89
IMMUNOBIOLOGY And EXPERIMENT

IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Embed Size (px)

Citation preview

Page 1: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

IMMUNOBIOLOGY

And EXPERIMENT

Page 2: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Immunopharmacology: intersection of immunology and pharmacology.

The most well-known immunopharmacology agents include anti-rejection drugs and vaccines.

Focuses on drugs that affect the immune system, whether to suppress it, activate it, or manipulate it in some way.

Page 3: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 4: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Fluorescence-activated cell sorting (FACS)Flowcytometry using a BD FACS Calibur.

Page 5: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

• Flow-FISH (fluorescent in-situ hybridization) is a cytogenetic technique to quantify the copy number of specific repetitive elements in genomic DNA of whole cell populations via the combination of flow cytometry with cytogenetic fluorescent in situ hybridization staining protocols

Page 6: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Gel electrophoresis apparatus – An agarose gel is placed in this buffer-filled box and electrical field is applied via the power

supply to the rear. The negative terminal is at the far end (black wire), so DNA migrates toward the camera.

Classification ElectrophoresisOther techniques

Related

Capillary electrophoresisSDS-PAGETwo-dimensional gel electrophoresis

Temperature gradient gel electrophoresis

Page 7: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 8: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

P53 ; RT-PCR

Page 9: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Immunocytochemistry vs. immunohistochemistryImmunocytochemistry differs from immunohistochemistry in that the former is performed on samples of intact cells that have had most, if not all, of their surrounding extracellular matrix removed. This includes cells grown within a culture, deposited from suspension, or taken from a smear. In contrast, immunohistochemical samples are sections of biological tissue, where each cell is surrounded by tissue architecture and other cells normally found in the intact tissue.CounterstainsAfter immunohistochemical staining of the target antigen, a second stain is often applied to provide contrast that helps the primary stain stand out. Many of these stains show specificity for discrete cellular compartments or antigens, while others will stain the whole cell. Both chromogenic and fluorescent dyes are available for IHC to provide a vast array of reagents to fit every experimental design, and include: hematoxylin, Hoechst stain and DAPI are commonly used.

Page 10: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Aktivitas Senyawa Semisintetik Kuasinoid dari Buah Makasar (Brucea javanica [L.] Merr) sebagai Antikanker dengan Target Protein P53, Bcl-2, Kaspase-3, COX-2 dan c-Myc

Microscope

Ab Primer P21 ;C-myc; Bcl2COX-2

Page 11: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 12: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 13: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Components of the immune system

• White blood cells• Lymphoid organ

– Primary lymphoid organ: • Bone marrow & fetal liver

– origin of all immune cells – site for development and education of B cells

• Thymus: – site for development and education of T cells

– Secondary lymphoid organ• Lymph nodes, spleen, lymphoid tissue

– induction sites for immune responses• Body tissues

• effector sites for immune responses

Page 14: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Growth and differentiation factors (cytokines) produced by and present on bone marrow stromal cells determine the type of white blood cell that will emerge, as well as their

relative numbers.

All white blood cells originate from the bone marrowcells

Page 15: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Blood cells derived from bone marrow cells

cells

Innate immAdaptive imm

Page 16: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Blood cells migrate through blood and lymph nodes or home to tissues

cells

Page 17: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Molecules involved for antigen recognition

• B cell receptor & product– antibodies (Abs): immunoglobulin (Ig)

• T cell receptor (TCR)– TCR / a b (type II), g/ d (type I)

• Major histocompatibility complex (MHC)/HLA– Class I– Class II

Page 18: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Immune responses

• Natural/innate/non-specific– Humoral: type I Interferon (IFN- / ), a b lysozyme,

complement (C)– Cellular: phagocytes, NK cells

• Adaptive/acquired/specific– Humoral: Abs: IgM, IgG, IgA, IgE, IgD– Cellular: T cells:

• CD4+ Th, CD8+CTL, CD4+CD25+ T reg.

