Insulin and Glucose Alter Death-Associated Protein Kinase 3

Insulin and glucose alter death-associated protein kinase 3 (DAPK3) DNA methylation

in human skeletal muscle

Jonathan M. Mudry1, David G. Lassiter

1, Carolina Nylén

1, Sonia García-Calzón

2, Erik

Näslund3, Anna Krook

2, Juleen R. Zierath

1,2,4.

Running title: DAPK3 DNA methylation in human skeletal muscle

1Department of Molecular Medicine and Surgery, Integrative Physiology, Karolinska

Institutet, Stockholm, Sweden. 2Department of Physiology and Pharmacology, Integrative

Physiology, Karolinska Institutet, Stockholm, Sweden. 3Division of Surgery, Department of

Clinical Sciences, Danderyd Hospital, Karolinska Institutet, Stockholm, Sweden. 4Section of

Integrative Physiology, The Novo Nordisk Foundation Center for Basic Metabolic Research,

Faculty of Health and Medical Science, University of Copenhagen, Copenhagen, Denmark.

Juleen R. Zierath

Department of Molecular Medicine and Surgery, Section of Integrative Physiology, Karolinska

Institutet, von Eulers väg 4a, SE 171 77 Stockholm, Sweden

Phone: +46 (0)8 524 87581

Fax: +46 (0) 8 33 54 36

E-mail: [email protected]

Page 1 of 89 Diabetes

Diabetes Publish Ahead of Print, published online December 23, 2016

2

Abstract

DNA methylation is altered by environmental factors. We hypothesized DNA methylation is

altered in skeletal muscle in response to either insulin or glucose exposure. We performed a

genome-wide DNA methylation analysis in muscle from healthy men before and after insulin

exposure. DNA methylation of selected genes was determined in muscle from healthy and

type 2 diabetic men before and after a glucose tolerance test. Insulin altered DNA methylation

in the 3’UTR of the calcium pump ATP2A3 gene. Insulin increased DNA methylation in the

gene body of DAPK3, a gene involved in cell proliferation, apoptosis and autophagy. DAPK3

methylation was reduced in type 2 diabetic patients. Carbohydrate ingestion reduced DAPK3

DNA methylation in healthy and type 2 diabetic men, suggesting glucose may play a role.

Supporting this, DAPK3 DNA methylation was inversely correlated with the 2 hr glucose

concentration. While glucose incorporation to glycogen was unaltered by siRNA against

DAPK3, palmitate oxidation was increased. In conclusion, insulin and glucose exposure

acutely alter the DNA methylation profile of skeletal muscle, indicating DNA methylation

constitutes a rapidly and adaptive epigenetic mark. Furthermore, insulin and glucose modulate

DAPK3 DNA methylation in a reciprocal manner suggesting a feedback loop in the control of

the epigenome.

Page 2 of 89Diabetes

3

Type 2 diabetes is a life threatening metabolic disease reaching epidemic-like proportions.

The pathophysiology of Type 2 diabetes is incompletely understood, but both genetic and

environmental factors contribute to disease development (1). People with Type 2 diabetes are

characterized by skeletal muscle insulin resistance arising from impaired insulin signaling and

reduced glucose transport activity (2, 3). Many of these same steps are impaired in skeletal

muscle from glucose intolerant (IGT) relatives of type 2 diabetic patients (4, 5). Thus, skeletal

muscle insulin resistance is a characteristic feature of Type 2 diabetes that can be noted at all

stages of disease development.

Skeletal muscle insulin resistance may arise in part from a dysfunctional metabolic

program, either of an epigenetic or genetic origin (6). This notion is partly based on the

observation that impairments in glucose and lipid metabolism persist in skeletal muscle

cultures derived from people with Type 2 diabetes (7-10), as well as insulin-resistant non-

diabetic relatives of type 2 diabetic patients (11, 12). Strikingly, these metabolic derangements

observed in cultured cells mirror the clinical presentation of Type 2 diabetes in the donors,

indicating insulin resistance is an underlying intrinsic defect. However, skeletal muscle insulin

resistance can also be acquired by exposure to high levels of insulin, glucose, free fatty acids

or cytokines (7, 13-16), systemic factors associated with Type 2 diabetes. While acquired

insulin resistance has largely been attributed to defective signal transduction and enzymatic

modifications, epigenetic modifications may also play a role (1).

Epigenetic modifications including DNA methylation, provide a potential molecular

basis for the interaction between genetic and environmental factors on glucose homeostasis.

Recent evidence suggests that systematic factors associated with obesity or insulin resistance

can modify DNA methylation in somatic tissues (9, 13, 17-19), indicating that the regulation

of the epigenome is a more dynamic process than previously appreciated. Using whole-

genome promoter methylation analysis of DNA from skeletal muscle from healthy and Type 2


4

diabetic participants, we screened for differentially methylated genes and identified

hypermethylation of promoters of genes involved in glucose metabolism and mitochondrial

function (13). We also found elevated levels of cytokines and free fatty acids altered DNA

methylation of genes important for lipid metabolism in primary human muscle cultures (13),

suggesting systemic factors associated with insulin resistance may play a role. Changes in

DNA methylation in skeletal muscle are also triggered by exercise (20-22), dietary factors

(19, 23, 24) and gastric bypass-induced weight loss (17). Whether DNA methylation of genes

involved in metabolic regulation is altered in response to dynamic shifts in metabolic demand

experienced during an acute insulin-stimulation or a glucose challenge is unknown.

We have shown that changes in skeletal muscle DNA methylation in Type 2 diabetes

are inversely correlated with mRNA expression of multiple genes involved in the regulation

of insulin sensitivity (13, 17), indicating that an epigenetic fingerprint emerges in response to

metabolic dysregulation. Insulin treatment acutely alters the gene expression profile of

skeletal muscle biopsies of healthy individuals and Type 2 diabetic patients (25). Thus, we

hypothesized that insulin directly mediates changes in DNA methylation of skeletal muscle.

We found insulin treatment reduced DNA methylation in the calcium pump ATP2A3 gene and

increased DNA methylation in the gene body of death-associated protein kinase 3 (DAPK3), a

gene involved in cell proliferation, apoptosis and autophagy. Short-term fasting/refeeding is

also associated with changes in skeletal muscle gene expression profiles concomitant with

shifts in substrate utilization between carbohydrates and fats as main fuel sources (26). Thus,

we determined whether a glucose challenge alters DNA methylation of ATP2A3 and DAPK3

in skeletal muscle. Establishing the epigenomic response to these physiological challenges in

metabolically healthy people with normal glucose tolerance will build profiles to better

predict the development of skeletal muscle insulin resistance.


5

Methods

Clinical cohorts Two separate cohorts were studied. Ten healthy sedentary men with normal

glucose tolerance were recruited for the open muscle biopsy study. Clinical characteristics of

these participants are presented in Table 1A. Twenty-four men with either normal glucose

tolerance (n = 12) or Type 2 diabetes (n = 12) were recruited for the glucose tolerance study.

Clinical characteristics of these participants are presented in Table 1B. Study protocols were

approved by the local ethics committee in Stockholm and performed according to the

Declaration of Helsinki. Informed written consent was obtained from all participants. All

subjects included were instructed to not participate in any physical exercise two days prior to

the visit to the clinic. Subjects reported to the clinic at 8:00 after an overnight fast, where they

have been asked not to eat or drink anything but water since 20:00 the night before.

Open Muscle Biopsy and in vitro incubation Open muscle biopsies were performed as

previously described (27). A skeletal muscle biopsy (~2 g) was excised and placed in

oxygenated Krebs-Henseleit buffer (KHB) containing 5 mM HEPES and 0.1% bovine serum

albumin (BSA; RIA Grade; Sigma-Aldrich, St. Louis, MO). Smaller muscle strips were

dissected from the biopsy specimen and mounted on Plexiglas clamps, placed in oxygenated

KHB containing 5 mM HEPES 0.1% BSA, 15 mM mannitol and 5 mM glucose and

transported to the laboratory. Thereafter, muscle strips were incubated in the absence (basal)

or presence of insulin (120 nM) for 60 min in individual glass vials containing oxygenated

KHB plus the addition of 5 mM HEPES 0.1% BSA, 15 mM mannitol and 5 mM glucose.

Muscle strips were frozen in liquid nitrogen for subsequent methylation analysis.

Oral glucose tolerance test and skeletal muscle biopsy Fasting blood samples were taken

for clinical chemistry (Table 1B) and a skeletal muscle biopsy (40-100 mg) was obtained from


6

the vastus lateralis with a Weil Blakesley conchotome tong instrument (Agnthos, Sweden)

under local anesthesia (mepivacain chloride 10 mg/ml (AstraZeneca). Biopsies were frozen

and stored in liquid nitrogen. Thereafter, the subjects ingested a standardized solution

containing 75 g of glucose. Two hours after the glucose ingestion, a blood sample and skeletal

muscle biopsy was collected as described above.

Cell isolation and culture Skeletal muscle biopsies were obtained from healthy male

volunteers as previously described (28). Cell sub-culture was performed as described (28),

with the following adaptations: primary myoblasts were grown in DMEM/F-12 with 20%

fetal bovine serum (FBS), 1% Penicillin-Streptomycin (10,000 U/mL), 1% Fungizone on

uncoated culture flasks. At 80% confluence, medium was changed to a fusion medium (76%

of DMEM with 25 mM glucose, 20% of M199 (5.5 mM), 2% HEPES, 1% Penicillin-

Streptomycin (10,000 U/mL), 1% Fungizone (all from Thermo Fisher Scientific, Waltman,

MA except the FBS from Sigma-Aldrich); 0.03 µg/ml of zinc sulfate, 1.4 mg/ml of vitamin

B12 (both from Sigma-Aldrich), 100 µg/ml of apo-transferrin (from BBI solutions, Cardiff,

UK) and 0.286 IU/ml of insulin (Novo Nordisk, Bagsværd, Denmark) for 4-5 days. Following

fusion, medium was switched to the same medium but without apo-transferrin and insulin for

an additional 4-5 days (post-fusion media) with 2% FBS, except for the insulin-treatment

study, where no FBS was used. In the Low/High glucose experiment, DMEM with 5.5 mM

glucose was used in the post-fusion medium. Medium was changed every 2-3 days and prior

to each experiment. Myotubes were incubated for 1 hr in the absence or presence of insulin

(120 nM) and either harvested immediately, or washed with fresh post-fusion media, and

harvested after an additional 4 hr incubation in the absence of insulin.


7

ATP2A3 or DAPK3 gene silencing in primary human skeletal muscle cells Myotubes were

transfected (Lipofectamine RNAiMAX Transfection Reagent, Thermo Fisher Scientific) with

10 nM of a non-targeting negative control siRNA (silencer select Negative control No.2

#4390847, Thermo Fisher Scientific) or siRNA directed against ATP2A3 or DAPK3 (validated

silencer select siRNA s1749 or s557, respectively; Thermo Fisher Scientific). Cells were

transfected twice, separated by a period of 48 hr, and the final transfection was initiated 48 hr

prior to further experiments.

Lipid oxidation and glucose incorporation into glycogen was determined as described

(28). For lipid oxidation, myotubes were exposed to serum-free post-differentiation media

containing 0.025 mM palmitate and incubated in the absence or presence of 2 mM 5-

aminoimadazole-4-carboxamide ribonucleotide (AICAR; Toronto Research Chemicals,

Toronto, CA) for 6 hrs. For glycogen synthesis, cells were incubated for 4 hrs in serum-free

post-fusion media, prior to a 2 hr incubation in fresh serum-free post-fusion media in the

presence or absence of 120 nM insulin.

To assess signal transduction, cells were incubated in the absence or presence of 120

nM insulin or 2 mM AICAR for 1 hr. Cells were rinsed twice in ice-cold PBS and then frozen

at -20°C. mRNA analysis and description of Primer Oligos are detailed in Supplementary

Table 1. Western blot analysis and description of antibodies are detailed in Supplementary

Table 2.

DNA and mRNA extraction Genomic DNA and mRNA was extracted from skeletal muscle

and cultured myotubes using AllPrep DNA/RNA kit or DNAeasy and RNAeasy kits (Qiagen,

Hilden, Germany). DNA and RNA concentration was measured with Nanodrop 1000 (Thermo

Fisher Scientific). Genomic DNA was bisulfite treated using EpiTect Fast Bisulfite

Conversion Kit (Qiagen).


8

Methylation array Genome wide methylation was run on the Infinium

HumanMethylation450 BeadChip arrays (Illumina, San Diego, CA). Analysis was performed

at the Bioinformatics and Expression Analysis core facility at Karolinska Institutet. Beta-

values were converted into M-values in R, using Bioconductor packages lumi and methylumi

(29, 30). Paired data was analyzed as Beta-values and then converted to M-values. Kyoto

Encyclopedia of Genes and Genomes (KEGG) pathway analysis was performed using

WebGestalt as updated on 30.01.2013 (31, 32). DNA pyrosequencing analysis and primer

oligos are detailed in Supplementary Table 4.

mRNA analysis RNA was reverse transcribed using the High-capacity cDNA RT Kit

(Thermo Fisher Scientific). Real-time PCR was performed using SYBR green-based primers.

HPRT1 was used as reference gene for skeletal muscle biopsies. The geometric mean of

reference genes (B2M, GAPDH, HPRT and RPLP0) was used to compare results of

experiments performed using cultured cells, except for gene-silencing experiments, where the

geometric mean of PPIB and TBP were used. Primer oligos for the qPCR analysis is shown in

Supplementary Table 1.

Statistical analysis Parametric tests or non-parametric tests were employed as appropriate

followed by either Bonferroni’s post-hoc correction or Benjamini-Hochberg correction

(KEGG pathway analysis). Correlation analysis was determined using Spearman’s correlation

coefficient. Analysis was performed using GraphPad Prism version 6.0 (GraphPad Software,

Inc., La Jolla, CA) or R base v 3.3.1 and open-source packages. Comparisons were considered

to be statistically significant at p < 0.05.


9

Results

Insulin alters DNA methylation in isolated skeletal muscle Genome wide methylation was

determined in isolated skeletal muscle strips incubated in the absence (basal) or presence of

insulin using an Illumina 450k array. The methylation array data is deposited in the Gene

Expression Omnibus (GEO accession: GSE87655). Genes showing differentially methylated

CpGs were selected (p < 0.05). Genes showing CpGs with differences in β-value and an M

value above 0.03 between basal and insulin-stimulated muscle were considered further

(Supplementary Table 3). Insulin treatment altered methylation of over 1,600 genes on at least

one CpG site. The list was further interrogated using Webgestalt (31, 32). If several CpGs

relating to same gene were identified, the list was curated, such that any gene associated with

a significant change in CpG methylation between basal and insulin-stimulated skeletal muscle

occurred only once in the list. KEGG pathway analysis revealed that insulin stimulation

significantly altered DNA methylation of genes related to over 15 pathways, including genes

involved in insulin signaling, metabolic pathways and Type 2 diabetes (Fig. 1).

Pyrosequencing validation of the 450k methylation array To validate the results from the

450k array, we studied 4 specific regions/genes of interest: DAPK3 (cg18748062), ATP2A3

(cg08498987), HK1 (cg17575314), and HDAC5 (cg16217242) (Table 2). We purchased or

designed primers for pyrosequencing analysis (Supplementary Table 4). HK1 was selected as

part of the insulin signaling pathway as revealed by the KEGG analysis. The other three sites

were selected based on either the high M or β-value difference, as well as the role of each

gene in metabolism. Pyrosequencing of DNA extracted from isolated skeletal muscle strips

incubated in the absence or presence of insulin was performed. Consistent with results from

the 450k array, methylation of one CpG site (cg08498987) in the gene body of DAPK3 was


10

increased in response to insulin. As pyrosequencing allows for the sequencing of regions over

100 base pairs in length, we investigated the adjacent CpGs and found that methylation

differed between CpGs and that insulin impacted methylation in the whole region (Fig. 2A).

We next analyzed 5 different CpGs in the 3’UTR region of the ATP2A3 gene. CpG5

corresponded to the probe on the array (cg08498987). While methylation was unchanged in

CpG5 in response to insulin, methylation of CpG2 and CpG3 was altered (Fig. 2B).

Moreover, the methylation pattern was unaltered over 5 different CpGs in HK1 in response to

insulin (Fig. 2C). The level of methylation in the HDAC5 region probed was close to the

unmethylated negative control (below 1% of the CpGs methylated) and therefore considered

below background (data not shown). Given the change in methylation of DAPK3 and

ATP2A3, we next determined mRNA expression of each respective gene. Despite the changes

in DNA methylation, mRNA of DAPK3 or ATP2A3 was unaltered in response to insulin (Fig.

2D).

To determine whether an insulin-induced methylation change occurred specifically at the

studied CpG site, or whether it was a more general effect over a stretch of the chromosome,

we interrogated the methylation array by focusing on the genes directly adjacent to DAPK3

(Supplementary Table 5).

DNA Methylation and mRNA in cultured human skeletal muscle cells DNA methylation

of DAPK3, and ATP2A3 was determined in myotubes incubated for 1 hour in the absence or

presence of insulin (120 nM) (Fig. 3). Myotubes were studied immediately after insulin

exposure or allowed to recover in standard media for an additional 4 hours. Insulin treatment

did not significantly increase DAPK3 DNA methylation in myotubes acutely (p < 0.09; Fig.

3A). Although ATP2A3 methylation was consistently lower after insulin stimulation, no


11

significant change was noted between time-points (Fig. 3B). The level of methylation in basal

and insulin-stimulated myotubes was variable between donors (Fig. 3C), while the insulin-

stimulated change in percent DNA copies methylated was more stable (Fig. 3D). mRNA of

DAPK3 and ATP2A3 was unaltered between basal and insulin-stimulated conditions (data not

shown).

Glucose tolerance alters DNA methylation in skeletal muscle We next measured DNA

methylation of DAPK3 and ATP2A3 in skeletal muscle obtained from a separate cohort of

men with NGT or Type 2 diabetes before and 2 hr after a glucose challenge. ATP2A3

methylation was not altered between Type 2 diabetes patients and healthy men (data not

shown). Moreover, a glucose challenge did not alter ATP2A3 methylation (data not shown).

We assessed methylation of DAPK3 at two CpG sites (CpG1; Fig. 4A and CpG2; Fig. 4B).

Methylation of DAPK3 at CpG1, but not CpG2, was lower in type 2 diabetic men compared

with healthy control men. Moreover, a glucose challenge was associated with lower CpG1 and

CpG2 methylation in DAPK3 in both type 2 diabetic and healthy men. To determine whether

glucose altered DNA methylation in vitro, differentiated human myotubes were incubated in

the presence of 25 mM glucose for 2 hrs and CpG1 and CpG2 methylation in DAPK3 was

assessed. While methylation at the CpG1 site (Fig. 4C) was unaltered, a trend for reduced

methylation was observed at the CpG2 site (Fig. 4D).

Since plasma glucose was significantly different between the groups before and after the

glucose tolerance test, as well as between type 2 diabetic and healthy men (Table 1B), we

correlated percentage of DAPK3 methylation with glucose concentration. DAPK3 methylation

at CpG1 and CpG2 was inversely correlated with the 2 hrs glucose concentration. However,

the relationship between fasting glucose concentration and DAPK3 methylation did not reach


12

statistical significance (Fig. 5). BMI did not associate with DAPK3 methylation, while waist

to hip ratio correlated with DAPK3 CpG1 methylation in skeletal muscle obtained 2 hrs after a

glucose challenge (p = 0.004) (data not shown).

Effects of silencing ATP2A3 or DAPK3 on insulin signaling and metabolism in primary

human skeletal muscle cells. siRNA was used to knockdown the expression of ATP2A3 or

DAPK3 in human skeletal muscle. Subsequently glucose incorporation into glycogen,

palmitate oxidation, and signal transduction was assessed. ATP2A3 and DAPK3 mRNA was

reduced after gene silencing in differentiated primary human skeletal muscle cells (Fig. 6A-

B). Silencing of ATP2A3 (Fig. 6C) or DAPK3 (Fig. 6D) did not alter basal or insulin-

stimulated glucose incorporation into glycogen. Silencing ATP2A3 (Fig. 6E) did not alter

basal or AICAR-stimulated palmitate oxidation. Conversely, DAPK3 silencing increased basal

and AICAR-stimulated palmitate oxidation (Fig. 6F).

To further explore the effects of ATP2A3 or DAPK3 on myotube function, we determined

insulin- and autophagic-signaling after silencing these genes. Silencing ATP2A3 or DAPK3

did not impact phosphorylation of protein kinase B (PKB; also known as Akt) or TBC1

domain family member 4 (TBC1D4; also known as Akt substrate of 160 kDa, AS160) in basal

or insulin-stimulated myotubes (Fig. 7A-D). Since DAPK3 is involved in autophagy, we

measured p62 and LC3 protein abundance. DAPK3 silencing did not alter the protein

abundance of p62 and LC3 in cultured myotubes (Fig. 7E-H). GAPDH protein abundance was

not altered by gene silencing (data not shown).

Discussion

Epigenetic modifications of the genome, including DNA methylation, provide a molecular

basis for the interaction between genetic and environmental factors on glucose homeostasis


13

(1). While dynamic changes in DNA methylation have been mainly studied during the narrow

window of early development, evidence is emerging that diabetes, obesity and weight loss

have a dynamic effect on the epigenome (1). Changes in skeletal muscle DNA methylation in

Type 2 diabetes are inversely correlated with mRNA expression of multiple genes involved in

the regulation of insulin sensitivity (13, 17), indicating that an epigenetic fingerprint emerges

in response to metabolic dysregulation. Careful mapping of epigenetic signatures in healthy

people and type 2 diabetic patients at rest and in response to various metabolic challenges may

uncover novel biomarkers and targets that can be leveraged to predict and treat insulin

resistance. Here we show that insulin stimulation or oral glucose ingestion rapidly alters the

DNA methylation in human skeletal muscle, supporting the notion that systemic factors can

modify the epigenome in Type 2 diabetes.

Type 2 diabetes and obesity are associated with genome-wide changes in DNA

methylation in skeletal muscle (13, 17). Interestingly, therapeutic interventions to improve

insulin sensitivity including weight loss (17) and exercise training (20-22) remodel DNA

methylation patterns in skeletal muscle. Moreover, exposure of cultured muscle cells to

systemic factors that induce insulin resistance such as elevated lipids or cytokines or to agents

that mimic the effects of exercise on glucose and lipid metabolism alter DNA methylation of

metabolic genes (9, 33). Thus, alterations in the extracellular milieu, including hyperglycemia,

hyperinsulinemia, elevated free fatty acids, and cytokines, may reprogram skeletal muscle

insulin sensitivity through changes in DNA methylation and gene expression profiles. Here

we determined the direct effects of an acute insulin stimulation genome-wide DNA

methylation profiles in intact skeletal muscle from healthy donors incubated in vitro. We

studied the epigenomic response to insulin in metabolically healthy people with normal

glucose tolerance to gain insight into the development of insulin resistance. Our bioinformatic

analysis of genome-wide DNA methylation revealed rapid and broad changes in CpG


14

methylation patterns in skeletal muscle from healthy men in response to an acute insulin

exposure. Furthermore, insulin-induced changes in CpG sites were identified in genes related

to the insulin signaling pathway. Moreover, several pathways related to insulin action were

enriched including those annotated as “Metabolic pathways”, “Inositol Phosphate

Metabolism” and “Type 2 diabetes”. Thus, we reveal an insulin-induced epigenetic fingerprint

in skeletal muscle on multiple pathways involved in glucose and lipid metabolism.

Our motivation for taking a genome-wide approach to assess DNA methylation was

fueled in part by our desire to identify previously unrecognized insulin responsive targets.

Confirming the array results on a base pair level, we found that insulin stimulation increased

DNA methylation in the DAPK3 gene. DAPK3 (ZIPK/DLK) is a Ca2+/calmodulin-regulated

serine/threonine kinase that shares a high level of homology within its kinase domain with the

other two DAPK family members (DAPk), DAPK1 and DAPK2. DAPK3 plays a role in

autophagy (34) and apoptosis (35). To further validate the effects of insulin on DAPK3

methylation, we exposed primary human myotubes to insulin and assessed methylation at the

identified CpG sites. We observed a trend for insulin-induced DAPK3 methylation in primary

human skeletal muscle that persisted over 4 hrs. Although not statistically significant, this

effect mirrored the insulin-induced DNA methylation of DAPK3 in incubated human muscle

strips. Interestingly, DAPK3 is a tumor suppressor that is frequently methylated or mutated in

many cancer types (36) and is negatively regulated by Akt signaling (37). DAPK3 is important

for myosin light chain phosphorylation, leading to muscle contraction or cell mobility (34).

While the role of DAPk family members in metabolic disease is unknown, acute exercise

alters DAPK2 phosphorylation in skeletal muscle from healthy untrained men (38).

One of the most dramatic shifts in fuel utilization throughout the day occurs during the

transition between the use of lipids in the fasting state and the use of carbohydrates in the

insulin-stimulated fed state. In this regard, skeletal muscle is a highly malleable tissue and can


15

transition between these states with a high degree of metabolic flexibility (39). Moreover,

activation of energy/nutrient-sensing pathways in the fasted versus fed state subsequently

modifies gene expression (40). Thus, we determined whether an oral glucose challenge altered

DNA methylation of CpG sites in DAPK3. Contrasting the insulin-stimulated condition, we

found DAPK3 DNA methylation was reduced in skeletal muscle from healthy men after the

glucose tolerance test. The difference in DAPK3 DNA methylation between the insulin- and

glucose-stimulated conditions is difficult to reconcile, given that plasma insulin levels rise

during a glucose challenge. However, metabolomic studies have revealed that thousands of

metabolites from classes that include free fatty acids, acylcarnitines, bile acids,

lysophosphatidylcholines and amino acids, are altered during an oral glucose tolerance test

(41, 42). Thus, the systemic milieu between the in vitro muscle incubation and the oral

glucose tolerance test may account for the differences. During the glucose tolerance test, the

rise in blood glucose, as well as any one of a number of metabolites, may act as nutrient

signals to suppress processes controlling DAPK3 DNA methylation. However, we did not

observe similar reductions in DAPK3 DNA methylation in human muscle cells exposed to

high glucose in vitro. Thus, other metabolites, in addition to glucose, may influence DAPK3

DNA methylation. In mouse knockout models, DAPK3 has an independent effect from ERK

or Akt activation to negatively regulate mTOR-S6K-S6 signaling (43), implicating DAPK3 in

nutrient signaling pathways. We observed an inverse correlation between DNA methylation

and the 2 hrs blood glucose concentration, suggesting dynamic regulation of the DAPK3 gene

with refeeding. Furthermore, methylation of the DAPK3 gene at CpG1, but not CpG2 was

lower in Type 2 diabetic patients. Even though the Type 2 diabetic patients are fasted, they are

in a state of metabolic inflexibility, with peripheral tissues facing nutrient overload (39),

which may account for the differences in DNA methylation.


16

We used siRNA against DAPK3 or ATP2A3 and assessed glucose or lipid metabolism.

Silencing of either DAPK3 or ATP2A3 did not alter basal or insulin-stimulated glucose

incorporation into glycogen in cultured myotubes. However, DAPK3 silencing increased basal

and AICAR-stimulated palmitate oxidation. Since carbohydrate ingestion acutely reduces

lipid oxidation, our data suggests glucose/carbohydrate feeding may lead to a long-lasting

inhibition of lipid oxidation via reduced methylation of DAPK3, a gene which may normally

modulate lipid oxidation, as evidenced by our siRNA experiments. While we did not observe

any changes in DAPK3 mRNA at two hours following the glucose challenge, changes in

DAPK3 expression may occur at a later time point. DAPK3 has been implicated in the

regulation of autophagy (34), and therefore we determined abundance of the autophagy

markers p62 and LC3. Silencing of DAPK3 did not alter the abundance of these targets. We

cannot exclude the possibility that DAPK3 or ATP2A3 may be involved in other aspects of

metabolism and skeletal muscle physiology. For example, ATP2A3 encodes for a SERCA3

Ca2+-ATPase, an intracellular pump located in the sarcoplasmic and endoplasmic reticulum

that plays a role in excitation and contraction, and thus ATP2A3 silencing may affect skeletal

muscle contraction.

Pyrosequencing studies confirmed that insulin altered DNA methylation of ATP2A3 in

incubated human skeletal muscle from men with normal glucose tolerance. ATP2A3 is

implicated in glucose-activated beta cell regulation of calcium homeostasis in Type 2 diabetes

(44) and ER stress (45). Rare missense mutations in the ATP2A3 gene are associated with

Type 2 diabetes (46). In cultured human muscle, we observed insulin acutely decreased

ATP2A3 methylation, with levels normalized within 4 hr after the stimulation, indicating

systemic factors play a role. Chronic hyperglycemia in rats subjected to partial

pancreatectomy reduces ATP2A3/SERCA3 mRNA, implicating that glucose may have a direct

effect on gene expression (47). However, we found ATP2A3 DNA methylation was unaltered


17

by a glucose challenge, and similar levels were noted between Type 2 diabetic patients and

healthy subjects. Thus, insulin rather than glucose or Type 2 diabetes, appears to drive

ATP2A3 methylation changes.

DNA methylation can affect gene expression by altering histone interactions,

influencing transcription factor binding, and/or recruitment of methyl-binding proteins (48).

Thus, a simple filter for analyzing genome-wide methylation and transcriptomic data is to

search for inverse relationships between DNA methylation and mRNA expression of the

corresponding gene. In the present study, changes in DNA methylation did not correlate with

changes in mRNA level of DAPK3 or ATP2A3 in skeletal muscle at the time points

investigated. However, DNA methylation may not always correlate with mRNA expression

(17, 18, 49, 50). While epigenetic processes are one part of the complex system of regulation

of gene transcription, and a localized CpG methylation might be insufficient to control gene

expression, changes in mRNA could occur at later time points than investigated in the present

study.

In conclusion, insulin acutely alters the DNA methylation profile of human skeletal

muscle. These findings advance the notion that DNA methylation is a rapidly adaptive

epigenetic mark in somatic cells. Acute insulin exposure altered DNA methylation of DAPK3

and ATP2A3, genes involved in apoptosis and ER stress, respectively. ATP2A3 was unaffected

by glucose challenge or type 2 diabetes, indicating insulin has a direct role. In contrast,

DAPK3 DNA methylation was altered in Type 2 diabetes and after an oral glucose challenge,

with levels of DNA methylation inversely correlated with glucose levels. Moreover, insulin

and glucose modulate skeletal muscle DAPK3 DNA methylation in a reciprocal manner

suggesting a feedback control on gene expression. Continued efforts to establish the

epigenomic response to systemic factors associated with Type 2 diabetes in metabolically


18

healthy people with normal glucose tolerance will be useful to better predict genomic

landscape involved in the development of skeletal muscle insulin resistance.

Acknowledgements. The Strategic Diabetes Program at Karolinska Institutet, European

Research Council Ideas Program (ICEBERG, ERC-2008-AdG23285), Swedish Research

Council (2011-3550), Swedish Diabetes Foundation (DIA2012-082; DIA2012-047), Swedish

Foundation for Strategic Research (SRL10-0027), Diabetes Wellness Sweden, NovoNordisk

Foundation and Stockholm County Council supported this research. The Novo Nordisk

Foundation Center for Basic Metabolic Research is an independent Research Center at the

University of Copenhagen partially funded by an unrestricted donation from the Foundation

Duality of Interest. The authors have no relevant conflicts of interest to disclose.

Author Contributions. J.M. helped design the study, collected and analyzed data, drafted and

helped revise the manuscript. D.G.L. helped design the study, collected and analyzed data,

and helped revise the manuscript. E.N. helped design the study, collected and analyzed data.

C.N. and S.G-C. collected and analyzed data. A.K. and J.R.Z designed the study, interpreted

data, and drafted and revised the manuscript. J.R.Z. is the guarantor of this work and, as such,

had full access to all the data in the study and takes responsibility for the integrity of the data

and the accuracy of the data analysis.

