Vol. 30, No. 4JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 1992, p. 796-8000095-1137/92/040796-05$02.00/0Copyright © 1992, American Society for Microbiology

Identification of Chlamydia pneumoniae by DNA Amplificationof the 16S rRNA Gene

CHARLOTTE A. GAYDOS,1* THOMAS C. QUINN,"12 AND JOSEPH J. EIDEN3

Division of Infectious Diseases, Department ofMedicine, 1 and Division of Infectious Diseases, Department ofPediatrics,3 The Johns Hopkins University School of Medicine, Baltimore, Matyland 21205 and Laboratoryof Immunoregulation, National Institute ofAllergy and Infectious Diseases, Bethesda, Maryland 208922

Received 27 September 1991/Accepted 30 December 1991

Chlamydia pneumoniae is an important cause of respiratory disease in humans, but diagnosis of C.pneumoniae is hindered by difficulties in the in vitro growth of the organism. In order to improve detection andidentification, we recently developed a polymerase chain reaction (PCR) assay which uses oligonucleotideprimers specific for C. pneumoniae. The nucleic acid sequence was determined for the 16S rRNA of C.pneumoniae, and regions in which C. pneumoniae differed from both Chlamydia psittaci and Chlamydiatrachomatis were identified. Oligonucleotide primers corresponding to these unique regions were thensynthesized and used in a PCR for the detection of C. pneumoniae. The C. pneumoniae-specific primerspermitted the identification of six isolates of C. pneunwniae, but no reaction was observed with the 15 serovars

of C. trachomatis or two strains of C. psittaci. PCR should prove to be valuable in confirming the identificationof C. pneumoniae and in the diagnosis of C. pneumoniae infections.

Chiamydia pneumoniae is a recently described cause ofrespiratory infection, accounting for as many as 10% ofcases of community-acquired pneumonia (1, 4-6, 10, 11, 13,14, 18, 19, 23). C. pneumoniae has also recently beenimplicated, on the basis of serologic assays, as a cause ofbronchitis, sinusitis, and recently, acute chest syndrome ofsickle cell disease as well as asthma attacks (15, 20). Moreextensive microbiological and epidemiological investigationsof C. pneumoniae disease are needed, but routine isolationof the organism is difficult. Diagnosis of C. pneumoniaeinfection is usually made on the basis of elevated antibodytiters by using microimmunofluorescence (MIF) and, occa-sionally, by in vitro isolation (4, 11). MIF serology issensitive and specific but requires the detection of risingantibody titers in both acute- and convalescent-phase sera,resulting in a delay in definitive diagnosis. Thus, alternatemethods of identification should prove helpful in improvingthe detection of C. pneumoniae infection.The polymerase chain reaction (PCR) has been used to

amplify DNA from C. pneumoniae. The PCR is based onprimers derived from the major outer membrane proteingene sequence of Chlamydia trachomatis, but these primerswere not specific for C. pneumoniae (7, 9, 16). Pollard et al.(22) have also described the use of PCR for the detection ofC. trachomatis and Chlamydia psittaci by using primersbased on the sequences of the 16S rRNAs of those organ-isms. One primer pair (1A and 1B) yielded a PCR product of240 bp when it was reacted with DNA from either C.trachomatis or C. psittaci. Another 16S rRNA primer pair(2A and 2B) was reported to not react with C. trachomatisbut produced a 119-bp product when it was reacted with C.psittaci. While these two primer pairs were reported topermit the differentiation of C. trachomatis from C. psittaci,the reaction of the 16S rRNA primers with C. pneumoniaewas not noted, and the 16S rRNA sequence of C. pneumo-niae was not available for comparison. Since C. pneumoniaemay be encountered in respiratory specimens, the reactivity

* Corresponding author.

of this species with 16S rRNA primers should also beinvestigated. Identification of additional primers would alsobe likely to improve the specific detection of C. pneumoniae.We therefore determined the nucleic acid sequence of the16S rRNA of C. pneumoniae and identified sequences whichdiffered from those of C. trachomatis and C. psittaci. Wereport here the development of a PCR assay which permitsthe sensitive detection of C. pneumoniae and its specificdifferentiation from C. trachomatis and C. psittaci.