Page 19: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 20: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 21: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 22: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 23: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 24: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 25: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Lymphocytes: the B and T cells

Page 26: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

The cells in adaptive immune responses

Antigen specific lymphocytes Effector cells Specialized accessory cells

Page 27: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Lymphocytes

Capable of specifically recognizing and distinguishing different antigenic determinants

Responsible for the defining characteristics of adaptive IR i.e.

- specificity- memory

Page 28: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Normal Blood Cell Counts

Page 29: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

PCR , IHC, ELISA, FACS-FlowsitometriExperiment Design: Invitro; Invivo

Page 30: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 31: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 32: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 33: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 34: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

antigenpresenting cell (macrophage,dendritic cell)

cytotoxicT cells

Antigen

CD4T helpercell

primedCD4T helpercell

CD8 T cell

plasmacells

1

2 3

4

4

IL-1 IL-2

IL-2

IL-2

MAJOR STEPS IN IMMUNE RESPONSES

B cell

Page 35: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Antigen

antigenpresenting cell

CD4T helpercell

primedCD4T helpercell

CD8 T cell

cytotoxicT cells

plasmacells

1

2 3

4

4

IL-1 IL-2

IL-2

cytokines

SITES OF ACTION OF IMMUNOSUPPRESSIVE DRUGS

X

X

X X

XA

BD D

EC

X

Page 36: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 37: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 38: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 39: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 40: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 41: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 42: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Immunostimulatory Cytokines

InterleukinsIL-2 (enhance antitumor actions of cytotoxic T cells

and NK cells)Colony Stimulating Factors

G-CSF (neutropenia) and GM-CSF (bone marrow transplant patients)

Interferons (uses)alpha (anticancer uses)beta (relapsing type multiple sclerosis)gamma (chronic granulomatous disease)

Page 43: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Interferon UsesInterferon Alpha (prod. by leukocytes)

(antiviral, antiproliferative)malignant melanoma, renal cell carcinoma, hairy cell

leukemia, Kaposi’s sarcomaInterferon Beta (prod. by fibroblasts)

(antiviral, antiproliferative)relapsing type MS

Interferon Gamma (prod. by lymphocytes)(stimulates NK cells and macrophages)chronic granulomatous disease

Page 44: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Other Hematopoetic Growth Factors

• Erythropoietin alpha (Epoetin alpha) (Procrit®)– Produced by recombinant DNA technology– Stimulates division and differention of erythroid

progenitor cells – Used for anemia due to renal failure or cancer

chemotherapy– Adverse effects include hypertension, headache,

hypersensitivity reactions are rare• Darbopoetin alpha (Aranesp®)

– Recombinant long-acting erythropoetin (3X epoetin)

Page 45: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Cytokine Inhibitors• TNF inhibitors (disease modifiers to treat

rheumatoid arthritis)– Etanercept (Enbrel)

• Recombinant version of TNF receptor– Infliximab (Remicade)

• Chimeric human/murine anti-TNF monoclonal antibody

• Anakinra (Kineret)– Human IL-1 receptor antagonist– Disease modifier agent for Rheumatoid arthritis

Page 46: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Other Immunostimulants

• Thymic Hormones– Improve primary immune deficiency in children

• Synthetic Stimulants– Levamisole stimulates phagocytosis and T cell

production of cytokines• Adjuvants of bacterial origin

– BCG is viable strain of Mycobacterium bovis that enhances macrophage activity

– BCG used for bladder cancer and melanomas

Page 47: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Targeted Immunotherapy

• Antibody-mediated delivery systems• Radiolabeled antibodies• Types of antibodies in trials

– Anti-CD20 for B cell lymphomas– Anti-vascular endothelial cell growth factor– Anti-fibroblast growth factor– Anti-body to F19 on surface of activated fibroblasts

Page 48: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

New Approaches for Tolerance• Interference with costimulatory signals required for