References

1. Barres R, Zierath JR: The role of diet and exercise in the transgenerational epigenetic

landscape of T2DM. Nat Rev Endocrinol 12:441-451, 2016

2. Krook A, Bjornholm M, Galuska D, Jiang XJ, Fahlman R, Myers MG, Jr., Wallberg-

Henriksson H, Zierath JR: Characterization of signal transduction and glucose transport

in skeletal muscle from type 2 diabetic patients. Diabetes 49:284-292, 2000


19

3. Ryder JW, Yang J, Galuska D, Rincon J, Bjornholm M, Krook A, Lund S, Pedersen O,

Wallberg-Henriksson H, Zierath JR, Holman GD: Use of a novel impermeable

biotinylated photolabeling reagent to assess insulin- and hypoxia-stimulated cell surface

GLUT4 content in skeletal muscle from type 2 diabetic patients. Diabetes 49:647-654,

2000

4. Karlsson HK, Ahlsen M, Zierath JR, Wallberg-Henriksson H, Koistinen HA: Insulin

signaling and glucose transport in skeletal muscle from first-degree relatives of type 2

diabetic patients. Diabetes 55:1283-1288, 2006

5. Storgaard H, Song XM, Jensen CB, Madsbad S, Bjornholm M, Vaag A, Zierath JR:

Insulin signal transduction in skeletal muscle from glucose-intolerant relatives of type 2

diabetic patients [corrected]. Diabetes 50:2770-2778, 2001

6. Kirchner H, Osler ME, Krook A, Zierath JR: Epigenetic flexibility in metabolic

regulation: disease cause and prevention? Trends Cell Biol 23:203-209, 2013

7. Bouzakri K, Zierath JR: MAP4K4 gene silencing in human skeletal muscle prevents

tumor necrosis factor-alpha-induced insulin resistance. J Biol Chem 282:7783-7789,

2007

8. Boyle KE, Zheng D, Anderson EJ, Neufer PD, Houmard JA: Mitochondrial lipid

oxidation is impaired in cultured myotubes from obese humans. Int J Obes (Lond)

36:1025-1031, 2012

9. Maples JM, Brault JJ, Witczak CA, Park S, Hubal MJ, Weber TM, Houmard JA,

Shewchuk BM: Differential epigenetic and transcriptional response of the skeletal

muscle carnitine palmitoyltransferase 1B (CPT1B) gene to lipid exposure with obesity.

Am J Physiol Endocrinol Metab 309:E345-356, 2015

10. Sarabia V, Lam L, Burdett E, Leiter LA, Klip A: Glucose transport in human skeletal

muscle cells in culture. Stimulation by insulin and metformin. J Clin Invest 90:1386-

1395, 1992

11. Jackson S, Bagstaff SM, Lynn S, Yeaman SJ, Turnbull DM, Walker M: Decreased

insulin responsiveness of glucose uptake in cultured human skeletal muscle cells from

insulin-resistant nondiabetic relatives of type 2 diabetic families. Diabetes 49:1169-

1177, 2000

12. Thompson DB, Pratley R, Ossowski V: Human primary myoblast cell cultures from

non-diabetic insulin resistant subjects retain defects in insulin action. J Clin Invest

98:2346-2350, 1996

13. Barres R, Osler ME, Yan J, Rune A, Fritz T, Caidahl K, Krook A, Zierath JR: Non-CpG

methylation of the PGC-1alpha promoter through DNMT3B controls mitochondrial

density. Cell Metab 10:189-198, 2009

14. Henry RR, Ciaraldi TP, Mudaliar S, Abrams L, Nikoulina SE: Acquired defects of

glycogen synthase activity in cultured human skeletal muscle cells: influence of high

glucose and insulin levels. Diabetes 45:400-407, 1996

15. Zierath JR, Galuska D, Nolte LA, Thorne A, Kristensen JS, Wallberg-Henriksson H:

Effects of glycaemia on glucose transport in isolated skeletal muscle from patients with

NIDDM: in vitro reversal of muscular insulin resistance. Diabetologia 37:270-277,

1994

16. Ciaraldi TP, Carter L, Mudaliar S, Kern PA, Henry RR: Effects of tumor necrosis

factor-alpha on glucose metabolism in cultured human muscle cells from nondiabetic

and type 2 diabetic subjects. Endocrinology 139:4793-4800, 1998

17. Barres R, Kirchner H, Rasmussen M, Yan J, Kantor FR, Krook A, Naslund E, Zierath

JR: Weight loss after gastric bypass surgery in human obesity remodels promoter

methylation. Cell Rep 3:1020-1027, 2013


20

18. Multhaup ML, Seldin MM, Jaffe AE, Lei X, Kirchner H, Mondal P, Li Y, Rodriguez V,

Drong A, Hussain M, Lindgren C, McCarthy M, Naslund E, Zierath JR, Wong GW,

Feinberg AP: Mouse-human experimental epigenetic analysis unmasks dietary targets

and genetic liability for diabetic phenotypes. Cell Metab 21:138-149, 2015

19. Jacobsen SC, Gillberg L, Bork-Jensen J, Ribel-Madsen R, Lara E, Calvanese V, Ling C,

Fernandez AF, Fraga MF, Poulsen P, Brons C, Vaag A: Young men with low

birthweight exhibit decreased plasticity of genome-wide muscle DNA methylation by

high-fat overfeeding. Diabetologia 57:1154-1158, 2014

20. Barres R, Yan J, Egan B, Treebak JT, Rasmussen M, Fritz T, Caidahl K, Krook A,

O'Gorman DJ, Zierath JR: Acute exercise remodels promoter methylation in human

skeletal muscle. Cell Metab 15:405-411, 2012

21. Nitert MD, Dayeh T, Volkov P, Elgzyri T, Hall E, Nilsson E, Yang BT, Lang S, Parikh

H, Wessman Y, Weishaupt H, Attema J, Abels M, Wierup N, Almgren P, Jansson PA,

Ronn T, Hansson O, Eriksson KF, Groop L, Ling C: Impact of an exercise intervention

on DNA methylation in skeletal muscle from first-degree relatives of patients with type

2 diabetes. Diabetes 61:3322-3332, 2012

22. Rowlands DS, Page RA, Sukala WR, Giri M, Ghimbovschi SD, Hayat I, Cheema BS,

Lys I, Leikis M, Sheard PW, Wakefield SJ, Breier B, Hathout Y, Brown K, Marathi R,

Orkunoglu-Suer FE, Devaney JM, Leiken B, Many G, Krebs J, Hopkins WG, Hoffman

EP: Multi-omic integrated networks connect DNA methylation and miRNA with

skeletal muscle plasticity to chronic exercise in Type 2 diabetic obesity. Physiol

Genomics 46:747-765, 2014

23. Brons C, Jacobsen S, Nilsson E, Ronn T, Jensen CB, Storgaard H, Poulsen P, Groop L,

Ling C, Astrup A, Vaag A: Deoxyribonucleic acid methylation and gene expression of

PPARGC1A in human muscle is influenced by high-fat overfeeding in a birth-weight-

dependent manner. J Clin Endocrinol Metab 95:3048-3056, 2010

24. Jacobsen SC, Brons C, Bork-Jensen J, Ribel-Madsen R, Yang B, Lara E, Hall E,

Calvanese V, Nilsson E, Jorgensen SW, Mandrup S, Ling C, Fernandez AF, Fraga MF,

Poulsen P, Vaag A: Effects of short-term high-fat overfeeding on genome-wide DNA

methylation in the skeletal muscle of healthy young men. Diabetologia 55:3341-3349,

2012

25. Sreekumar R, Halvatsiotis P, Schimke JC, Nair KS: Gene expression profile in skeletal

muscle of type 2 diabetes and the effect of insulin treatment. Diabetes 51:1913-1920,

2002

26. Pilegaard H, Saltin B, Neufer PD: Effect of short-term fasting and refeeding on

transcriptional regulation of metabolic genes in human skeletal muscle. Diabetes

52:657-662, 2003

27. Koistinen HA, Galuska D, Chibalin AV, Yang J, Zierath JR, Holman GD, Wallberg-

Henriksson H: 5-amino-imidazole carboxamide riboside increases glucose transport and

cell-surface GLUT4 content in skeletal muscle from subjects with type 2 diabetes.

Diabetes 52:1066-1072, 2003

28. Al-Khalili L, Bouzakri K, Glund S, Lonnqvist F, Koistinen HA, Krook A: Signaling

specificity of interleukin-6 action on glucose and lipid metabolism in skeletal muscle.

Mol Endocrinol 20:3364-3375, 2006

29. Davis S, Du P, Bilke S, Triche Jr. T, Bootwalla M: methylumi: Handle Illumina

methylation data. R package version 2.20.0., 2016

30. Du P, Kibbe WA, Lin SM: lumi: a pipeline for processing Illumina microarray.

Bioinformatics 24:1547-1548, 2008

31. Zhang B, Kirov S, Snoddy J: WebGestalt: an integrated system for exploring gene sets

in various biological contexts. Nucleic Acids Res 33:W741-748, 2005


21

32. Wang J, Duncan D, Shi Z, Zhang B: WEB-based GEne SeT AnaLysis Toolkit

(WebGestalt): update 2013. Nucleic Acids Res 41:W77-83, 2013

33. Kulkarni SS, Salehzadeh F, Fritz T, Zierath JR, Krook A, Osler ME: Mitochondrial

regulators of fatty acid metabolism reflect metabolic dysfunction in type 2 diabetes

mellitus. Metabolism 61:175-185, 2012

34. Komatsu S, Ikebe M: ZIP kinase is responsible for the phosphorylation of myosin II and

necessary for cell motility in mammalian fibroblasts. J Cell Biol 165:243-254, 2004

35. Kawai T, Matsumoto M, Takeda K, Sanjo H, Akira S: ZIP kinase, a novel

serine/threonine kinase which mediates apoptosis. Mol Cell Biol 18:1642-1651, 1998

36. Brognard J, Zhang YW, Puto LA, Hunter T: Cancer-associated loss-of-function

mutations implicate DAPK3 as a tumor-suppressing kinase. Cancer Res 71:3152-3161,

2011

37. Das TP, Suman S, Papu John AM, Pal D, Edwards A, Alatassi H, Ankem MK,

Damodaran C: Activation of AKT negatively regulates the pro-apoptotic function of

death-associated protein kinase 3 (DAPK3) in prostate cancer. Cancer Lett 377:134-

139, 2016

38. Hoffman NJ, Parker BL, Chaudhuri R, Fisher-Wellman KH, Kleinert M, Humphrey SJ,

Yang P, Holliday M, Trefely S, Fazakerley DJ, Stockli J, Burchfield JG, Jensen TE,

Jothi R, Kiens B, Wojtaszewski JF, Richter EA, James DE: Global Phosphoproteomic

Analysis of Human Skeletal Muscle Reveals a Network of Exercise-Regulated Kinases

and AMPK Substrates. Cell Metab 22:922-935, 2015

39. Storlien L, Oakes ND, Kelley DE: Metabolic flexibility. Proc Nutr Soc 63:363-368,

2004

40. Freyssenet D: Energy sensing and regulation of gene expression in skeletal muscle. J

Appl Physiol (1985) 102:529-540, 2007

41. Palmer ND, Stevens RD, Antinozzi PA, Anderson A, Bergman RN, Wagenknecht LE,

Newgard CB, Bowden DW: Metabolomic profile associated with insulin resistance and

conversion to diabetes in the Insulin Resistance Atherosclerosis Study. J Clin

Endocrinol Metab 100:E463-468, 2015

42. Zhao X, Peter A, Fritsche J, Elcnerova M, Fritsche A, Haring HU, Schleicher ED, Xu

G, Lehmann R: Changes of the plasma metabolome during an oral glucose tolerance

test: is there more than glucose to look at? Am J Physiol Endocrinol Metab 296:E384-

393, 2009

43. Kocher BA, White LS, Piwnica-Worms D: DAPK3 suppresses acini morphogenesis and

is required for mouse development. Mol Cancer Res 13:358-367, 2015

44. Varadi A, Molnar E, Ostenson CG, Ashcroft SJ: Isoforms of endoplasmic reticulum

Ca(2+)-ATPase are differentially expressed in normal and diabetic islets of Langerhans.

Biochem J 319 ( Pt 2):521-527, 1996

45. Chaabane C, Corvazier E, Bredoux R, Dally S, Raies A, Villemain A, Dupuy E, Enouf

J, Bobe R: Sarco/endoplasmic reticulum Ca2+ATPase type 3 isoforms (SERCA3b and

SERCA3f): distinct roles in cell adhesion and ER stress. Biochem Biophys Res Commun

345:1377-1385, 2006

46. Varadi A, Lebel L, Hashim Y, Mehta Z, Ashcroft SJ, Turner R: Sequence variants of the

sarco(endo)plasmic reticulum Ca(2+)-transport ATPase 3 gene (SERCA3) in Caucasian

type II diabetic patients (UK Prospective Diabetes Study 48). Diabetologia 42:1240-

1243, 1999

47. Jonas JC, Sharma A, Hasenkamp W, Ilkova H, Patane G, Laybutt R, Bonner-Weir S,

Weir GC: Chronic hyperglycemia triggers loss of pancreatic beta cell differentiation in

an animal model of diabetes. J Biol Chem 274:14112-14121, 1999


22

48. Feng S, Jacobsen SE, Reik W: Epigenetic reprogramming in plant and animal

development. Science 330:622-627, 2010

49. Ronn T, Volkov P, Davegardh C, Dayeh T, Hall E, Olsson AH, Nilsson E, Tornberg A,

Dekker Nitert M, Eriksson KF, Jones HA, Groop L, Ling C: A six months exercise

intervention influences the genome-wide DNA methylation pattern in human adipose

tissue. PLoS Genet 9:e1003572, 2013

50. Laurent L, Wong E, Li G, Huynh T, Tsirigos A, Ong CT, Low HM, Kin Sung KW,

Rigoutsos I, Loring J, Wei CL: Dynamic changes in the human methylome during

differentiation. Genome Res 20:320-331, 2010


23

Figure Legends

Figure 1: Genome-wide methylation analysis reveals insulin-induced DNA methylation

in isolated human skeletal muscle. Genome-wide analysis showing the 15 most significantly

enriched KEGG pathways (Benjamini-Hochberg adjusted p value) of genes with significant

changes in DNA methylation between basal and insulin-stimulated skeletal muscle from n=3

healthy subjects. ECM, extracellular matrix; MAPK, mitogen-activated protein kinase.

Figure 2: Effects of insulin on DNA methylation and mRNA expression in isolated

human skeletal muscle. DNA methylation of (A) DAPK3, (B) ATP2A3 and (C) HK1 in

isolated skeletal muscle incubated for 1 hr in the absence (Basal; Open Boxes) or presence of

120 nM insulin (Insulin; Filled Boxes). Whiskers in boxplots indicate maximal and minimal

values. (D) mRNA expression of DAPK3 and ATP2A3 in skeletal muscle incubated for 1 hr in

the absence (Basal; Open Bars) or presence of 120 nM insulin (Insulin; Grey Bars). Data in

panel D are mean ± SEM. *Indicates significant pairwise comparison.

Figure 3: Effects of insulin on DNA methylation in cultured human skeletal muscle cells.

Primary human skeletal muscle cultures from healthy donors were incubated for 1 hr in the

absence (Basal; Open Boxes) or presence of 120 nM insulin (Insulin; Grey Boxes) and either

harvested immediately, or washed with fresh post-fusion media, and harvested after an

additional 4 hr incubation in the absence of insulin (Insulin + 4 hrs; Hatched Boxes).

Whiskers in boxplots indicate maximal and minimal values. (A) Effect of insulin on DAPK3

DNA methylation (p < 0.09). (B) ATP2A3 DNA methylation was unaltered between basal and

insulin-stimulated conditions. Individual changes in DNA methylation of DAPK3 at CpG1 at

each time point in percentage of DNA copies methylated (C) or relatively to the basal level

(D) is shown. Each dot represents a subject at a specific time-point.


24

Figure 4: Effect of a glucose challenge on DAPK3 DNA methylation in skeletal muscle

from people with normal glucose tolerance or Type 2 diabetes (A, B) or cultured human

myotubes in vitro (C, D). Skeletal muscle biopsies were obtained from people with normal

glucose tolerance (NGT) or Type 2 diabetes (T2D) before (Basal; Open Triangles) and 2 hr

after an oral glucose tolerance test (Post OGTT; Open Boxes). (A) DAPK3 CpG1 methylation

was reduced after the OGTT and in T2D versus NGT. (B) DAPK3-CpG2 methylation was

also reduced after the OGTT, but there was no significant difference between T2D and NGT

(p < 0.09). Glucose challenge was associated with lower (A) DAPK3 CpG1 methylation and

(B) DAPK3-CpG2 methylation in skeletal muscle from people with NGT or T2D.

Differentiated human myotubes were exposed to Low (5 mM) or High (25 mM) glucose for 2

hrs. DAPK3 CpG1 methylation was unaltered by High glucose in human myotubes (C).

DAPK3 CpG2 was unaltered by High glucose in human myotubes (Fig. 4D). *Indicates a

main effect due to the OGTT. †Indicates a main effect of T2D.

Figure 5: Spearman’s rank correlation coefficient between DAPK3 DNA methylation

and glucose concentration in people with normal glucose tolerance or Type 2 diabetes. In

men with normal glucose tolerance (NGT; Open Circles) and type 2 diabetes (T2D; Filled

Squares) the relationship between fasting (Basal) glucose concentration and (A) DAPK3

CpG1 methylation (p = 0.05) and (B) DAPK3 CpG2 methylation (p = 0.1) did not reach

statistical significance. (C) DAPK3 CpG1 methylation and (D) DAPK3 CpG2 methylation

was inversely correlated with the 2 hr glucose concentration measured during the oral glucose

tolerance test (Post OGTT). *Indicates a significant inverse correlation.


25

Figure 6: Effect of ATP2A3 or DAPK3 siRNA on glycogen synthesis and palmitate

oxidation. Primary myotubes derived from people with normal glucose tolerance were

transfected with siRNA against ATP2A3 (A) or DAPK3 (B) and mRNA expression of the

respective gene was determined. Control experiments in which myotubes were transfected

with a non-targeting negative control siRNA (Control) are shown for each gene as a reference.

Untreated (Basal; Open Bars) and 120 nM insulin-stimulated (Insulin; Gray Bars) glucose

incorporation to glycogen was assessed in cultured myotubes transfected with siRNA against

ATP2A3 (C) or DAPK3 (D). Untreated (Basal; Open Bars) or 2 mM AICAR-stimulated

(AICAR; Lined Bars) palmitate oxidation was assessed in cultured myotubes transfected with

siRNA against ATP2A3 (E) or DAPK3 (F). *Indicates significant pairwise effect. †Indicates

significant main effect of insulin. ‡Indicates significant main effect of AICAR. § Indicates

significant main effect of silencing DAPK3.Results are mean ± SEM and n = 4 - 9 matched

primary myotubes in all panels.

Figure 7: Effect of silencing ATP2A3 or DAPK3 on insulin signaling and abundance of

autophagy markers. Primary myotubes derived from people with normal glucose tolerance

were transfected with siRNA against ATP2A3 or DAPK3. Myotubes were incubated in the

absence (Basal; Open Bars) or presence of 120 nM insulin (Insulin; Gray Bars) for 1 hr.

Control experiments in which myotubes were transfected with a non-targeting negative

control siRNA (Control) are shown for each gene as a reference. PKB p-Thr-308 (A-B),

TBC1D4 p-Ser-318 (C-D), P62 (E), LC3-I (F), LC3-II (G), and the ratio of LC3-I to LC3-II

(H) was determined by Western blot analysis. *Indicates significant pairwise comparison. †

Indicates significant main effect of insulin. ‡ Indicates significant effect by Friedman’s test

when assumptions of 2-way RM ANOVA were violated. Results are mean ± SEM and n = 5-7

matched primary myotubes in all panels.


Table 1: Anthropometric Measurements and Metabolic Parameters of the Men Enrolled in the Skeletal Muscle Biopsy Studies

A) NGT B) NGT Type 2 diabetic

n 10 n 12 12

Age, years 53 ± 2 Age, years 60 ± 3 63 ± 1

Height, cm 181 ± 2 Height, cm 178 ± 2 180 ± 1

Weight, kg 82.4 ± 2.7 Weight, kg 80.8 ± 2.3 91.5 ± 2.0

BMI, kg/m2 25.2 ± 0.6 BMI, kg/m

2 25.4 ± 0.5 28.3 ± 0.6

*

Waist to hip ratio 0.89 ± 0.02 Waist to hip ratio 0.92 ± 0.01 0.98 ± 0.01*

SBP, mmHg 125 ± 5 SBP, mmHg 133 ± 5 135 ± 3

DBP. mmHg 81 ± 3 DBP. mmHg 81 ± 3 85 ± 2

FPG, mmol/L 5.3 ± 0.1 FPG, mmol/L 5.3 ± 0.1 8.1 ± 0.4*

2-h PG, mmol/L 5.9 ± 0.3 15.8 ± 1.0*

Fasting Insulin, pmol/L 36.9 ± 8.0 Fasting Insulin, pmol/L 51.2 ± 6.4 100.6 ± 13.9*

2-h Insulin, pmol/L 293.6 ± 56.2 362.2 ± 58.4

HbA1c, % 5.4 ± 0.1 HbA1c, % 5.5 ± 0.1 6.9 ± 0.2*

HbA1c,mmol/mol 35.9 ± 0.6 HbA1c,mmol/mol 37.1 ± 1.0 52.3 ± 2.3*

HOMA-IR 1.6 ± 0.2 5.4 ± 0.9*

HDL cholesterol, mmol/L 1.4 ± 0.1 HDL cholesterol, mmol/L 1.3 ± 0.1 1.3 ± 0.1

LDL cholesterol, mmol/L 3.7 ± 0.2 LDL cholesterol, mmol/L 3.4 ± 0.1 2.8 ± 0.3*

Triglycerides, mmol/L 0.85 ± 0.14 Triglycerides, mmol/L 0.98 ± 0.16 1.22 ± 0.15

Total cholesterol, mmol/L 5.3 ± 0.3 Total cholesterol, mmol/L 5.1 ± 0.2 4.6 ± 0.2

A) Biopsies were obtained after an overnight fast. B) Biopsies were taken after an overnight fast before and during an OGTT. NGT, normal

glucose tolerance; BMI, Body Mass Index; SBP, Systolic Blood Pressure; DBP, Diastolic blood pressure; FPG, Fasting Plasma Glucose; 2-h PG,

Plasma Glucose 2 hours after oral glucose ingestion; HOMA-IR, homeostatic model assessment-insulin resistance; HDL, high density

lipoproteins; LDL, low density lipoproteins. Data mean ± SEM. *

p < 0.05 calculated using Student t-test.


Table 2: Insulin-Induced Percent and Fold Change in DNA Methylation in Skeletal

Muscle

Gene Target ID Gene Region % Change Fold Change p value

HK1 cg17575314 Body 5 % 1.07 0.034

HDAC5 cg16217242 TSS 1500 2 % 1.64 0.001

DAPK3 cg18748062 Body 18 % 1.25 0.006

ATP2A3 cg08498987 3'UTR -21 % 0.68 0.014

Targets selected for validation from the Illumina 450k Array. Values for HK1 and HDAC are

from the M-values analysis, while values for DAPK3 and ATP2A3 are from the Beta-values

analysis. Percent and fold- change in methylation is reported from the Illumina 450k Array for

basal versus insulin-stimulated human skeletal muscle. n = 3 subjects


Genome-wide methylation analysis reveals insulin-induced DNA methylation in isolated human skeletal

muscle.

254x190mm (96 x 96 DPI)


Effects of insulin on DNA methylation and mRNA expression in isolated human skeletal muscle.

254x190mm (96 x 96 DPI)


Effects of insulin on DNA methylation in cultured human skeletal muscle cells.

254x190mm (96 x 96 DPI)


Effect of a glucose challenge on DAPK3 DNA methylation in skeletal muscle from people with normal glucose tolerance or Type 2 diabetes (A, B) or cultured human myotubes in vitro (C, D).

254x190mm (96 x 96 DPI)


Spearman’s rank correlation coefficient between DAPK3 DNA methylation and glucose concentration in people with normal glucose tolerance or Type 2 diabetes.

254x190mm (96 x 96 DPI)


Effect of ATP2A3 or DAPK3 siRNA on glycogen synthesis and palmitate oxidation.

254x190mm (96 x 96 DPI)


Effect of silencing ATP2A3 or DAPK3 on insulin signaling and abundance of autophagy markers.

254x190mm (96 x 96 DPI)


Supplementary Table 1: List of Primer Oligos for qPCR analysis

Gene Forward (5’->3’) Reverse (5’->3’)

HPRT1 GAAAAGGACCCCACGAAGTGT AGTCAAGGGCATATCCTACAA

B2M TGTCTTTCAGCAAGGACTGG AGCAAGCAAGCAGAATTTGG

RPLP0 TGTTTCATTGTGGGAGCAGA GAACACAAAGCCCACATTCC

GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG

DAPK3 AATCTGAGGAGCTGGGTTGC TCCAGGGAAAGTGCAGTCAC

ATP2A3 AGTGCTCCGAAGACAACCC GTTCTCCGAGACGCTGTTG

PPIB ATGTAGGCCGGGTGATCTTT CATCTCCCCTGGTGAAGTCT

TBP AGTTCTGGGATTGTACCGCA TATATTCGGCGTTTCGGGCA

mRNA was harvested from cultured myotubes using a kit (E.Z.N.A. Total RNA Kit 1, Omega

bio-tek, Norcross, GA). Reverse transcription and quantitative PCR were carried out using

MultiScribe Reverse Transcriptase and Fast SYBR Green Master Mix, respectively (Thermo

Fisher Scientific). Gene expression of ATP2A3, DAPK3, and reference genes (PPIB, TBP)

was assessed using self-designed oligonucleotides (Sigma-Aldrich).


Supplementary Table 2: List of Antibodies used for Western-blot analysis

Target Vendor Product Number

PKB p-Thr-308 Cell Signaling (Danvers, MA) 4056

PKB total Cell Signaling 9272

TBC1D4 p-Ser-318 Cell Signaling 8619

TBC1D4 total Merck Millipore (Billerica, MA) 07-741

p62 Sigma-Aldrich P0067

LC3 Sigma-Aldrich L8918

GAPDH Santa Cruz Biotechnology (Dallas, TX) sc-257758

Myotube lysates were diluted in Laemmli buffer (60 mM tris base at pH 6.8, 2% w/v SDS,

10% v/v glycerol, 0.01% w/v bromophenol blue, 1.25% v/v β-mercaptoethanol). SDS-PAGE

was conducted using pre-cast tris-HCl and tris-bis gels with tris/glycine/SDS or 2-(N-

morpholino)ethanesulfonic acid running buffers, respectively (Bio-Rad). Proteins were

transferred to Immobilon-P PVDF membranes (Merck Millipore). Equal loading of protein

between samples was assessed by Ponceau staining (Sigma-Aldrich) or fluorescent-detection

in the case of stain-free gels (Bio-Rad). Membranes were washed in tris-buffered saline (TBS)

with Tween-20 (Sigma-Aldrich) (TBST) (20 mM tris at pH 7.6, 137 mM NaCl, 0.02% v/v

Tween-20). Membranes were blocked in 7.5% non-fat dry milk, washed again in TBST, then

incubated with primary antibodies overnight at 4°C (1:1000 in TBS with 0.1% w/v bovine

serum albumin, 0.1% w/v NaN3). Membranes were washed again in TBST, incubated with

horseradish peroxidase-conjugated secondary antibodies (1:25000 in TBST with 4% NFDM;

Thermo Fisher Scientific) for 1-2 hours at room temperature and then washed in TBST.

Immunolabeled bands were visualized using extended chemiluminescence reagents (GE

Healthcare) and autoradiograms were quantitated by scanning densitometry using Image Lab

software (Bio-Rad).


target_ID

M value

difference

Beta value

difference p_unpaired p_paired

Gene Name

name of the

closest gene UCSC_REFGENE_GROUP UCSC_CPG_ISLANDS_NAME

RELATION_TO_

UCSC_CPG_ISLA

ND

cg03312587 -0.2728 0.0361 0.0122 0.0207 A2BP1 5'UTR;5'UTR;5'UTR

cg20307184 0.6291 -0.0475 0.0287 0.0113 ABCA13 Body

cg07372195 0.9867 -0.0462 0.0111 0.0239 ABCA5 5'UTR;1stExon;5'UTR

cg14647845 0.4657 -0.0323 0.0181 0.0040 ABLIM2 Body;Body;Body;Body;Body;Body;Body

cg20497635 1.0417 -0.0930 0.0345 0.0094 ABR Body;Body;Body

cg13686847 -0.4127 0.0310 0.0203 0.0239 ACACB Body

cg06698843 -0.5306 0.0403 0.0314 0.0164 ACADS Body chr12:121177115-121177341 N_Shelf

cg07343187 -0.8390 0.0336 0.0399 0.0498 ACAN Body;Body

cg16380285 -0.6346 0.0318 0.0106 0.0139 ACAP3 3'UTR chr1:1228780-1230163 N_Shore

cg04854749 -0.2989 0.0420 0.0002 0.0006 ACIN1 Body;Body;Body;Body;Body chr14:23528360-23528582 S_Shore

cg22402043 0.7627 -0.0487 0.0272 0.0044 ACP6 Body chr1:147141842-147142918 N_Shelf

cg17541674 -0.3461 0.0661 0.0095 0.0113 ACPT Body chr19:51294876-51295098 S_Shore

cg07665222 0.5427 -0.0509 0.0032 0.0095 ACRV1

TSS1500;TSS1500;TSS1500;TSS1500;TSS150

0;TSS1500;TSS1500;TSS1500;TSS1500

cg04252928 0.4396 -0.0412 0.0491 0.0049 ACSF3 Body;Body;Body chr16:89167116-89167482 S_Shore

cg02009395 0.3747 -0.0423 0.0490 0.0246 ACSM1 TSS200

cg03369957 0.5781 -0.0794 0.0448 0.0469 ACTL6B Body chr7:100253782-100254150 N_Shore

cg18862171 0.7014 -0.0449 0.0088 0.0009 ACTN3 TSS200;TSS1500 chr11:66314207-66314455 Island

cg04738270 0.7167 -0.0537 0.0053 0.0172 ACTR1A Body chr10:104262224-104262524 N_Shore

cg21577356 -0.4103 0.0406 0.0038 0.0046 ACTR3C TSS1500;5'UTR;5'UTR chr7:150019950-150020752 S_Shore

cg04892170 0.7435 -0.0300 0.0232 0.0108 ADAM12 1stExon;5'UTR;5'UTR;1stExon chr10:128076155-128077482 Island

cg05847038 0.7683 -0.0500 0.0405 0.0247 ADAM7 Body

cg16451601 0.7209 -0.0577 0.0234 0.0446 ADAMTS2 Body;Body

cg01260219 -0.3110 0.0414 0.0019 0.0295 ADAMTS8 TSS1500 chr11:130297401-130298517 S_Shore

cg21170978 0.7111 -0.0340 0.0454 0.0314 ADAMTSL1 Body

cg01629749 0.4718 -0.0651 0.0323 0.0262 ADAP1 Body chr7:959724-959959 Island

cg04233620 -0.8087 0.0847 0.0106 0.0195 ADARB1 Body;Body;Body;Body;Body;Body;Body

cg00615654 0.8293 -0.0706 0.0081 0.0201 ADARB2 Body chr10:1382500-1383006 N_Shore

cg11637718 -0.4758 0.0424 0.0004 0.0063 ADCY9 Body chr16:4029157-4029413 Island

t-tests (unpaired &

paired, 2-sided


cg16230755 -0.3191 0.0309 0.0243 0.0312 ADD3 5'UTR;5'UTR;5'UTR

cg05727225 -0.3990 0.0446 0.0207 0.0274 ADM Body chr11:10327013-10329831 Island

cg25320816 -0.3776 0.0529 0.0130 0.0168 ADPRHL1 5'UTR;Body chr13:114096050-114096317 S_Shelf

cg11367939 -0.4440 0.0361 0.0099 0.0220 ADRA2A 3'UTR;1stExon chr10:112835990-112839303 Island

cg22275864 0.7223 -0.0492 0.0303 0.0395 ADRB3 Body chr8:37822486-37824008 Island

cg16389474 0.5792 -0.0369 0.0241 0.0009 ADRM1 5'UTR;5'UTR chr20:60877499-60879008 Island

cg10028549 -0.3009 0.0419 0.0319 0.0136 AFAP1 TSS1500;TSS1500 chr4:7940563-7941853 S_Shore

cg02441982 0.6113 -0.0419 0.0234 0.0015 AFMID Body;TSS1500;Body;Body chr17:76183077-76183449 S_Shore

cg27436044 -0.3079 0.0301 0.0104 0.0095 AGA Body chr4:178363239-178363708 N_Shelf

cg13018278 -0.1426 0.0359 0.0461 0.0030 AGAP1 Body;Body chr2:237028848-237029121 Island

cg22199080 -0.5048 0.0814 0.0437 0.0293 AGAP2 1stExon chr12:58130870-58132047 S_Shelf

cg01338043 -0.4313 0.0608 0.0176 0.0379 AGFG2 TSS1500 chr7:100136448-100136919 N_Shore