MATERUILS AND METHODS

Organisms. C. pneumoniae TW183, AR39, and AR388were obtained from the Washington Research Foundation,Seattle. C. pneumoniae CWL-029, 2023, and 2043 were fromthe American Type Culture Collection, Rockville, Md., asVR1310, VR1356, and VR1355, respectively. C. psittaci 6BCwas also obtained from the American Type Culture Collec-tion. C. psittaci SM006 was cultured in our laboratory froma patient with psittacosis. C. trachomatis serovars A, B, Ba,C, D, E, F, G, H, I, J, Ll, L2, and L3, in high titer and fixedin formalin, were obtained from the Washington ResearchFoundation. Other respiratory bacterial strains were ob-tained from the Clinical Microbiology Laboratory, TheJohns Hopkins Hospital, Baltimore, Md.Growth and purification. Chlamydial strains were propa-

gated in HL or McCoy cells as described previously (16).Purification of high-titer preparations of elementary bodieswas performed in a density gradient of 30% Percoll in 12%sucrose-phosphate-glutamate buffer (pH 7.4). The prepara-tion was centrifuged for 30 min at 18,800 x g at 4°C. Theband of elementary bodies was collected, washed and pel-leted twice with 8.4% sucrose-phosphate glutamate buffer(pH 7.4) for 30 min at 18,800 x g at 4°C. Elementary bodieswere resuspended in 1-ml aliquots and stored at -70°C.PCR. Percoll-purified elementary bodies or tissue culture

isolates (200 ,ul) were lysed with Tween 20-Nonidet P-40(final concentration, 0.5% [vol/vol] each) and a final concen-tration of 100 ,ug of proteinase K (Sigma Chemical Co., St.Louis, Mo.) per ml. After boiling for 5 min to inactivate the

796

on April 20, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

C. PNEUMON1AE IDENTIFICATION 797

proteinase K, the specimens were chilled on ice. For DNApreparation, the samples were extracted by phenol-chloro-form treatment and precipitated with sodium acetate-ethanolby standard methods (24). PCR was performed on a 50-,ulprocessed sample in a total volume of 100 ,l. The finalmixture contained 0.5 ,uM primers, 0.2mM deoxynucleosidetriphosphates, lx PCR buffer (10 mM Tris [pH 8.3], 50 mMKCI, 2.5 mM MgCl2, 0.01% gelatin), and 1.5 U of Taqpolymerase (Perkin-Elmer Cetus, Norwalk, Conn.). Sam-ples were subjected to 30 cycles of denaturation (94°C, 1min), annealing (55°C, 1 min), and extension (72°C, 1 min) ina Perkin-Elmer Cetus thermocycler. PCR products (10 ,ul)were separated by electrophoresis in 12% polyacrylamidegels (7 by 10 cm) at 120 V for 1 h by using Tris-borate-EDTAbuffer (pH 8.3) (24). Nucleic acids were then visualized bystaining with either ethidium bromide (0.5 p,g/ml) or silvernitrate (silver stain kit; Bio-Rad, Richmond, Calif.).

Sequence analysis. The sequences of the DNA generatedby PCR were determined on an automated DNA sequencer(373A; Applied Biosystems, Foster City, Calif.) which sep-arated, detected, and identified fluorescently labeled DNAmolecules. Analysis of nucleic acid sequences were per-formed with the GCG sequence analysis software package(Genetics Computer Group, Inc., Madison, Wis.).Primer synthesis. Oligonucleotides were synthesized on a

DNA synthesizer (380; Applied Biosystems) by the phos-phoramidite method. Primer sets lA-lB and 2A-2B werethose published by Pollard et al. (22).

