c© Indian Academy of Sciences

RESEARCH NOTE

Identification of a novel SHOX mutation in a Chinese familywith isolated Madelung deformity

LIBIN MEI, YANRU HUANG, QIAN PAN, HAOXIAN LI, DESHENG LIANG and LINGQIANWU∗

State Key Laboratory of Medical Genetics, Central South University, Changsha, Hunan 410078, People’s Republic of China

[Mei L., Huang Y., Pan Q., Li H., Liang D. and Wu L. 2014 Identification of a novel SHOX mutation in a Chinese family with isolatedMadelung deformity. J. Genet. 93, 809–812]

Introduction

Madelung deformity is a pseudoautosomal dominant heredi-tary disorder characterized by the lateral and dorsal curvatureof the distal radius, positive ulnar variance and proximalsubsidence of the lunate (Anton et al. 1938; Arora andChung 2006). It is frequently associated with Léri–Weilldyschondrosteosis (LWD) (Leri and Weill 1929), which ischaracterized by disproportionate short stature attributable tomesomelic shortening of the limbs. The Madelung deformityis a typical characteristic of LWD (Langer 1965; Herdmanet al. 1966); however, the presence of the forearm deformitywithout any other clinical characteristics of dyschondro-steosis supports the diagnosis of isolated Madelung defor-mity (IMD). Individuals with IMD have normal height andbody proportions, and the forearm anomaly is typicallybilateral and symmetrical. IMD is progressive, is usuallyobserved in adolescence, and occurs more commonly infemales than males (Lichtenstein et al. 1980; Grigelionieneet al. 2001). IMD is caused by mutations of the short staturehomeobox gene (SHOX, OMIM: 312865) (Ellison et al.1997; Rao et al. 1997). In addition, mutations in the GNASgene have also been reported to cause IMD (Rump et al.2011). In this study, the clinical and radiographic features of aChinese family with IMD is described. Mutation analysis ofthe SHOX gene indicated that a novel heterozygous deletionmutation of SHOX was responsible for the IMD disease inthis family.

Materials and methods

Patients

The IMD family studied here is from the southern Chinesecity of Hangzhou and comprized three generations with three

∗For correspondence. E-mail: wulingqian@sklmg.edu.cn.

affected members (figure 1a). The proband (III 2) was a29-year-old female who was 157 cm in height and 45 kgin weight. She developed bilateral wrist joint pain when shewas 13 years old. At the age of 14, she gradually exhib-ited symptoms of ulnar and palmar curvature of the distalradius and a mild limitation of abduction of the wrist joint,and at this point she was diagnosed with Madelung defor-mity. Both the proband’s sister (III 1) and father (II 1) werealso patients; her sister was 155 cm in height and presentedwith similar clinical manifestations but also exhibited mode-rately short limbs, while her father was 165 cm in height andshowed relatively mild symptoms of Madelung deformity.All three affected members showed normal stature and bodyproportions (table 1). This study complied completely withthe Tenets of the Declaration of Helsinki, and was approvedby the Ethics Board of the State Key Laboratory of Medi-cal Genetics of China. Informed consent was received by allmembers of the family before testing.

Mutation analysis by direct sequencing

Genomic DNA was isolated from the peripheral blood usingstandard extraction methods. The entire coding region andthe intron–exon boundaries of the SHOX gene were amplifiedby the polymerase chain reaction (PCR). The PCR primerswere designed using Primer5 software (Primer Biosoft Inter-national, Vancover, Canada) (table 2). The PCR productswere confirmed by polyacrylamide gel electrophoresis(PAGE), and directly sequenced using an ABI PRISMBigDye kit on an ABI3130 DNA sequencer (Applied Biosys-tems, Carlsbad, USA). Sequences were analysed usingthe DNASTAR (Madison, USA) software. The genomicsequence of the SHOX gene (NM_000451.3) was used asreference sequence.The same experiment was carried out on five unaffected

individuals of the family and 200 unrelated normal con-trols (including 118 males and 82 females aged 12–70 years,

Keywords. isolated Madelung deformity; SHOX gene; c.21delT; mutation analysis.