cg20352108 0.5140 -0.0536 0.0270 0.0010 AGPAT4 5'UTR

cg03120284 -0.8278 0.0888 0.0464 0.0191 AGRN Body chr1:990274-990694 N_Shelf

cg09745307 0.5330 -0.0353 0.0040 0.0250 AGXT2 TSS1500

cg04911680 0.5029 -0.0316 0.0216 0.0013 AHDC1 5'UTR chr1:27894927-27895524 Island

cg21267167 0.3733 -0.0387 0.0094 0.0034 AJAP1 Body;Body

cg17181543 0.5245 -0.0303 0.0451 0.0229 AK5 TSS1500 chr1:77747314-77748224 N_Shore

cg27090975 0.2071 -0.0339 0.0223 0.0156 AKAP8L Body chr19:15512025-15512393 S_Shelf

cg24455383 -0.3794 0.0748 0.0257 0.0052 AKT3 Body;Body

cg14469290 1.0575 -0.1133 0.0332 0.0092 ALAD TSS1500 chr9:116163208-116163848 S_Shore

cg16086130 -0.9008 0.0976 0.0047 0.0043 ALDH1A3 TSS1500 chr15:101419261-101421133 Island

cg02946394 -0.3862 0.0407 0.0423 0.0431 ALOXE3 Body;Body chr17:8012474-8012846 N_Shore

cg11441891 0.7929 -0.0395 0.0192 0.0019 ALS2CL TSS1500;Body

cg02562052 1.6860 -0.1228 0.0044 0.0270 ALS2CR4 TSS200;TSS1500 chr2:202507139-202508270 S_Shore

cg16893614 0.7877 -0.0554 0.0199 0.0398 ALX3 TSS1500 chr1:110610265-110613303 S_Shore

cg00268840 -1.0339 0.0505 0.0249 0.0359 ALX4 TSS1500 chr11:44332314-44332757 Island

cg21101750 0.6357 -0.0596 0.0334 0.0231 AMBRA1 TSS1500 chr11:46615197-46615664 N_Shore

cg01636354 -0.4430 0.0731 0.0046 0.0421 AMOTL2 Body chr3:134080390-134080596 N_Shore

cg12756093 -0.4006 0.0754 0.0015 0.0065 AMPD1 TSS1500

cg24435741 -0.4782 0.0454 0.0246 0.0204 AMPD3 TSS1500 chr11:10472000-10472857 N_Shore

cg02251567 -0.3202 0.0745 0.0044 0.0271 AMT

Body;5'UTR;1stExon;3'UTR;1stExon;1stExon

;5'UTR;5'UTR;1stExon;5'UTR


cg01186212 0.6372 -0.0340 0.0421 0.0175 ANK3 Body

cg14455319 0.2916 -0.0431 0.0375 0.0181 ANKK1 Body chr11:113258443-113258821 S_Shore

cg04035353 -0.6295 0.0497 0.0055 0.0178 ANKRD11 Body chr16:89334574-89335088 S_Shore

cg13718961 0.3988 -0.0332 0.0200 0.0188 ANKRD13B Body chr17:27939298-27940770 N_Shore

cg01635821 0.5661 -0.0347 0.0476 0.0114 ANKRD46 5'UTR chr8:101571515-101572104 N_Shore

cg00515408 0.6839 -0.0569 0.0034 0.0258 ANKS1B 5'UTR;1stExon chr12:100378243-100378582 N_Shore

cg14938313 -0.4778 0.0431 0.0337 0.0176 ANO1 Body;Body

cg15476875 0.6279 -0.0463 0.0054 0.0222 ANO4 Body

cg00363845 0.5519 -0.0836 0.0162 0.0446 ANO8 TSS1500 chr19:17443965-17444633 S_Shore

cg05998672 0.4527 -0.0316 0.0426 0.0030 AP2A2 Body

cg01632240 -0.1981 0.0307 0.0155 0.0067 AP3M2 TSS1500;TSS1500 chr8:42009723-42011098 N_Shore

cg14907738 0.3881 -0.0316 0.0092 0.0207 APC2 Body chr19:1456077-1456347 Island

cg03624661 -0.7388 0.0314 0.0005 0.0159 APH1B TSS1500;TSS1500 chr15:63569296-63570100 Island

cg16353361 -0.5892 0.0507 0.0143 0.0123 APLN TSS1500 chrX:128788003-128789195 S_Shore

cg13880303 0.4886 -0.1007 0.0280 0.0195 APOC1 TSS200

cg20691580 -0.5979 0.0348 0.0093 0.0495 APOC3 5'UTR

cg04006839 -0.5281 0.0373 0.0152 0.0237 APOH 1stExon

cg19599611 0.5928 -0.0369 0.0274 0.0423 AQR 3'UTR

cg09120188 0.6820 -0.0357 0.0227 0.0275 ARHGAP23 Body

cg15368044 -0.2989 0.0409 0.0408 0.0050 ARHGAP26 Body;Body

cg00402547 0.9041 -0.0549 0.0038 0.0487 ARHGAP28 5'UTR;5'UTR

cg07837534 -0.4113 0.0656 0.0007 0.0139 ARHGAP30 Body;Body

cg06015525 -0.8355 0.0439 0.0255 0.0204 ARHGAP9 Body;Body;TSS1500 chr12:57869075-57870182 S_Shore

cg22062741 0.3656 -0.0303 0.0027 0.0013 ARHGEF10 Body chr8:1893696-1894083 S_Shelf

cg19537511 -0.2371 0.0413 0.0012 0.0235 ARHGEF15 5'UTR

cg08929791 -0.3065 0.0303 0.0125 0.0269 ARHGEF19 5'UTR chr1:16532917-16534580 S_Shore

cg23919844 0.5460 -0.0338 0.0484 0.0337 ARHGEF7 Body;5'UTR;Body;Body

cg02001279 -0.4875 0.0894 0.0429 0.0193 ARID3A Body chr19:940723-942490 Island

cg18975055 -0.4284 0.0520 0.0079 0.0175 ARRB1 3'UTR;3'UTR

cg23779331 1.0897 -0.0699 0.0135 0.0338 ARRB2 Body;Body chr17:4613400-4614423 Island

cg14335435 0.9738 -0.0422 0.0128 0.0014 ARRDC4 Body

cg22193089 1.0426 -0.0444 0.0037 0.0482 ARSG 5'UTR chr17:66255192-66255556 S_Shelf

cg24056730 0.7071 -0.0616 0.0473 0.0129 ART3 TSS1500;TSS1500;5'UTR


cg23212751 0.8714 -0.0695 0.0203 0.0284 ARTN TSS1500;Body;Body;Body;Body chr1:44401757-44402423 N_Shore

cg18513624 0.5113 -0.0358 0.0369 0.0426 ARVCF Body chr22:19974274-19974756 Island

cg16414561 -1.0241 0.0354 0.0003 0.0038 ARX 1stExon;5'UTR chrX:25033664-25034712 Island

cg06404572 0.6670 -0.0677 0.0043 0.0071 ASAP1 Body chr8:131370087-131371317 S_Shelf

cg10903916 0.5699 -0.0470 0.0237 0.0081 ASAP2 Body;Body chr2:9533572-9533807 N_Shore

cg12724466 -0.4413 0.0969 0.0351 0.0177 ASB11 TSS1500;1stExon

cg24074054 0.1913 -0.0329 0.0196 0.0345 ASF1B Body chr19:14246899-14248520 N_Shore

cg19619206 -0.4352 0.0434 0.0036 0.0307 ASGR2 5'UTR;5'UTR;1stExon;5'UTR;5'UTR

cg18159819 -0.6957 0.0504 0.0236 0.0423 ASRGL1 Body;Body chr11:62138621-62138873 S_Shore

cg13978347 0.4576 -0.0321 0.0005 0.0117 ASTN2 Body;Body;Body

cg11794959 -0.1507 0.0305 0.0260 0.0092 ATAD3A 5'UTR;Body;Body chr1:1452701-1453199 N_Shore

cg15688683 0.6093 -0.0394 0.0163 0.0311 ATAD3B Body

cg27563529 0.8191 -0.0389 0.0119 0.0277 ATF7 3'UTR;3'UTR;3'UTR

cg13858127 0.7489 -0.0600 0.0046 0.0433 ATP11A Body;Body chr13:113497296-113497661 S_Shore

cg05808709 -0.5070 0.0831 0.0141 0.0288 ATP1A2 Body

cg07807695 -0.3289 0.0590 0.0081 0.0036 ATP6AP1L Body

cg04726373 -0.5797 0.0434 0.0230 0.0264 ATP6V0D1 Body chr16:67514398-67515345 N_Shore

cg13100918 0.8528 -0.0449 0.0105 0.0333 ATP8A1 Body;Body chr4:42658278-42659550 N_Shelf

cg26048101 0.7194 -0.0827 0.0137 0.0261 ATP9A Body

cg16904686 -0.4187 0.0418 0.0329 0.0199 ATPAF1 Body;Body chr1:47133674-47134395 N_Shore

cg07225277 -0.3604 0.0365 0.0005 0.0037 ATPGD1 Body;Body chr11:67188087-67188879 Island

ch.X.1171704R 1.2776 -0.0796 0.0087 0.0446 ATRX Body;Body

cg14791639 -0.2978 0.0393 0.0382 0.0111 ATXN1 5'UTR;5'UTR

cg19465374 -0.2831 0.0427 0.0100 0.0358 AZGP1 Body

cg02069944 -0.4221 0.0512 0.0073 0.0184 AZI1 Body;Body

cg05973866 -0.7722 0.0399 0.0023 0.0228 B3GALT4 TSS1500 chr6:33244677-33245554 Island

cg16756854 0.6394 -0.0329 0.0313 0.0066 B3GNT1 TSS1500 chr11:66114497-66115525 S_Shore

cg22535523 0.5672 -0.0318 0.0111 0.0047 BAHCC1 Body chr17:79380359-79380723 S_Shelf

cg09544050 0.3782 -0.0688 0.0406 0.0123 BAI1 Body chr8:143580769-143580975 Island

cg19176696 -0.5623 0.0427 0.0119 0.0262 BAIAP2 Body;Body;Body;Body

cg23598068 -0.3009 0.0389 0.0261 0.0154 BAIAP2L1 Body

cg05781294 0.8806 -0.0622 0.0216 0.0202 BAT1 Body;TSS200;Body

cg18685724 -0.5657 0.0790 0.0099 0.0229 BAT2 TSS1500 chr6:31587779-31589024 Island


cg13873889 -0.5319 0.0450 0.0179 0.0003 BAT3 Body;Body;Body;Body

cg08319238 0.5345 -0.0353 0.0175 0.0465 BCAM Body;Body chr19:45312059-45312397 S_Shore

cg08465120 0.7182 -0.1350 0.0404 0.0090 BCAN Body chr1:156627342-156627576 Island

cg10172669 -0.5399 0.0307 0.0207 0.0165 BEND4 1stExon;5'UTR;5'UTR;1stExon chr4:42152766-42154984 Island

cg23032598 0.6907 -0.0685 0.0069 0.0016 BFSP1 Body;TSS1500 chr20:17511478-17512209 S_Shore

cg09177577 0.6398 -0.0772 0.0162 0.0094 BIN3 Body

cg16925678 -0.5001 0.0539 0.0044 0.0310 BIRC7 3'UTR;3'UTR chr20:61870781-61871178 Island

cg22047703 0.7753 -0.0358 0.0311 0.0333 BMP7 TSS200 chr20:55840216-55841794 S_Shore

cg07843733 0.5850 -0.0372 0.0275 0.0135 BRAF Body

cg13782816 0.4537 -0.0496 0.0257 0.0432 BRCA1 Body;Body;5'UTR;1stExon;Body;Body chr17:41278134-41278460 N_Shelf

cg10835365 1.1917 -0.0727 0.0217 0.0121 BRD1 Body chr22:50169612-50169864 Island

cg02935097 -0.2705 0.0452 0.0088 0.0270 BRDT TSS200 chr1:92414718-92414986 Island

cg26318206 -0.2705 0.0579 0.0360 0.0412 BRF1 Body chr14:105738159-105738664 N_Shelf

cg11529614 0.6081 -0.0374 0.0103 0.0270 BRIP1 TSS1500 chr17:59940825-59941067 Island

cg22849672 0.5697 -0.0349 0.0468 0.0078 BRP44L Body chr6:166795368-166797301 N_Shelf

cg14746118 0.7733 -0.0783 0.0051 0.0286 BRS3 TSS1500

cg03695103 0.9083 -0.0913 0.0135 0.0394 BRSK2 Body chr11:1471339-1471595 Island

cg13408027 -0.3966 0.0305 0.0028 0.0277 BSPRY 3'UTR

cg17170819 0.4966 -0.0348 0.0288 0.0355 BTBD17 3'UTR chr17:72352827-72353798 N_Shore

cg16870622 -0.6618 0.0454 0.0217 0.0046 BTBD2 3'UTR chr19:1985880-1986198 Island

cg21391023 0.4242 -0.0505 0.0032 0.0092 BTBD8 TSS1500 chr1:92545819-92546480 N_Shore

cg19281794 0.8365 -0.0566 0.0291 0.0458 BTLA TSS1500;TSS1500

cg21432745 0.6478 -0.0354 0.0119 0.0399 BTN3A2 3'UTR

cg21369812 0.5280 -0.0532 0.0349 0.0337 C10orf105 3'UTR;3'UTR;Body

cg03522510 -0.5612 0.0345 0.0318 0.0360 C10orf107 5'UTR chr10:63422538-63423105 S_Shore

cg03448754 0.3489 -0.0352 0.0162 0.0438 C10orf11 TSS1500

cg12518630 0.8376 -0.0558 0.0001 0.0078 C10orf12 TSS1500

cg24291461 0.5544 -0.0429 0.0152 0.0469 C10orf2 Body;Body;Body;Body chr10:102748870-102749088 S_Shore

cg03275084 0.4482 -0.0313 0.0036 0.0201 C10orf32 Body;Body chr10:104614000-104614326 S_Shelf

cg11824509 -0.7859 0.1248 0.0023 0.0224 C10orf57 TSS1500;Body;Body;Body;Body;Body chr10:81838359-81839078 N_Shore

cg14618310 -0.6362 0.0638 0.0427 0.0145 C10orf84 3'UTR;3'UTR

cg07780895 -0.4798 0.0542 0.0149 0.0172 C10orf93 Body chr10:134755663-134756852 N_Shore

cg02789688 -0.5474 0.0348 0.0294 0.0116 C11orf45 TSS1500;5'UTR


cg03019460 0.6012 -0.0304 0.0304 0.0418 C11orf51 5'UTR chr11:71823668-71823975 N_Shore

cg03847768 1.0103 -0.0784 0.0045 0.0146 C12orf35 TSS1500 chr12:32112161-32112833 N_Shore

cg07979579 0.8547 -0.0624 0.0400 0.0477 C13orf1 Body;3'UTR;3'UTR

cg03135713 0.5759 -0.0506 0.0163 0.0175 C13orf18 TSS1500 chr13:46960684-46961670 S_Shore

cg22032900 -0.5351 0.0361 0.0010 0.0023 C13orf35 1stExon;5'UTR chr13:113303306-113303540 N_Shore

cg03565081 -0.4462 0.0666 0.0032 0.0321 C14orf93 5'UTR;5'UTR;5'UTR chr14:23479310-23479532 N_Shore

cg25710630 0.5209 -0.0313 0.0039 0.0018 C15orf23 Body;Body;3'UTR

cg01818102 0.8107 -0.0389 0.0041 0.0071 C16orf45 TSS1500;Body

cg16578568 -0.2712 0.0510 0.0017 0.0012 C16orf54 TSS200

cg08734647 0.8783 -0.0588 0.0110 0.0443 C16orf73 TSS1500;TSS1500 chr16:1921897-1922426 Island

cg08358426 -0.2926 0.0586 0.0173 0.0168 C16orf79 TSS1500;3'UTR chr16:2263912-2265428 N_Shore

cg07150585 0.8218 -0.0484 0.0200 0.0225 C16orf90 TSS1500 chr16:3546366-3546769 Island

cg19196735 0.9906 -0.0601 0.0031 0.0042 C17orf108 5'UTR chr17:26219938-26220475 N_Shelf

cg15532088 -0.5005 0.0589 0.0448 0.0361 C17orf66 Body

cg03284113 0.7326 -0.0515 0.0453 0.0468 C19orf26 Body chr19:1234938-1235231 Island

cg08399733 -0.5983 0.0327 0.0054 0.0392 C19orf35 Body chr19:2278605-2278848 Island

cg22627406 -0.3462 0.0451 0.0049 0.0124 C19orf38 TSS200

cg22642495 -0.3375 0.0557 0.0380 0.0168 C19orf66 Body chr19:10196696-10197857 Island

cg20433455 -0.3213 0.0406 0.0045 0.0397 C1orf144 Body;Body

cg02907021 -0.9137 0.0488 0.0351 0.0313 C1orf198 Body;5'UTR;Body

cg08843859 0.7559 -0.0420 0.0274 0.0198 C1orf21 Body

cg08910524 0.6542 -0.0333 0.0310 0.0328 C1orf27 5'UTR;5'UTR;Body;5'UTR chr1:186344124-186344848 S_Shelf

cg16684817 -0.4966 0.0620 0.0063 0.0213 C1orf38 Body;Body;Body chr1:28199031-28199257 S_Shelf


cg06794398 0.6462 -0.0316 0.0017 0.0052 C1orf85 TSS200

cg27332111 1.4373 -0.0421 0.0118 0.0023 C1orf91 TSS1500;Body chr1:32687521-32688040 S_Shore

cg24484138 0.2645 -0.0303 0.0340 0.0062 C20orf112 5'UTR chr20:31070189-31072676 Island

cg22963777 -0.5801 0.0608 0.0154 0.0297 C20orf173 3'UTR;Body

cg19333980 0.2634 -0.0416 0.0062 0.0444 C20orf30 TSS1500;TSS1500;TSS1500;TSS1500 chr20:5093360-5094145 S_Shore

cg03908688 -0.4591 0.0524 0.0243 0.0015 C20orf54 Body chr20:741633-742058 S_Shore

cg04677846 0.2059 -0.0326 0.0353 0.0380 C21orf33 Body;Body chr21:45560662-45560999 Island

cg17136243 0.5093 -0.0373 0.0127 0.0044 C22orf39 3'UTR



cg20712489 1.0528 -0.0716 0.0087 0.0322 C2orf83 3'UTR;3'UTR

cg24290756 -0.4075 0.0723 0.0174 0.0263 C2orf85 TSS1500 chr2:242815056-242815599 N_Shelf

cg09613130 -0.7663 0.0469 0.0035 0.0157 C2orf90 3'UTR;1stExon

cg13868855 -0.3926 0.0465 0.0188 0.0266 C3orf21 Body

cg15083578 0.5995 -0.0473 0.0037 0.0386 C3orf23 3'UTR

cg07472196 0.6088 -0.0407 0.0077 0.0322 C3orf26 Body;5'UTR;5'UTR


cg01436664 -0.4632 0.0322 0.0492 0.0238 C3orf37 1stExon;5'UTR;5'UTR chr3:128997958-128998303 N_Shore

cg13197078 0.4698 -0.0363 0.0463 0.0268 C4B Body;Body

cg10183150 0.4135 -0.0487 0.0442 0.0397 C4orf3 Body;TSS1500 chr4:120221626-120222007 S_Shore

cg25222324 -0.3514 0.0310 0.0086 0.0142 C4orf36 3'UTR

cg06034548 -0.3210 0.0571 0.0105 0.0157 C5orf27 Body

cg01983248 0.6482 -0.0636 0.0271 0.0481 C5orf28 5'UTR chr5:43483519-43484555 N_Shore


cg04657419 -0.5175 0.0348 0.0146 0.0370 C5orf43 3'UTR chr5:60457840-60458654 N_Shelf

cg02351082 -0.3303 0.0587 0.0288 0.0133 C5orf60 3'UTR

cg06192961 0.2227 -0.0386 0.0014 0.0103 C6orf10 Body

cg09931909 0.9990 -0.0706 0.0472 0.0452 C6orf150 Body chr6:74161086-74162090 N_Shore

cg04972856 0.7734 -0.0625 0.0387 0.0383 C6orf162 TSS1500;5'UTR;TSS1500 chr6:88032157-88032429 N_Shore

cg17731470 0.5361 -0.0482 0.0321 0.0163 C6orf25 Body;Body;Body;Body;Body;Body chr6:31691425-31691718 S_Shore

cg08092333 -0.6970 0.0460 0.0242 0.0353 C7orf27 Body chr7:2594724-2595538 N_Shelf

cg13544405 1.0793 -0.0756 0.0306 0.0251 C7orf29 1stExon;5'UTR;5'UTR;3'UTR


cg22277106 0.4076 -0.0441 0.0481 0.0014 C7orf50 Body;Body;Body;1stExon chr7:1097405-1097953 Island


cg02102080 0.6135 -0.0538 0.0068 0.0131 C8orf33 3'UTR chr8:146277254-146277491 S_Shelf

cg21926804 -0.3547 0.0585 0.0492 0.0101 C8orf74 Body

cg07337434 0.8949 -0.0749 0.0039 0.0061 C9orf135 TSS1500

cg01251476 -0.7385 0.0420 0.0473 0.0358 C9orf40 Body chr9:77566773-77568038 N_Shore

cg04517374 1.0510 -0.0869 0.0081 0.0360 CABLES2 Body chr20:60982405-60982780 N_Shore

cg05308117 -0.2622 0.0467 0.0207 0.0071 CABP5 TSS200

cg20099906 0.5321 -0.0568 0.0232 0.0433 CACNA1A Body;Body chr19:13346962-13347346 N_Shelf

cg24052239 0.4564 -0.0403 0.0003 0.0115 CACNA1F Body chrX:49087209-49087520 Island


cg27000853 -0.5709 0.0416 0.0403 0.0092 CACNA1H Body;Body chr16:1209939-1210945 S_Shore

cg16915733 0.6431 -0.0531 0.0373 0.0101 CADPS Body;Body;Body

cg22430036 -0.3595 0.0489 0.0065 0.0357 CALD1 Body;Body;Body;Body;Body

cg17832674 0.7860 -0.0369 0.0326 0.0499 CALM3 TSS1500 chr19:47103786-47104864 N_Shore

cg10509407 0.6344 -0.0632 0.0020 0.0161 CALN1 Body;Body

cg21078247 0.2977 -0.0393 0.0084 0.0025 CAMK2D Body;Body;Body;Body;Body;Body

cg01776391 1.0670 -0.0505 0.0032 0.0274 CAMKK1 Body;Body;Body chr17:3771284-3771676 Island

cg03865604 -0.3587 0.0398 0.0268 0.0215 CAMKK2 5'UTR;5'UTR;5'UTR;5'UTR;5'UTR;5'UTR;5'UTR

cg05998153 -0.4124 0.0305 0.0281 0.0187 CAMLG Body chr5:134074083-134074494 S_Shore

cg26251680 -0.1663 0.0337 0.0177 0.0395 CAMTA1 Body

cg12056772 -0.3916 0.0578 0.0186 0.0038 CANT1 3'UTR;3'UTR;3'UTR chr17:76989642-76990039 N_Shore

cg11427177 -0.3187 0.0463 0.0179 0.0229 CAPN3 TSS1500;Body;TSS1500;Body;Body;TSS1500

cg03704061 -0.2968 0.0342 0.0018 0.0325 CAPN9 1stExon;1stExon

cg10826045 0.9062 -0.0347 0.0118 0.0132 CAPNS1 5'UTR;5'UTR chr19:36630420-36631142 S_Shore

cg25106791 -0.4823 0.0482 0.0224 0.0030 CARD11 Body

cg02342906 1.2364 -0.0946 0.0222 0.0190 CASZ1 Body;Body

cg08484992 0.4872 -0.0747 0.0272 0.0481 CBFA2T3 5'UTR;Body chr16:88975850-88976169 S_Shore

cg05004142 0.6524 -0.0368 0.0091 0.0331 CCDC102A Body chr16:57562451-57563325 Island

cg13379763 -0.7261 0.0730 0.0339 0.0237 CCDC108 Body

cg05881753 0.6594 -0.0452 0.0246 0.0486 CCDC135 Body chr16:57759991-57760243 Island

cg03789597 -0.5144 0.0549 0.0016 0.0172 CCDC57 Body

cg26521278 -0.2950 0.0335 0.0049 0.0111 CCDC60 TSS1500 chr12:119772353-119772594 N_Shore

cg16313230 0.4626 -0.0353 0.0124 0.0231 CCDC87 1stExon chr11:66360097-66360834 N_Shelf

cg16750914 0.7173 -0.0326 0.0335 0.0346 CCDC88A 5'UTR;1stExon;1stExon;5'UTR chr2:55646621-55647329 Island

cg20451705 0.2823 -0.0382 0.0339 0.0254 CCDC88C Body

cg15374898 -0.6220 0.0839 0.0160 0.0314 CCHCR1 Body;Body;Body chr6:31125894-31126561 N_Shelf

cg16415785 0.9317 -0.0315 0.0068 0.0277 CCK 5'UTR chr3:42304944-42305311 Island

cg00803692 0.5982 -0.0466 0.0110 0.0211 CCR5 TSS200;TSS200

cg01477015 0.7248 -0.0309 0.0181 0.0161 CD19 Body chr16:28948000-28948450 Island

cg07980671 0.5076 -0.0305 0.0015 0.0122 CD2AP Body

cg21697512 0.4453 -0.0396 0.0085 0.0142 CD34 Body;Body chr1:208084098-208084513 N_Shelf

cg14479884 0.6425 -0.0679 0.0494 0.0452 CD36 5'UTR;1stExon;5'UTR;1stExon;5'UTR

cg02768785 -0.2987 0.0439 0.0345 0.0445 CD3EAP 3'UTR;Body;Body chr19:45909062-45910124 S_Shelf


cg01517776 0.6350 -0.0431 0.0402 0.0249 CD81 Body chr11:2417650-2417993 Island

cg09838701 0.8003 -0.0544 0.0150 0.0352 CD86 3'UTR;3'UTR

cg06507434 -0.3698 0.0416 0.0206 0.0037 CDC42BPG Body chr11:64596975-64597519 Island

cg15188688 -0.2350 0.0309 0.0170 0.0028 CDC45L Body chr22:19466308-19467811 S_Shore

cg01750200 0.9705 -0.0475 0.0183 0.0396 CDH13 Body

cg07895504 -0.3877 0.0719 0.0488 0.0472 CDH22 Body chr20:44806599-44806875 S_Shore

cg05140231 -0.2868 0.0396 0.0072 0.0050 CDH4 Body chr20:59965576-59965790 Island

cg04123347 0.8687 -0.1370 0.0021 0.0335 CDK16 Body;5'UTR;TSS200 chrX:47077163-47078637 S_Shelf

cg10231862 -0.5337 0.0364 0.0139 0.0138 CDKAL1 Body

cg16147336 1.4222 -0.0443 0.0358 0.0463 CDKN2C 5'UTR;TSS1500;1stExon chr1:51433762-51435505 Island

cg26867821 -0.5894 0.0339 0.0162 0.0077 CDV3 TSS200;TSS200;TSS1500 chr3:133292203-133292908 Island

cg21494337 1.2992 -0.0317 0.0199 0.0427 CENPO TSS1500;Body chr2:25015879-25016627 N_Shore

cg11639001 0.9934 -0.0715 0.0400 0.0049 CEP164 TSS1500 chr11:117198423-117198950 N_Shore

cg24865482 0.8755 -0.0569 0.0034 0.0222 CEP350 Body

cg08620313 -1.0126 0.0666 0.0080 0.0326 CES1 TSS1500;TSS1500;TSS1500 chr16:55866647-55866998 S_Shore

cg02447462 -0.6518 0.0531 0.0017 0.0181 CFD Body chr19:860517-862123 Island

cg21232015 -0.8342 0.0546 0.0385 0.0435 CHFR Body;Body;Body;Body;Body

cg02168925 0.6965 -0.0784 0.0041 0.0071 CHM Body;3'UTR

cg03062865 0.4232 -0.0486 0.0090 0.0137 CHMP1A Body;Body chr16:89723192-89724636 N_Shelf

cg13448968 -1.5292 0.1082 0.0134 0.0410 CHPF Body chr2:220406363-220406840 Island

cg05957190 0.3902 -0.0531 0.0262 0.0132 CHST11 Body

cg07399369 1.0263 -0.0424 0.0005 0.0070 CHST2 TSS1500 chr3:142837885-142840838 Island

cg12395205 1.3236 -0.0323 0.0061 0.0475 CIDEA Body;TSS200 chr18:12254147-12255089 Island

cg10669058 -0.4197 0.0517 0.0482 0.0316 CILP2 TSS1500 chr19:19648134-19649390 Island

cg27492942 0.5990 -0.0992 0.0100 0.0203 CISD3 TSS1500;3'UTR chr17:36886108-36886525 N_Shore

cg02690554 -0.6351 0.0401 0.0236 0.0125 CITED1 TSS1500;TSS1500 chrX:71524832-71527299 S_Shore

cg09125723 -0.3856 0.0339 0.0069 0.0330 CLASP1 3'UTR;3'UTR;3'UTR

cg14617014 0.4976 -0.0384 0.0357 0.0151 CLCA3P Body

cg11108456 0.4786 -0.0480 0.0125 0.0449 CLCN5 TSS1500;TSS1500 chrX:49687027-49687993 N_Shore

cg02882493 0.8957 -0.0686 0.0315 0.0370 CLCN7 Body;Body chr16:1507355-1507653 S_Shore

cg08199758 -0.6810 0.0497 0.0016 0.0132 CLDN9 TSS200 chr16:3063679-3063981 N_Shore

cg01130127 1.4244 -0.1219 0.0057 0.0133 CLEC11A 3'UTR chr19:51227661-51228883 Island

cg13026137 -0.2788 0.0300 0.0094 0.0152 CLIC1 Body chr6:31695894-31698245 S_Shelf


cg16006141 0.7105 -0.0382 0.0081 0.0246 CLIC4 3'UTR

cg15882878 1.2345 -0.2110 0.0294 0.0452 CLSTN3 TSS1500;TSS200

cg21088983 0.6363 -0.0645 0.0407 0.0381 CLVS1 TSS200

cg27344162 0.5610 -0.0441 0.0492 0.0290 CMIP Body;Body

cg15630394 0.9178 -0.0982 0.0206 0.0222 CMKLR1 TSS1500;5'UTR;5'UTR;5'UTR

cg09655403 0.3291 -0.0397 0.0494 0.0422 CMYA5 TSS200

cg02840828 -0.1881 0.0376 0.0274 0.0257 CNDP1 TSS200

cg26686932 0.6522 -0.0309 0.0035 0.0302 CNGA1 5'UTR;5'UTR

cg13859943 0.9257 -0.0988 0.0048 0.0330 CNKSR2 Body;Body chrX:21674018-21677066 N_Shelf

cg09882550 -0.2747 0.0344 0.0215 0.0173 CNOT6 TSS1500 chr5:179921201-179922179 N_Shore

cg09479341 0.4612 -0.0712 0.0021 0.0269 CNP Body chr17:40119811-40120047 Island

cg26456563 0.7925 -0.0566 0.0228 0.0032 CNTD2 3'UTR chr19:40728235-40728618 Island

cg11635155 0.7379 -0.0405 0.0408 0.0484 CNTN3 Body

cg11395306 0.5278 -0.0373 0.0374 0.0232 CNTN5 5'UTR;5'UTR

cg27405644 1.0143 -0.0604 0.0159 0.0022 CNTNAP1 TSS200;TSS1500 chr17:40834791-40835098 N_Shore

cg11070260 1.1662 -0.0661 0.0258 0.0485 COASY TSS200;TSS200;TSS200;TSS200;TSS200 chr17:40714087-40715282 N_Shore

cg18084609 -0.4475 0.0678 0.0373 0.0319 COCH Body;Body chr14:31343355-31344757 S_Shore

cg19628686 1.5536 -0.1465 0.0225 0.0257 COL11A2 Body;Body;Body;Body chr6:33159991-33160263 N_Shore

cg17453252 -0.2044 0.0378 0.0077 0.0300 COL4A2 Body chr13:110965774-110966223 N_Shore

cg18995182 1.7531 -0.1323 0.0290 0.0285 COL4A5 TSS1500;TSS1500;TSS1500;TSS1500;TSS200

cg26947474 0.6248 -0.0636 0.0208 0.0434 COL4A6 Body;Body

cg03384959 -0.6739 0.0611 0.0203 0.0209 COL6A3 Body;Body;Body;Body;Body

cg00762069 0.5215 -0.0331 0.0149 0.0125 COL6A4P2 Body chr3:129982745-129983090 S_Shelf

cg20682720 0.5652 -0.0403 0.0088 0.0421 COL9A1 3'UTR;3'UTR

cg18753958 -0.8709 0.1238 0.0041 0.0027 COL9A3 TSS1500 chr20:61447685-61448891 N_Shore