Clinical specimens. Human throat culture specimens wereobtained from 98 patients enrolled in a community-acquiredpneumonia study. Samples from a previously reported pri-mate model of experimental infection with C. pneumoniaewere also tested (17). These included nostril and nasopha-ryngeal specimens from two cynomolgus monkeys. Twospecimens were obtained from each monkey prior to inocu-lation with C. pneumoniae; and 12 specimens were obtainedat weeks 1, 4, and 18 post-inoculation (p.i.). A reinoculationoccurred at week 15 (17). For these clinical specimens, PCRproducts were detected by PCR-enzyme immunoassay (3).MIF. Sera from PCR-enzyme immunoassay-positive pa-

tients were tested by MIF against antigens from C. pneumo-niae and three pools of antigens from C. trachomatis (25).

RESULTS

Reaction of primers lA-lB and 2A-2B with C. pneumonwiae.Initial experiments were conducted in order to determine thereactivity of C. pneumoniae with the primers described byPollard et al. (22) for the detection of C trachomatis and C.psittaci. An approximately 240-bp product was observedfollowing PCR of C. pneumoniae DNA with primer pairlA-1B, and an approximately 119-bp product was observedwith primer pair 2A-2B (Fig. 1). The reaction of C. pneumo-niae with these primers could not be distinguished from thatof either C. trachomatis or C. psittaci. In addition, it wasnoted that C. trachomatis reacted with both of the 16S rRNAprimer pairs (lA-lB and 2A-2B) reported by Pollard et al.(22).

Sequence of 16S rRNA and synthesis of PCR primers.Additional oligonucleotide primers were synthesized on thebasis of published sequences of the 16S rRNAs of C.trachomatis and C. psittaci, and these primers were used inPCRs to construct overlapping fragments of the 16S rRNA ofC. pneumoniae (27). By this means, 1,448 bp (94%) of the C.pneumoniae 16S rRNA gene was determined. Comparisonwith other chlamydial species revealed regions of substantial

2 3 4 5 6 7 8 9 10

240 bp -

119 bp -

- 603 bp

- 234 bp

-118 bp

FIG. 1. PCR products generated with Chlamydia spp. and prim-ers lA-lB and 2A-2B. Chlamydial DNA was extracted and reactedin a PCR as described in the text. Lanes 1 and 10 contain markerDNAs, with the sizes of some of the markers noted to the right.DNA templates included C. trachomatis (lanes 2 and 3), C. psittaci(lanes 4 and 5), C. pneumoniae (lanes 6 and 7), and negative control(no DNA) (lanes 8 and 9). Primer pair lA-lB was used for thereactions applied to lanes 2, 4, 6, and 8. Primer pair 2A-2B was usedfor the reactions applied to lanes 3, 5, 7, and 9. Size markers for theexpected products of lA-lB (240 bp) and 2A-2B (119 bp) appear onthe left. PCR products were visualized with UV light followingstaining with ethidium bromide.

sequence diversity from which a pair of oligonucleotideprimers (CpnA, CpnB) was synthesized (Fig. 2). When usedin a PCR with the TW183 strain of C. pneumoniae, theseprimers resulted in the generation of a product of 463 bp.This PCR product was consistent in size with that predictedfrom the nucleic acid sequence of the C. pneumoniae 16SrRNA (Fig. 3). No product was produced with C trachoma-tis or C. psittaci. Each of six different C. pneumoniae strainsreacted with primers CpnA and CpnB (Fig. 4), but no PCRproduct was noted with the 15 serovars of C. trachomatis orthe two strains of C. psittaci. In contrast, each of thesechlamydial isolates generated a 240-bp product when theywere reacted with primer pair lA-lB as described by Pollardet al. (22). No reactivity was noted in the PCR by usingprimer pair CpnA-CpnB with any of the cell lines or otherbacteria which were evaluated (Table 1).

