–642.

30. Fournier, P. E., J. S. Dumler, G. Greub, J. Zhang, W. Yimin, and D. Raoult.2003. Gene sequence-based criteria for the identification of new Rickettsiaisolates and description of Rickettsia heilongjiangensis sp. nov. J. Clin. Mi-crobiol. 41:5456–5465.

31. Gage, K. L., M. E. Schrumpf, R. H. Kartstens, W. Burgdorfer, and T. G.Schwan. 1994. DNA typing of rickettsiae in naturally infected ticks using apolymerase chain reaction/restriction fragment length polymorphism system.Am. J. Trop. Med. Hyg. 50:247–260.

32. Herrero, C., C. Pelaz, J. Alvar, R. Molina, J. Vazquez, P. Anda, J. Casal, andC. Martin-Bourgon. 1992. Evidence of the presence of spotted fever grouprickettsiae in dogs and dog ticks of the central provinces in Spain. Eur. J.Epidemiol. 8:575–579.

33. Herrero, C., C. Pelaz, and C. Martin-Bourgon. 1992. Isolation of an agent ofthe spotted fever group rickettsia from tick eggs in Madrid, Spain. Epide-miol. Infect. 108:555–557.

34. Herrero-Herrero, J. I., R. Ruiz-Beltran, and D. H. Walker. 1993. Antigens ofRickettsia conorii recognized by seropositive healthy people from Salamanca(central-west Spain). Eur. J. Epidemiol. 9:59–63.

35. Lauer, B. A., L. B. Reller, and S. Mirrett. 1981. Comparison of acridineorange and Gram stains for detection of microorganisms in cerebrospinalfluid and other clinical specimens. J. Clin. Microbiol. 14:201–205.

36. Loftis, A. D., J. S. Gill, M. E. Schriefer, M. L. Levin, M. E. Eremeeva, M. J.Gilchrist, and G. A. Dasch. 2005. Detection of Rickettsia, Borrelia, andBartonella in Carios kelleyi (Acari:Argasidae). J. Med. Entomol. 42:473–480.

37. Matsumoto, K., M. Ogawa, P. Brouqui, D. Raoult, and P. Parola. 2005.Transmission of Rickettsia massiliae in the tick, Rhipicephalus turanicus. Med.Vet. Entomol. 19:263–270.

38. Nicholson, W. L., R. Gordon, and L. Demma. 2006. Spotted fever grouprickettsial infection in dogs from eastern Arizona: how long has it beenthere? Ann. N. Y. Acad. Sci., in press.

39. Niebylski, M. L., M. E. Schrumpf, W. Burgdorfer, E. R. Fisher, K. L. Gage,and T. G. Schwan. 1997. Rickettsia peacockii sp. nov., a new species infectingwood ticks, Dermacentor andersoni, in western Montana. Int. J. Syst. Bacte-riol. 47:446–452.

40. Niebylski, M. L., M. G. Peacock, and T. G. Schwan. 1999. Lethal effect ofRickettsia rickettsii on its tick vector (Dermacentor andersoni). Appl. Environ.Microbiol. 65:773–778.

41. Paddock, C. D., J. W. Sumner, J. A. Comer, S. R. Zaki, C. S. Goldsmith, J.Goddard, S. L. McLellan, C. L. Tamminga, and C. A. Ohl. 2004. Rickettsiaparkeri: a newly recognized cause of spotted fever rickettsiosis in the UnitedStates. Clin. Infect. Dis. 38:805–811.

42. Paddock, C. D., S. R. Zaki, T. Koss, J. Singleton, J. Sumner, M. Eremeeva,G. Dasch, B. Cherry, and J. Childs. 2003. Rickettsialpox in New York City:a persistent urban zoonosis. Ann. N. Y. Acad. Sci. 990:36–44.

43. Parola, P., B. Davoust, and D. Raoult. 2005. Tick- and flea-borne rickettsialemerging zoonoses. Vet. Res. 36:469–492.

44. Parola, P., C. D. Paddock, and D. Raoult. 2005. Tick-borne rickettsiosesaround the world: emerging diseases challenging old concepts. Clin. Micro-biol. Rev. 18:719–756.

45. Philip, R. N., E. A. Casper, R. L. Anacker, J. Cory, S. F. Hayes, W. Burgdorfer,and C. E. Yunker. 1983. Rickettsia bellii sp. nov.: a tick-borne rickettsia, widelydistributed in the United States, that is distinct from the spotted fever andtyphus biogroups. Int. J. Syst. Bacteriol. 33:94–106.

46. Philip, R. N., and E. A. Casper. 1981. Serotypes of spotted fever grouprickettsiae isolated from Dermacentor andersoni (Stiles) ticks in WesternMontana. Am. J. Trop. Med. Hyg. 30:230–238.

47. Philip, R. N., R. S. Lane, and E. A. Casper. 1981. Serotypes of tick-bornespotted fever group rickettsiae from Western California. Am. J. Trop. Med.Hyg. 30:722–727.

48. Policastro, P. F., M. G. Peacock, and T. Hackstadt. 1996. Improved plaqueassays for Rickettsia prowazekii in Vero 76 cells. J. Clin. Microbiol. 34:1944–1948.

49. Pudney, M., M. G. Varma, and C. J. Leake. 1973. Establishment of a cell line(XTC-2) from the South African clawed toad, Xenopus laevis. Experientia29:466–467.