cg22974630 0.7299 -0.0873 0.0493 0.0077 COPZ1 Body

cg08822732 0.5727 -0.0378 0.0208 0.0232 COQ3 Body chr6:99841661-99842146 N_Shelf

cg07053699 0.9466 -0.1034 0.0045 0.0354 COX6A2 TSS1500 chr16:31438891-31439682 S_Shore

cg26230601 -0.5780 0.0467 0.0223 0.0041 CPN2 TSS200

cg08565632 0.6168 -0.0712 0.0247 0.0253 CPNE7 Body;Body chr16:89650792-89651058 Island

cg06891533 -0.9945 0.0730 0.0075 0.0089 CPSF1 Body chr8:145622979-145623325 Island

cg23026906 -0.1747 0.0301 0.0244 0.0405 CR1L Body chr1:207818389-207818952 S_Shore

cg03734660 0.7088 -0.0350 0.0031 0.0295 CRABP2 5'UTR;1stExon chr1:156674858-156676654 Island


cg05151055 0.6015 -0.0437 0.0148 0.0318 CREBBP Body;Body chr16:3776134-3776548 S_Shore

cg16424311 0.6538 -0.0579 0.0230 0.0021 CRISP3 Body

cg16106368 -1.0266 0.0327 0.0123 0.0065 CRMP1 Body;TSS200 chr4:5889203-5890645 Island

cg07472953 1.5954 -0.0905 0.0289 0.0442 CSF3 TSS1500;TSS1500;TSS1500

cg13619522 -1.1202 0.2022 0.0029 0.0117 CSK 3'UTR;3'UTR chr15:75095349-75095560 N_Shore

cg19884629 0.7380 -0.0390 0.0130 0.0470 CSMD1 Body

cg21917532 0.9683 -0.0644 0.0037 0.0318 CSMD3 Body;Body chr8:114444826-114445085 S_Shelf

cg24598020 1.1372 -0.0970 0.0237 0.0366 CSNK1A1 Body;Body chr5:148930249-148931244 N_Shore

cg20281729 0.5420 -0.0432 0.0114 0.0402 CSNK2B Body chr6:31632815-31634093 S_Shore

cg24665612 0.7092 -0.0315 0.0333 0.0241 CT45A6 TSS1500

cg04653469 -0.5463 0.0340 0.0103 0.0020 CTBP1 Body;Body chr4:1233872-1234420 N_Shore

cg19923114 0.5984 -0.0385 0.0431 0.0080 CTNNA2 Body;Body

cg14453321 0.4853 -0.0416 0.0203 0.0031 CTPS2 Body;Body;TSS200;Body

cg20858526 -0.3838 0.0518 0.0023 0.0001 CTRC Body

cg18738367 -0.2875 0.0462 0.0249 0.0107 CTSH TSS1500;TSS1500 chr15:79237040-79237571 S_Shore

cg24873880 0.5315 -0.0364 0.0355 0.0092 CUGBP2 Body;Body

cg13300744 -0.5500 0.0442 0.0074 0.0342 CUX2 Body

cg01257799 -0.3815 0.0554 0.0354 0.0302 CXCR5 TSS1500

cg10064814 -0.2947 0.0560 0.0406 0.0140 CXorf40B Body

cg13929206 -0.2332 0.0397 0.0331 0.0498 CXorf58 5'UTR;5'UTR;TSS1500;TSS1500 chrX:23925590-23926315 S_Shore

cg14871225 -1.1558 0.0743 0.0369 0.0370 CXXC5 5'UTR chr5:139040819-139041028 Island

cg25917853 0.7756 -0.0341 0.0189 0.0310 CYB5R4 TSS1500 chr6:84569263-84569619 N_Shore

cg02723913 0.7020 -0.0489 0.0044 0.0177 CYFIP1 Body;Body

cg23462242 -0.6709 0.0559 0.0275 0.0453 CYFIP2 TSS200;5'UTR;5'UTR chr5:156692812-156693749 S_Shelf

cg16445268 -0.5523 0.0810 0.0022 0.0135 CYP26A1 Body;Body chr10:94833272-94835256 S_Shore

cg06122697 -0.6456 0.0618 0.0069 0.0101 CYP26B1 Body

cg07750118 -0.6192 0.0324 0.0409 0.0182 CYP2F1 Body chr19:41630485-41630794 S_Shore

cg10896827 -0.4254 0.0403 0.0167 0.0090 CYP4V2 3'UTR

cg26040060 0.4408 -0.0312 0.0285 0.0173 CYTH1 Body;Body

cg25044524 0.4638 -0.0655 0.0271 0.0368 CYTSB Body;TSS1500;TSS1500;Body chr17:20059028-20060060 N_Shore

cg14190522 -0.6965 0.0881 0.0019 0.0215 DAB2IP Body

cg06437799 0.4529 -0.0643 0.0262 0.0234 DAP3 5'UTR;5'UTR;TSS1500;TSS1500 chr1:155657832-155659125 S_Shore

cg09357934 -0.2383 0.0320 0.0008 0.0106 DAPL1 1stExon


cg24513883 -0.8427 0.0406 0.0153 0.0155 DAXX 5'UTR;Body;Body;5'UTR chr6:33290370-33291087 Island

cg09439260 0.8296 -0.0376 0.0234 0.0462 DAZL Body chr3:16645948-16646259 N_Shore

cg26900724 0.5203 -0.0359 0.0326 0.0141 DBN1 TSS1500

cg08442088 -0.6065 0.0451 0.0207 0.0417 DBNL Body;Body;Body chr7:44084106-44084747 S_Shore

cg23004409 -0.5176 0.0807 0.0031 0.0455 DCAKD 5'UTR;5'UTR chr17:43128789-43129038 N_Shore

cg18969798 0.4625 -0.0349 0.0163 0.0029 DCLK2 Body;Body

cg21596858 0.4046 -0.0415 0.0075 0.0060 DCST1 Body;TSS1500;Body

cg02999755 0.8725 -0.0505 0.0485 0.0333 DCUN1D5 TSS1500 chr11:102962274-102963049 S_Shore

cg14293129 0.4656 -0.0776 0.0222 0.0441 DDAH2 Body chr6:31695894-31698245 Island

cg23587005 0.8881 -0.0395 0.0211 0.0003 DDX12 TSS200 chr12:9600415-9601259 Island

cg26055054 0.5962 -0.0376 0.0077 0.0013 DDX26B TSS1500 chrX:134655102-134655750 N_Shore

cg07089660 0.5888 -0.0619 0.0038 0.0016 DEFA4 5'UTR

cg12279138 -0.2794 0.0346 0.0076 0.0424 DEGS1 TSS1500;TSS1500 chr1:224370585-224371755 N_Shore

cg26141291 -0.4004 0.0567 0.0079 0.0090 DENND3 Body

cg25496104 -0.5882 0.0438 0.0411 0.0381 DERA 3'UTR

cg04206724 -0.3021 0.0433 0.0045 0.0443 DEXI 3'UTR

cg18249027 -0.4738 0.0334 0.0043 0.0302 DGKI Body chr7:137531125-137532382 N_Shelf

cg10519492 0.6693 -0.0326 0.0036 0.0063 DHX16 TSS200;TSS200 chr6:30640431-30640853 S_Shore

cg10625504 0.5283 -0.0380 0.0022 0.0216 DHX30 5'UTR;5'UTR chr3:47844121-47845155 S_Shelf

cg08368055 -0.2574 0.0414 0.0024 0.0003 DHX38 5'UTR;TSS1500 chr16:72127129-72127341 S_Shore

cg16762195 0.8409 -0.0321 0.0037 0.0018 DHX58 TSS200

cg24949196 -0.6067 0.0624 0.0239 0.0349 DIAPH3 3'UTR

cg25539589 0.8094 -0.0584 0.0095 0.0179 DIP2A


0;TSS1500;TSS1500 chr21:47878070-47879576 N_Shore

cg02061711 1.0511 -0.1619 0.0103 0.0014 DIP2C Body

cg09307104 0.9141 -0.0340 0.0213 0.0127 DLG3 1stExon chrX:69665102-69665355 Island

cg23566401 0.5980 -0.0504 0.0147 0.0294 DLG4 1stExon;Body;5'UTR chr17:7123038-7123718 N_Shelf

cg04119909 -0.5718 0.0863 0.0009 0.0130 DLG5 Body

cg27602828 0.5440 -0.0503 0.0346 0.0385 DLGAP1 TSS200;Body

cg16268546 0.7704 -0.0453 0.0398 0.0100 DLGAP2 3'UTR chr8:1649439-1649759 S_Shore

cg11951427 0.4359 -0.0391 0.0015 0.0240 DLGAP3 Body chr1:35350878-35351854 S_Shore

cg12308746 0.4317 -0.0442 0.0283 0.0004 DLX1 Body;Body chr2:172952809-172953160 N_Shore

cg27136740 0.5709 -0.0309 0.0375 0.0210 DLX2 Body chr2:172964762-172967857 Island


cg18544329 0.5835 -0.0319 0.0300 0.0068 DLX5 TSS200 chr7:96653467-96654199 Island

cg04599026 0.5745 -0.0337 0.0273 0.0192 DLX6AS Body;TSS1500 chr7:96634622-96634915 Island

cg14457908 -0.4542 0.0418 0.0159 0.0263 DMP1 3'UTR;3'UTR

cg12743974 0.4615 -0.0324 0.0176 0.0319 DNAH11 Body

cg06951011 -0.8361 0.0445 0.0331 0.0456 DNAH3 Body

cg03062166 -1.0319 0.0685 0.0001 0.0092 DNAI1 TSS200;TSS200 chr9:34457375-34458892 Island

cg14645317 -1.0124 0.0573 0.0494 0.0358 DNAJB5 TSS1500;TSS1500;TSS1500 chr9:34989555-34989875 N_Shore

cg06635715 0.8567 -0.0404 0.0168 0.0370 DNAJC1 Body

cg17689490 0.7480 -0.0378 0.0033 0.0028 DOCK1 Body;Body

cg20036377 0.5812 -0.0373 0.0373 0.0129 DOCK5 Body

cg05090137 0.7426 -0.0496 0.0354 0.0408 DOK7 Body;Body chr4:3475058-3475360 N_Shelf

cg13259605 0.8371 -0.0433 0.0027 0.0250 DPM2 5'UTR;1stExon chr9:130699759-130700266 Island

cg12666279 -0.6557 0.0312 0.0438 0.0375 DPP10 TSS1500;Body chr2:115918737-115920765 Island

cg26441097 -0.7171 0.0939 0.0024 0.0120 DPPA4 Body

cg19477942 -0.8226 0.0426 0.0067 0.0457 DSCAM Body

cg03761952 0.6758 -0.0442 0.0054 0.0083 DSG4 1stExon;1stExon;5'UTR;5'UTR

cg07991100 0.7039 -0.0497 0.0305 0.0324 DTHD1 TSS200

cg13862271 0.6628 -0.0325 0.0317 0.0306 DTX4 Body

cg18088242 0.9096 -0.0341 0.0358 0.0032 DUOX1 5'UTR;TSS1500;5'UTR chr15:45421236-45422394 Island

cg05371885 1.4052 -0.0770 0.0015 0.0061 DUSP22 3'UTR

cg02107163 0.5856 -0.0322 0.0483 0.0429 DUSP28 5'UTR;1stExon chr2:241499582-241500785 Island

cg15089090 0.7785 -0.0324 0.0128 0.0472 DUSP7 Body chr3:52089652-52090845 N_Shore

cg05085049 0.6765 -0.0378 0.0469 0.0461 DUSP9 5'UTR chrX:152909502-152910069 Island

cg16398957 -0.4355 0.0304 0.0290 0.0217 DYNC1H1 Body

cg01238502 0.6185 -0.0323 0.0405 0.0123 DYNLL1 Body;Body;Body chr12:120933649-120934713 S_Shore

cg07056057 -0.4743 0.0354 0.0497 0.0366 DYNLL2 TSS1500 chr17:56160754-56161494 N_Shore

cg07070273 0.7601 -0.0367 0.0103 0.0382 DYNLRB2 3'UTR

cg22079271 -0.5269 0.0339 0.0034 0.0189 ECEL1 Body chr2:233350278-233352974 N_Shelf

cg20052010 0.7312 -0.0336 0.0160 0.0436 EFEMP1 Body;Body;Body

cg14874936 0.4361 -0.0317 0.0314 0.0377 EFNA5 Body

cg01107476 0.5650 -0.0359 0.0124 0.0188 EGR1 3'UTR chr5:137803095-137803333 S_Shore

cg16391101 -0.7469 0.0468 0.0004 0.0021 EHMT1 3'UTR chr9:140728478-140729896 Island

cg21190306 -0.3968 0.0379 0.0260 0.0122 EHMT2 Body;Body chr6:31864897-31865419 N_Shore


cg06753055 0.4888 -0.0328 0.0044 0.0291 EIF2AK4 Body chr15:40226210-40226631 S_Shelf

cg07752613 -0.3632 0.0342 0.0465 0.0339 EIF2C2 Body;Body

cg06206086 -1.0724 0.0936 0.0075 0.0323 EIF2C3 5'UTR;Body

cg20110780 1.9427 -0.1314 0.0003 0.0091 EIF3E TSS200 chr8:109260526-109261127 Island

cg08456754 -0.2829 0.0305 0.0423 0.0004 EIF3G Body chr19:10226164-10226702 Island

cg14153321 0.6299 -0.0334 0.0148 0.0157 EIF3L Body chr22:38245341-38245681 S_Shore

cg17324095 -0.6638 0.0988 0.0093 0.0266 ELFN1 5'UTR chr7:1784027-1786934 N_Shore

cg19781013 0.6536 -0.0314 0.0005 0.0039 ELP3 TSS1500 chr8:27950470-27950868 N_Shore

cg06350544 0.6076 -0.0788 0.0206 0.0457 EMP3 Body chr19:48833394-48833720 Island

cg08050360 1.3142 -0.1256 0.0008 0.0145 EN1 TSS200 chr2:119606038-119606313 N_Shore

cg25975818 1.1219 -0.0668 0.0042 0.0144 ENPP7 TSS1500

cg02103653 0.6645 -0.0386 0.0403 0.0476 EPB41L4A Body

cg15882566 -0.3383 0.0541 0.0390 0.0087 EPB42 Body;Body

cg13587495 0.3801 -0.0461 0.0026 0.0379 EPHA3 3'UTR;Body

cg23658326 1.7155 -0.0594 0.0104 0.0161 EPM2AIP1

5'UTR;TSS1500;TSS1500;TSS1500;TSS200;1s

tExon chr3:37034228-37035356 Island

cg10503037 0.8090 -0.0468 0.0305 0.0108 EPRS Body chr1:220219416-220219824 N_Shore

cg17875320 0.3966 -0.0362 0.0445 0.0264 EPS8L3 TSS1500;TSS1500;TSS1500

cg05616959 0.8241 -0.0568 0.0239 0.0344 ERC2 Body

cg08678898 0.3999 -0.0352 0.0355 0.0157 ERF Body chr19:42757495-42759475 Island

cg26952936 -0.2280 0.0512 0.0242 0.0362 ERN2 TSS200 chr16:23724270-23724775 S_Shore

cg25015465 -0.5576 0.0380 0.0349 0.0283 ESRRB Body chr14:76957865-76958074 Island

cg01432520 0.9934 -0.0820 0.0288 0.0380 ESRRG 5'UTR;5'UTR;5'UTR

cg21535580 0.2286 -0.0455 0.0263 0.0316 ETNK2 TSS1500 chr1:204120398-204121109 S_Shore

cg22387575 -0.4479 0.0410 0.0099 0.0376 ETV7 3'UTR

cg00196414 1.2640 -0.0828 0.0004 0.0142 EVX2 Body chr2:176944087-176948446 Island

cg14495958 -0.2996 0.0402 0.0371 0.0483 EXD3 5'UTR chr9:140301338-140301826 N_Shore

cg01890435 0.4336 -0.0487 0.0074 0.0489 EXOC3 TSS1500;3'UTR;1stExon chr5:442820-443604 N_Shore

cg03526652 1.0768 -0.0591 0.0207 0.0418 EXOC6B Body

cg17800649 -0.4644 0.0307 0.0003 0.0128 EXOSC10 Body;Body chr1:11159387-11160136 Island

cg04066177 0.8132 -0.0662 0.0060 0.0421 FABP9 TSS1500

cg06096805 0.4114 -0.0393 0.0394 0.0384 FAM102A TSS1500 chr9:130742515-130743486 S_Shore

cg18931398 0.8932 -0.0651 0.0198 0.0211 FAM102B Body


cg00811565 0.4583 -0.0503 0.0314 0.0197 FAM159B TSS1500 chr5:63986189-63986974 N_Shore

cg21313962 -0.7761 0.0366 0.0339 0.0173 FAM160B2 Body

cg12094006 -0.9538 0.0401 0.0011 0.0271 FAM167A TSS200 chr8:11323779-11324697 Island

cg03502562 -0.8317 0.0742 0.0011 0.0190 FAM175B Body chr10:126490161-126490934 S_Shore

cg00088507 -0.7819 0.0379 0.0049 0.0410 FAM189A1 Body

cg19045983 -0.5252 0.0317 0.0021 0.0201 FAM18B2 Body;Body chr17:15466359-15466843 Island

cg17769199 0.4191 -0.0362 0.0425 0.0090 FAM197Y2 TSS1500 chrY:9193597-9194776 N_Shore

cg11020853 -0.2010 0.0428 0.0177 0.0341 FAM198A TSS200 chr3:43020702-43021354 N_Shore

cg04382374 0.3220 -0.0421 0.0133 0.0349 FAM19A5 Body;Body

cg02603662 -0.8501 0.0568 0.0002 0.0070 FAM38A Body chr16:88803802-88804112 N_Shelf

cg22942908 0.3628 -0.0545 0.0337 0.0176 FAM40A Body chr1:110577199-110577942 S_Shore

cg07765262 0.5101 -0.0691 0.0363 0.0237 FAM53A Body chr4:1645886-1646324 Island

cg08901593 0.3299 -0.0500 0.0487 0.0427 FAM5B Body

cg20497803 0.8733 -0.0437 0.0377 0.0487 FAM83B 5'UTR chr6:54711153-54712033 Island

cg17199320 -0.8891 0.0372 0.0095 0.0030 FAM89A TSS1500 chr1:231176785-231177009 Island

cg22172517 0.9077 -0.0536 0.0008 0.0165 FAM9A TSS1500;TSS1500 chrX:8769177-8769559 S_Shore

cg10492417 -0.3951 0.0350 0.0013 0.0232 FANCA Body

cg14222432 0.9434 -0.0545 0.0127 0.0095 FAR2 TSS200

cg03673225 0.7496 -0.0517 0.0038 0.0294 FARP1 Body

cg08193821 0.5778 -0.0401 0.0382 0.0050 FARS2 Body

cg14797580 0.6479 -0.0486 0.0258 0.0062 FASN Body chr17:80054171-80054392 N_Shore

cg22011804 0.3161 -0.0436 0.0416 0.0201 FASTK TSS1500;Body;Body;TSS1500 chr7:150777607-150780879 Island

cg26031678 -0.2591 0.0403 0.0020 0.0150 FBLN2 Body;Body;Body chr3:13611923-13612435 S_Shore

cg21011649 0.2407 -0.0360 0.0416 0.0072 FBN1 Body

cg03621470 0.9013 -0.0696 0.0087 0.0459 FBRSL1 Body chr12:133136392-133137480 Island

cg24327472 0.8405 -0.0554 0.0181 0.0348 FBXO16 TSS1500 chr8:28351456-28352560 N_Shelf

cg15746187 0.3145 -0.0520 0.0075 0.0046 FBXO2 Body;TSS1500 chr1:11714217-11715304 N_Shore

cg06109876 -0.4136 0.0392 0.0434 0.0047 FBXO32 TSS1500;Body

cg04853218 -0.2913 0.0429 0.0001 0.0044 FBXO34 5'UTR;5'UTR

cg20107840 0.6957 -0.0317 0.0047 0.0375 FBXO45 3'UTR

cg00479908 0.4336 -0.0353 0.0188 0.0141 FBXO46 Body chr19:46214961-46216180 Island

cg26740942 0.5522 -0.0430 0.0042 0.0394 FBXO47 TSS200

cg24783510 0.5644 -0.0582 0.0113 0.0193 FCHO1 5'UTR;TSS200;TSS200;5'UTR chr19:17858371-17858891 S_Shelf


cg08786003 0.7873 -0.0590 0.0118 0.0445 FCRL3 TSS200

cg12906303 0.4831 -0.0325 0.0497 0.0228 FEZ1 Body

cg11902408 -0.1791 0.0324 0.0033 0.0081 FGD5 TSS1500

cg20684197 0.5212 -0.0428 0.0064 0.0474 FGF1 5'UTR;5'UTR;TSS1500;TSS1500;Body;Body

cg02302670 -0.5599 0.0558 0.0384 0.0164 FGF17 Body chr8:21905461-21905757 N_Shore

cg13422817 0.4028 -0.0316 0.0444 0.0267 FGF6 Body chr12:4554405-4554624 N_Shelf

cg16248277 -0.4878 0.0494 0.0085 0.0298 FGF8 TSS1500;TSS1500;TSS1500;TSS1500 chr10:103535636-103536505 Island

cg02826685 0.5534 -0.0343 0.0139 0.0239 FGFRL1 Body;Body;Body chr4:1005930-1006282 S_Shelf

cg10055277 -0.1921 0.0396 0.0009 0.0055 FHAD1 Body

cg23737061 0.7965 -0.0882 0.0212 0.0260 FHIT Body;Body

cg06626224 0.5662 -0.0337 0.0064 0.0165 FIZ1 TSS1500;TSS1500 chr19:56111498-56112063 Island

cg23801475 -1.2387 0.0781 0.0006 0.0081 FKBP2 5'UTR;TSS200;5'UTR chr11:64008283-64009487 Island

cg11609631 0.5170 -0.0389 0.0037 0.0283 FLI1 3'UTR;3'UTR chr11:128680332-128680543 S_Shelf

cg26829758 -0.7416 0.0650 0.0305 0.0255 FLJ22536 Body

cg26600181 1.1372 -0.0834 0.0074 0.0133 FLJ36777 TSS200

cg06534376 -0.6117 0.0604 0.0206 0.0387 FLOT1 Body chr6:30710307-30712440 N_Shore

cg13263274 0.6007 -0.0433 0.0174 0.0466 FLRT1 Body;Body chr11:63885581-63885788 Island

cg06485114 1.2022 -0.0875 0.0045 0.0122 FLT4 Body;Body chr5:180045789-180048897 Island

cg15007623 -0.5005 0.0327 0.0274 0.0326 FMN2 Body chr1:240370859-240371526 S_Shore

cg26204803 -0.3624 0.0349 0.0051 0.0180 FMNL2 Body

cg09425262 -0.7328 0.0418 0.0033 0.0313 FMR1NB TSS200 chrX:147062671-147062917 Island

cg15367592 -0.3817 0.0485 0.0232 0.0092 FOLR3 TSS1500

cg24397007 -0.7294 0.0818 0.0241 0.0016 FOSL2 Body chr2:28612964-28616748 S_Shelf

cg09200221 0.8291 -0.0762 0.0142 0.0082 FOXK1 Body

cg11779900 0.5542 -0.0302 0.0378 0.0449 FOXK2 Body

cg16384774 -0.8127 0.0427 0.0344 0.0023 FOXN3 3'UTR;3'UTR chr14:89628885-89629199 N_Shore

cg04784898 -0.2553 0.0506 0.0281 0.0495 FOXN4 Body chr12:109729572-109729826 N_Shelf

cg13680696 0.9974 -0.0487 0.0236 0.0020 FRAT2 3'UTR;1stExon chr10:99093406-99094955 N_Shore

cg27180636 0.5014 -0.0570 0.0480 0.0051 FRG2C 3'UTR chr3:75718116-75719159 N_Shelf

cg15803756 -0.6519 0.0339 0.0067 0.0302 FRMD4A Body chr10:13933482-13934184 N_Shore

cg22828061 -0.5759 0.0543 0.0327 0.0375 FUT8 TSS1500;TSS1500 chr14:65878486-65880370 N_Shelf

cg17000199 0.5807 -0.0774 0.0171 0.0194 FUT9 5'UTR chr6:96463869-96464136 S_Shore

cg07158339 0.3780 -0.0704 0.0078 0.0054 FXN TSS1500;TSS1500;TSS1500 chr9:71650646-71651176 N_Shore


cg07780528 0.7121 -0.0656 0.0313 0.0369 FXYD1 5'UTR;TSS200 chr19:35632356-35632572 N_Shelf

cg25424600 0.7746 -0.0357 0.0022 0.0123 FYB 3'UTR;3'UTR

cg26129669 -0.3058 0.0643 0.0027 0.0049 GABBR1 Body;Body;Body chr6:29595298-29595795 N_Shore

cg21242208 0.6550 -0.0675 0.0268 0.0220 GABRB2 Body;Body chr5:160974692-160975384 N_Shelf

cg00206332 0.2065 -0.0325 0.0149 0.0110 GABRE Body chrX:151142680-151143555 N_Shore

cg25295063 1.0615 -0.0495 0.0111 0.0449 GADD45B TSS1500 chr19:2474610-2476828 Island

cg21452538 0.7787 -0.0379 0.0015 0.0304 GAK Body chr4:870695-870969 Island

cg00988350 -0.4635 0.0661 0.0335 0.0159 GALE 5'UTR;1stExon;5'UTR;5'UTR chr1:24126799-24127549 N_Shore

cg15448736 0.9450 -0.0500 0.0094 0.0101 GALNT9 Body;Body chr12:132853943-132854190 N_Shore

cg11734841 0.6059 -0.0494 0.0281 0.0291 GAS7 Body

cg06839377 0.3856 -0.0537 0.0008 0.0032 GBF1 TSS1500 chr10:104005139-104005592 N_Shore

cg16476432 -0.2459 0.0365 0.0134 0.0051 GCK TSS1500

cg03309176 1.1205 -0.1291 0.0046 0.0157 GEFT TSS1500;TSS200 chr12:58003880-58004249 N_Shore

cg17896463 0.3545 -0.0324 0.0417 0.0191 GEMIN7 TSS1500;TSS1500;TSS1500 chr19:45582337-45582936 N_Shore

cg13085470 0.5439 -0.0537 0.0005 0.0043 GFER TSS1500 chr16:2033492-2034800 Island

cg14633783 0.8717 -0.0308 0.0202 0.0499 GFRA2 1stExon;5'UTR;1stExon;5'UTR;1stExon;5'UTR chr8:21644908-21647845 Island

cg11828203 -0.1531 0.0361 0.0115 0.0499 GHRHR Body;Body

cg18538812 -0.1769 0.0306 0.0324 0.0052 GIF TSS1500

cg16905207 0.4203 -0.0414 0.0013 0.0276 GIPC1 Body;5'UTR;5'UTR;Body;5'UTR;Body chr19:14591032-14591308 S_Shelf

cg06088858 0.4040 -0.0468 0.0105 0.0198 GJB4 TSS1500 chr1:35227028-35227276 N_Shelf

cg09157127 0.6996 -0.0600 0.0205 0.0181 GKN1 TSS1500

cg14864999 0.9172 -0.0619 0.0217 0.0099 GLCE 3'UTR

cg13588086 0.5163 -0.0670 0.0040 0.0122 GLDC Body chr9:6645080-6645975 N_Shore

cg16248554 -0.5261 0.0491 0.0006 0.0089 GLI2 Body

cg04304216 0.7507 -0.0404 0.0057 0.0068 GLS Body

cg15474999 0.7616 -0.0653 0.0146 0.0341 GLT25D1 Body chr19:17666192-17666978 S_Shelf

cg14585174 0.6889 -0.0478 0.0169 0.0179 GLT6D1 3'UTR

cg19248242 0.7873 -0.0469 0.0225 0.0109 GNA11 Body chr19:3094671-3095055 Island

cg14219599 0.9286 -0.0303 0.0149 0.0025 GNL1 Body;TSS1500;TSS1500 chr6:30523286-30523519 Island

cg09817993 1.3949 -0.1082 0.0122 0.0010 GNL3 TSS1500;5'UTR;TSS1500;TSS1500 chr3:52719934-52720335 N_Shore

cg06242751 0.8531 -0.0538 0.0229 0.0023 GOLGA3 Body chr12:133349663-133349998 S_Shore

cg01095157 -0.4440 0.0662 0.0156 0.0284 GORASP2 TSS1500 chr2:171785474-171786399 N_Shore

cg03952248 0.4141 -0.0629 0.0160 0.0399 GPATCH3 TSS1500 chr1:27226492-27227009 S_Shore


cg01390346 0.6503 -0.0493 0.0048 0.0014 GPBP1 TSS200;TSS200 chr5:56469018-56470521 Island

cg22998749 0.6116 -0.0333 0.0033 0.0180 GPC6 Body

cg20423693 0.3421 -0.0417 0.0367 0.0488 GPM6A 5'UTR;Body

cg01061553 -1.1684 0.0824 0.0027 0.0078 GPN3 Body;Body;Body chr12:110887861-110888245 S_Shelf

cg05220599 0.4576 -0.0521 0.0049 0.0014 GPR123 3'UTR chr10:134944511-134944792 Island

cg23843100 -0.5847 0.0368 0.0020 0.0054 GPR126 Body;Body;Body;Body chr6:142622583-142623453 S_Shelf

cg14359680 -0.4897 0.0339 0.0292 0.0091 GPR132 TSS1500

cg08943696 -0.5908 0.0450 0.0164 0.0248 GPR133 TSS1500

cg13074682 0.4920 -0.0345 0.0093 0.0257 GPR176 Body

cg01859669 -0.1980 0.0343 0.0014 0.0192 GPR31 TSS200

cg27450557 0.4050 -0.0362 0.0474 0.0011 GPR37L1 TSS1500

cg19254163 0.2160 -0.0408 0.0490 0.0420 GPR44 TSS1500 chr11:60619924-60621111 S_Shelf

cg19755435 0.8616 -0.0537 0.0256 0.0151 GPR65 5'UTR

cg01768433 0.8892 -0.0602 0.0067 0.0024 GPR98 Body;Body

cg14489965 -0.6431 0.0568 0.0006 0.0170 GPSM1 Body;Body chr9:139255523-139256012 N_Shelf

cg23788628 1.0126 -0.0521 0.0197 0.0066 GPX5 Body;3'UTR

cg20561261 0.3948 -0.0584 0.0106 0.0146 GRB2 3'UTR;3'UTR

cg23285393 0.4661 -0.0429 0.0033 0.0330 GREB1 Body chr2:11732841-11733303 S_Shelf

cg20306837 1.2169 -0.0595 0.0267 0.0052 GRIA4 Body;Body;Body;Body chr11:105481126-105481422 S_Shore

cg06855422 0.6999 -0.0550 0.0426 0.0403 GRID2 Body

cg00534626 0.8107 -0.0634 0.0203 0.0018 GRIN2A Body;Body;Body

cg11277090 0.2782 -0.0476 0.0360 0.0111 GRIN2C Body chr17:72848166-72848901 N_Shore

cg05141026 0.3792 -0.0316 0.0157 0.0221 GRINA 5'UTR;5'UTR chr8:145063919-145065386 Island

cg05572003 0.3644 -0.0313 0.0090 0.0056 GRK6 Body;Body;Body chr5:176863062-176863266 S_Shelf

cg00986191 0.4864 -0.0629 0.0401 0.0110 GRM6 Body chr5:178421225-178422337 N_Shore

cg13054613 0.5964 -0.0616 0.0419 0.0009 GRM7 Body;3'UTR

cg14184077 0.5236 -0.0342 0.0081 0.0007 GRXCR1 1stExon

cg00671823 -0.3354 0.0642 0.0143 0.0174 GTF3C1 Body chr16:27560979-27561560 N_Shelf

cg01285164 0.8500 -0.0348 0.0452 0.0305 GXYLT2 TSS1500

cg07156296 0.6433 -0.0397 0.0123 0.0474 HADH Body chr4:108910770-108911370 Island

cg03324101 0.5149 -0.0466 0.0194 0.0083 HAP1 TSS1500;TSS1500;TSS1500 chr17:39889956-39891489 S_Shore

cg25315287 1.0509 -0.0413 0.0442 0.0461 HAUS5 TSS200 chr19:36103554-36103804 N_Shore

cg26432088 -0.3611 0.0634 0.0071 0.0424 HAVCR1 TSS1500;TSS1500


cg01598642 0.9033 -0.0589 0.0142 0.0348 HBG1 TSS1500

cg10322499 0.9023 -0.0668 0.0037 0.0006 HBXIP TSS1500 chr1:110949892-110950540 S_Shore