Sensitivity of PCR primers CPN3 and CPN4. The sensitiv-ity of PCR with primer pair CpnA-CpnB was initially as-sayed with serial dilutions of DNA extracted from elemen-tary bodies of C pneumoniae. In repeated experiments, asfew as 0.4 to 40 inclusion-forming units (IFU) of C. pneu-moniae DNA could be detected by PCR and visualization by

AC. pneumoniaeC. psittadC. trachomafsE oli

B_. nnaummnian

primer CpnA 5 '

TGACCGCGGCAGAAATGTCGTTGACCGCGGCAGAAATGTCGT

1002 GGAAGTTTTCAGAGATGAGAA 1022

3'| 5, primer CpnB5' ATTTATAGGAGAGAGGCG 3'

C.ttrachomatis CTGCAAAGGAGAGAGGCGC. trahomatis CCGCAAGGGAGAGAGGCG

1449 C-TTCG-GGAGGGCGCTT 1464

FIG. 2. Sequences of C. pneumoniae 16S rRNA and C. pneumo-niae primers. Sequences of C. pneumoniae were determined asdescribed in the text. These sequences were then aligned withsimilar regions from C. psittaci, C. trachomatis, and Escherichiacoli. The 16S rRNA regions are identified by base number from the5' end of the E. coli 16S rRNA, bases 1002 to 1022 (A) and bases1449 to 1464 (B). Letters in boldface type indicate bases withdifferences between C. pneumoniae and other Chlamydia spp.Primer CpnB was made the complement of the sequence shown inpanel B.

VOL. 30, 1992

on April 20, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

798 GAYDOS ET AL.

9 10 TABLE 1. Bacterial strains which gave no PCR productwhen tested with primers CpnA-CpnB

- 603 bp463 bp -

240 bp - 310 bp

- 1I8 bp

FIG. 3. PCR products generated with Chlamydia spp. and the C.pneumoniae-specific primer pair CpnA and CpnB. Chlamydial DNAwas extracted and reacted in a PCR as described in the text. Lanes1 and 10 contain marker DNAs, with the sizes of some of themarkers noted to the right. DNA templates included C. trachomatis(lanes 2 and 3), C. psittaci (lanes 4 and 5), C. pneumoniae (lanes 6and 7), and negative control (no DNA) (lanes 8 and 9). Primer pairlA-lB was used for the reactions applied to lanes 2, 4, 6, and 8.Primer pair CpnA-CpnB were used for the reactions applied to lanes3, 5, 7, and 9. Size markers for the expected products of lA-lB (240bp) and CpnA-CpnB (463 bp) appear to the left. PCR products werevisualized with UV light following staining with ethidium bromide.

silver staining of the 463-bp product on polyacrylamide gels(Fig. 5). The sensitivity was approximately 1 log dilution lesson ethidium-stained agarose gels.PCR of clinical specimens. Of 98 human throat specimens

obtained from patients with community-acquired pneumo-nia, 5 (5.1%) were positive for C. pneumoniae by PCR-enzyme immunoassay with primers CpnA and CpnB. Noneof these specimens yielded C. pneumoniae by tissue culturein HL cells. Of these five patients, acute-phase sera wereavailable for three patients and convalescent-phase serawere available for two patients. Two acute-phase sera dem-onstrated titers of 1:128 against C. pneumoniae. One of thesegave a titer of 1:32 in the convalescent-phase serum test.Frozen aliquots of respiratory specimens from two cyno-

molgus monkeys that were experimentally inoculated withC. pneumoniae were also available for testing (17). Speci-mens were obtained from nostrils and nasopharynxes bothbefore and after inoculation. At the time of the originalstudy, four preinoculation specimens were culture negative.One of four swabs obtained 1 week p.i. grew C. pneumoniaeat the time of the original study. Also available for studywere eight specimens for weeks 4 and 18 p.i. These speci-mens grew C. pneumoniae when they were first cultured.

