485

J.F. Loring & S.E. Peterson (eds): Human Stem Cell Manual, Second edition. DOI: © 2013 Elsevier Inc. All rights reserved.2012

http://dx.doi.org/10.1016/B978-0-12-385473-5.00031-X

Gene Targeting by Homologous Recombination in Human Pluripotent Stem Cells

CHAPTER 31

Sangyoon Han and Ying Liu

EDITOR’S COMMENTARYGene targeting by homologous recombination has become a widely used tech-nique for genetically modifying mice. This approach was initiated in the mid-1980s by a handful of pioneering researchers who found that knocking out genes in mouse embryonic stem cells (ESCs) was an effective way to generate mice that had mutations in specific genes. Over the past 20 years, with large investments from funding agencies, variations on this method have resulted in thousands of precisely engineered mouse strains. However, applying the les-sons learned from mouse ESC experience to human PSCs has been a challenge. Human PSCs divide more slowly and are more sensitive to transfection tech-niques and cloning methods that are routinely used for mouse ESCs. However, with adaptations, targeting genes in hPSCs using straightforward homologous recombination methods has been successful in several laboratories. There are alternative methods for gene targeting that have become available in the past few years, and one of these, zinc finger nuclease (ZFN)-mediated homologous recombination, is described in detail in Chapter 32. The nuclease approaches engineer fusions of a restriction enzyme (Fok1) with sequence-specific DNA-binding proteins like ZFs and TALEs (transcription activator-like effectors). The efficiency of targeting protocols using ZFNs and TALE nucleases (TALENs) is generally higher, usually much higher, than conventional gene targeting vec-tors. One great advantage of conventional gene targeting approaches is that because of the tremendous history of genetic manipulation in the mouse, the construction of targeting vectors is routine at many institutions. There is also a huge toolkit of subtle genetic engineering approaches that have been devel-oped for the mouse, including conditional and inducible systems for control-ling the timing and cell type-specificity of the genetic changes. At the moment, the main disadvantage of ZFNs and TALENs appears to be that their design is not easily accessible so they are not widely applied in research laboratories, and commercial sources are too expensive for most grant-funded researchers.

CHAPTER 31: Gene Targeting by Homologous Recombination in hPSCs486

There is also the unanswered question about whether the nucleases may have significant off-target effects that cause DNA aberrations elsewhere in the genome. The authors of this chapter have both independently targeted genes in hPSCs, and they describe here a method that has worked well for their labs.

OVERVIEWHere we describe a conventional method used to construct targeting vectors and the workflow for generating reporter lines in hPSCs using those vectors (Figure 31.1). This protocol works well and has been used to generate several reporter lines in multiple hPSC lines. Targeting efficiency is determined by accessibility of the genetic loci in hPSCs, the structure of targeting vectors, and other uni-dentified factors. This chapter describes the construction of targeting vectors and transfection into hPSCs to make lineage reporters at a relatively high efficiency.

PROCEDURESTargeting vector design is crucial for the successful creation of any transgenic cell line. Here we outline a method that will decrease false positives and increase efficiency. The strategy described will also greatly reduce laborious work during clonal expansion and screening to identify true positives. Figure 31.1 provides an overview of the process of creating a reporter cell line, and Figure 31.2 illus-trates the elements of the targeting construct: 5 and 3 arms of homology, posi-tive selection cassette (Neo), reporter (GFP), and negative selection elements (DTA).

Choice of Targeting VectorTo be able to select for cells that have successfully integrated the target-ing vector, the vectors are generally constructed to include positive selection

FIGURE 31.1Workflow for gene targeting in hPSCs.

Procedures 487

cassettes, usually genes that confer resistance to drugs such as neomycin, hygromycin, or puromycin. Positive drug selection, however, does not allow selection against random integrations, and strategies using only positive selection often require the screening of many hundreds of colonies to find homologous recombinants.

In order to reduce the likelihood of false positives from random integra-tion, negative selection markers are often added to targeting vector design. Thymidine kinase (TK) and diphtheria toxin A (DTA) are the most common negative selection markers. TK activity is achieved using toxic thymidine analogs (e.g. 5-bromodeoxyuridine, ganciclovir), which are incorporated into DNA only if there is TK activity in the cell via random integration. The

FIGURE 31.2(A) Schematic of the genomic structure and locus of a hypothetical targeting area. Red line is sequence area used in targeting vector. (B) Design of targeting vector including arms, reporter, and selection markers. (C) The location of primers for genomic PCR. Each set should have one primer outside of the arm and inside of the targeting construct. (D) An example of the probe to be used for Southern blotting and the restriction site for digestion of genomic DNA from the wild type cell line (top). Possible genomic fragment after digestion of a transgenic cell line (bottom).