cg01126821 0.2076 -0.0362 0.0231 0.0225 HCCA2 Body;TSS1500

cg24711407 0.7893 -0.0350 0.0160 0.0473 HCCS TSS1500;TSS1500 chrX:11129276-11129758 N_Shore

cg08276565 -0.8559 0.1234 0.0122 0.0086 HCG18 TSS1500;5'UTR;5'UTR;TSS1500 chr6:30294169-30295071 S_Shore

cg04875977 -0.5439 0.0856 0.0123 0.0015 HCN2 Body chr19:615691-623505 Island

cg05933219 0.7689 -0.0308 0.0214 0.0079 HDAC4 Body chr2:240100625-240100852 N_Shore

cg03847432 0.6467 -0.0484 0.0355 0.0246 HECW1 Body

cg00510111 0.2569 -0.0301 0.0329 0.0157 HECW2 TSS1500 chr2:197457392-197458522 Island

cg09995631 -0.6024 0.0460 0.0104 0.0055 HERC2 Body

cg07846755 -0.7511 0.0339 0.0306 0.0023 HES1 TSS1500 chr3:193852241-193852717 Island

cg24127874 -0.7272 0.0380 0.0078 0.0155 HES6 TSS1500;TSS1500 chr2:239147592-239149900 Island

cg00987513 -0.2591 0.0447 0.0057 0.0278 HFE2 1stExon;5'UTR;5'UTR;1stExon;1stExon;5'UTR;5'UTR;1stExonchr1:145415411-145415708 N_Shelf

cg22858008 0.6765 -0.0520 0.0293 0.0369 HGC6.3 1stExon;5'UTR chr6:168377416-168377724 Island

cg04413153 -0.4456 0.0468 0.0437 0.0297 HHEX TSS1500 chr10:94448693-94450479 Island

cg25703243 1.3548 -0.1622 0.0068 0.0145 HHIP Body chr4:145566242-145567413 S_Shore

cg02075822 0.5056 -0.0319 0.0339 0.0136 HIP1 Body chr7:75368062-75369078 N_Shelf

cg23478350 -0.5981 0.0402 0.0491 0.0309 HIP1R Body

cg01023668 0.6152 -0.0330 0.0127 0.0252 HIPK1 TSS1500;TSS1500 chr1:114471965-114472899 N_Shore

cg09379385 0.3461 -0.0348 0.0036 0.0184 HIST1H2AI TSS1500 chr6:27775329-27776258 N_Shore

cg19514765 0.7371 -0.0382 0.0418 0.0313 HIST1H2BN TSS1500;1stExon;3'UTR chr6:27805843-27806853 N_Shore

cg13836098 0.5285 -0.0688 0.0233 0.0164 HIST1H3E TSS200 chr6:26225386-26225790 N_Shore

cg19268652 0.5806 -0.0465 0.0294 0.0327 HIVEP1 Body

cg19170991 -0.4991 0.0459 0.0081 0.0024 HK1 Body;Body;Body;Body;Body

cg26281025 -0.7192 0.0632 0.0006 0.0140 HK3 3'UTR chr5:176304965-176305166 S_Shelf

cg12291348 0.2710 -0.0339 0.0194 0.0357 HLA-C Body chr6:31238852-31240120 Island

cg22324029 -0.2990 0.0452 0.0438 0.0254 HLA-DMB Body

cg01200893 0.5027 -0.0412 0.0473 0.0157 HLA-DOB TSS1500

cg08865625 0.5686 -0.0313 0.0126 0.0485 HLF Body chr17:53342198-53343061 S_Shelf

cg13275679 -0.5248 0.0665 0.0018 0.0139 HN1 TSS1500;TSS1500;TSS1500 chr17:73149830-73150885 S_Shore

cg11495399 -0.7779 0.0607 0.0038 0.0426 HNRNPUL2 TSS1500;TSS200 chr11:62493994-62495127 S_Shore

cg09059988 1.3776 -0.0694 0.0002 0.0078 HORMAD1 1stExon;5'UTR

cg11532431 0.8934 -0.0322 0.0050 0.0298 HOXA4 Body chr7:27169572-27170638 Island


cg26506288 0.3808 -0.0304 0.0430 0.0396 HOXB13 3'UTR chr17:46804203-46804415 N_Shore

cg00893471 -0.2837 0.0537 0.0073 0.0228 HOXD3 5'UTR chr2:177029413-177029941 Island

cg03095533 1.0349 -0.0391 0.0077 0.0352 HPN Body;Body chr19:35531780-35531991 S_Shelf

cg10256662 0.4596 -0.0345 0.0495 0.0485 HPRT1 Body chrX:133594203-133594828 Island

cg11220161 0.3686 -0.0624 0.0294 0.0356 HRK TSS1500 chr12:117318708-117319521 S_Shore

cg20214871 -1.0077 0.1169 0.0369 0.0019 HRNBP3 TSS200

cg18575730 -0.3136 0.0308 0.0213 0.0443 HS6ST3 Body chr13:96742138-96744162 S_Shore

cg01502872 -0.4490 0.0631 0.0051 0.0410 HSD17B8 Body chr6:33172289-33172823 S_Shore

cg02025827 1.4232 -0.0791 0.0018 0.0022 HSD3B7 5'UTR;1stExon;1stExon;5'UTR;1stExon;5'UTR

cg16587174 0.4757 -0.0706 0.0351 0.0146 HSPA1L Body chr6:31774475-31774862 S_Shelf

cg03373442 0.7853 -0.0375 0.0112 0.0132 HSPH1 TSS1500 chr13:31735109-31736670 Island

cg01306498 0.6431 -0.0419 0.0425 0.0243 HTATIP2 3'UTR;3'UTR;3'UTR;3'UTR chr11:20408755-20409781 N_Shelf

cg24489774 -0.8414 0.0916 0.0027 0.0289 HTR2C 5'UTR;TSS1500

cg23332689 1.1902 -0.0679 0.0187 0.0306 IDUA Body;TSS1500;TSS1500;TSS1500 chr4:984926-985695 S_Shore

cg18177731 0.3594 -0.0487 0.0037 0.0131 IFFO2 Body

cg23893332 -0.2224 0.0380 0.0021 0.0208 IFI27 TSS1500;TSS1500

cg13304609 0.6908 -0.0938 0.0407 0.0243 IFI44L TSS1500

cg09757087 0.6852 -0.0852 0.0001 0.0061 IFT140 Body;Body chr16:1583809-1584641 S_Shore

cg08125539 -0.6685 0.0725 0.0187 0.0193 IGF2BP1 Body;Body chr17:47072820-47076042 S_Shelf

cg11135168 -0.5584 0.1000 0.0058 0.0285 IGFL2 TSS1500;TSS200

cg23066675 0.5600 -0.0386 0.0343 0.0052 IGSF11 Body;Body

cg00386725 0.2811 -0.0371 0.0212 0.0223 IGSF21 Body

cg18162528 0.6072 -0.0391 0.0105 0.0288 IGSF9B 1stExon;5'UTR chr11:133825337-133827457 Island

cg19875535 0.7396 -0.0513 0.0403 0.0490 IK Body chr5:140026826-140027504 S_Shelf

cg15488457 0.5116 -0.0324 0.0072 0.0453 IKZF2 3'UTR;3'UTR

cg26279025 -0.8194 0.1140 0.0062 0.0293 IL11 TSS1500 chr19:55880577-55880922 S_Shore

cg23969506 0.3693 -0.0375 0.0134 0.0464 IL17D Body

cg16366604 0.5977 -0.0341 0.0340 0.0075 IL17RC Body;Body;Body chr3:9956822-9957664 S_Shelf

cg18730511 -0.5023 0.0492 0.0063 0.0294 IL17REL 3'UTR chr22:50438257-50438776 N_Shelf

cg09383860 -0.3416 0.0402 0.0361 0.0228 IL18BP TSS200;TSS1500;TSS200;TSS1500;TSS1500

cg19050351 -0.3570 0.0382 0.0178 0.0302 IL1F5 Body;Body

cg14753070 0.4000 -0.0406 0.0383 0.0347 IL27RA 3'UTR

cg27392904 -0.5589 0.0519 0.0162 0.0056 IL4I1 TSS1500;Body


cg24585690 0.6528 -0.0371 0.0082 0.0214 IL9 1stExon;5'UTR

cg03147598 -0.3191 0.0401 0.0172 0.0290 IMP4 3'UTR chr2:131099469-131100863 S_Shelf

cg14263426 0.9491 -0.0835 0.0151 0.0431 INCENP Body;Body

cg05210373 -0.6802 0.0343 0.0175 0.0111 INF2 Body;Body

cg17270821 0.7466 -0.0542 0.0068 0.0064 INPP5A Body chr10:134360859-134361084 S_Shore

cg13001289 0.4079 -0.0426 0.0051 0.0391 INPP5K Body;Body;Body chr17:1419442-1420434 N_Shelf

cg17100616 0.6937 -0.0423 0.0051 0.0347 INTS1 Body chr7:1523541-1523976 S_Shore

cg22048132 1.3213 -0.0335 0.0366 0.0272 INTS2 1stExon;5'UTR;Body chr17:60004889-60005416 Island

cg21796430 0.4619 -0.0382 0.0359 0.0237 INTS6 TSS1500;TSS1500;TSS1500 chr13:52025691-52027946 S_Shore

cg18644782 -0.5612 0.0425 0.0075 0.0012 IQSEC1 Body

cg09703963 -0.6497 0.0588 0.0009 0.0090 IRF7 TSS1500;TSS1500;3'UTR;TSS1500;3'UTR chr11:617226-617797 N_Shore

cg08348990 0.3590 -0.0339 0.0269 0.0438 IRS2 Body

cg16642791 0.4715 -0.0641 0.0345 0.0493 IRX5 Body chr16:54962422-54967805 Island

cg20777315 -0.5974 0.0360 0.0033 0.0315 ISM1 Body chr20:13279711-13279947 Island

cg05625471 0.6385 -0.0312 0.0062 0.0056 ITGAM Body;Body chr16:31342452-31343140 Island

cg18566702 -0.2515 0.0337 0.0181 0.0084 ITGB4 Body;Body;Body chr17:73738579-73738810 N_Shore

cg15521097 0.6718 -0.0520 0.0063 0.0055 ITIH5L 1stExon

cg09453312 0.8154 -0.0644 0.0042 0.0465 ITK 1stExon

cg14396306 -0.6813 0.0538 0.0023 0.0054 ITM2C Body;Body;Body

cg02889647 0.6393 -0.0608 0.0274 0.0024 IVL TSS1500

cg04524668 1.1177 -0.0601 0.0029 0.0107 JAG2 Body;Body chr14:105615342-105615624 Island

cg22231101 0.6066 -0.0791 0.0002 0.0062 JAKMIP1 Body

cg10364109 0.5649 -0.0332 0.0214 0.0399 JAKMIP3 Body chr10:133937695-133938295 S_Shore

cg07490283 0.4713 -0.0400 0.0381 0.0031 JDP2 3'UTR;3'UTR;3'UTR;3'UTR

cg10959498 0.7975 -0.0425 0.0171 0.0491 JMJD1C Body;5'UTR

cg02529544 1.0575 -0.0963 0.0136 0.0094 JPH3 Body

cg08437802 -0.6004 0.0439 0.0141 0.0209 KANK2 Body;Body chr19:11303697-11304609 Island

cg14792031 0.9609 -0.0565 0.0271 0.0337 KBTBD6 TSS1500 chr13:41706202-41707120 S_Shore

cg04063166 -0.2580 0.0409 0.0001 0.0061 KCNA4 5'UTR chr11:30037672-30037944 N_Shelf

cg13800769 -0.3705 0.0562 0.0154 0.0410 KCNA6 TSS1500 chr12:4918273-4919657 N_Shore

cg02597153 1.0311 -0.0409 0.0079 0.0132 KCNC1 Body;Body chr11:17793276-17793959 Island

cg16665234 0.7185 -0.0481 0.0349 0.0031 KCNC3 Body chr19:50826780-50827028 N_Shore

cg02363526 1.0395 -0.1301 0.0292 0.0009 KCNH2 Body;Body chr7:150674737-150675026 N_Shore


cg20406482 0.2856 -0.0319 0.0180 0.0021 KCNH4 TSS1500 chr17:40332597-40333471 S_Shore

cg19906454 -0.1919 0.0401 0.0293 0.0275 KCNJ4 5'UTR;TSS1500

cg12569736 -0.3417 0.0600 0.0170 0.0265 KCNK9 Body

cg08252303 0.7136 -0.0634 0.0111 0.0088 KCNMA1 TSS1500;TSS1500;TSS1500;TSS1500 chr10:79396095-79398495 S_Shore

cg21871203 0.4147 -0.0669 0.0082 0.0101 KCNMB3 Body;TSS200;TSS1500;Body;Body;Body

cg27332243 2.5304 -0.0732 0.0018 0.0222 KCNN3 TSS200

cg06827779 0.6740 -0.0422 0.0118 0.0107 KCNQ1 Body;Body chr11:2603220-2603469 N_Shore

cg26601317 0.2864 -0.0518 0.0251 0.0223 KCNQ1DN TSS1500 chr11:2890388-2891337 Island

cg12627726 0.4473 -0.0338 0.0129 0.0205 KCNQ4 Body;Body

cg13954127 0.6875 -0.0572 0.0249 0.0122 KCNT1 Body chr9:138678108-138678467 N_Shelf

cg13454407 0.7307 -0.0307 0.0035 0.0274 KCNV1 TSS200 chr8:110986113-110986983 Island

cg11069284 -0.8712 0.0332 0.0430 0.0153 KCTD14 Body

cg04599840 0.5635 -0.0355 0.0273 0.0144 KDELR1 3'UTR

cg06024930 0.3778 -0.0504 0.0066 0.0474 KDM2B Body;Body chr12:121890223-121890510 Island

cg13357776 -0.6411 0.0380 0.0111 0.0063 KDM4B Body chr19:5110587-5110853 Island

cg14437446 0.8121 -0.0511 0.0265 0.0340 KIAA0020 Body

cg02025573 0.5963 -0.0331 0.0057 0.0051 KIAA0100 TSS1500 chr17:26971782-26972481 Island

cg00780845 -0.7445 0.0534 0.0005 0.0186 KIAA1024 5'UTR chr15:79724099-79725643 Island

cg12485744 0.6955 -0.0732 0.0120 0.0004 KIAA1026 Body;5'UTR;Body;Body

cg00168417 -0.4000 0.0414 0.0399 0.0201 KIAA1210 TSS1500 chrX:118284519-118285065 S_Shore

cg18699337 -0.5079 0.0959 0.0005 0.0064 KIAA1267 Body

cg04892182 -1.2526 0.1273 0.0030 0.0164 KIAA1522 Body

cg13929480 1.0919 -0.0357 0.0312 0.0319 KIAA1530 TSS1500 chr4:1340107-1341471 Island

cg05179757 0.7748 -0.0442 0.0023 0.0024 KIAA1671 3'UTR

cg20579564 0.5115 -0.0396 0.0197 0.0085 KIAA1688 Body chr8:145772645-145773966 N_Shore

cg23181870 0.6649 -0.0374 0.0030 0.0370 KIAA1949 5'UTR;5'UTR;1stExon chr6:30654392-30654934 Island

cg16333269 0.7989 -0.0397 0.0093 0.0006 KIDINS220 TSS1500 chr2:8977373-8977789 S_Shore

cg22527425 0.8738 -0.0712 0.0489 0.0252 KIF17 TSS1500;TSS1500 chr1:21043832-21044771 Island

cg17588812 0.8650 -0.0551 0.0013 0.0050 KIF1A Body

cg07344172 1.0852 -0.0723 0.0146 0.0445 KIF21B Body

cg23962342 -0.6613 0.0666 0.0104 0.0008 KIF26A Body chr14:104641258-104641762 Island

cg14174928 0.6858 -0.0576 0.0030 0.0388 KIF26B Body

cg27312338 0.3860 -0.0339 0.0100 0.0013 KIFC3 TSS1500;5'UTR;5'UTR chr16:57835955-57836989 N_Shelf


cg16837557 0.5448 -0.0521 0.0049 0.0463 KIRREL3 Body;Body

cg16792560 1.2340 -0.0876 0.0446 0.0348 KLF13 Body chr15:31621655-31621893 S_Shelf

cg14738273 0.5038 -0.0422 0.0063 0.0223 KLF15 5'UTR chr3:126074783-126076865 N_Shore

cg00890649 0.5679 -0.1363 0.0205 0.0142 KLHDC3 Body chr6:42989178-42989510 N_Shore

cg23556525 0.2615 -0.0318 0.0042 0.0244 KLHL15 5'UTR chrX:24042835-24044094 Island

cg03043911 -0.3512 0.0326 0.0111 0.0139 KLHL4 TSS1500;TSS1500

cg11170179 0.7229 -0.0412 0.0001 0.0055 KLK10 5'UTR;5'UTR;5'UTR chr19:51522004-51522803 Island

cg27361914 0.4855 -0.0535 0.0423 0.0185 KLK13 Body chr19:51568154-51568412 N_Shore

cg13793157 -0.2970 0.0486 0.0026 0.0414 KLK4 TSS1500 chr19:51416002-51416249 N_Shore

cg18330082 -0.1699 0.0331 0.0425 0.0212 KNDC1 Body chr10:134980302-134981059 S_Shelf

cg08131100 -1.0953 0.0427 0.0092 0.0423 KRBA1 TSS1500 chr7:149410858-149412351 Island

cg22506453 0.8791 -0.0562 0.0193 0.0260 KRT39 1stExon

cg24461814 -0.1242 0.0314 0.0204 0.0035 KRT84 1stExon

cg22443249 0.5954 -0.0374 0.0257 0.0312 KRTAP2-2 TSS1500

cg11043146 0.6911 -0.0368 0.0040 0.0427 KRTAP22-2 TSS1500;TSS1500

cg13506670 0.5406 -0.0493 0.0144 0.0326 KTN1 TSS1500;Body;TSS1500;TSS1500;TSS1500 chr14:56046634-56047986 N_Shore

cg12039689 -0.4730 0.0717 0.0117 0.0059 L1CAM TSS1500;TSS1500;TSS1500

cg16773803 -0.3751 0.0359 0.0132 0.0220 L3MBTL 3'UTR;Body

cg07532159 0.4335 -0.0313 0.0380 0.0177 LAMA2 Body;Body

cg17409288 0.7520 -0.0354 0.0070 0.0370 LAP3 Body

cg00574819 -0.6453 0.0609 0.0029 0.0268 LARP1B TSS1500;TSS1500;TSS1500 chr4:128981810-128983478 N_Shore

cg08847335 -0.8127 0.0362 0.0034 0.0322 LARP4B Body

cg16005883 1.0895 -0.0775 0.0124 0.0274 LARP7 5'UTR;TSS1500;5'UTR chr4:113558032-113558681 S_Shore

cg16778811 -0.5341 0.0441 0.0353 0.0028 LASP1 Body chr17:37074860-37075097 N_Shelf

cg14374861 0.7209 -0.0555 0.0068 0.0374 LBX1 Body;TSS1500 chr10:102984182-102990063 Island

cg22044308 -0.6697 0.0455 0.0007 0.0110 LCE2D TSS1500

cg20239639 -0.4063 0.0473 0.0159 0.0097 LCK 5'UTR;TSS1500 chr1:32740710-32741544 N_Shore

cg14633329 0.5261 -0.0456 0.0198 0.0426 LCN6 Body chr9:139640640-139640885 N_Shore

cg26112909 -0.3682 0.0336 0.0288 0.0291 LDLRAD2 3'UTR;Body chr1:22149683-22149897 S_Shore

cg26962002 0.7802 -0.0453 0.0037 0.0169 LENG8 Body chr19:54960191-54960948 S_Shelf

cg24334632 -0.3732 0.0410 0.0084 0.0363 LEPREL1 5'UTR;Body

cg11623476 -0.7671 0.0717 0.0158 0.0262 LFNG Body;Body;Body;Body chr7:2565872-2566114 Island

cg18086521 0.8507 -0.0368 0.0192 0.0493 LGALS8 Body;Body;Body;Body chr1:236687071-236687608 S_Shelf


cg01460991 -0.2961 0.0557 0.0287 0.0173 LGI2 Body chr4:25032028-25032311 N_Shore

cg10712554 -0.4927 0.0463 0.0096 0.0326 LGR6 Body;Body;Body

cg15617023 -0.3855 0.0527 0.0282 0.0339 LHFP Body

cg12894748 0.6204 -0.0365 0.0206 0.0305 LHFPL3 Body

cg11189384 1.4263 -0.0785 0.0139 0.0230 LHX4 Body chr1:180198119-180204975 Island

cg11842415 -0.4736 0.0365 0.0172 0.0464 LHX8 Body chr1:75600674-75601415 N_Shore

cg17753347 -0.2722 0.0456 0.0012 0.0165 LHX9 Body chr1:197885060-197885389 N_Shore

cg00727947 0.6370 -0.0461 0.0191 0.0099 LILRA5 TSS1500;TSS1500;TSS1500;TSS1500

cg19721087 0.3913 -0.0422 0.0118 0.0347 LIN28B TSS1500 chr6:105400877-105401149 S_Shelf

cg22440951 -0.4436 0.0558 0.0042 0.0498 LIN9 3'UTR

cg05212323 0.7476 -0.0384 0.0082 0.0295 LIPM 1stExon

cg07143635 -0.4416 0.0393 0.0163 0.0472 LITAF TSS200;TSS1500;TSS1500;TSS1500 chr16:11680008-11681275 S_Shore

cg13539171 -0.9459 0.0905 0.0405 0.0477 LLGL2 Body;Body chr17:73569163-73569410 Island

cg16515546 -0.5403 0.0493 0.0447 0.0212 LMF1 TSS1500 chr16:1020219-1021303 S_Shore

cg22017015 1.0319 -0.0541 0.0028 0.0244 LMNA Body;Body;Body

cg05641348 0.4212 -0.0390 0.0320 0.0169 LMNB2 Body chr19:2455863-2457078 N_Shore

cg13060233 0.6777 -0.0764 0.0361 0.0056 LMO7 5'UTR;Body

cg13252613 0.6492 -0.0454 0.0035 0.0394 LOC100101121 TSS1500;TSS1500 chrY:9745559-9745993 S_Shore

cg05979400 0.3212 -0.0304 0.0293 0.0305 LOC100128731 TSS1500 chr2:27294139-27294915 S_Shore

cg03193299 0.3496 -0.0495 0.0003 0.0031 LOC100130872-SPON2Body;TSS1500;TSS1500 chr4:1164515-1166582 S_Shore

cg24051554 0.3034 -0.0471 0.0391 0.0155 LOC100132111 Body;5'UTR chr1:151810460-151811684 Island

cg22727572 1.0458 -0.0402 0.0168 0.0057 LOC100132215 Body;Body;Body;Body;Body chr2:63272127-63272409 Island

cg12932211 0.5221 -0.0320 0.0079 0.0173 LOC100286948 TSS200;Body;Body

cg09654116 0.5655 -0.0574 0.0435 0.0466 LOC154822 Body chr7:158816092-158816409 Island

cg13505469 0.5982 -0.0375 0.0360 0.0311 LOC219347 TSS200;TSS200;Body;TSS200;TSS200;TSS200 chr10:81838359-81839078 Island

cg20738500 0.5530 -0.0377 0.0261 0.0017 LOC254559 TSS200 chr15:89920793-89922768 Island

cg15808604 -0.5956 0.0704 0.0388 0.0408 LOC283731 Body chr15:74419870-74423044 N_Shore

cg08767637 -0.3131 0.0410 0.0015 0.0227 LOC283867 Body

cg22488719 0.4674 -0.0579 0.0241 0.0359 LOC285205 TSS1500

cg22620414 0.3511 -0.0501 0.0030 0.0381 LOC285370 TSS1500

cg12467226 -0.2467 0.0351 0.0343 0.0387 LOC285375 Body chr3:13696627-13697127 N_Shelf

cg17774418 0.8446 -0.0483 0.0122 0.0320 LOC285780 Body;Body


cg02945359 0.7590 -0.0447 0.0035 0.0337 LOC285830 Body;Body;Body chr6:29691106-29692093 S_Shelf

cg26723524 -0.7692 0.0703 0.0173 0.0494 LOC349114 Body chr7:39772839-39773252 S_Shelf

cg21735115 0.7674 -0.0333 0.0309 0.0101 LOC374443 TSS1500 chr12:9800543-9800852 N_Shore

cg26363555 -0.2130 0.0307 0.0260 0.0470 LOC399959 Body

cg22732432 1.1214 -0.0589 0.0150 0.0410 LOC400027 TSS200 chr12:46120726-46124104 Island

cg24147392 0.5491 -0.0447 0.0260 0.0315 LOC440461 Body chr17:66192363-66195873 Island

cg25318278 -0.2100 0.0405 0.0464 0.0116 LOC441601 TSS200 chr11:50257255-50257772 S_Shore

cg20788133 -0.8744 0.0770 0.0138 0.0444 LOC643837 Body chr1:762416-763445 S_Shore

cg20550513 0.8165 -0.0587 0.0096 0.0200 LOC651250 Body chr17:66097528-66098631 S_Shore

cg24809698 -0.5575 0.0363 0.0022 0.0105 LOC731789 TSS200

cg25340786 0.6883 -0.0525 0.0149 0.0282 LOC93432 TSS1500

cg08017756 -0.5794 0.0567 0.0318 0.0396 LONRF2 TSS200 chr2:100937779-100939059 S_Shore

cg19282019 0.7737 -0.0492 0.0031 0.0068 LOXHD1 TSS1500;Body chr18:44140362-44140575 N_Shore

cg08864083 -0.5207 0.0318 0.0054 0.0306 LOXL2 Body

cg15989091 0.1698 -0.0332 0.0425 0.0091 LOXL3 5'UTR chr2:74781494-74782685 N_Shore

cg16533510 0.8302 -0.0370 0.0186 0.0328 LPCAT1 Body

cg25977938 0.5554 -0.0565 0.0456 0.0028 LPPR5 Body;Body

cg16385330 0.8703 -0.1078 0.0462 0.0131 LRBA Body;1stExon;5'UTR chr4:151504011-151505085 N_Shore

cg11885324 0.4519 -0.0568 0.0053 0.0181 LRIT1 Body chr10:85997109-85997427 N_Shelf

cg27352715 -0.5681 0.0727 0.0100 0.0378 LRIT2 1stExon

cg22799110 -0.4536 0.0360 0.0006 0.0117 LRP5 Body chr11:68181086-68181289 Island

cg26191586 -0.4680 0.0519 0.0045 0.0111 LRP8 TSS1500;TSS1500;TSS1500;TSS1500 chr1:53791687-53793496 S_Shore

cg26263234 -0.3289 0.0532 0.0346 0.0163 LRRC3B 5'UTR chr3:26665950-26666164 Island

cg13933859 0.8801 -0.0959 0.0308 0.0282 LRRK1 Body chr15:101513245-101514323 N_Shore

cg14139935 -0.7249 0.0454 0.0065 0.0384 LRSAM1 Body;Body;Body

cg24552015 0.6540 -0.0654 0.0155 0.0377 LSP1 5'UTR;TSS200;TSS200;Body chr11:1892037-1892556 Island

cg09761080 -0.2215 0.0353 0.0041 0.0129 LST1

Body;TSS1500;TSS1500;5'UTR;TSS1500;5'UT

R;Body;5'UTR;1stExon

cg09274091 0.9475 -0.1135 0.0003 0.0109 LTB4R 5'UTR;TSS1500;TSS1500 chr14:24779874-24780932 S_Shore

cg21301224 0.4301 -0.0317 0.0161 0.0016 LYN 5'UTR;5'UTR

cg26370158 -0.7667 0.0459 0.0330 0.0431 LYST Body

cg19499884 0.9702 -0.1355 0.0064 0.0093 LZTS2 5'UTR chr10:102756834-102759798 S_Shore

cg03840849 0.4375 -0.0451 0.0178 0.0358 MACC1 TSS1500


cg18546384 -0.6888 0.0423 0.0031 0.0002 MAD1L1 Body;Body;Body

cg17879352 -0.3809 0.0464 0.0241 0.0022 MAEA Body;Body chr4:1320098-1320301 N_Shore

cg05573182 1.0908 -0.0501 0.0165 0.0136 MAFB TSS1500 chr20:39316550-39319987 Island

cg00117663 0.6249 -0.0377 0.0251 0.0498 MAGEB16 TSS200

cg22072691 0.4180 -0.0438 0.0008 0.0098 MAGED2 Body;TSS1500;Body;Body

cg20311601 0.9107 -0.0533 0.0376 0.0057 MAGI2 Body

cg04831694 -0.5437 0.0558 0.0125 0.0500 MAK TSS1500

cg03129884 0.9758 -0.0719 0.0092 0.0435 MAL Body;Body;Body;Body chr2:95690857-95692431 S_Shore

cg23566411 0.9282 -0.0681 0.0354 0.0026 MALAT1 TSS1500 chr11:65264957-65265398 N_Shore

cg21396956 0.8963 -0.0647 0.0153 0.0039 MALT1 Body;Body chr18:56338211-56339277 S_Shore

cg03371275 0.7809 -0.0527 0.0239 0.0139 MAML2 Body

cg07533819 0.3756 -0.0501 0.0190 0.0404 MAP1B Body chr5:71402877-71404868 S_Shelf

cg03391426 0.9810 -0.0459 0.0176 0.0202 MAP7D1 3'UTR chr1:36641756-36642461 S_Shelf

cg05181212 0.1819 -0.0410 0.0426 0.0383 MAPK10 5'UTR;5'UTR;5'UTR

cg09080909 0.6410 -0.0465 0.0027 0.0008 MAPK8IP3 Body;Body chr16:1796810-1797229 Island

cg13188869 0.7479 -0.0366 0.0201 0.0361 MAPKAPK3 TSS1500 chr3:50654276-50655120 Island

cg15221532 1.0791 -0.0642 0.0006 0.0099 MARCH10 Body;Body

cg04348222 0.1733 -0.0307 0.0271 0.0203 MARCKSL1 TSS1500 chr1:32800859-32802229 S_Shore

cg18823904 0.7512 -0.0373 0.0022 0.0071 MARK3 Body;Body;Body;Body;Body

cg05817232 1.3047 -0.1477 0.0026 0.0123 MARK4 Body chr19:45754630-45755261 Island

cg06340704 0.4422 -0.0386 0.0088 0.0328 MBNL2 5'UTR;5'UTR

cg00706570 0.4471 -0.0433 0.0041 0.0020 MBP 3'UTR;3'UTR;3'UTR;3'UTR;3'UTR chr18:74691262-74691466 S_Shore

cg19028462 0.7035 -0.0982 0.0028 0.0084 MCF2L Body;Body chr13:113677627-113677836 Island

cg13227206 0.5773 -0.0301 0.0183 0.0156 MCOLN2 Body

cg15129679 0.4383 -0.0368 0.0111 0.0065 MCOLN3 5'UTR chr1:85513509-85514555 N_Shore

cg26193015 0.3477 -0.0359 0.0119 0.0452 MDC1 5'UTR chr6:30684836-30685503 N_Shore

cg11605108 -0.4745 0.0375 0.0084 0.0451 MED24 Body;Body chr17:38210767-38210975 N_Shelf

cg01034631 -0.3711 0.0435 0.0284 0.0154 MEG8 TSS200

cg25221496 0.4324 -0.0349 0.0075 0.0238 MEIS2 Body;Body;Body;Body;Body;Body;Body chr15:37387386-37387614 N_Shore

cg14431547 0.5558 -0.0628 0.0089 0.0477 MELK TSS1500 chr9:36572703-36573073 N_Shore

cg07651189 -0.3470 0.0647 0.0488 0.0217 MEPE TSS1500

cg26651775 -0.4451 0.0500 0.0161 0.0450 METRN TSS1500 chr16:764748-765994 N_Shore

cg02633149 0.4998 -0.0552 0.0024 0.0349 METRNL Body chr17:81042626-81043244 Island


cg06544937 -1.1465 0.0441 0.0284 0.0147 METT5D1 5'UTR;TSS1500;5'UTR chr11:28131863-28132221 N_Shore

cg09418267 0.4474 -0.0389 0.0057 0.0059 MEX3D 3'UTR chr19:1555010-1555213 Island

cg10201923 0.5975 -0.0358 0.0325 0.0322 MFAP2 TSS1500;TSS1500;TSS1500;TSS1500 chr1:17306551-17307363 S_Shore

cg26894288 0.5434 -0.0549 0.0021 0.0007 MFGE8 Body;Body

cg04442042 -0.3547 0.0688 0.0056 0.0305 MFHAS1 Body

cg01869896 -0.2890 0.0434 0.0013 0.0041 MFSD2A TSS1500;TSS1500 chr1:40420487-40421366 N_Shore