2 3 4 5 6 7 8

- 603 bp463 bp

-310 bp

FIG. 4. PCR products generated with primer pair CpnA-CpnBand different strains of C. pneumoniae. Chlamydial DNA wasextracted and reacted in a PCR as described in the text. All reactionscontained primer pair CpnA-CpnB. Lanes 1 to 6 contained astemplates C. pneumoniae TW183, AR39, AR388, CWL029, 2023,and 2043, respectively. Lane 7 contained the negative control (noDNA). Lane 8 contained marker DNAs, with the sizes of some ofthe markers noted to the right. Size markers for the expectedproducts of CpnA-CpnB (463 bp) appear to the left. PCR productswere visualized with UV light following staining with ethidiumbromide.

Strain

Staphylococcus aureusStaphylococcus epidermidisHaemophilus influenzaeHaemophilus parahaemolyticusEscherichia coliKlebsiella pneumoniaeStreptococcus pyogenesStreptococcus agalactiaeBranhamella catarrhalisMicrococcus luteusCorynebacterium sp.Enterococcus faecalisStreptococcus bovisViridans group streptococciPseudomonas aeruginosa

None of these positive cultures ever yielded more than twoinclusions. Frozen aliquots of these specimens were reeval-uated for growth in tissue culture by using HL cells and alsoby PCR. All four preinoculation specimens were negative byPCR as well as by culture. Of four specimens obtained 1week p.i., three were positive by PCR, but none grew uponrepeat culture 4 years after the original aliquots were frozen.Of the remaining eight specimens that were originally culturepositive, only one grew C. pneumoniae upon repeat culturefrom frozen aliquots. However, seven of these were positiveby PCR. In summary, for p.i., eight of nine specimens thatwere culture positive originally were PCR positive and twoof three specimens that were culture negative were PCRpositive.

DISCUSSIONThe differential reactivities of C. trachomatis and C.

psittaci were described for PCR by using two primer sets(lA-lB and 2A-2B) derived from the 16S rRNA sequence ofChlamydia spp. (22). Primer pair 2A-2B was said to reactwith C. psittaci but not with C. trachomatis. However, wenoted that both of these primer sets reacted with C. pneu-moniae as well as C. trachomatis and C. psittaci. Thisdiscrepancy was not likely to have resulted from differencesin PCR conditions, since the PCR used in this study wasmore stringent than that used in an earlier study (22).Comparison of published sequences of C. trachomatis andC. psittaci and the 16S rRNA sequences of C. pneumoniae

2 3 4 5 6 7

463 bp- I31- 0-3Ibp

FIG. 5. PCR with serial dilutions of C. pneumoniae and primerpair CpnA-CpnB. Elementary bodies of C. pneumoniae were pre-pared, and the DNA was extracted from 10-fold serial dilutions ofthe preparation as described in the text. These dilutions were thenreacted in PCRs which used the primer pair CpnA-CpnB. Of each100-pl reaction, 10 ,ul was applied to a polyacrylamide gel forelectrophoresis. The 463-bp products were visualized by stainingwith silver nitrate as noted in the text. PCRs contained 40,000 IFU(lane 1), 4,000 IFU (lane 2), 400 IFU (lane 3), 40 IFU (lane 4), 4 IFU(lane 5), and 0.4 IFU (lane 6). Marker DNA is included in lane 7.

J. CLIN. MICROBIOL.

on April 20, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

C. PNEUMONUE IDENTIFICATION 799

AC. pneurnnac. psittaciC. trachomatisE. coli

BC. neumoniae

C. trachomatsE. coli

primer2A 5' 3'5' GCTTTTCTAATTTATACC 3'

GCTTTTCTAATTTACACCGCTTTTCTAATTTATACC

733 GGCCCCCTGGACGAAGAC 750

31' d 5spri5'ATGTGGATGGTCTCAACCCCAT 3'

ATGTGGATAGTCTCAACCCTATATGTGGATGGTCTCAACCCCAT

830 GAGGTTGTGCCCTTGA-GGCGT 850

FIG. 6. 16S rRNA sequences of Chlamydia spp. in the regionsused for primer pair 2A-2B. Sequences were aligned with similarregions from C. pneumoniae, C. psittaci, C. trachomatis, and E.coli. The 16S rRNA regions are identified by base number from the5' end of the E. coli 16S rRNA, bases 733 to 750 (A) and bases 830to 850 (B). Primer 2B was made as the complement of the sequence

shown in panel B.

revealed that few sequence differences were present among

these three species within the regions of primers 2A and 2B(Fig. 6). Importantly, the 3'-terminal bases of these primersequences were highly conserved. Mismatches in the 3'region are known to affect primer template annealing andPCR extension more than mismatches at other positions are

(21). On the basis of these sequences, we conclude that theprimer pair 2A-2B permits detection of all three Chlamydiaspp. by PCR.