Journal of Genetics, Vol. 93, No. 3, December 2014 809

Libin Mei et al.

Figure 1. (a) Pedigree of the Chinese family with IMD. The filled symbols indicate individuals affected withIMD. Proband is marked by an arrow. (b) Photographs showing the IMD phenotypic characteristics of the proband.(c) Radiograph of the forearm(s) of the proband.

with an average age of 30 years) to determine whether thedetected gene variation was a causative mutation or a geneticpolymorphism.

Results

Clinical findings

Photographs of the proband’s forearm showed a prominenceof the head of the ulna at the back of the wrist and an ulnardeviation of the hand (figure 1b). An anteroposterior X-rayof the wrist and carpus showed a ‘triangular’ arrangement ofthe carpal bones, ulnar tilt, lunate subsidence and rarefactionof the medial border of the lower end of the radius. A lateralX-ray of the wrist exhibited an anterior curve of the radiusand a backward luxation of the head of the ulna (figure 1c).

Mutation screening

Direct sequencing of the PCR products amplified fromgenomic DNA from the proband (III 2) revealed a single-base deletion at nucleotide 21 (c.21delT) of the SHOX gene(figure 2a). This sequence change is predicted to resultin a frameshift at codon 7 with substitution of a leucinefor a phenylalanine and introduction of a putative stopcodon 69 amino acids downstream in the translated protein(p.Phe7LeufsX69) (figure 2d). Thus, the mutation results intruncation of 217 N-terminal amino acids of the gene prod-uct (74% of the polypeptide), including the homeodomain(figure 2c). The proband’s father (II 1) and sister (III 1) werefound to be heterozygous for this mutation, which was notfound in the five unaffected pedigree members (I 2, II 2, II 3,II 4, II 5; figure 2b), indicating that the mutation cosegregateswith IMD in the family. We also investigated this mutation

Table 1. Summary of clinical features of some affected and healthy members.

Age at test HeightID Gender (years) (cm) Madelung deformity Short limbs Body proportion Mutation

PatientsII 1 M 58 165 Mild NA Normal c.21delTIII 1 F 31 155 Obvious Mild Normal c.21delTIII 2 F 29 157 Obvious NA Normal c.21delT

Healthy membersI 2 F 75 155 NA NA Normal NAII 2 F 57 168 NA NA Normal NAII 3 M 56 172 NA NA Normal NAII 4 F 53 160 NA NA Normal NAII 5 F 50 157 NA NA Normal NA

M, male; F, female; NA, not available.

810 Journal of Genetics, Vol. 93, No. 3, December 2014

Novel SHOX mutation in Chinese IMD family

Table 2. Primers and PCR conditions used to amplify the genomic segments of SHOX.

Primer Forward primer (5′–3′) Reverse primer (5′–3′) Annealing temperature (◦C) Product size (bp)

SHOX-2 GAGGTCGCCGCGTATAAATAGT TCGGGTCCACTCCTGCCTT 61 603SHOX-3 GAAAGCAGCGAGTATCCTCCTC CGCAATGAACCCATCCTACAG 60 574SHOX-4-5 CATCAGTCACCTCCCAGCTCC GATGCGGCAGCAAATAGGG 59 470SHOX-6 GAAGGAGGAAAGGCGGGTGT TCAGGCCTCTTGCAGGAGCT 60 549

Figure 2. Genetic characterization of the IMD family. (a) Sequencing in proband (III 2) show a novel deletion mutation(c.21delT) in SHOX. (b) Sequence in an unaffected female member (II 4) in the family. (c) Relative position of mutationin SHOX. (d) Evolutionary conservation of amino acids: box showing loss of the conserved phenylalanine residue andtruncation of protein in the patient.

in 200 healthy controls by direct sequencing, and found thatthis mutation did not exist in any of the 200 unrelated normalcontrols. Until now, this variant has not been reported in theExome Variant Server, dbSNP135 or 1000 Genome datasets.These results confirm that the c.21delT mutation in SHOX isresponsible for IMD in this family.