cg04186606 -0.5758 0.0439 0.0284 0.0344 MFSD7 Body chr4:681313-681514 N_Shore

cg21160192 -0.8499 0.0308 0.0118 0.0008 MGAT1 5'UTR;5'UTR;5'UTR;5'UTR;5'UTR chr5:180229375-180230147 Island

cg09736950 -1.0030 0.0540 0.0028 0.0332 MGC15885 TSS1500;TSS1500

cg02803836 0.6402 -0.0380 0.0229 0.0129 MGMT Body

cg26700932 0.7575 -0.0598 0.0013 0.0085 MGRN1 Body;Body;Body;Body chr16:4702628-4702851 S_Shore

cg00874480 0.4062 -0.0501 0.0260 0.0395 MGST1 Body;Body;Body;Body

cg05642789 0.8640 -0.0547 0.0001 0.0039 MIB2 Body;Body;Body;Body;Body;Body chr1:1564421-1570006 Island

cg23381224 -1.1464 0.1213 0.0051 0.0083 MINPP1 Body

cg20788415 0.4930 -0.0406 0.0374 0.0307 MIR106A TSS1500 chrX:133305678-133306936 Island

cg11201447 -0.9115 0.0805 0.0004 0.0084 MIR1204 TSS200;Body chr8:128806081-128806899 S_Shore

cg11175091 -0.5730 0.0634 0.0378 0.0026 MIR1243 TSS1500;Body;Body;Body

cg03307581 -0.2346 0.0372 0.0429 0.0313 MIR1289-2 TSS1500;Body

cg14892570 0.4645 -0.0390 0.0235 0.0024 MIR1470 TSS1500;5'UTR

cg07513814 -0.2202 0.0386 0.0367 0.0218 MIR1471 TSS1500

cg09732987 0.7026 -0.0376 0.0002 0.0095 MIR17HG TSS1500;TSS1500 chr13:91999541-92001441 Island

cg25511278 0.9437 -0.1597 0.0428 0.0261 MIR219-1 TSS1500;Body chr6:33175561-33176387 N_Shore

cg19321304 -0.5362 0.0419 0.0260 0.0364 MIR320B1 TSS1500 chr1:117209824-117210621 S_Shelf

cg11721554 -0.4852 0.0435 0.0213 0.0049 MIR377 TSS1500 chr14:101531643-101532384 N_Shelf

cg25047306 0.5404 -0.0421 0.0257 0.0426 MIR384 TSS1500

cg20704442 -0.2718 0.0391 0.0012 0.0015 MIR548F5 Body;Body chr13:36052553-36053119 Island

cg16796899 0.6378 -0.0397 0.0318 0.0315 MIR656 Body chr14:101531643-101532384 S_Shore

cg14189049 0.7400 -0.0936 0.0084 0.0407 MIR9-3 TSS1500 chr15:89910521-89912177 N_Shore

cg06070625 -0.3431 0.0356 0.0019 0.0039 MITF Body;TSS200

cg16208863 0.3879 -0.0339 0.0321 0.0161 MLLT1 Body chr19:6230103-6230306 Island

cg18264687 0.9003 -0.0487 0.0031 0.0175 MLLT3 5'UTR;1stExon chr9:20620728-20621862 S_Shore

cg26255831 0.7318 -0.0543 0.0003 0.0119 MMP14 Body chr14:23305893-23307013 S_Shelf

cg25400200 -0.4871 0.0527 0.0025 0.0106 MMP21 Body chr10:127462230-127462987 N_Shore


cg08747557 0.7280 -0.0678 0.0034 0.0016 MMP8 3'UTR

cg10841673 0.6148 -0.0389 0.0461 0.0425 MOCS3 TSS200;TSS1500 chr20:49574816-49576287 Island

cg02475474 -0.2854 0.0553 0.0241 0.0252 MOG

3'UTR;Body;3'UTR;Body;Body;Body;Body;B

ody;Body;Body;Body

cg05798059 -0.1751 0.0329 0.0216 0.0460 MPPED2 Body;Body

cg26771557 0.3240 -0.0303 0.0152 0.0230 MPRIP Body;Body

cg11802469 0.9625 -0.0858 0.0368 0.0479 MRAP2 TSS1500 chr6:84743357-84743948 N_Shore

cg25807487 -0.5185 0.0847 0.0206 0.0079 MRGPRF TSS1500;TSS1500 chr11:68778569-68778851 S_Shelf

cg23310975 0.7056 -0.0487 0.0301 0.0342 MRPL13 Body chr8:121457353-121457657 N_Shelf

cg14795268 -0.6752 0.0305 0.0190 0.0159 MRPL20 Body chr1:1342004-1342952 N_Shore

cg14836313 0.6788 -0.0744 0.0477 0.0464 MRPL23 Body chr11:1977523-1977765 N_Shore

cg11469325 0.7135 -0.0306 0.0358 0.0360 MRPS16 1stExon;5'UTR chr10:75012126-75012531 Island

cg17630127 0.7141 -0.0530 0.0101 0.0153 MS4A5 TSS1500

cg24393665 0.9856 -0.0875 0.0388 0.0418 MSL3 5'UTR;Body;Body;Body chrX:11775784-11776936 S_Shelf

cg17440757 0.3897 -0.0507 0.0222 0.0329 MSMB Body;Body chr10:51565071-51565648 N_Shelf

cg07355157 0.2772 -0.0387 0.0367 0.0170 MSRB2 Body chr10:23384533-23385078 S_Shore

cg05958050 -0.6115 0.0684 0.0202 0.0282 MT1G TSS1500;TSS1500 chr16:56703387-56703648 Island

cg26117622 0.7933 -0.0350 0.0163 0.0470 MTERFD2 TSS1500;TSS1500;TSS1500;TSS1500 chr2:242041543-242042026 S_Shore

cg13470367 -0.4186 0.0414 0.0082 0.0343 MTF1 TSS1500 chr1:38325150-38325999 S_Shore

cg15241130 -0.6495 0.0895 0.0077 0.0388 MTHFD1L Body

cg00414384 0.7949 -0.0398 0.0304 0.0210 MTL5 Body;Body chr11:68517667-68518179 Island

cg13630878 -0.3169 0.0484 0.0097 0.0338 MTMR15 Body

cg26046924 -0.5217 0.0485 0.0423 0.0358 MTMR8 TSS1500 chrX:63614957-63615423 S_Shore

cg19977866 0.5425 -0.0401 0.0269 0.0329 MTNR1B Body chr11:92702789-92703434 S_Shore

cg13906098 -0.5908 0.0486 0.0149 0.0135 MUC17 TSS200

cg13957457 1.2184 -0.0913 0.0362 0.0232 MUC2 Body chr11:1107802-1108041 N_Shelf

cg07974485 -0.2510 0.0370 0.0042 0.0239 MUC6 Body chr11:1024003-1024492 S_Shore

cg23674169 0.5279 -0.0881 0.0189 0.0198 MUM1 TSS200;5'UTR chr19:1354420-1355350 S_Shore

cg11414742 0.3812 -0.0575 0.0319 0.0372 MXRA8 3'UTR chr1:1289707-1291126 N_Shore

cg15769920 -0.3953 0.0304 0.0029 0.0140 MYL6B TSS1500 chr12:56546192-56546411 N_Shore

cg20142309 -0.3993 0.0564 0.0468 0.0310 MYO18A TSS1500;TSS1500 chr17:27506889-27507607 S_Shore

cg07332330 -1.2534 0.0533 0.0391 0.0125 MYO1C 5'UTR;Body;TSS1500 chr17:1388686-1389730 Island

cg22798362 0.7363 -0.0317 0.0011 0.0041 MYO1D Body chr17:30845903-30846702 S_Shelf


cg08891123 -0.7986 0.0437 0.0229 0.0118 MYO1E Body

cg21188037 0.5841 -0.0449 0.0125 0.0456 MYO1G 5'UTR;1stExon

cg24961970 0.5230 -0.0327 0.0396 0.0285 MYO1H 3'UTR

cg06363798 -0.6240 0.0623 0.0143 0.0277 MYOC 3'UTR

cg05486872 -0.4169 0.0528 0.0042 0.0251 MYOM1 3'UTR;3'UTR chr18:3067297-3067533 N_Shore

cg00480231 0.1920 -0.0366 0.0311 0.0383 MYT1L 5'UTR chr2:2193510-2193716 S_Shelf

cg18120808 -0.4560 0.0565 0.0143 0.0134 NAF1 TSS1500;TSS1500 chr4:164087461-164088146 S_Shore

cg24080291 0.6042 -0.0417 0.0177 0.0492 NARS2 Body;Body chr11:78285405-78285995 N_Shelf

cg00910355 -0.4323 0.0437 0.0287 0.0160 NAT15 5'UTR chr16:3507545-3508606 N_Shelf

cg13372293 0.5850 -0.0463 0.0171 0.0370 NBEAL1 TSS1500 chr2:203879249-203879891 N_Shore

cg06614336 -0.7601 0.0614 0.0200 0.0469 NCAPG2 Body

cg20502854 -0.2583 0.0342 0.0195 0.0424 NCKAP5 Body;Body

cg12052114 0.5764 -0.0517 0.0406 0.0158 NCL Body;TSS1500;TSS200

cg02492405 -0.7432 0.0423 0.0012 0.0071 NCOA2 5'UTR

cg25763426 0.6457 -0.0364 0.0344 0.0232 NCOR2 Body;Body chr12:124901064-124901441 S_Shelf

cg05138681 -0.2788 0.0499 0.0019 0.0094 NCRNA00092 Body chr9:98783216-98784364 N_Shore

cg00995670 0.7097 -0.0493 0.0170 0.0361 NCRNA00171 Body

cg18103043 0.7012 -0.0731 0.0083 0.0287 NCRNA00176 TSS1500;TSS1500 chr20:62660961-62661352 S_Shelf

cg11267496 0.3256 -0.0341 0.0285 0.0048 NDP TSS200

cg07062933 0.4897 -0.0329 0.0029 0.0216 NDRG1 TSS1500;TSS1500 chr8:134308328-134310145 Island

cg25733559 0.6665 -0.0570 0.0031 0.0202 NDUFA12 TSS1500 chr12:95397382-95397611 S_Shore

cg14755054 0.8205 -0.0683 0.0458 0.0351 NDUFB3 5'UTR chr2:201936024-201936376 S_Shelf

cg19038228 1.3171 -0.0629 0.0042 0.0496 NDUFV1 TSS1500;TSS1500 chr11:67374150-67374726 N_Shore

cg08762432 0.3177 -0.0450 0.0192 0.0450 NEBL Body

cg14263969 0.5743 -0.0353 0.0027 0.0175 NECAB3 Body;Body;TSS200 chr20:32251123-32251832 N_Shore

cg10433327 -0.3462 0.0339 0.0142 0.0052 NEDD4 TSS200;Body

cg17017564 0.5731 -0.0346 0.0209 0.0166 NEDD4L

5'UTR;Body;5'UTR;5'UTR;5'UTR;Body;Body;

Body;5'UTR chr18:55922987-55924068 N_Shelf

cg20256245 0.7482 -0.0577 0.0048 0.0450 NEFH Body chr22:29875919-29877242 S_Shore

cg13387869 0.6019 -0.0489 0.0111 0.0222 NEFM 3'UTR;3'UTR chr8:24770908-24772547 S_Shelf

cg03387238 -0.4326 0.0304 0.0210 0.0271 NEIL1 Body;TSS1500 chr15:75648404-75648709 N_Shore

cg17742559 -0.3411 0.0300 0.0035 0.0350 NEK8 Body chr17:27070538-27071570 N_Shelf

cg27258696 0.7094 -0.0643 0.0479 0.0062 NELL1 Body;Body


cg05767035 0.5875 -0.0404 0.0464 0.0252 NELL2 Body;Body;Body;Body;Body

cg12598025 0.5622 -0.0431 0.0086 0.0273 NEURL1B Body

cg25567448 0.2530 -0.0475 0.0326 0.0377 NEURL3 TSS1500 chr2:97173851-97174485 S_Shore

cg21850879 0.7656 -0.0431 0.0221 0.0215 NF1 Body;3'UTR;Body

cg17449235 0.6240 -0.0622 0.0333 0.0439 NFASC Body;Body;Body;Body

cg23240477 0.6592 -0.0363 0.0226 0.0352 NFATC1 Body;Body;Body;Body chr18:77230597-77230803 N_Shore

cg13118545 0.2917 -0.0311 0.0284 0.0480 NFE2L3 TSS1500 chr7:26191794-26192757 N_Shore

cg08037935 0.8504 -0.0353 0.0061 0.0275 NFIA Body;TSS1500;TSS1500;TSS200 chr1:61548753-61549564 N_Shore

cg14543226 -0.4402 0.0333 0.0181 0.0132 NFIC Body;Body chr19:3387963-3388203 N_Shelf

cg14290576 0.1804 -0.0346 0.0118 0.0465 NFIL3 5'UTR chr9:94183407-94183994 N_Shore

cg05503349 0.7368 -0.0304 0.0262 0.0187 NFYB 5'UTR chr12:104531174-104532539 Island

cg22819824 -0.6860 0.0575 0.0231 0.0106 NHLRC2 Body chr10:115614373-115615056 S_Shelf

cg06297391 -0.7445 0.0528 0.0410 0.0176 NHLRC4 TSS1500 chr16:614792-615095 S_Shore

cg18765906 0.3699 -0.0449 0.0272 0.0489 NID1 Body

cg17868994 0.7833 -0.0344 0.0010 0.0055 NIPSNAP3B TSS200 chr9:107526172-107526779 Island

cg07015221 -0.7135 0.0476 0.0050 0.0018 NKD2 Body chr5:1037964-1038426 N_Shelf

cg05939513 -0.4926 0.0333 0.0075 0.0159 NLGN4Y Body;Body;Body chrY:16941822-16942188 S_Shore

cg23093333 -0.7960 0.0562 0.0179 0.0079 NLK Body

cg23985930 0.6155 -0.0567 0.0054 0.0143 NLRP5 TSS1500

cg15343797 -0.6045 0.0426 0.0025 0.0029 NLRX1 3'UTR;TSS1500;Body;TSS1500

cg05546038 0.5921 -0.0539 0.0140 0.0251 NOL3 TSS1500 chr16:67208067-67208678 N_Shore

cg14120703 0.5356 -0.0335 0.0435 0.0306 NOTCH1 Body chr9:139417115-139417518 N_Shore

cg19157199 0.7001 -0.0548 0.0354 0.0184 NOX3 TSS1500

cg10224655 0.7759 -0.0952 0.0128 0.0003 NPHP4 TSS1500 chr1:6051595-6052955 S_Shore

cg20557999 0.4426 -0.0489 0.0024 0.0199 NPTX1 3'UTR chr17:78442568-78442849 Island

cg08415785 0.5002 -0.0885 0.0265 0.0072 NR0B1 TSS1500 chrX:30326439-30327668 S_Shore

cg08098450 -1.0093 0.0640 0.0374 0.0181 NR1H4 Body

cg25214346 -0.1400 0.0348 0.0066 0.0491 NR1I3

1stExon;1stExon;1stExon;5'UTR;1stExon;1st

Exon;5'UTR;5'UTR;5'UTR;5'UTR;1stExon;1st

Exon;5'UTR;1stExon;5'UTR;5'UTR;5'UTR;5'U

TR;5'UTR;1stExon;1stExon;1stExon;5'UTR;1s

tExon;5'UTR;5'UTR;1stExon;1stExon;5'UTR;

1stExon


cg23676151 -0.5874 0.0685 0.0483 0.0320 NR2E1 Body chr6:108491033-108491410 Island

cg26446929 1.7072 -0.1377 0.0102 0.0491 NR4A1 5'UTR;5'UTR chr12:52444553-52445421 S_Shore

cg17661135 0.5485 -0.0588 0.0144 0.0316 NRG1

Body;Body;Body;Body;Body;Body;Body;Bod

y;Body;Body;Body;Body

cg10307632 -0.9432 0.0521 0.0152 0.0371 NRP2 Body;Body;Body;Body;Body

cg07256668 0.5841 -0.0376 0.0014 0.0255 NRXN2 Body;Body;Body chr11:64397644-64398016 S_Shore

cg21265548 1.4496 -0.2486 0.0010 0.0207 NSDHL 5'UTR;5'UTR;TSS1500 chrX:151999149-151999751 S_Shore

cg02917210 0.6859 -0.0415 0.0255 0.0306 NSMCE2 TSS1500;5'UTR chr8:126103760-126104122 N_Shore

cg23369601 0.6064 -0.0494 0.0067 0.0075 NSUN2 Body chr5:6632740-6634162 N_Shore

cg04493247 0.6450 -0.0496 0.0126 0.0315 NSUN5 Body;Body;Body;Body chr7:72717665-72717985 S_Shore

cg01377911 0.4345 -0.0506 0.0137 0.0489 NTF4 TSS1500

cg03393889 -0.2642 0.0316 0.0011 0.0228 NTHL1 Body chr16:2097465-2098365 N_Shelf

cg23493497 0.4723 -0.0505 0.0065 0.0247 NTM Body;Body;Body;Body

cg24346905 -0.7060 0.0446 0.0309 0.0486 NTNG1 Body;Body;Body chr1:108023232-108023442 Island

cg04131010 -0.7310 0.0446 0.0215 0.0450 NUDT1 Body;Body;Body;Body;Body;Body;Body

cg27042667 0.5878 -0.0321 0.0044 0.0127 NUF2 Body;Body chr1:163291479-163292021 S_Shelf

cg22311942 1.1109 -0.0613 0.0227 0.0161 NUP85 TSS1500 chr17:73201326-73202122 Island

cg12740087 -0.5770 0.0491 0.0190 0.0020 NVL Body;Body;TSS1500

cg05575733 -0.6984 0.0490 0.0262 0.0333 NXN Body chr17:708319-708598 Island

cg01933308 0.6008 -0.0442 0.0300 0.0005 NXPH1 Body chr7:8483132-8483711 Island

cg08881871 -0.2188 0.0500 0.0481 0.0309 OBSCN Body;Body chr1:228503556-228504762 Island

cg03261633 0.4990 -0.0370 0.0276 0.0144 OBSL1 Body chr2:220428115-220428342 Island

cg15843691 0.4752 -0.0342 0.0144 0.0496 OCA2 Body chr15:28015346-28015795 N_Shore

cg24379599 0.6984 -0.0565 0.0030 0.0177 OCLM TSS1500;Body;Body;Body;Body

cg17818912 -0.3250 0.0447 0.0433 0.0401 OCLN TSS1500 chr5:68788151-68789823 N_Shore

cg03791434 0.7373 -0.0413 0.0222 0.0431 OCRL Body;Body chrX:128674133-128674727 S_Shelf

cg06589421 -0.5182 0.0570 0.0310 0.0486 ODZ3 3'UTR chr4:183720658-183721739 S_Shore

cg27153782 0.6327 -0.0787 0.0477 0.0259 OLAH 5'UTR;5'UTR

cg00014194 0.3521 -0.0551 0.0038 0.0367 OLFM1 Body;Body chr9:137978821-137980254 N_Shore

cg00488788 -1.1223 0.0891 0.0292 0.0223 ONECUT1 Body chr15:53076187-53077926 Island

cg12591625 -0.2896 0.0407 0.0222 0.0003 OPCML Body chr11:133230884-133231645 S_Shore

cg03309898 0.3359 -0.0381 0.0111 0.0470 OPLAH Body chr8:145114550-145115828 Island

cg17786206 -0.3698 0.0518 0.0076 0.0216 OPRD1 Body chr1:29138501-29139348 S_Shelf


cg01004457 -0.9095 0.0557 0.0479 0.0270 OR10H3 TSS1500

cg02650767 -0.2716 0.0479 0.0041 0.0029 OR2B11 1stExon chr1:247614695-247614944 S_Shore

cg16274221 -0.6128 0.0729 0.0363 0.0346 OR2T1 TSS1500

cg19519899 0.8416 -0.0562 0.0394 0.0083 OR2T33 TSS200

cg20615517 0.4649 -0.0319 0.0195 0.0060 OR3A4 Body

cg20084079 0.5097 -0.0618 0.0019 0.0267 OR4A15 1stExon

cg25747935 0.4834 -0.0449 0.0419 0.0349 OR51A2 TSS1500

cg26148471 0.5644 -0.0312 0.0069 0.0181 OR5AS1 TSS1500

cg09831620 0.7345 -0.0419 0.0090 0.0400 OR5H2 1stExon

cg05369553 0.7428 -0.0473 0.0334 0.0390 OR6K3 TSS1500

cg14514991 0.3953 -0.0601 0.0105 0.0169 OR6N1 TSS1500

cg08460629 0.4566 -0.0337 0.0286 0.0028 OR7E156P Body

cg00320138 0.8098 -0.0437 0.0323 0.0031 OR8D1 TSS1500

cg07598370 0.7292 -0.0464 0.0080 0.0297 OR8U8 Body;1stExon

cg21253590 0.5981 -0.0872 0.0106 0.0014 ORAI2 TSS1500;TSS1500 chr7:102073605-102074334 N_Shore

cg03242344 0.5098 -0.0316 0.0040 0.0346 ORAOV1 Body chr11:69489754-69490329 N_Shore

cg03174521 0.5270 -0.0457 0.0061 0.0305 OSBPL5 5'UTR;5'UTR;5'UTR chr11:3181574-3182120 N_Shelf

cg17451879 0.9468 -0.1028 0.0314 0.0128 OSBPL9 3'UTR;3'UTR;3'UTR;3'UTR;3'UTR;3'UTR;3'UTR

cg20707692 -0.3478 0.0367 0.0299 0.0129 OSR1 5'UTR chr2:19555789-19558403 N_Shore

cg09222115 0.5110 -0.0540 0.0119 0.0374 OTOS 5'UTR chr2:241075403-241075916 S_Shelf

cg21933175 0.4216 -0.0423 0.0048 0.0116 OTX1 TSS1500 chr2:63274475-63279430 Island

cg15607672 -0.5035 0.0591 0.0066 0.0088 OTX2 TSS200 chr14:57278068-57278287 N_Shore

cg04731988 -0.4344 0.0421 0.0040 0.0487 OXT TSS1500 chr20:3052097-3053103 N_Shore

cg22373508 -0.2004 0.0459 0.0380 0.0468 P2RX2 Body;Body;Body;Body;Body;Body chr12:133194868-133195544 S_Shore

cg16955074 0.7648 -0.0427 0.0106 0.0174 P2RX4 3'UTR

cg15867829 -0.3181 0.0444 0.0134 0.0236 PABPC4L 3'UTR

cg18853010 0.8466 -0.0329 0.0039 0.0293 PACS2 Body;Body chr14:105836031-105836386 Island

cg06059147 -0.4224 0.0423 0.0031 0.0144 PADI1 Body

cg15149491 -0.6859 0.0477 0.0470 0.0036 PAK4 Body;Body;Body;Body;Body chr19:39663600-39663815 N_Shore

cg17914107 0.6510 -0.0574 0.0333 0.0033 PALLD Body;Body

cg21885107 0.2657 -0.0384 0.0034 0.0100 PAPLN Body chr14:73712288-73712911 Island

cg22805909 0.8671 -0.0536 0.0047 0.0463 PAPOLA TSS1500 chr14:96968154-96969371 N_Shore

cg09461005 0.4712 -0.0310 0.0420 0.0337 PARD3 Body


cg03124214 0.5448 -0.0895 0.0019 0.0034 PARN Body;Body

cg22989843 0.7041 -0.0907 0.0255 0.0071 PAX3 Body;Body;Body;Body;Body;Body chr2:223155726-223156154 N_Shore

cg16113298 0.9365 -0.0516 0.0484 0.0433 PAX6 5'UTR;1stExon;5'UTR;5'UTR chr11:31831620-31839038 Island

cg19073171 -0.4782 0.0549 0.0316 0.0244 PAXIP1 Body;TSS1500 chr7:154794017-154795750 N_Shore

cg14031054 0.4472 -0.0479 0.0026 0.0034 PBX1 Body

cg09001226 0.5187 -0.0369 0.0323 0.0464 PBX2 Body

cg26005973 -0.2034 0.0324 0.0431 0.0499 PCBD1 3'UTR

cg12162886 0.3680 -0.0446 0.0022 0.0217 PCBP3 Body;Body chr21:47318509-47318900 Island

cg09150559 0.5551 -0.0375 0.0031 0.0062 PCDHB10 TSS1500 chr5:140573423-140574316 N_Shore

cg19967668 -0.6361 0.0606 0.0143 0.0312 PCDHB17 Body chr5:140536896-140537766 N_Shore

cg23918315 0.4558 -0.0493 0.0262 0.0405 PCDHB3 TSS1500 chr5:140481546-140482460 N_Shelf

cg05197036 0.6521 -0.0409 0.0422 0.0228 PCDHGA4


y;Body;Body;Body;Body;Body;Body;Body;B

ody;Body;Body;Body;Body chr5:140821228-140821688 S_Shelf

cg15843217 -0.3814 0.0578 0.0378 0.0122 PCGF3 TSS1500 chr4:699541-699951 N_Shore

cg14382564 0.5585 -0.0489 0.0189 0.0421 PCLO Body;Body

cg06008158 1.1363 -0.0451 0.0110 0.0042 PCM1 5'UTR chr8:17780032-17781272 S_Shore

cg09563451 -0.8047 0.0708 0.0031 0.0293 PCNA 5'UTR chr20:5107202-5108086 N_Shelf

cg24494009 -0.4611 0.0398 0.0366 0.0027 PCSK6


y

cg20248866 0.9185 -0.0884 0.0056 0.0141 PCYT2 TSS1500 chr17:79868687-79869811 Island

cg13353733 -0.2669 0.0491 0.0465 0.0259 PDDC1 Body chr11:776803-777998 N_Shelf

cg21913301 0.4221 -0.0387 0.0232 0.0451 PDE3A Body

cg15091868 0.4254 -0.0337 0.0355 0.0469 PDE6B Body;Body;Body chr4:652665-652908 Island

cg16879907 0.4701 -0.0355 0.0066 0.0351 PDE6D Body

cg10661904 0.7365 -0.0678 0.0003 0.0019 PDE6G Body;Body chr17:79614850-79615559 S_Shelf

cg08729135 0.7786 -0.0651 0.0254 0.0027 PDE9A


0;TSS1500;TSS1500;TSS1500;TSS1500;TSS15

00;TSS1500;TSS1500;TSS1500;TSS1500;TSS1

500;TSS1500;TSS1500;TSS1500;TSS1500;TSS

1500 chr21:44073201-44074650 Island

cg20535794 1.0300 -0.0429 0.0218 0.0417 PDGFA Body;Body chr7:556611-562845 Island

cg22268137 0.8634 -0.0607 0.0118 0.0306 PDX1 Body chr13:28498226-28499046 N_Shore

cg20230182 0.6537 -0.0304 0.0301 0.0120 PDZD11 3'UTR chrX:69509644-69509962 N_Shelf


cg17182036 -0.5582 0.0338 0.0114 0.0499 PDZD8 Body

cg21731345 -1.0024 0.0349 0.0380 0.0344 PEX11G TSS1500 chr19:7553699-7554033 S_Shore

cg21812332 0.6680 -0.0421 0.0102 0.0309 PEX19 5'UTR;Body

cg01058932 -0.1959 0.0308 0.0037 0.0094 PFKFB1 TSS1500

cg09274658 -0.4754 0.0478 0.0173 0.0430 PFKL Body;Body chr21:45730220-45730444 N_Shelf

cg16324184 -0.4770 0.0304 0.0172 0.0125 PFKP Body

cg02539829 -0.6612 0.0409 0.0278 0.0032 PGAP1 Body chr2:197791390-197791599 N_Shelf

cg09938881 -0.3018 0.0353 0.0129 0.0182 PGBD5 3'UTR

cg04746197 0.4421 -0.0404 0.0318 0.0156 PHLDA2 TSS1500 chr11:2949788-2951756 Island

cg06040420 0.5850 -0.0333 0.0443 0.0117 PHOSPHO2 Body;5'UTR

cg08062484 0.6446 -0.0411 0.0199 0.0362 PHOX2B 3'UTR chr4:41747508-41747944 Island

cg06564473 0.4256 -0.0352 0.0208 0.0145 PHRF1 Body chr11:597465-597700 S_Shelf

cg23666536 0.5605 -0.0325 0.0049 0.0163 PHTF1 3'UTR

cg00339913 -0.1325 0.0333 0.0361 0.0278 PHYHIP Body;Body

cg27179498 0.4297 -0.0321 0.0103 0.0291 PI4KA 3'UTR;3'UTR chr22:21056258-21058793 S_Shelf

cg05674437 0.8609 -0.0306 0.0310 0.0020 PIGZ 5'UTR chr3:196693765-196694200 Island

cg09706586 -0.8773 0.0604 0.0066 0.0071 PIK3CD Body chr1:9775708-9775997 Island

cg23365392 -0.3370 0.0595 0.0046 0.0466 PILRA TSS1500;TSS1500;TSS1500

cg03747030 0.5435 -0.0319 0.0082 0.0314 PIP5K1C TSS1500 chr19:3699950-3700616 S_Shore

cg14609960 1.0929 -0.0625 0.0299 0.0017 PITRM1 Body chr10:3180174-3180578 Island

cg20146573 0.3622 -0.0308 0.0278 0.0498 PKIA 3'UTR;3'UTR

cg13964781 0.6061 -0.0785 0.0255 0.0101 PKN1 Body;Body chr19:14551998-14552255 S_Shore

cg01775379 -0.2088 0.0444 0.0107 0.0227 PKP4 5'UTR;5'UTR chr2:159313652-159314813 S_Shore

cg04023204 -0.1680 0.0412 0.0024 0.0290 PLA2G15 Body chr16:68278870-68279628 S_Shelf

cg04232541 0.9665 -0.0526 0.0295 0.0480 PLAGL1 5'UTR;5'UTR chr6:144384894-144385888 Island

cg17168630 -0.2707 0.0404 0.0010 0.0187 PLAUR TSS1500;TSS1500;TSS1500 chr19:44172916-44173252 S_Shore

cg14788049 0.6268 -0.0982 0.0264 0.0263 PLCB3 TSS1500 chr11:64018435-64019377 Island

cg03819243 -0.4208 0.0624 0.0073 0.0487 PLCD1 TSS1500 chr3:38070394-38071598 S_Shore

cg27638309 -0.4297 0.0679 0.0124 0.0217 PLCE1 Body;Body

cg26120132 0.7555 -0.0669 0.0099 0.0174 PLEC1


y chr8:144990270-145002135 Island

cg24492508 -0.7469 0.0442 0.0137 0.0062 PLEKHA5 5'UTR;Body

cg23881613 -0.7422 0.0452 0.0140 0.0245 PLVAP 3'UTR chr19:17462721-17463137 Island


cg05961145 0.6153 -0.0449 0.0031 0.0154 PMFBP1 Body;Body

cg00571700 -0.6609 0.0467 0.0184 0.0164 PNCK TSS1500 chrX:152938634-152939544 S_Shore

cg18259342 0.3324 -0.0374 0.0207 0.0338 PNKD Body chr2:219187653-219188251 N_Shelf

cg06484000 -0.3875 0.0399 0.0094 0.0404 PNMAL2 1stExon chr19:46996327-46998437 Island

cg04683830 0.3372 -0.0385 0.0032 0.0248 PNPLA7 Body;Body chr9:140417626-140417856 N_Shore

cg03417156 -0.2896 0.0346 0.0305 0.0225 PODNL1 Body;Body;Body chr19:14043645-14044211 Island

cg16725944 -0.3158 0.0545 0.0021 0.0027 POLE Body

cg10237599 0.6193 -0.0796 0.0221 0.0067 POLR2B Body chr4:57844857-57845202 S_Shore

cg09851883 0.8038 -0.0397 0.0039 0.0116 POLR2K TSS200

cg06095296 -0.6511 0.0426 0.0051 0.0184 POLR3E Body chr16:22337148-22337576 N_Shore

cg22985036 0.8891 -0.0812 0.0351 0.0271 POLS Body

cg16927253 0.8210 -0.0314 0.0169 0.0371 POM121L2 TSS1500 chr6:27279794-27280635 Island

cg02757179 -0.7119 0.0565 0.0428 0.0188 POMC Body;Body chr2:25383939-25384763 S_Shore

cg03027774 0.5853 -0.0319 0.0312 0.0030 POP7 5'UTR chr7:100303014-100304079 Island

cg24118856 -0.5384 0.0806 0.0479 0.0191 PPAN-P2RY11 Body;Body chr19:10224442-10225138 N_Shore