T cell activation– Two signals required for T cell activation

• Signal 1 via T cell receptor• Signal 2 via costimulatory receptor-ligand pair

• Antibodies to costimulator receptors (on T cell) or ligands (on antigen presenting cell)– Anti-CTLA4 (blocks B7 binding to T cell CD28)– Anti-CD40 (inhibits macrophage and endothelial

activation by blocking T cell CD40 ligand binding to macrophage CD40)

Page 49: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

TUMOR CELL

Page 50: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 51: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 52: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 53: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 54: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Different Principles in drugs used for cancer vs immunosupressant

Page 55: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 56: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 57: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 58: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 59: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 60: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

TEKNIK DASAR BIOLOGI MOLEKULER

Page 61: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Teknik yang sering digunakan a.l :

Page 62: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Faga, Bakteri, Yeast / Fungi, VIRUS ?Higher eukaryotes

KIT DNA /RNA : Sesuaikan petunjuk penggunaan dari Manufakturing

Page 63: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

PROTOKOL ISOLASI DNA/

RNA

Page 64: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Denaturasi 94oC Anealing primer 55oC

Sintesis 72oC

Page 65: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

72oC

Page 66: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Produk dominan

Page 67: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Efek Hepatoprotektor, Nefroprotektor, dan

ImunomodulatorUbi jalar (Ipomoea batatas) pada

Tikus Putih Jantan(Rattus novergicus) Galur Sprague

Dawley Sarmalina et al., 2012, Laporan

Hasil Penelitian28 ekor hewan coba; dibagi 7 kelompok; satu kontrol (K). Hari ke 7 diberi parasetamol dosis tinggi (P1), Diberi bakteri salmonella p.o 107 cfu (P2), Ekstrak Ipomea (P3), Ekstrak Ipomea + Salmonella (P4), Ipomea + Parasetamol (P5-6). Hari ke 21-28. Narkose, darah intrakardiak, Sentrifugasi serum-darah.

(Persetujuan Etikal Klirins: FK Unsri Oktober 2012)

Page 68: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Pengukuran serum (IL-4) Elisa, SGPT, SGOT, Kreatinin dan Ureum dengan Kolori meter. Analisis data anova test dengan signifikansi p<0,05Pengukuran: Kadar SGPT, SGOT, kreatinin dan ureum. sekresi interleukin 4 (IL-4).

Laboratorium Kes Daerah Palembang (Akreditasi Lab Pengujian)

Refference; Roller, M., Rechkemmer, G., and Watzl, G. 2004.

Page 69: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 70: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 71: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 72: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Bakteri, tanaman mamalia

Page 73: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Gel AgarosaGel Poliakrilamid :

Dengan / tanpa SDS

Page 74: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 75: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Hubungan antara Laju migrasi dan konformasi DNA plasmid

Sirkuler, linier, superkoil

DNA Kromosom

Page 76: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 77: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 78: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Gel Poliakrilamid SDS ( vertical )

Page 79: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

ss DNA – ss DNA ( Southern )

ss DNA – RNARNA – RNA ( Northern )

Pembentukan duplek antaraPROTEIN - ANTIBODI ( Western )

Pembentukan duplek antara dua untai asam nukleat yang komplemen

Page 80: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

DOUBLE HELIX DNA

UNTAI 1 UNTAI 2

Page 81: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 82: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

TCCGA CCTGA CCCGAAT GGACT GGGCTTA CCCTG

CCTGACCCGAATGGC GGCTTACCGTTAAGTTCC

1

2

CCTGACCCGAATGGCGGACTGGGCTTACCG

3

Page 83: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 84: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 85: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 86: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 87: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents
Page 88: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents

Denaturasi 94oC Anealing primer 55oC

Sintesis 72oC

Page 89: IMMUNOBIOLOGY And EXPERIMENT. Immunopharmacology: intersection of immunology and pharmacology.pharmacology The most well-known immunopharmacology agents