CHAPTER 31: Gene Targeting by Homologous Recombination in hPSCs488

disadvantage of using TK is that different concentrations of toxic thymidine analogs must be tested in the same cell line prior to gene targeting experi-ments in order to determine the optimal drug concentration. This negative selection method also requires an extra plate of cells during screening to eliminate false positives by applying thymidine analogs on one plate while keeping the other plate for maintenance until the toxic analog test reveals which clones have survived. In contrast, it is not necessary to add analogs when DTA is used as a negative selection marker. DTA is sufficiently strong enough to kill a cell when even one molecule of DTA protein is expressed as a result of random integration. Upon electroporation of cells with a tar-geting vector containing DTA, cells expressing DTA start to die as early as 12 hours later. Furthermore, elimination of false positives is more effective when double DTAs are located at the end of both arms. However, it is possi-ble that they can be excised during the process of homologous recombination due to the fact that both DTAs have identical sequences. Figure 31.3 illustrates the construction of a DTA-containing targeting vector. In the pages that follow we describe a strategy for targeting vector construction with an example that can be modified depending on genes of interest and reporter cassettes.

Construction of Targeting Vector with Selection MarkerDesign primers with an additional enzyme site linker and amplify PGK-neo-bpA (Addgene, Plasmid #13442). In general, the concentration of neomycin after transfection is between 50 and 200 μg/mL. The fragment will be digested by one or two of the restriction enzymes used in the multi-cloning site (MCS) and will be cloned between the arms later. Alternatively, a different combina-tion of promoters and antibiotic resistant cassettes can be used (Table 31.1).

Construction of Reporter CassettesFluorescent proteins are often used as reporters for visualization of targeted cells. Depending upon the purpose of the transgenic cell line (e.g. knock-out, knock-in, or inducible transgenic cell lines), the reporter cassettes can be located at different sites in the targeting constructs. Here, we specifically discuss knock-in transgenic cell lines in which endogenous expression is not interrupted by the reporter gene. This strategy allows the reporter gene to recapitulate expression of the endogenous gene. A simple method used to achieve this is the introduction of an internal ribosome entry site (IRES) or the self-cleaving 2A peptide fragment at the end of the last exon.

The reporter described here is green fluorescent protein (GFP) with an equine rhinitis A virus 2A domain (ERAV, E2A) linked to the last exon of the gene of interest. The E2A domain can be synthesized with DNA oli-gos of 13–15 base pairs overlapping with the first 13–15 base pairs of GFP. To achieve this: (1) perform a PCR reaction with synthesized E2A DNA as a

Procedures 489

FIGURE 31.3Cloning strategy. 5 and 3 arms are amplified and subcloned with the reporter gene using a positive selection maker such as Neo in the cloning vector. In parallel, negative selection markers are subcloned into the target vector backbone. Later the 5 arm-reporter-3 arm fragment is cloned into the targeting vector with a negative selection maker.

Table 31.1 Different Combinations of Promoters with Antibiotic Resistance Genes Described Here Can Be Used for Selection. Each Antibiotic Resistance Gene Has Been Tested in Different Concentrations with hPSCs

Promoters Antibiotics

EF1a (elongation factor 1a) Neomycin (G418): 50–200 μg/mL

PGK (phosphoglycerate Kinase) Hygromycin: 100 μg/mLSV40 (simian virus 40) Puromycin: 1 μg/mLActB (human beta acin)

CHAPTER 31: Gene Targeting by Homologous Recombination in hPSCs490

forward primer and a regular reverse primer for GFP; and (2) Re-amplify E2A-GFP with primers containing linkers to clone into the multiple cloning site later. (Alternatively, the linker can be added when E2A is synthesized).The sequence for E2A is 5TCTAGAGCATGCGCACCGGTGAAACAGACTT TGAATTTTGACCTTCTTAAGCTTGCGGGAGACGTCGAGTCCAACCCTGGGC CC 3’.

Cloning of Homology Arms and Finalizing Targeting VectorFirst, decide the length of the 5 and 3 homology arms, which must be at least 3 kb long each. Generally, homology arms shorter than 3 kb are not rec-ommended. Amplify the 5 and 3 arms with primers containing additional unique enzyme site linkers. Clone into a cloning vector and confirm by sequencing. If possible, amplify the homology arms from the human cell line to be targeted.