cg16223079 -0.2741 0.0459 0.0397 0.0119 PPCDC Body

cg08514558 0.2282 -0.0409 0.0046 0.0272 PPIF TSS1500 chr10:81107082-81107488 N_Shore

cg11311280 -0.4326 0.0334 0.0006 0.0153 PPM1H Body

cg24834740 0.7918 -0.0384 0.0343 0.0369 PPP1R16B 5'UTR chr20:37434206-37435592 Island

cg14245239 -0.8161 0.0750 0.0239 0.0338 PPP1R1C Body

cg11060379 -0.1389 0.0322 0.0210 0.0194 PPP1R2P1 Body chr6:32847498-32847846 Island

cg22338118 -0.2910 0.0594 0.0029 0.0112 PPP1R9A TSS1500;TSS1500 chr7:94536849-94537477 N_Shore

cg23473849 0.7663 -0.0560 0.0210 0.0379 PPP2R5B TSS200 chr11:64692060-64692496 Island

cg17803298 0.5612 -0.0376 0.0109 0.0228 PPP5C TSS1500 chr19:46850185-46850678 N_Shore

cg09939205 0.4650 -0.0374 0.0314 0.0321 PPPDE2 Body chr22:42016301-42017784 N_Shelf

cg12626589 0.6743 -0.1178 0.0153 0.0085 PPT2 TSS1500;TSS1500;TSS1500 chr6:32121829-32122529 N_Shore

cg25504749 0.9890 -0.1569 0.0080 0.0241 PRAP1 TSS1500;TSS1500

cg13152158 -0.6202 0.0548 0.0111 0.0015 PRDM16 Body;Body chr1:3147845-3148081 N_Shelf

cg00848461 -0.5015 0.0677 0.0399 0.0089 PRELID1 Body;TSS1500;TSS1500 chr5:176730031-176731130 S_Shore

cg00734018 0.7092 -0.0686 0.0132 0.0168 PRIC285 Body;Body chr20:62193966-62198985 Island

cg07242375 1.1792 -0.0711 0.0064 0.0486 PRICKLE3 Body chrX:49042676-49043059 N_Shore

cg18107623 -0.6902 0.0436 0.0019 0.0038 PRKAG2 Body;Body chr7:151479989-151480353 S_Shore

cg18463891 0.5285 -0.0359 0.0218 0.0025 PRKAR1B Body;Body;Body;Body;Body;Body chr7:592620-593058 S_Shore


cg18025961 0.4600 -0.0369 0.0399 0.0033 PRKCZ Body;Body;Body

cg09196146 0.7793 -0.0398 0.0349 0.0046 PRO1768 TSS200;5'UTR

cg04685253 0.4492 -0.0497 0.0212 0.0155 PRR12 Body chr19:50119223-50119476 N_Shore

cg27067781 -0.5964 0.0531 0.0100 0.0058 PRRT1 3'UTR chr6:32116590-32117229 Island

cg13494826 -0.5575 0.0527 0.0070 0.0160 PRRX2 Body

cg02256969 -0.6333 0.0616 0.0143 0.0177 PRSS22 TSS200 chr16:2907574-2907836 S_Shore

cg07530759 -0.6930 0.0460 0.0419 0.0140 PRSS37 TSS1500

cg09970967 -0.4945 0.0851 0.0060 0.0345 PSEN1 TSS1500;TSS1500 chr14:73602898-73603747 N_Shore

cg10778455 0.7429 -0.0523 0.0184 0.0364 PSMA2 3'UTR

cg13610026 -0.2504 0.0449 0.0161 0.0106 PSMB7 Body

cg13806767 0.5707 -0.0644 0.0277 0.0225 PSMD14 TSS1500 chr2:162164675-162165248 N_Shore

cg00052482 -0.7864 0.1180 0.0081 0.0304 PSMD4 TSS1500

cg24054649 0.5649 -0.0305 0.0133 0.0446 PSME1 TSS1500;TSS1500 chr14:24605082-24605760 N_Shore

cg13671374 0.4312 -0.0501 0.0176 0.0394 PSORS1C1 Body;Body

cg06613515 -0.2600 0.0312 0.0082 0.0016 PSTPIP1 5'UTR;1stExon

cg02348462 0.4373 -0.0475 0.0044 0.0416 PTBP1 Body;Body;Body;Body chr19:807131-807445 Island

cg13974838 0.7354 -0.0543 0.0205 0.0172 PTCH1 Body;Body;Body;Body;Body;Body;Body

cg00554604 0.9943 -0.0576 0.0038 0.0387 PTDSS2 Body chr11:460468-460715 Island

cg13712952 0.8633 -0.0621 0.0042 0.0292 PTENP1 TSS1500

cg13853217 -0.8409 0.0734 0.0199 0.0129 PTGES3 3'UTR

cg00028636 1.8420 -0.1413 0.0296 0.0296 PTMS Body chr12:6875481-6876923 Island

cg02349739 -0.6756 0.0338 0.0090 0.0039 PTOV1 Body chr19:50353790-50355483 Island

cg05394244 0.6303 -0.0648 0.0033 0.0134 PTP4A1 TSS1500 chr6:64282151-64283736 N_Shore

cg15975802 -0.3565 0.0377 0.0400 0.0270 PTPN6 TSS1500 chr12:7053149-7053927 S_Shore

cg01437204 0.6449 -0.0418 0.0229 0.0160 PTPN7 TSS1500;TSS1500

cg00086113 -0.4018 0.0384 0.0011 0.0255 PTPN9 3'UTR

cg13382703 -0.8637 0.0444 0.0297 0.0304 PTPRF Body;Body chr1:44056755-44057179 Island

cg24389102 1.1078 -0.0455 0.0103 0.0172 PTPRK Body;Body

cg10225197 0.6936 -0.0621 0.0003 0.0002 PTPRN Body;TSS1500 chr2:220159438-220159977 Island

cg25120425 0.5207 -0.0433 0.0218 0.0058 PTPRN2 Body;Body;Body

cg23836612 -0.5591 0.0350 0.0115 0.0179 PUS1 Body;Body;Body chr12:132413338-132414801 S_Shelf

cg25328384 -0.3633 0.0540 0.0479 0.0113 PVR 3'UTR;3'UTR;3'UTR

cg14094027 -0.7737 0.1066 0.0398 0.0343 PXN 5'UTR;Body;Body


cg09587549 -0.3921 0.0424 0.0051 0.0427 PYCARD 5'UTR;1stExon;5'UTR;1stExon chr16:31213566-31214287 Island

cg13532359 0.3816 -0.0332 0.0007 0.0053 QSOX2 Body

cg16352485 0.7997 -0.0520 0.0261 0.0484 RAB11FIP3 Body;Body chr16:532467-532669 Island

cg10892375 -0.8824 0.0428 0.0320 0.0430 RAB2B Body;Body;TSS1500;TSS200 chr14:21944914-21945812 N_Shore

cg19404781 0.8502 -0.0423 0.0309 0.0394 RAB3GAP2 Body;Body

cg07476963 0.6069 -0.0514 0.0021 0.0177 RABGAP1L TSS1500 chr1:174128296-174129289 N_Shore

cg21131421 0.5510 -0.0419 0.0139 0.0445 RAD51L1 Body;Body;Body

cg01718580 -0.5133 0.0442 0.0226 0.0109 RAET1G Body chr6:150243902-150244210 N_Shore

cg08631427 1.1324 -0.0874 0.0019 0.0342 RAET1L TSS200

cg11778749 1.2123 -0.1318 0.0004 0.0060 RAGE TSS1500 chr14:102771116-102771718 S_Shore

cg10870160 0.3065 -0.0401 0.0353 0.0262 RAI1 5'UTR chr17:17697710-17698063 N_Shelf

cg03291819 -0.4037 0.0375 0.0349 0.0146 RAI2 5'UTR chrX:17878441-17878888 N_Shelf

cg20842915 0.7054 -0.0972 0.0183 0.0143 RALA 5'UTR chr7:39662543-39663792 S_Shore

cg03562117 0.5166 -0.0311 0.0040 0.0151 RALYL Body;Body;Body;Body

cg06293049 0.5473 -0.0406 0.0280 0.0457 RARG 5'UTR chr12:53625629-53625993 N_Shelf

cg10626896 0.5030 -0.0363 0.0474 0.0019 RASA3 Body chr13:114813942-114814457 N_Shelf

cg23525051 0.7310 -0.0379 0.0141 0.0446 RASGRP1 Body;Body chr15:38856262-38857658 N_Shelf

cg14750543 0.6140 -0.0438 0.0027 0.0093 RASSF2 Body;Body

cg02035751 -0.2142 0.0465 0.0090 0.0316 RASSF5 Body;TSS1500;Body chr1:206730397-206730908 N_Shore

cg08646051 0.9353 -0.0523 0.0205 0.0065 RASSF8 5'UTR;5'UTR;5'UTR;5'UTR;1stExon

cg13911392 0.6584 -0.0478 0.0068 0.0304 RAVER1 TSS1500;Body chr19:10443688-10446022 Island

cg27222157 0.5105 -0.0379 0.0016 0.0217 RBM14 TSS1500 chr11:66383571-66385047 N_Shore

cg13172905 0.9124 -0.0608 0.0216 0.0318 RBPMS Body;Body;Body;Body

cg05523906 -0.6464 0.0400 0.0082 0.0067 RCC2 Body;Body

cg15836710 -0.5289 0.0412 0.0247 0.0382 RDBP Body chr6:31926489-31926940 N_Shelf

cg18628371 0.3559 -0.0363 0.0285 0.0157 REC8 TSS200;TSS200 chr14:24641053-24642220 Island

cg20880031 0.9758 -0.0653 0.0036 0.0483 RELN TSS1500;TSS1500 chr7:103629525-103630652 S_Shore

cg01295673 0.5931 -0.0491 0.0488 0.0077 RFC5 TSS1500;TSS1500;TSS1500;TSS1500 chr12:118454391-118454996 N_Shore

cg09690219 -0.6165 0.0463 0.0188 0.0214 RFXAP Body chr13:37393213-37394092 S_Shelf

cg23889610 0.8480 -0.0559 0.0188 0.0394 RGL1 Body

cg05876591 0.6037 -0.0491 0.0450 0.0332 RGL2 Body;Body chr6:33266302-33267582 N_Shore

cg00415704 -0.2734 0.0412 0.0004 0.0056 RGMA Body;5'UTR chr15:93631428-93633173 N_Shore

cg19111287 -0.2731 0.0397 0.0027 0.0146 RGS12 Body;Body;Body chr4:3374733-3374998 N_Shore


cg15452973 0.9107 -0.0550 0.0015 0.0237 RGS22 Body chr8:101117922-101118693 N_Shelf

cg21219268 0.3986 -0.0352 0.0492 0.0452 RGS3 Body;Body;Body

cg11093040 1.2495 -0.1208 0.0387 0.0131 RHBDD1 5'UTR;5'UTR chr2:227700313-227701115 S_Shore

cg17284809 1.1575 -0.0477 0.0111 0.0111 RHBDL3 Body chr17:30593198-30594033 S_Shore

cg06216293 -0.2740 0.0416 0.0171 0.0198 RHBG Body;Body chr1:156338758-156339251 Island

cg05939380 -0.6434 0.0808 0.0019 0.0317 RHCG Body chr15:90029931-90030328 Island

cg09618778 0.1766 -0.0329 0.0448 0.0464 RHOD Body chr11:66838918-66839192 Island

cg20599295 1.0547 -0.1502 0.0422 0.0446 RILPL1 Body

cg15811568 -0.7863 0.0796 0.0191 0.0397 RIMBP2 Body chr12:130908777-130909191 N_Shelf

cg26099432 0.6416 -0.0583 0.0467 0.0135 RIMS1 Body;Body;Body;Body;Body;Body

cg19702383 0.8605 -0.0880 0.0054 0.0462 RMST Body;TSS200

cg03117412 -0.7284 0.0576 0.0449 0.0293 RNASEH1 Body chr2:3605489-3606332 N_Shore

cg07222133 0.7963 -0.0423 0.0062 0.0456 RNF130 TSS1500 chr5:179498291-179499338 S_Shore

cg03166236 -0.6073 0.0434 0.0271 0.0499 RNF144A 5'UTR chr2:7057530-7058433 S_Shelf

cg08521800 1.0150 -0.0604 0.0277 0.0444 RNF180 5'UTR;5'UTR chr5:63461448-63462106 S_Shore

cg23782719 0.7720 -0.0433 0.0130 0.0114 RNF182 Body;Body;Body;Body

cg21210232 0.7799 -0.1326 0.0482 0.0327 RNF207 Body chr1:6268820-6269588 N_Shore

cg21231302 -0.2975 0.0374 0.0367 0.0203 RNF208 TSS1500 chr9:140115986-140118466 Island

cg12852872 -0.5317 0.0412 0.0142 0.0066 RNF213 Body;Body

cg20160729 -0.6071 0.0646 0.0095 0.0109 RNF216 Body;Body

cg01209655 -0.4754 0.0303 0.0080 0.0124 RNF39 Body;Body chr6:30042918-30043500 N_Shore

cg15661311 0.5878 -0.0446 0.0006 0.0131 RNH1

5'UTR;5'UTR;5'UTR;5'UTR;5'UTR;5'UTR;5'UT

R;5'UTR chr11:504189-504659 Island

cg16047663 1.6119 -0.0845 0.0023 0.0173 RNPEP 3'UTR

cg11080651 -0.4705 0.0346 0.0134 0.0048 ROPN1L Body chr5:10441605-10442512 S_Shelf

cg02458188 -0.3590 0.0305 0.0371 0.0288 RORA Body

cg24741392 0.9960 -0.0392 0.0027 0.0172 RPGR Body;Body chrX:38186422-38187010 Island

cg13829638 -0.3569 0.0539 0.0154 0.0032 RPL35 Body chr9:127623557-127624486 N_Shelf

cg09867945 -0.1481 0.0306 0.0297 0.0392 RPS10P7 Body

cg20486651 0.6383 -0.0901 0.0347 0.0271 RPS6KA2 Body

cg03043406 0.8000 -0.0869 0.0433 0.0012 RPS8 Body;TSS1500 chr1:45241013-45241900 S_Shore

cg15946337 0.6741 -0.0464 0.0401 0.0116 RPTOR Body;Body chr17:78775591-78775815 N_Shelf

cg26417554 0.5357 -0.0792 0.0236 0.0321 RPUSD3 TSS1500;TSS1500 chr3:9885512-9885780 S_Shore


cg21534309 0.3974 -0.0422 0.0061 0.0430 RSF1 Body

cg01625761 -0.7109 0.0474 0.0054 0.0186 RTN4IP1 Body

cg11504646 0.6853 -0.0468 0.0414 0.0284 RTP1 TSS1500 chr3:186917411-186917756 N_Shelf

cg02767634 -0.3567 0.0433 0.0025 0.0195 RUFY1 3'UTR;3'UTR;3'UTR

cg10475689 -0.2527 0.0472 0.0232 0.0091 RUNDC2A Body

cg22234962 -0.7459 0.0356 0.0256 0.0247 RUSC1 5'UTR;5'UTR;5'UTR chr1:155292469-155295433 N_Shore

cg23519671 0.9964 -0.1102 0.0413 0.0333 RYR1 Body;Body chr19:39009876-39010142 S_Shore

cg10725912 0.5991 -0.0435 0.0204 0.0198 RYR3 Body

cg17421062 -0.2031 0.0398 0.0028 0.0308 S100A7 5'UTR

cg10297473 0.4923 -0.0542 0.0014 0.0060 SALL1 Body;5'UTR chr16:51183699-51188763 Island

cg03712816 0.6140 -0.0444 0.0398 0.0075 SALL3 Body chr18:76737005-76741244 Island

cg06036236 -0.6251 0.0612 0.0308 0.0191 SAMD11 Body chr1:869332-871872 S_Shore

cg27512513 0.7861 -0.0365 0.0036 0.0346 SAMD12 Body

cg21483922 0.5991 -0.0580 0.0114 0.0201 SAMD14 5'UTR chr17:48206663-48207601 N_Shore

cg09274864 -0.5047 0.0319 0.0002 0.0051 SAMD4A Body;Body;Body chr14:55226963-55227200 Island

cg07224310 -0.4548 0.0346 0.0074 0.0368 SAPS2 Body chr22:50862756-50862967 Island

cg12465490 -0.4377 0.0421 0.0437 0.0354 SARS 3'UTR

cg26131754 0.7121 -0.0317 0.0410 0.0093 SATB1 TSS1500;5'UTR chr3:18467440-18467664 Island

cg14736108 0.4664 -0.0320 0.0275 0.0117 SBK2 1stExon chr19:56047403-56047668 Island

cg18693051 -0.2812 0.0334 0.0078 0.0045 SBNO2 5'UTR chr19:1163466-1163876 N_Shore

cg22303442 0.5402 -0.0436 0.0144 0.0401 SCARA5 Body chr8:27737077-27737289 N_Shelf

cg05131292 0.5891 -0.0329 0.0398 0.0143 SCARNA3 Body;Body;Body

cg27585618 0.5509 -0.0369 0.0379 0.0470 SCML4 5'UTR

cg15422644 -0.3370 0.0389 0.0424 0.0451 SCN8A Body chr12:52115410-52115679 S_Shore

cg14836522 0.1938 -0.0328 0.0047 0.0058 SDC3 Body

cg12242474 -0.4777 0.0754 0.0412 0.0140 SDCBP2 Body;Body chr20:1293681-1294328 Island

cg23956499 -0.6194 0.0528 0.0364 0.0101 SDCCAG8 Body chr1:243637639-243638142 N_Shelf

cg20871445 0.7884 -0.0339 0.0094 0.0202 SDF4 5'UTR;5'UTR;TSS1500 chr1:1167001-1168985 N_Shore

cg26275264 0.2884 -0.0362 0.0000 0.0014 SDK1 Body;Body

cg26261291 -0.5906 0.0571 0.0221 0.0070 SDK2 Body chr17:71431621-71431878 S_Shelf

cg13855364 0.3372 -0.0365 0.0115 0.0308 SEC16A 3'UTR chr9:139332839-139334501 S_Shore

cg03322752 -0.7205 0.0631 0.0494 0.0213 SEC61G Body;Body chr7:54826581-54827188 N_Shelf

cg06093460 0.4360 -0.0316 0.0036 0.0086 SELE 5'UTR


cg22927302 -0.1967 0.0391 0.0105 0.0215 SEMA3B TSS1500;TSS1500

cg11016195 0.7477 -0.0490 0.0130 0.0468 SEMA5A 5'UTR

cg18419070 -0.8618 0.0449 0.0335 0.0490 SEMA5B Body

cg01791648 0.3298 -0.0473 0.0266 0.0158 SENP7 TSS1500;TSS1500 chr3:101231610-101232173 S_Shore

cg02506716 1.2046 -0.1717 0.0047 0.0044 SEPT10 Body;Body chr2:110370906-110373301 N_Shore

cg07429284 0.5512 -0.0433 0.0273 0.0431 SEPT8 Body;5'UTR;Body;Body

cg00817885 0.6595 -0.0490 0.0122 0.0350 SERPINA7 TSS1500

cg17330652 0.6796 -0.0323 0.0391 0.0483 SERPINC1 5'UTR;1stExon

cg23007535 0.4163 -0.0364 0.0158 0.0129 SETD2 Body

cg22885062 0.4399 -0.0402 0.0444 0.0436 SF1 Body;Body;Body chr11:64532936-64533763 Island

cg20822858 1.4276 -0.0757 0.0018 0.0225 SGK1 Body;TSS1500 chr6:134497536-134497756 S_Shore

cg18378817 -0.5493 0.0565 0.0041 0.0281 SGTA 3'UTR chr19:2757566-2757856 N_Shore

cg07647796 0.8366 -0.0863 0.0022 0.0294 SH2B1 Body;Body;Body;Body;Body

cg22633936 -0.3537 0.0511 0.0217 0.0235 SH2D4B Body;1stExon;5'UTR

cg13415795 -0.4899 0.0572 0.0028 0.0375 SH2D7 3'UTR

cg08222309 0.4810 -0.0535 0.0479 0.0094 SH3BGRL TSS1500;5'UTR

cg04493432 0.5171 -0.0721 0.0059 0.0435 SH3TC1 5'UTR

cg13018402 0.6225 -0.0554 0.0131 0.0071 SH3TC2 TSS1500

cg00646241 0.6133 -0.0806 0.0106 0.0449 SHANK2 Body chr11:70563664-70563886 Island

cg03193168 0.2453 -0.0451 0.0001 0.0044 SHANK3 Body chr22:51158386-51160060 Island

cg17833341 0.7037 -0.0357 0.0415 0.0112 SHC1 TSS1500;TSS1500;Body;Body chr1:154946742-154947486 Island

cg24736471 0.8292 -0.0585 0.0234 0.0186 SHC4 Body;1stExon;3'UTR chr15:49170144-49170710 S_Shore

cg23704066 1.4204 -0.0317 0.0024 0.0294 SHFM1 1stExon chr7:96338816-96339277 Island

cg02852989 0.5680 -0.0309 0.0050 0.0164 SHISA7 TSS1500 chr19:55953371-55954641 S_Shore

cg19535267 0.7615 -0.0652 0.0041 0.0003 SHMT2


y chr12:57623420-57623903 S_Shore

cg21433933 -0.3329 0.0526 0.0217 0.0105 SHROOM1 TSS1500 chr5:132160904-132161809 S_Shore

cg24592906 1.1882 -0.1613 0.0299 0.0052 SIM1 1stExon;5'UTR chr6:100912071-100913337 N_Shore

cg02194789 0.6460 -0.0946 0.0043 0.0140 SIM2 Body;Body chr21:38068193-38073891 S_Shore

cg00328376 0.7195 -0.0578 0.0484 0.0388 SKAP2 Body chr7:26903869-26904753 N_Shore

cg07574267 0.5057 -0.0327 0.0033 0.0300 SKI 3'UTR chr1:2236442-2239069 Island

cg24521988 -0.7012 0.0478 0.0039 0.0077 SKIV2L Body chr6:31926489-31926940 S_Shore

cg04656051 -0.2743 0.0313 0.0320 0.0052 SLC11A1 Body chr2:219252421-219252631 Island


cg27585120 0.6959 -0.0357 0.0028 0.0025 SLC12A7 Body chr5:1077844-1078056 N_Shore

cg00087274 -0.3397 0.0393 0.0071 0.0114 SLC12A8 Body chr3:124860569-124861019 N_Shelf

cg13261725 0.5391 -0.0401 0.0284 0.0167 SLC17A4 5'UTR

cg27083019 0.4072 -0.0300 0.0391 0.0453 SLC17A7 TSS1500 chr19:49946345-49947222 N_Shore

cg10385290 1.0263 -0.0686 0.0086 0.0302 SLC1A6 TSS200

cg12439773 -0.2336 0.0449 0.0460 0.0434 SLC22A6 1stExon;1stExon;1stExon;1stExon

cg22177795 -0.6865 0.0388 0.0104 0.0214 SLC23A2 5'UTR;TSS200

cg18467110 0.6348 -0.0393 0.0220 0.0429 SLC25A36 Body;Body chr3:140660334-140661602 Island

cg14218435 0.4915 -0.0764 0.0295 0.0203 SLC26A9 Body;Body;Body

cg02114341 0.5019 -0.0455 0.0121 0.0004 SLC29A3 Body chr10:73078857-73079181 S_Shelf

cg23338195 0.8783 -0.0690 0.0484 0.0013 SLC30A8 TSS1500

cg05936441 0.5690 -0.0313 0.0107 0.0472 SLC32A1 Body chr20:37352130-37357372 Island

cg18492059 0.4337 -0.0405 0.0071 0.0430 SLC38A5 TSS1500

cg19805748 -0.1476 0.0391 0.0426 0.0001 SLC39A11 Body;Body

cg19668951 0.8967 -0.0733 0.0235 0.0103 SLC39A13 5'UTR;5'UTR chr11:47429733-47430346 S_Shore

cg16061354 0.4985 -0.0367 0.0279 0.0389 SLC43A2 Body chr17:1531110-1533229 N_Shelf

cg07067982 -0.8366 0.0467 0.0231 0.0111 SLC43A3 5'UTR;5'UTR;1stExon;5'UTR chr11:57194340-57194650 Island

cg00087735 -0.6701 0.0321 0.0317 0.0097 SLC45A1 Body chr1:8390202-8390800 Island

cg03426615 0.7251 -0.0707 0.0491 0.0395 SLC4A2 Body

cg02523679 -0.2700 0.0525 0.0028 0.0280 SLC6A13 TSS1500

cg02830714 0.5256 -0.0549 0.0402 0.0451 SLC6A18 Body chr5:1232352-1232594 Island

cg10778996 0.8250 -0.0475 0.0112 0.0430 SLC7A1 Body

cg15070897 -0.5713 0.0372 0.0019 0.0356 SLC7A7 5'UTR;1stExon;5'UTR;5'UTR

cg11282353 -0.3798 0.0463 0.0016 0.0283 SLCO2A1 Body

cg20018563 -0.2624 0.0403 0.0062 0.0075 SLCO3A1 Body;Body

cg20421928 0.8586 -0.1050 0.0106 0.0390 SLIT3 Body

cg04642759 1.9774 -0.1824 0.0165 0.0362 SLITRK2 TSS1500;TSS1500;TSS1500;TSS1500 chrX:144899363-144900266 N_Shore

cg05720429 1.3079 -0.0644 0.0000 0.0001 SMARCA5 Body chr4:144434249-144435343 S_Shore

cg05311180 0.5944 -0.0491 0.0124 0.0446 SMARCAL1 Body;Body

cg17154187 2.6986 -0.0481 0.0103 0.0280 SMCR7 TSS200;TSS1500;TSS200 chr17:18163685-18164672 Island

cg06745378 0.7634 -0.0552 0.0456 0.0265 SMEK2 Body;Body chr2:55844267-55845065 N_Shelf

cg02873263 -0.5323 0.0553 0.0260 0.0181 SMOC1 Body;Body

cg02922084 -0.4653 0.0582 0.0350 0.0232 SMOC2 Body;Body


cg06768213 -0.5705 0.0675 0.0087 0.0228 SNAP47 Body

cg12634276 0.6084 -0.0333 0.0362 0.0307 SNORA26 TSS1500;TSS1500 chr4:53578358-53579238 N_Shore

cg16050237 0.6515 -0.0364 0.0283 0.0361 SNORD115-10 TSS1500;TSS1500

cg07664976 0.6520 -0.0366 0.0488 0.0454 SNORD116-26 TSS200

cg27122942 0.9656 -0.0366 0.0171 0.0220 SNORD15A TSS1500;TSS200 chr11:75110493-75110924 N_Shore

cg00821444 0.9061 -0.0588 0.0078 0.0189 SNORD34 TSS200;Body;TSS1500;Body chr19:49990435-49990965 S_Shelf

cg03557725 -0.4899 0.0836 0.0019 0.0252 SNRPF TSS1500 chr12:96252020-96252246 N_Shore

cg11164993 1.2884 -0.0615 0.0408 0.0402 SNX12 TSS1500 chrX:70287890-70288359 S_Shore

cg27081230 0.8179 -0.0591 0.0052 0.0411 SNX20 TSS1500;TSS1500;TSS1500

cg14135783 0.8513 -0.0681 0.0030 0.0165 SNX8 Body chr7:2318238-2319079 Island

cg05761277 0.6572 -0.0396 0.0233 0.0054 SOCS3 TSS1500 chr17:76354818-76357038 Island

cg09190795 -0.5096 0.0671 0.0138 0.0115 SOLH 5'UTR chr16:587567-588172 N_Shelf

cg27312979 -0.2097 0.0351 0.0125 0.0494 SORBS1 Body;Body;Body;Body;Body;Body;Body

cg04928457 0.4411 -0.0430 0.0052 0.0074 SORBS2 5'UTR

cg25606172 0.7926 -0.0632 0.0036 0.0019 SORCS2 Body

cg26807939 0.6978 -0.0510 0.0320 0.0391 SOX14 TSS1500 chr3:137482964-137484454 Island

cg22530053 1.2155 -0.0577 0.0102 0.0352 SOX2OT Body;TSS1500 chr3:181430141-181431076 N_Shore

cg08625851 0.4871 -0.0327 0.0024 0.0020 SOX4 TSS200 chr6:21594613-21596437 N_Shore

cg14242042 0.8169 -0.0447 0.0349 0.0369 SOX5 5'UTR chr12:24714956-24716243 Island

cg26516680 1.1742 -0.0599 0.0140 0.0103 SPAG17 Body

cg26845278 -0.6252 0.0573 0.0294 0.0087 SPATA21 1stExon;5'UTR chr1:16766998-16767803 N_Shelf

cg10202436 0.6902 -0.1085 0.0446 0.0159 SPATA24 Body chr5:138727710-138730911 S_Shelf

cg06029050 0.6374 -0.0319 0.0101 0.0382 SPCS2 1stExon;TSS200 chr11:74659931-74660373 S_Shore

cg20456243 0.5421 -0.0576 0.0469 0.0022 SPEG Body chr2:220348955-220349784 S_Shelf

cg17041861 0.7746 -0.0402 0.0004 0.0075 SPIRE1 5'UTR;Body;Body chr18:12657044-12658727 N_Shelf

cg22453911 0.3732 -0.0421 0.0067 0.0257 SPPL2B 3'UTR;3'UTR chr19:2354289-2354560 Island

cg20410997 0.6440 -0.0320 0.0171 0.0458 SPRY4 TSS1500;TSS1500 chr5:141705391-141705688 N_Shore

cg10912634 -0.8632 0.0737 0.0042 0.0373 SRA1 3'UTR chr5:139927157-139927491 S_Shelf

cg03641529 0.7570 -0.0676 0.0190 0.0311 SREBF1 Body;Body chr17:17715696-17716219 Island

cg18278184 0.5668 -0.0561 0.0109 0.0334 SRGN TSS1500

cg07166266 -0.3846 0.0461 0.0087 0.0420 SRP68 Body chr17:74068174-74068756 N_Shore

cg18034259 0.4110 -0.0477 0.0128 0.0099 SRRM3 Body chr7:75896510-75896944 S_Shore

cg25240254 -0.3232 0.0518 0.0457 0.0035 SSC5D Body chr19:56000722-56001026 Island


cg07700680 0.6151 -0.0328 0.0488 0.0392 SSH1 Body;Body;Body

cg22537597 -0.2331 0.0467 0.0152 0.0122 SSPO 3'UTR

cg14757173 -0.1642 0.0357 0.0017 0.0249 SSTR3 3'UTR chr22:37603001-37603753 N_Shore

cg02231767 0.6505 -0.0533 0.0166 0.0148 ST18 5'UTR

cg14640789 0.6883 -0.0506 0.0008 0.0081 ST3GAL1 Body;Body

cg07929956 0.6318 -0.0440 0.0165 0.0355 ST3GAL2 5'UTR

cg13338207 0.5035 -0.0336 0.0440 0.0072 ST3GAL6 5'UTR chr3:98451286-98452225 S_Shore

cg17653583 -0.8700 0.0557 0.0208 0.0481 ST7OT3 TSS1500;Body;Body

cg20723302 0.5480 -0.0331 0.0000 0.0028 STAP1 TSS1500

cg24997845 0.6371 -0.0333 0.0026 0.0162 STAT1 5'UTR;5'UTR chr2:191878608-191879253 N_Shore

cg17587998 0.5229 -0.0318 0.0336 0.0429 STK19 TSS1500;TSS1500;TSS1500;Body chr6:31939730-31940559 N_Shore

cg09124518 1.2114 -0.1088 0.0007 0.0159 STK32C Body chr10:134120447-134122422 N_Shore

cg24110635 0.5119 -0.0459 0.0065 0.0123 STK38L Body

cg23917779 -0.5303 0.0783 0.0071 0.0100 STK40 Body chr1:36807362-36807584 Island

cg15527491 0.9394 -0.0887 0.0151 0.0007 STMN1 Body;Body;Body;Body chr1:26231950-26233624 N_Shelf

cg18628646 0.3773 -0.0481 0.0365 0.0390 STOX2 Body

cg04798930 1.0083 -0.0497 0.0037 0.0286 STRN Body chr2:37193131-37194287 N_Shore

cg03602730 0.8543 -0.0414 0.0171 0.0297 STXBP5L TSS200 chr3:120626880-120627579 Island

cg23124755 0.5650 -0.0309 0.0018 0.0051 SUGT1P1 Body;1stExon chr9:33447446-33447824 Island

cg24069221 -0.3779 0.0562 0.0227 0.0357 SUMO4 3'UTR;Body;1stExon

cg08739188 0.5739 -0.0492 0.0338 0.0314 SV2C TSS1500 chr5:75377898-75378189 N_Shore

cg22439459 0.3694 -0.0375 0.0218 0.0188 SVOPL Body;Body chr7:138348962-138349444 N_Shelf