In order to develop an assay capable of distinguishing C.pneumoniae from other Chlamydia spp., additional oligonu-cleotide primers were identified. For this purpose, we se-

quenced almost the entire length of the 16S rRNA gene of C.pneumoniae and identified a set of oligonucleotide primerswhich specifically recognized only C. pneumoniae. rRNAsequences are particularly appropriate for this purpose,

because 16S rRNA is highly conserved within individualbacterial species (28). This was especially important in thecase of C. pneumonae. Antigenic differences have recentlybeen described for C. pneumoniae, but the variations innucleic acid sequences among C. pneumoniae strains are

largely unknown (2). These antigenic strain differences are

likely to reflect changes in nucleic acid sequence. Forexample, strain variations in the major outer membraneprotein of C. trachomatis have been correlated with differ-ences at the nucleic acid level (8, 26). Since 16S rRNAsequences are highly conserved, PCR primers designed fromthose sequences are likely to recognize diverse C. pneumo-niae strains (27). This, indeed, was documented in theexperiments described here, with primer pair CpnA-CpnBcapable of detecting each of the six strains of C. pneumoniaewhich were tested by PCR.Comparison of PCR with tissue culture for the detection of

the TW183-strain of C. pneumoniae indicated that the PCRassay is capable of detecting 0.4 to 40 IFU. No increasedsensitivity was noted by PCR when primers previouslydescribed for the detection of C. trachomatis and C. psittaciwere used (22). The numerical range (0.4 to 40) of IFUdetected by PCR in different experiments is likely to haveresulted from the adhesiveness of the elementary bodies.Serial dilutions of these preparations can be difficult tocalculate precisely because of this adhesive property. Inaddition, the presence of nonviable particles might havevaried from experiment to experiment. Alternatively, differ-ences in experimental sensitivity may have resulted from thepresence of reticulate bodies in the elementary body prepa-

rations. Reticulate body nucleic acids would be detected by

PCR, but these particles are noninfectious and would notresult in the formation of an inclusion in tissue culture titers.The sensitivity of the PCR described here was compared

with the sensitivity of culture of Chlamydia strains whichwere well adapted to growth in vitro. However, C. pneumo-niae is often difficult to culture directly from clinical speci-mens. PCR may therefore offer even greater sensitivityrelative to tissue culture if it used for strains which do notgrow well in vitro.PCR also resulted in the detection of C. pneumoniae in

throat specimens from patients in a community-acquiredpneumonia study. However, interpretation of these culture-negative, PCR-positive results was difficult since PCR wasmore sensitive than the routine culture method. Two of thefive PCR-positive specimens were obtained from individualswhose sera had high-titer immunoglobulin G directed againstC. pneumoniae, as detected by MIF. Examination of thefrozen specimens from experimentally infected monkeysalso offered an opportunity to compare detection of C.pneumoniae by PCR and culture. Of the nine previouslyculture-positive unfrozen specimens, the quantity of viableorganisms was very small, because none of the cultures grewmore than two inclusions initially, and some were onlyculture positive after a blind passage. Since only 1 of 12specimens was positive upon repeat culture from frozenaliquots, this may have indicated that PCR offers increasedutility for examination of such specimens. In addition, twospecimens obtained 1 week p.i. were negative upon originaland repeat culture but were positive by PCR. This findingdemonstrates the ability of PCR to detect the presence oforganisms at a time early during infection when specimensare not yet positive by culture.While PCR offers the possibility for improved detection of