Discussion

Madelung deformity, a rare congenital anomaly of the wrist,is associated with a SHOX gene defect (Shears et al. 1998;Clement-Jones et al. 2000). The SHOX gene, which spansmore than 35 kb of genomic DNA and contains six exons,is located within the pseudoautosomal region (PAR1) of theX and Y chromosomes (Rao et al. 1997). SHOX encodes apaired related homeodomain transcription factor, which con-sists of a homeodomain and a C-terminal OAR (otp arista-less rax) domain. SHOX is mainly expressed in human limband pharyngeal arches, with the strongest expression in theelbow, the distal ulna/radius and the wrist (Rao et al. 1997;Clement-Jones et al. 2000; Blaschke et al. 2003). A study by

Clement-Jones et al. (2000) indicated that the homeodomainproteins play critical roles in controlling the embryonicdevelopment in vertebrates, suggesting that mutations to theSHOX gene may lead to developmental abnormalities.In this study, we analysed a Chinese family diagnosedwith

IMD, which is defined as the presence of the bilateral wristdeformity without short stature and body disproportion. Phe-notypic heterogeneity and intrafamilial variability are regu-larly observed in patients with SHOX deficiency, and the clin-ical symptoms of IMD become more apparent with age andare more severe in females (Schiller et al. 2000; Blaschkeet al. 2003). These conditions were also observed in thefamily under study, as three patients developed Madelungdeformity at the onset of puberty and the sisters (III 1 andIII 2) exhibited more severe wrist deformities than theirfather (II 1). This demonstrates the necessity of early molec-ular diagnosis of every member of a family in which IMD issuspected to provide guidance and early treatment opportuni-ties for patients so as to reduce the harmful effects of skeletaldeformities.In this study, a single-base deletion mutation (c.21delT) in

the SHOX gene was identified. This mutation cosegregatedwith the disease phenotype and was not found in the healthy

Journal of Genetics, Vol. 93, No. 3, December 2014 811

Libin Mei et al.

members of the family or in 200 unrelated control indivi-duals, indicating that the c.21delT mutation of SHOXis a pathogenic mutation of IMD in the family. Munnset al. (2003) concluded that SHOX haploinsufficiency leadsto short arms in 92%, bilateral Madelung deformity in73% and short stature in 54%. SHOX haploinsufficiencycaused by nucleotide deletions has been frequently reportedin dyschondrosteosis individuals, but point mutations arerelatively rare (Shears et al. 1998; Schiller et al. 2000).Previous studies of LWD families have reported two dele-tion mutations causing a truncation of the SHOX proteinbefore the start of the homeodomain: a single-base deletion(c.272delG) and a two-base pair deletion (c.106–107delCG),both led to a frameshift and premature translational ter-mination at codons 75 and 77, respectively (Grigelionieneet al. 2000; Huber et al. 2001). Likewise, the single-basedeletion mutation (c.21delT) identified in this study occurs inthe highly conserved domain and leads to a premature stopcodon 69 amino acids downstream. The resulting prematuretermination of translation is expected to yield a nonfunc-tional protein lacking the homeodomain, leading to SHOXhaploinsufficiency and the disease phenotype. This findingsupports the view that SHOX haploinsufficiency is the mostfrequent disease-causing mechanism in dyschondrosteosis(Grigelioniene et al. 2001; Flanagan et al. 2002).In conclusion, we have identified a novel heterozygous

deletion mutation in the SHOX gene of an IMD family. Thisdiscovery will help provide the patients’ offspringwith accu-rate and reliable genetic counselling and prenatal diagno-sis. Further, our findings broaden the mutation spectrum ofSHOX and understanding of the diverse and variable effectsof SHOX mutations.

Acknowledgements

Authors thank the family members who participated in this studyfor their help and support. This study was supported by the researchgrant (no. 2012CB944601) from the National Basic Research Pro-gramme of China.

References

Anton J. I., Reitz G. B. and Spiegel M. B. 1938 Madelung’sdeformity. Ann. Surg. 108, 411–439.

Arora A. S. and Chung K. C. 2006 Otto W. Madelung and therecognition of Madelung’s deformity. J. Hand. Surg. 31, 177–182.