cg09105523 -0.4816 0.0307 0.0236 0.0100 SYCP2L Body chr6:10887184-10887622 S_Shore

cg01513802 0.5088 -0.0378 0.0049 0.0356 SYNE1 Body;5'UTR;Body;Body

cg14008998 0.6803 -0.0529 0.0493 0.0166 SYNE2 Body;Body

cg00789347 0.7254 -0.0744 0.0077 0.0325 SYNGR3 TSS1500 chr16:2040034-2040628 N_Shore

cg27550918 0.2709 -0.0384 0.0228 0.0425 SYNPO2L 1stExon;5'UTR;Body chr10:75407413-75407706 S_Shelf

cg04013592 0.4621 -0.0400 0.0032 0.0207 SYNPR TSS1500 chr3:63263989-63264205 N_Shore

cg18176363 0.6146 -0.0492 0.0343 0.0101 SYT1 Body;Body;Body

cg24720849 -0.9362 0.1423 0.0112 0.0449 SYT8 TSS1500

cg17007339 1.3021 -0.0915 0.0024 0.0166 SYTL2

Body;TSS1500;TSS1500;Body;TSS1500;Body

;Body;Body

cg08036278 -0.8924 0.0453 0.0106 0.0254 SYVN1 TSS1500;TSS1500 chr11:64901526-64902107 S_Shore


cg22186380 -0.2649 0.0404 0.0015 0.0078 TAAR2 Body;TSS1500

cg00554413 0.4207 -0.0418 0.0175 0.0368 TACSTD2 1stExon chr1:59042013-59043295 Island

cg18624274 -0.8776 0.0406 0.0416 0.0344 TADA3

5'UTR;TSS200;1stExon;TSS200;TSS200;1stEx

on;5'UTR chr3:9833992-9834985 Island

cg18266257 -0.5572 0.0597 0.0109 0.0009 TAP2 Body;Body chr6:32806284-32806669 N_Shelf

cg18930100 0.6305 -0.0401 0.0017 0.0302 TAPBP Body;Body;Body chr6:33281112-33281827 N_Shore

cg04615639 -0.7730 0.0955 0.0051 0.0361 TBC1D16 5'UTR chr17:77997723-77997951 Island

cg13689390 -0.5701 0.0346 0.0326 0.0363 TBC1D2 Body chr9:101017382-101018581 N_Shelf

cg01008267 -0.6148 0.0629 0.0002 0.0073 TBC1D22A Body chr22:47513202-47513585 S_Shore

cg01850334 0.5876 -0.0402 0.0019 0.0228 TBC1D8 Body

cg22736682 -0.4487 0.0331 0.0465 0.0005 TBCB Body chr19:36612342-36612932 S_Shore

cg07114009 -0.4482 0.0409 0.0261 0.0048 TBCD Body;TSS200

cg09728865 -0.2161 0.0421 0.0063 0.0154 TBL1Y 5'UTR;5'UTR;5'UTR chrY:6778574-6780028 Island

cg24710073 0.3020 -0.0482 0.0058 0.0351 TBP 5'UTR chr6:170862124-170862480 S_Shore

cg06797808 1.1092 -0.1017 0.0037 0.0093 TBX10 Body chr11:67396844-67398294 S_Shelf

cg00598758 0.5191 -0.0438 0.0335 0.0138 TBX20 Body;Body chr7:35292985-35294674 N_Shore

cg03559073 -0.4802 0.0398 0.0169 0.0461 TBX5 Body;Body;Body;Body chr12:114833911-114834210 N_Shore

cg14179628 -0.3776 0.0523 0.0134 0.0106 TCEAL7 TSS1500

cg14047630 -0.2410 0.0405 0.0132 0.0046 TCERG1L Body

cg04129308 0.3398 -0.0342 0.0017 0.0228 TCF21 3'UTR chr6:134216919-134217280 N_Shore

cg13484329 -0.2248 0.0527 0.0173 0.0212 TCHP Body;Body

cg03928812 0.6383 -0.0424 0.0290 0.0318 TCN1 TSS1500

cg27547703 0.7871 -0.0602 0.0128 0.0495 TDRD1 TSS200 chr10:115938962-115939292 Island

cg09191594 0.6404 -0.0339 0.0473 0.0258 TDRD9 Body

cg11777321 0.9181 -0.0385 0.0280 0.0095 TEF Body;Body chr22:41777430-41778281 S_Shore

cg12888231 0.5148 -0.0334 0.0344 0.0145 TESC Body;Body;Body chr12:117484305-117484627 Island

cg05798717 0.5681 -0.0457 0.0165 0.0280 TFAP2D Body chr6:50682334-50683214 S_Shore

cg24685006 1.4017 -0.0462 0.0111 0.0040 TFAP2E Body chr1:36042432-36043444 Island

cg09410308 1.2737 -0.0972 0.0112 0.0027 TFF2 3'UTR

cg04806409 -0.2208 0.0376 0.0264 0.0289 TFF3 1stExon

cg21778644 -0.8212 0.0513 0.0022 0.0203 TGFBRAP1 Body;Body

cg23278885 -0.4847 0.0702 0.0475 0.0435 TGM6 TSS200

cg16929107 -1.0441 0.0440 0.0297 0.0091 TGOLN2 Body chr2:85554134-85555414 Island


cg17499251 1.0864 -0.1164 0.0061 0.0292 THEG Body;Body chr19:375830-376094 N_Shelf

cg01075002 0.6198 -0.0517 0.0344 0.0373 TIAM2 Body

cg17639290 0.4836 -0.0306 0.0159 0.0325 TIMM8B Body;TSS1500;Body chr11:111957352-111957681 N_Shore

cg08479319 -0.4195 0.0335 0.0018 0.0079 TIPIN 5'UTR chr15:66648784-66649178 Island

cg22696612 -0.2750 0.0580 0.0477 0.0254 TKTL1 Body;Body chrX:153523741-153524175 S_Shelf

cg07015886 -0.3155 0.0629 0.0332 0.0092 TLR5 TSS1500 chr1:223316185-223316689 S_Shore

cg07792815 0.4892 -0.0358 0.0411 0.0195 TMC5 Body;Body;Body

cg24867468 0.9584 -0.1255 0.0069 0.0202 TMC6 3'UTR;3'UTR

cg04947157 -0.3484 0.0360 0.0231 0.0162 TMC8 Body;5'UTR;1stExon chr17:76127521-76128406 S_Shore

cg17853801 -0.3271 0.0438 0.0125 0.0187 TMEM11 Body;Body

cg23406136 0.2677 -0.0324 0.0386 0.0054 TMEM115 TSS1500 chr3:50396347-50397175 S_Shore

cg08386165 -0.7847 0.0395 0.0062 0.0309 TMEM126B Body

cg15328703 0.5570 -0.0375 0.0096 0.0032 TMEM132B 3'UTR

cg16533379 0.5180 -0.0351 0.0004 0.0043 TMEM132D Body

cg10265365 -0.2802 0.0457 0.0335 0.0442 TMEM145 Body chr19:42827743-42829149 N_Shore

cg12331160 -0.5031 0.0536 0.0047 0.0326 TMEM163 Body

cg00197026 0.5390 -0.0359 0.0159 0.0030 TMEM170B TSS1500 chr6:11537537-11538929 N_Shore

cg25921357 0.3965 -0.0316 0.0080 0.0326 TMEM190 TSS1500 chr19:55889005-55889476 N_Shore

cg13370852 -0.2664 0.0404 0.0286 0.0164 TMEM201 Body;Body chr1:9648586-9649517 S_Shelf

cg18811916 0.6330 -0.0310 0.0050 0.0457 TMEM33 3'UTR


cg07908984 -0.5253 0.0387 0.0211 0.0250 TMEM40 TSS200

cg26027853 -0.4899 0.0368 0.0084 0.0401 TMEM51 5'UTR;5'UTR;5'UTR;5'UTR chr1:15541181-15541447 Island

cg18507018 -0.9024 0.0598 0.0026 0.0229 TMEM55A Body

cg18883198 0.7807 -0.0671 0.0036 0.0438 TMEM57 Body chr1:25756470-25758115 S_Shore

cg06346993 -0.7583 0.0815 0.0004 0.0120 TMEM63B TSS1500;5'UTR chr6:44094708-44096134 N_Shore

cg16605187 0.4035 -0.0364 0.0227 0.0033 TMEM79 TSS1500;5'UTR;1stExon


cg13011901 0.5813 -0.0348 0.0074 0.0052 TMIE 3'UTR

cg03929575 -0.9058 0.0696 0.0295 0.0036 TMTC1 Body

cg03406844 0.5336 -0.0408 0.0222 0.0475 TNFAIP6 Body

cg05503460 -0.5142 0.0358 0.0217 0.0201 TNFAIP8L3 Body chr15:51387532-51387755 Island

cg20682376 -0.4550 0.0317 0.0106 0.0206 TNFRSF13B TSS200


cg26089892 0.5487 -0.0303 0.0230 0.0100 TNIK


y;Body

cg22178392 0.6786 -0.0409 0.0032 0.0264 TNIP1 5'UTR chr5:150460086-150460864 N_Shore

cg02132728 -0.4004 0.0406 0.0043 0.0123 TNIP2 Body;5'UTR chr4:2757653-2758010 N_Shore

cg22941315 0.6445 -0.0657 0.0291 0.0114 TNR 5'UTR

cg02825561 0.8411 -0.0517 0.0232 0.0300 TNRC18 Body chr7:5395872-5396300 Island

cg13154622 -0.3399 0.0387 0.0341 0.0101 TNXB Body

cg22753462 -0.1977 0.0350 0.0085 0.0253 TOP1P2 Body;5'UTR chr22:25159865-25160212 S_Shore

cg12352399 0.5773 -0.0613 0.0217 0.0212 TOP2B Body

cg07211044 0.1825 -0.0317 0.0221 0.0036 TOX TSS1500 chr8:60030134-60032356 S_Shore

cg12274663 0.5675 -0.0506 0.0423 0.0442 TP53I11 5'UTR;5'UTR chr11:44971048-44972685 N_Shelf

cg24722763 0.8646 -0.0328 0.0488 0.0215 TP53TG5 3'UTR;Body

cg16935075 -0.7074 0.0593 0.0026 0.0202 TPH1 TSS200

cg14791008 0.6958 -0.0706 0.0444 0.0213 TPH2 TSS1500

cg09044728 0.6246 -0.0862 0.0076 0.0478 TPI1 3'UTR;Body;3'UTR chr12:6982319-6982936 N_Shelf

cg12205230 0.3914 -0.0494 0.0032 0.0231 TPM3 TSS1500

cg23259542 -0.4902 0.0556 0.0306 0.0276 TPRG1 TSS1500

cg13947243 -0.4923 0.0355 0.0340 0.0090 TRAF2 5'UTR chr9:139784322-139784693 N_Shore

cg19711268 1.2564 -0.1050 0.0057 0.0189 TRAF3 Body;Body;Body

cg06813419 -0.5933 0.0428 0.0005 0.0149 TRAF5 5'UTR;5'UTR chr1:211500151-211500636 S_Shore

cg22155281 0.6122 -0.0339 0.0165 0.0499 TRAM1L1 TSS1500 chr4:118006538-118006859 S_Shore

cg08498647 -0.3351 0.0520 0.0114 0.0295 TREH TSS1500

cg01765174 -0.6900 0.0322 0.0091 0.0219 TRIM14 Body;Body;Body;Body chr9:100881098-100881660 N_Shore

cg01083029 0.6119 -0.0362 0.0002 0.0020 TRIM26 5'UTR

cg02007150 0.8497 -0.0496 0.0094 0.0085 TRIM39 TSS1500;Body;Body;TSS1500 chr6:30294169-30295071 N_Shore

cg12819144 0.6765 -0.0630 0.0086 0.0178 TRIM60 TSS200

cg14776998 0.3999 -0.0413 0.0047 0.0306 TRIM71 Body chr3:32863174-32863415 S_Shore

cg22241777 0.8739 -0.0556 0.0040 0.0077 TRIP12 5'UTR chr2:230785912-230787665 N_Shelf

cg03135127 0.5440 -0.0416 0.0392 0.0387 TRMT1 1stExon;5'UTR;5'UTR;5'UTR;1stExon chr19:13226897-13227660 Island

cg01907194 -0.6454 0.0779 0.0034 0.0458 TRMT61A 3'UTR chr14:104000887-104001138 S_Shelf

cg10969919 0.6065 -0.0545 0.0255 0.0258 TRPC7 Body;Body;Body chr5:135692397-135693042 S_Shore

cg23693752 -0.3408 0.0484 0.0146 0.0009 TRPM1 5'UTR

cg21120661 -0.4645 0.0456 0.0013 0.0103 TRPM2 Body chr21:45811345-45811550 N_Shore


cg11475555 0.2154 -0.0388 0.0260 0.0328 TRPV3 TSS200

cg03806175 0.3701 -0.0398 0.0440 0.0218 TRRAP Body chr7:98579439-98579640 N_Shore

cg07730183 -0.4350 0.0397 0.0055 0.0001 TSC2 Body;Body;Body chr16:2134259-2134632 S_Shore

cg22721472 -0.3506 0.0400 0.0006 0.0127 TSHZ3 3'UTR

cg04022379 0.6572 -0.0308 0.0268 0.0113 TSLP Body;TSS1500 chr5:110408704-110409039 Island

cg06541938 -0.6502 0.0719 0.0077 0.0048 TSNARE1 5'UTR

cg10317111 -0.6333 0.0897 0.0063 0.0056 TSPAN3 Body;Body;Body

cg20171011 0.7814 -0.0562 0.0427 0.0338 TSPAN4 Body;Body;Body;Body;Body;Body;Body

cg06847157 0.5517 -0.0594 0.0018 0.0211 TSSC4 TSS200 chr11:2421040-2422474 S_Shore

cg24901317 -0.4383 0.0472 0.0171 0.0320 TTBK1 Body chr6:43230610-43231064 N_Shelf

cg00018229 0.1924 -0.0356 0.0225 0.0178 TTC13 Body;TSS1500;Body chr1:231113871-231114873 N_Shore

cg24550149 0.5179 -0.0393 0.0461 0.0093 TTC22 Body chr1:55246742-55247519 Island

cg15528722 0.6861 -0.0772 0.0380 0.0385 TTC33 TSS1500 chr5:40755537-40756257 S_Shore

cg12639429 -0.2308 0.0344 0.0338 0.0437 TTC39C TSS200

cg24036116 0.6528 -0.0855 0.0126 0.0145 TTC7B Body chr14:91282227-91282757 N_Shore

cg11984463 0.4262 -0.0695 0.0014 0.0136 TTC9B TSS1500 chr19:40723104-40724389 S_Shore

cg17510786 -0.4256 0.0340 0.0094 0.0318 TTLL10 Body;Body chr1:1115574-1116006 Island

cg14084730 0.9768 -0.0577 0.0129 0.0055 TXLNA 5'UTR chr1:32645154-32645814 Island

cg04563169 0.3060 -0.0501 0.0254 0.0166 TXNRD1 Body chr12:104659057-104659583 S_Shore

cg01918043 0.6251 -0.0545 0.0126 0.0095 UACA Body chr15:71054898-71056230 N_Shore

cg02405476 0.5454 -0.0326 0.0052 0.0492 UBE2C

1stExon;5'UTR;1stExon;5'UTR;Body;Body;B

ody;Body chr20:44440946-44441655 S_Shore

cg17204510 0.3156 -0.0320 0.0088 0.0287 UBE2D2 5'UTR;Body

cg15251697 0.3465 -0.0346 0.0115 0.0306 UBE2G1 Body chr17:4268625-4270155 N_Shelf

cg04523320 -0.6544 0.0539 0.0252 0.0209 UBE2K Body;Body;Body chr4:39772810-39773309 N_Shore

ch.17.1996417R -0.5496 0.0655 0.0309 0.0433 UBE2O Body

cg13411658 0.6105 -0.0407 0.0006 0.0017 UBR3 Body

cg23947545 -0.4481 0.0385 0.0290 0.0359 UBTD2 3'UTR

cg12039314 0.6927 -0.0378 0.0090 0.0103 UBXN2B Body

cg18067103 0.7240 -0.0338 0.0303 0.0264 UCHL3 Body chr13:76123438-76124268 S_Shelf

cg10171609 -0.4860 0.0398 0.0087 0.0341 UCN3 TSS1500

cg19750657 0.8125 -0.0396 0.0315 0.0419 UFM1 3'UTR

cg18313132 0.4479 -0.0301 0.0157 0.0221 UGT1A8 TSS1500


cg17136038 -0.3357 0.0502 0.0020 0.0026 UHRF1BP1 Body chr6:34759534-34760309 S_Shelf

cg01763051 -0.5155 0.0490 0.0166 0.0383 ULBP1 Body chr6:150284682-150286515 Island

cg11881146 1.0699 -0.1089 0.0154 0.0114 UNC119 TSS1500;TSS1500;3'UTR chr17:26879239-26879787 S_Shore

cg16413715 -0.5999 0.0937 0.0353 0.0396 UNC5A Body chr5:176296541-176296933 Island

cg05673137 -0.2506 0.0342 0.0073 0.0359 UNC5CL TSS200

cg11736091 0.7587 -0.0359 0.0340 0.0059 UNC84A Body;Body chr7:886803-887535 N_Shelf

cg22859847 0.8903 -0.0386 0.0194 0.0100 USP16 TSS200;TSS200;TSS200 chr21:30396848-30397410 N_Shore

cg13604623 1.3987 -0.0591 0.0037 0.0307 USP28 Body chr11:113745816-113746693 N_Shore

cg26561986 -0.5277 0.0469 0.0003 0.0040 USP44 5'UTR;5'UTR chr12:95941906-95942979 N_Shelf

cg17274681 1.0113 -0.0455 0.0130 0.0114 UST TSS1500 chr6:149068179-149069775 N_Shore

cg18442587 0.7491 -0.0349 0.0291 0.0134 VASH1 1stExon;5'UTR chr14:77227569-77228691 S_Shore

cg17853850 0.9380 -0.0818 0.0024 0.0157 VASH2 TSS1500;TSS1500;TSS1500 chr1:213123647-213125092 N_Shore

cg14415079 -0.6477 0.0790 0.0061 0.0143 VAV2 Body;Body chr9:136659111-136659329 N_Shelf

cg05510041 0.6796 -0.0325 0.0034 0.0477 VCL Body;Body chr10:75757484-75758227 S_Shore

cg19743759 2.3765 -0.1634 0.0021 0.0186 VCP TSS200 chr9:35071756-35072885 Island

cg02397182 1.2938 -0.0972 0.0245 0.0478 VEGFA


y;Body;Body;Body;Body;Body;Body;Body;B

ody chr6:43737632-43739852 Island

cg14664726 -0.6156 0.0871 0.0265 0.0062 VGLL2 3'UTR;3'UTR chr6:117591533-117592279 S_Shelf

cg08693281 0.7416 -0.0582 0.0159 0.0110 VIPR2 Body chr7:158856817-158857209 Island

cg15599795 -0.3872 0.0437 0.0033 0.0142 VOPP1 Body

cg24003216 -0.7844 0.0781 0.0233 0.0130 VPS13B Body;Body

cg04275506 0.7130 -0.0357 0.0439 0.0297 VPS13D Body;Body

cg14715030 1.0539 -0.1181 0.0100 0.0053 VPS53 Body;Body

cg12704672 0.6849 -0.0375 0.0416 0.0374 VSIG8 TSS1500

cg07856295 -0.7905 0.0350 0.0087 0.0396 VSNL1 Body

cg10743390 0.3335 -0.0365 0.0134 0.0214 VSTM2B Body chr19:30015781-30021367 Island

cg12532653 0.3865 -0.0401 0.0350 0.0185 VTRNA1-1 TSS1500

cg00299558 0.4744 -0.0811 0.0292 0.0391 VWA5B2 Body;TSS1500 chr3:183959061-183959747 N_Shore

cg09847027 -0.3483 0.0302 0.0428 0.0481 WAC Body;Body;Body

cg23151401 0.3246 -0.0409 0.0449 0.0001 WBSCR26 TSS1500 chr7:73152564-73153716 N_Shelf

cg18086582 -0.5024 0.0346 0.0157 0.0030 WDR13 Body;Body;Body chrX:48455942-48456594 S_Shelf

cg24378470 1.0129 -0.0627 0.0126 0.0447 WDR16 TSS1500;Body;TSS1500 chr17:9479007-9479225 N_Shore

cg15313936 0.7569 -0.0872 0.0154 0.0199 WDR20 Body;Body;Body;Body chr14:102605597-102606977 S_Shore


cg23612492 -0.3565 0.0326 0.0029 0.0088 WDR25 Body;Body

cg13082120 0.7523 -0.0338 0.0323 0.0454 WDR46 1stExon;5'UTR;1stExon;TSS1500;5'UTR chr6:33256539-33256973 S_Shore

cg16649298 -0.7266 0.0343 0.0006 0.0186 WDR60 Body

cg06857900 -0.7301 0.0411 0.0345 0.0002 WDR66 Body

cg20667778 0.7366 -0.0543 0.0205 0.0431 WDR72 Body

cg16659003 0.9833 -0.0326 0.0325 0.0143 WDSUB1 5'UTR;5'UTR;5'UTR chr2:160142607-160143567 Island

cg17806224 -0.2632 0.0468 0.0315 0.0009 WIPF3 Body chr7:29923882-29924264 S_Shelf

cg17218062 0.3567 -0.0340 0.0117 0.0179 WISP1 Body;Body

cg24286165 0.6696 -0.0455 0.0069 0.0304 WIT1 Body chr11:32459422-32459878 N_Shore

cg20702935 0.7796 -0.0458 0.0123 0.0426 WIZ 5'UTR;TSS200 chr19:15563869-15564223 N_Shelf

cg05600023 0.8456 -0.1201 0.0067 0.0260 WNT4 Body chr1:22446520-22446943 S_Shore

cg09774932 0.5301 -0.0427 0.0116 0.0165 WNT5B TSS1500

cg10711871 -0.1976 0.0369 0.0125 0.0244 WNT7A Body chr3:13860434-13860882 Island

cg10818702 0.4256 -0.0319 0.0486 0.0304 WRB 3'UTR;3'UTR

cg02789515 -0.4243 0.0606 0.0077 0.0171 WSB1 TSS1500;TSS1500 chr17:25620999-25621730 N_Shore

cg12521910 0.4262 -0.0486 0.0002 0.0092 XAGE3 TSS1500;TSS1500

cg00848245 -0.4893 0.0676 0.0145 0.0323 XPO6 TSS1500 chr16:28223083-28223638 S_Shore

cg22026687 1.1114 -0.0339 0.0144 0.0414 XPR1 TSS1500;TSS1500 chr1:180601027-180601816 N_Shore

cg22891520 0.1889 -0.0339 0.0355 0.0435 YME1L1 TSS1500;TSS200;TSS1500 chr10:27444133-27444494 N_Shore

cg26462319 0.5144 -0.0308 0.0277 0.0028 YPEL5 Body;Body;Body;Body

cg03219514 -0.6830 0.0424 0.0038 0.0297 ZAP70 Body;TSS200 chr2:98350984-98351257 N_Shore

cg03537740 -0.3901 0.0466 0.0373 0.0078 ZBTB12 Body chr6:31868781-31870311 N_Shore

cg14258935 -0.2501 0.0352 0.0287 0.0210 ZBTB22 Body;TSS1500;TSS1500;TSS1500;Body chr6:33281112-33281827 S_Shore

cg01395650 -0.5298 0.0301 0.0049 0.0460 ZBTB41 TSS1500 chr1:197170005-197170719 Island

cg14351767 1.2098 -0.0311 0.0134 0.0459 ZBTB5 Body

cg04644653 -0.7359 0.0316 0.0475 0.0074 ZBTB7C Body chr18:45555644-45556213 Island

cg03140118 0.6265 -0.0598 0.0080 0.0038 ZC3H12A TSS1500 chr1:37939723-37940650 N_Shore

cg27115978 -0.2020 0.0304 0.0071 0.0075 ZC3H18 5'UTR

cg04878745 1.5072 -0.0748 0.0406 0.0375 ZC3H3 Body

cg24181914 0.5689 -0.0544 0.0228 0.0441 ZC3H4 TSS1500 chr19:47615253-47617101 S_Shore

cg00535466 -0.8260 0.0924 0.0235 0.0222 ZC3H8 TSS1500 chr2:113012108-113012784 S_Shore

cg27326620 -0.7637 0.0412 0.0076 0.0241 ZC4H2 TSS1500

cg00868074 -0.2446 0.0455 0.0014 0.0260 ZCCHC14 3'UTR chr16:87441387-87441671 Island


cg13863769 0.6608 -0.0420 0.0116 0.0464 ZCCHC2 3'UTR

cg03820837 0.8135 -0.0454 0.0008 0.0204 ZCWPW2 TSS1500

cg10307602 -0.3989 0.0336 0.0013 0.0089 ZDHHC14 Body;Body

cg23869439 0.9388 -0.0407 0.0015 0.0176 ZDHHC2 Body

cg10363915 0.4554 -0.0354 0.0252 0.0305 ZDHHC5 5'UTR chr11:57434542-57434788 S_Shelf

cg05543909 0.5825 -0.0437 0.0254 0.0015 ZFHX3 3'UTR;3'UTR chr16:72821140-72821592 N_Shore

cg06169590 0.7378 -0.0308 0.0447 0.0194 ZFP36L2 TSS1500;Body chr2:43451445-43454951 S_Shore

cg20232550 -0.3508 0.0455 0.0315 0.0059 ZFP41 3'UTR

cg01062937 -0.1232 0.0309 0.0206 0.0303 ZFPM1 Body chr16:88536936-88537375 Island

cg10898258 0.3863 -0.0550 0.0195 0.0185 ZFYVE21 Body chr14:104193901-104194627 N_Shore

cg15002294 0.5051 -0.0507 0.0064 0.0300 ZIC1 TSS1500 chr3:147126988-147128999 N_Shore

cg04765410 0.4496 -0.0304 0.0153 0.0088 ZMIZ1 Body

cg27263483 0.6994 -0.0376 0.0419 0.0242 ZNF134 3'UTR

cg21880712 0.5775 -0.0411 0.0174 0.0268 ZNF136 3'UTR

cg10227731 -1.0411 0.0306 0.0149 0.0221 ZNF16 5'UTR;5'UTR chr8:146175835-146176337 Island

cg15264273 0.5101 -0.0313 0.0183 0.0200 ZNF169 5'UTR

cg02595681 1.0568 -0.0605 0.0130 0.0098 ZNF215 TSS1500 chr11:6947520-6948212 N_Shore

cg19739578 0.5951 -0.0522 0.0407 0.0145 ZNF219 TSS1500 chr14:21571835-21572520 S_Shore

cg27273602 0.4604 -0.0325 0.0123 0.0194 ZNF23 5'UTR chr16:71495773-71496260 N_Shelf

cg03639749 -0.2730 0.0362 0.0237 0.0190 ZNF26 TSS1500 chr12:133562710-133563453 N_Shore

cg12096988 -0.9478 0.0340 0.0192 0.0005 ZNF264 TSS200 chr19:57702696-57703425 Island

cg10982935 0.9931 -0.1712 0.0009 0.0010 ZNF280C TSS1500 chrX:129402458-129403088 Island

cg17173891 1.0265 -0.0725 0.0001 0.0056 ZNF292 Body



cg05136804 -0.4239 0.0318 0.0019 0.0142 ZNF397OS 5'UTR;5'UTR chr18:32847284-32848130 S_Shore

cg00175987 0.6698 -0.0312 0.0266 0.0332 ZNF407 TSS1500;TSS1500;TSS1500

cg02705894 -0.5119 0.0362 0.0163 0.0386 ZNF420 3'UTR

cg26442883 -0.3830 0.0521 0.0087 0.0185 ZNF423 Body


cg18611281 0.7749 -0.0398 0.0158 0.0055 ZNF512 TSS200 chr2:27805754-27806078 Island

cg11611011 -0.6120 0.0351 0.0089 0.0467 ZNF524 Body chr19:56113827-56114232 Island

cg20103843 0.5260 -0.0313 0.0035 0.0310 ZNF560 Body


cg07378091 0.5646 -0.0343 0.0495 0.0288 ZNF564 1stExon;5'UTR chr19:12661804-12662302 Island

cg18457438 -0.5703 0.0364 0.0090 0.0192 ZNF575 Body chr19:44039232-44039756 Island


cg23699046 -0.3052 0.0311 0.0313 0.0455 ZNF605 TSS1500;TSS1500 chr12:133532642-133532979 S_Shore

cg17407324 -0.6880 0.0558 0.0111 0.0061 ZNF615 Body

cg12176605 0.3209 -0.0351 0.0324 0.0125 ZNF619


0;TSS1500 chr3:40518517-40518848 N_Shore

cg07000116 -0.5902 0.0388 0.0318 0.0300 ZNF689 Body chr16:30615777-30616286 S_Shore

cg25397663 0.6143 -0.0593 0.0142 0.0258 ZNF718 Body chr4:124332-124841 Island


cg23816537 -0.4799 0.0477 0.0289 0.0056 ZP1 TSS200

cg19988566 1.3722 -0.0780 0.0065 0.0384 ZRANB1 3'UTR

cg07369950 1.0442 -0.0546 0.0368 0.0292 ZSCAN18 TSS1500;Body;TSS1500;TSS1500 chr19:58609338-58609988 Island

cg24441954 -0.8682 0.0613 0.0268 0.0081 ZSCAN23 3'UTR

cg06395265 0.5167 -0.0381 0.0227 0.0023 ZSWIM1 Body

cg11023075 -0.6980 0.0491 0.0214 0.0333 ZSWIM6 Body chr5:60626505-60629809 S_Shelf

cg14497327 -0.5622 0.0303 0.0024 0.0144 ZYX TSS200;TSS200 chr7:143077469-143079169 Island

cg12087627 -0.4147 0.0571 0.0435 0.0046 ZZEF1 Body chr17:3907378-3907703 S_Shelf


Supplementary Table 4: List of Primer Oligos for Pyrosequencing

HK1 HDAC5

Forward Primer ATTGAGGTTTAGTTTTTGGTAGGAGTAGGA TTAGGGGTTGGGAGGGTTA

Reverse Primer CCTAACTCATTTCCACCTCAC CCCTAACCTTTCCCAAACTTTTCTT

Sequencing Primer GGTATGTTAGTTTTTAGTAGGT GGTTGGGAGGGTTAT

Biotin On the reverse primer On the reverse primer

Methylation analysis was performed using PyroMark Q24 (Qiagen). Primers for specific regions were from Qiagen (DAPK3: PM00614166;

ATP2A3: PM00614320) or designed manually as detailed above using PyroMark Assay Design 2.0 software (Qiagen). After bisulfite conversion,

DNA was amplified by PCR using the PyroMark PCR kit (Qiagen). Annealing temperature was optimized for each primer set. Non-CpG

cytosines were used as an internal control for the bisulfite conversion efficiency. Completely methylated, unmethylated, and a mixture of both

control DNA also used to determine the detection limits of the assay. Data are reported as percentage methylation by determining the number of

times the site was detected as cytosine in the context of the total number of times the site was detected as thymine or cytosine. Data were

analyzed using PyroMark Q24software (Qiagen).


Supplementary Table 5: Methylation Landscape for Genes Identified up to 200 kb from

DAPK3 3’UTR.

Gene

(# of probes*)

Target

ID

Gene

region

(%) DNA

Methylation

Fold change

Insulin/Basal

p

EEF2 (34) cg16142977 TSS1500 0 0.81 0.01

EEF2 (34) cg07663404 Body 1 1.01 0.03

EEF2; SNORD37 (13) cg20738733† Body; TSS1500 -2 0.97 0.01

EEF2; SNORD37 (13) cg05948856† Body; TSS1500 -5 0.94 0.03

ZFR2 (60) cg13983692 Body 4 1.07 0.02

ATCAY (21) All probes - - - > 0.05

MATK (25) All probes - - - > 0.05

DNA methylation differences are reported as percent change and fold change between the basal

sand insulin-stimulated skeletal muscle. *Number of probes on the array that can be related to

each gene identified within 200 kb of DAPK3 3’UTR. A total of 153 probes were identified on

the array within 200 kb of DAPK3 3’UTR. †Ambiguous probe which could also reflect changes

close to SNORD37, which is located on a different chromosome from DAPK3. 5 probes had

significant p-values: Paired Student’s t-tests were performed on β values. Using M values, no

CpG in this region were significantly altered by insulin treatment. Furthermore, since we used β

values in Table 3 for ATP2A3 and DAPK3, we have evaluated them here as well to be consistent.


Documents

Insulin and Glucose Alter Death-Associated Protein Kinase 3