C. pneumoniae in clinical specimens, the test has twodisadvantages: cost and the need for strict quality control.However, direct culture of C. pneumoniae from clinicalspecimens is also a relatively expensive process, and thecost of PCR reagents is likely to decrease in coming years.Strict quality control of all reactions is needed in order toprevent false-positive reactions, and this remains a hin-drance to the routine use of PCR for clinical diagnosis.Techniques for the avoidance of false-positive PCR resultshave been well described, and their use greatly improves theperformance of the assay. Despite these disadvantages, PCRappears to offer a highly specific method for confirming theidentification of C. pneumoniae. Further investigations willevaluate the use of the PCR primers described here for thedirect detection of chlamydiae in additional clinical speci-mens from patients with documented rises in antibody titersdetected against C. pneumoniae.

REFERENCES1. Berdal, B. P., P. I. Fields, S. H. Mitchell, and G. Hoddevilk 1990.

Isolation of Chlamydia pneumoniae during an adenovirus out-break, p. 445-448. In W. R. Bowie et al. (ed.), Chlamydialinfections. Proceedings of the 7th International Symposium onHuman Chlamydial Infections. Cambridge University Press,Cambridge.

2. Black, C. M., J. E. Johnson, C. E. Farshy, T. M. Brown, andB. P. Berdal. 1991. Antigenic variation among strains of Chla-mydia pneumoniae. J. Clin. Microbiol. 29:1312-1316.

3. Bobo, L., F. Coutlee, R. H. Yolken, T. Quinn, and R. P. Viscidi.1990. Diagnosis of Chlamydia trachomatis cervical infection bydetection of amplified DNA with an enzyme immunoassay. J.Clin. Microbiol. 28:1968-1973.

4. Campbell, J. F., R. C. Barnes, P. E. Kozarsky, and J. S. Spika.1991. Culture-confirmed pneumonia due to Chlamydiapneumo-niae. J. Infect. Dis. 164:411-413.

VOL. 30, 1992

on April 20, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

800 GAYDOS ET AL.

5. Campbell, L. A., C. C. Kuo, and J. T. Grayston. 1987. Charac-terization of the new Chlamydia agent, TWAR, as a uniqueorganism by restriction endonuclease analysis and DNA-DNAhybridization. J. Clin. Microbiol. 25:1911-1916.

6. Chirgwin, K., P. M. Roblin, M. Gelling, M. R. Hammerschlag,and J. Schachter. 1991. Infection with Chlamydia pneumoniaein Brooklyn. J. Infect. Dis. 163:757-761.

7. Claash, C. J., J. H. T. Wagenvoort, H. G. M. Niesters, T. T. Tio,J. H. Van Rijsoort-Vos, and W. G. V. Quint. 1991. Diagnosticvalue of the polymerase chain reaction for Chlamydia detectionas determined in a follow-up study. J. Clin. Microbiol. 29:42-45.

8. Dean, D., M. Patton, and R. S. Stephens. 1991. Direct sequenceevaluation of the major outer membrane protein gene variantregions of Chlamydia trachomatis subtypes D', I', and L2.Infect. Immun. 59:1579-1582.

9. Dulith, B., C. Bebear, P. Rodriguez, A. Vekris, J. Bonnet, andM. Garret. 1989. Specific amplification of a DNA sequencecommon to all Chlamydia trachomatis serovars using the poly-merase chain reaction. Res. Microbiol. 140:7-16.

10. Grayston, J. T., L. A. Campbell, C. C. Kuo, C. H. Mordhurst,P. Saikku, D. H. Thom, and S. P. Wang. 1990. A new respiratorytract pathogen: Chlamydia pneumoniae, strain TWAR. J. In-fect. Dis. 161:618-625.

11. Grayston, J. T., V. K. Diwan, M. Cooney, and S. P. Wang. 1989.Community and hospital acquired pneumonia associated withChlamydia TWAR infection demonstrated serologically. Arch.Intern. Med. 149:169-173.