Blaschke R. J., Töpfer C., Marchini A., Steinbeisser H., JanssenJ. W., Rappold G. A. et al. 2003 Transcriptional and translational

regulation of the Leri-Weill and Turner syndrome homeoboxgene SHOX. J. Biol. Chem. 278, 47820–47826.

Clement-Jones M., Schiller S., Paw E., Blaschke R. J., Zuniga A.,Zeller R. et al. 2000 The short stature homeobox gene SHOXis involved in skeletal abnormalities in Turner syndrome. Hum.Mol. Genet. 9, 695–702.

Ellison J. W., Wardak Z., Young M. F., Gehron Robey P., Laig-Webster M. and Chiong W. 1997 PHOG, a candidate gene forinvolvement in the short stature of Turner syndrome. Hum. Mol.Genet. 6, 1341–1347.

Flanagan S. F., Munns C. F., Hayes M., Williams B., Berry M.,Vickers D. et al. 2002 Prevalence of mutations in the short staturehomeobox containing gene (SHOX) in Madelung deformity ofchildhood. J. Med. Genet. 39, 758–763.

Grigelioniene G., Eklöf O., Ivarsson S. A., Westphal O., NeumeyerL., Kedra D. et al. 2000 Mutations in short stature home-obox containing gene (SHOX) in dyschondrosteosis but not inhypochondroplasia. Hum. Genet. 107, 145–149.

Grigelioniene G., Schoumans J., Neumeyer L., Ivarsson A., EklöfO., Enkvist O. et al. 2001 Analysis of short stature homeobox-containing gene (SHOX) and auxological phenotype in dyschon-drosteosis and isolated Madelung deformity. J. Hum. Genet. 109,551–558.

Herdman R. C., Langer L. O. and Good R. A 1966 Dyschondro-steosis, the most common cause of Madelung’s deformity. J.Pediatr. 68, 432–441.

Huber C., Cusin V., Le Merrer M., Mathieu M., Sulmont V.,Dagoneau N. et al. 2001 SHOX point mutations in dyschondros-teosis. J. Med. Genet. 38, 323.

Langer L. 1965 Dyschondrosteosis,a hereditable bone dysplasiawith characteristic roentographic features. Am. J. Roentgenol. 95,178–188.

Leri A. and Weill J. 1929 Une affection congenitale et symetriquedu development osseux :la dyschondrosteoste. Bull. Mem. Soc.Med. Hop. Paris 53, 1491–1494.

Lichtenstein J. R., Sundaram M. and Burdge R. 1980 Sex-influenced expression of Madelung’s deformity in a family ofdyschondrosteosis. J. Med. Genet. 17, 41–43.

Munns C. F., Glass I. A., Flanagan S., Hayes M., Williams B., BerryM. et al. 2003 Familial growth and skeletal features associatedwith SHOX haploinsufficiency. J. Pediatr. Endocrinol. Metab.16, 987–996.

Rao E., Weiss B., Fukami M., Rump A., Niesler B., Mertz A. et al.1997 Pseudoautosomal deletions encompassing a novel home-obox gene cause growth failure in idiopathic short stature andTurner syndrome. Nat. Genet. 16, 54–63.

Rump P., Jongbloed J. D., Sikkema-Raddatz B., Mundlos S.,Klopocki E. and van der Luijt R. B. 2011 Madelung deformity ina girl with a novel and de novo mutation in the GNAS gene. Am.J. Med. Genet. A. 155, 2566–2570.

Schiller S., Spranger S., Schechinger B., Fukami M., MerkerS., Drop S. L. et al. 2000 Phenotypic variation and geneticheterogeneity inLeri-Weill syndrome.Eur. J. Hum. Genet. 8, 54–62.

Shears D. J., Vassal H. J., Goodman F. R., Palmer R. W., ReardonW., Superti-Furga A. et al. 1998 Mutation and deletion of thepseudoautosomal gene SHOX cause Leri-Weill dyschondro-steosis. Nat. Genet. 19, 70–73.

Received 16 December 2013, in revised form 24 March 2014; accepted 25 April 2014Unedited version published online: 25 June 2014Final version published online: 22 September 2014

812 Journal of Genetics, Vol. 93, No. 3, December 2014