50. Regnery, R. L., C. L. Spruill, and B. D. Plikaytis. 1991. Genotypic identifi-cation of rickettsiae and estimation of intraspecies sequence divergence forportions of two rickettsial genes. J. Bacteriol. 173:1576–1589.

51. Robinson, J. B., O. Y. Mediannikov, N. K. Tokarevich, M. E. Eremeeva, M.Levin, and G. A. Dasch. 2003. Biological and molecular characterizationof the rickettsiae present in Ixodes spp. ticks. Presented at the AmericanAcarological Society Annual Meeting, Cincinnati, OH, 26 to 29 October2003.

52. Rolain, J. M., M. Maurin, G. Vestris, and D. Raoult. 1998. In vitro suscep-tibilities of 27 rickettsiae to 13 antimicrobials. Antimicrob. Agents Che-mother. 42:1537–1541.

53. Roux, V., and D. Raoult. 1995. Phylogenetic analysis of the genus Rickettsiaby 16S rDNA sequencing. Res. Microbiol. 146:385–396.

54. Roux, V., and D. Raoult. 2000. Phylogenetic analysis of members of thegenus Rickettsia using the gene encoding the outer-membrane proteinrOmpB (ompB). Int. J. Syst. Evol. Microbiol. 50:1449–1455.

55. Roux, V., P.-E. Fournier, and D. Raoult. 1996. Differentiation of spottedfever group rickettsiae by sequencing and analysis of restriction fragmentlength polymorphism of PCR-amplified DNA of the gene encoding theprotein rOmpA. J. Clin. Microbiol. 34:2058–2065.

56. Roux, V., E. Rydkina, M. Eremeeva, and D. Raoult. 1997. Citrate synthasegene comparison, a new tool for phylogenetic analysis, and its application forthe rickettsiae. Int. J. Syst. Bacteriol. 47:252–261.

57. Ruiz, R., J. I. Herrero, A. M. Martin, F. Sanz, A. Mateos, A. Hernandez, R.Querol, and J. Portugal. 1984. Vascular permeability in boutonneuse fever.J. Infect. Dis. 149:1036.

58. Sanchez, J. L., W. H. Candler, D. B. Fishbein, C. R. Greene, T. R. Cote, D. J.Kelly, D. P. Driggers, and B. J. Johnson. 1992. A cluster of tick-borneinfections: association with military training and asymptomatic infectionsdue to Rickettsia rickettsii. Trans. R. Soc. Trop. Med. Hyg. 86:321–325.

59. Santos, A. S., F. Bacellar, M. Santos-Silva, P. Formosinho, A. J. Gracio, andS. Franca. 2002. Ultrastructural study of the infection process of Rickettsiaconorii in the salivary glands of the vector tick Rhipicephalus sanguineus.Vector Borne Zoonotic Dis. 2:165–177.

60. Segura-Porta, F., G. Diestre-Ortin, A. Ortuno-Romero, I. Sanfeliu-Sala, B.Font-Creus, T. Munoz-Espin, E. M. de Antonio, and J. Casal-Fabrega. 1998.Prevalence of antibodies to spotted fever group rickettsiae in human beingsand dogs from an endemic area of Mediterranean spotted fever in Catalonia,Spain. Eur. J. Epidemiol. 14:395–398.

61. Segura-Porta, F., B. Font-Creus, E. Espejo-Arenas, and F. Bella-Cueto.1989. New trends in Mediterranean spotted fever. Eur. J. Epidemiol. 5:438–443.

62. Sekeyova, Z., V. Roux, and D. Raoult. 2001. Phylogeny of Rickettsia spp.inferred by comparing sequences of “gene D,” which encodes an intracyto-plasmic protein. Int. J. Syst. Evol. Microbiol. 51:1353–1360.

63. Tissot Dupont, H., J.-P. Cornet, and D. Raoult. 1994. Identification ofrickettsiae from ticks collected in the Central African Republic using thepolymerase chain reaction. Am. J. Trop. Med. Hyg. 50:373–380.

64. Tzianabos, T., B. E. Anderson, and J. E. McDade. 1989. Detection of Rick-ettsia rickettsii DNA in clincal specimens by using polymerase chain reactiontechnology. J. Clin. Microbiol. 27:2866–2868.

65. Vitale, G., S. Mansueto, J. M. Rolain, and D. Raoult. 2005. Rickettsia mas-siliae human isolation. Emerg. Infect. Dis. 12:174–175.

66. Weisburg, W. G., M. E. Dobson, J. E. Samuel, G. A. Dasch, L. P. Mallavia,O. Baca, L. Mandelco, J. E. Sechrest, E. Weiss, and C. R. Woese. 1989.Phylogenetic diversity of the rickettsiae. J. Bacteriol. 171:4202–4206.

67. Weiss, E. 1965. Adenosine triphosphate and other requirements for theutilization of glucose by agents of the psittacosis-trachoma group. J. Bacte-riol. 90:243–253.

68. Wike, D. A., and W. Burgdorfer. 1972. Plaque formation in tissue cultures byRickettsia rickettsii isolated directly from whole blood and tick hemolymph.Infect. Immun. 6:736–738.

69. Xu, W., and D. Raoult. 1997. Production of monoclonal antibodies againstRickettsia massiliae and their use in antigenic and epidemiological studies.J. Clin. Microbiol. 35:1715–1721.

VOL. 72, 2006 RICKETTSIA MASSILIAE IN ARIZONA 5577

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from