12. Grayston, J. T., C. C. Kuo, L. A. Campbell, and S. P. Wang.1989. Chlamydia pneumoniae sp. nov. for Chlamydia sp. strainTWAR. Int. J. Syst. Bacteriol. 39:88-90.

13. Grayston, J. T., C. C. Kuo, S. P. Wang, and J. Altman. 1986. Anew Chlamydia psittaci strain, TWAR, isolated from acuterespiratory tract infections. N. Engl. J. Med. 315:161-168.

14. Grayston, J. T., C. C. Kuo, S. P. Wang, M K. Cooney, J.Altman, T. J. Marrie, J. G. Marshall, and C H. Mordhorst.1986. Clinical findings in TWAR respiratory tract infections, p.337-340. In J. D. Oriel et al. (ed.), Chlamydial infections.Cambridge University Press, Cambridge.

15. Hahn, D. L., R. W. Dodge, and R. Golubjatnikou. 1991. Asso-ciation of Chlamydiapneumoniae (strain TWAR) infection withwheezing, asthmatic bronchitis, and adult-on' et asthma. JAMA266:225-230.

16. Holland, S. M., C. A. Gaydos, and T. C. Quinn. 1990. Detectionand differentiation of Chlamydia trachomatis, C. psittaci, andC. pneumoniae by DNA amplification. J. Infect. Dis. 162:984-987.

17. Holland, S. M., H. R. Taylor, C. A. Gaydos, E. W. Kappus, andT. C. Quinn. 1990. Experimental infection with Chlamydiapneumoniae in nonhuman primates. Infect. Immun. 58:593-597.

18. Kleemola, M., P. Saikku, R. Visakorpi, S. P. Wang, and J. T.Grayston. 1988. Epidemics of pneumonia caused by TWAR, anew chlamydia organism, in military trainees in Finland. J.Infect. Dis. 157:230-236.

19. Marrie, T. J., J. T. Grayston, S. P. Wang, and C. C. Kuo. 1987.Pneumonia associated with the TWAR strain of Chlamydia.Ann. Intern. Med. 106:507-511.

20. Miller, S. T., M. R. Hammerschlag, K. Chirgwin, S. P. Rao, P.Roblin, M. Gelling, T. Stilerman, J. Schachter, and G. Cassell.1991. Role of Chlamydia pneumoniae in acute chest syndromeof sickle cell disease. J. Pediatr. 118:30-33.

21. Petruska, J., M. F. Goodman, M. S. Boosalis, L. C. Sewers, C.Cheong, and I. Tinoco. 1988. Comparison between DNA meltingthermodynamics and DNA polymerase fidelity. Proc. Natl.Acad. Sci. USA 85:6252-6256.

22. Pollard, D. R., S. D. Tyler, C. W. Ng, and K. R. Rozee. 1989. Apolymerase chain reaction (PCR) protocol for the specific de-tection of Chlamydia sp. Mol. Cell. Probes 3:383-389.

23. Saikku, P., S. P. Wang, M. Kleemola, E. Brander, E. Rusanen,and J. T. Grayston. 1985. An epidemic of mild pneumonia due toan unusual strain to Chlamydia psittaci. J. Infect. Dis. 151:832-839.

24. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd ed. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

25. Wang, S. P., C. C. Kuo, and J. T. Grayston. 1979. FormalinizedChlamydia trachomatis organisms as antigens in the micro-immunofluorescence test. J. Clin. Microbiol. 10:259-261.

26. Wang, S. P., and J. T. Grayston. 1991. Three new serovars ofChlamydia trachomatis: Da, Ia, and L2a. J. Infect. Dis. 163:403-405.

27. Weisburg, W. G., T. P. Hatch, and C. R. Woese. 1986. Eubac-terial origin of chlamydiae. J. Bacteriol. 167:570-574.

28. Woese, C. R. 1987. Bacterial evolution. Microbiol. Rev. 51:221-271.

J. CLIN. MICROBIOL.

on April 20, 2021 by guest

http://jcm.asm

.org/D

ownloaded from