Depending on the restriction enzyme sites used, sequential cloning might be necessary. It is not necessary to combine pieces of the targeting vector in a specific order unless redundant restriction enzymes are used in the strategy.

Example of Gene Targeting in Human Embryonic Stem CellsPreparation of Geltrex®-Coated Plates1. Thaw a whole bottle of Geltrex at 4°C overnight.2. Add an equal volume of cold DMEM/F12 to make 100 stock solution

and store desired aliquots at 20°C.3. Thaw aliquots at 4°C before coating plates. Add appropriate volume of

DMEM/F12 to make 1 solution and add to culture dishes to completely cover plate (e.g. 3–4 mL per 100 mm dish). Coated dishes can be used immediately after coating or stored at 4°C for 2 weeks.

4. Avoid drying the dishes and remove coating solution right before use.

Passage of hPSCs on Geltrex-Coated Platesn Note

This is for use with feeder-free, enzymatic passage-adapted hPSCs (see Chapter 3 for feeder-free culture methods) n

1. Use medium designed for feeder-free culture (e.g. mTeSR or StemPro).2. Change medium daily until cells are 80% confluent.3. Incubate hPSCs with 5 mL of warm dispase at 37°C for 5–10 minutes

until the edges of colonies slightly curl up.4. Aspirate dispase and slowly add warm DMEM/F12 to wash away excess

dispase. Repeat once.

Procedures 491

5. Add appropriate volume of warm medium (e.g. 5 mL/100 mm dish) and detach colonies by pipetting the medium up and down.

6. Transfer collected colonies into a 50 mL conical tube and pipette vigorously to break apart colonies. In general, pipetting 5–10 times at the fastest speed is enough.

7. Add appropriate amount of warm medium into the tube based on the number of plates. Aliquot cells into dishes.

ElectroporationDifferent types and brands of electroporation instruments can be used. We outline a procedure for electroporation with the Bio-Rad Gene Pulser® II electroporation system. Methods using other systems are described in Chapter 30.

1. Culture feeder-free hPSCs to 80% confluency, usually cells harvested from two 60 mm dishes (3~6 106) are enough for one electroporation.

2. Add 30 μg linearized DNA to a 1.5 mL microcentrifuge tube. 3. Prepare drug resistant MEF dishes (for positive selection) and add

3 mL of conditioned medium/dish, save in 37°C, 5% CO2 incubator. 4. Pre-warm 3 mL conditioned medium for each electroporation in a 15 mL

conical tube in a 37°C water bath. 5. Add 1 mL Accutase™ to each 60 mm dish and incubate for 3–5 minutes

until the cells become dislodged. 6. Collect cells and centrifuge at 200 g for 5 minutes to pellet them. 7. Resuspend cells in 1 PBS as single cells and count. 8. Remove desired number of cells and place in a new 15 mL conical

tube. 9. Spin at 200 g for 5 minutes. 10. Remove PBS and resuspend in 800 μL of OptiPro™ SFM or PBS. 11. Add cells into the 1.5 mL microcentrifuge tube that contains DNA, and

transfer the mixture to an electroporation cuvette (0.4 cm gap). 12. Electroporate the cells once using the Bio-Rad Gene Pulser II or Xcell

system using the following conditions: 250 V, 250 μF. 13. Immediately transfer the cells into the 15 mL conical tube (prepared in

Step 4) using a Pasteur pipette and incubate at room temperature for 5 minutes.

14. Transfer the mixture from Step 13 into the 60 mm dish (prepared in Step 3) and incubate in the 37°C, 5% CO2 incubator.

Picking and expanding clones1. On the day following electroporation, change medium with 10 mL of

fresh, warm culture medium (TeSR™ or equivalent feeder-free medium).

CHAPTER 31: Gene Targeting by Homologous Recombination in hPSCs492

2. Change medium with 10 mL of medium 48 hours later. This will give the cells enough time to settle and any cells with random integration will die.

3. The third day following electroporation, change to medium with G418 at the concentration of 50 μg/mL and increase the concentration by 50 μg/mL every 2 days until the concentration is 200 μg/mL.

n NoteThe gradual increase in G418 concentration allows you to control the rate at which cells are killed so that there is not too much damage to neigh-boring cells. The concentration of G418 to be used is dependent on the sensitivity of the cell line as well as the power of the promoter driving the drug selection cassette. Cells containing a weak promoter for neo (or a mutated neo) may be unintentionally killed by using too high a con-centration of G418. Ideally, a “kill curve” should be established for your cell line. This is done by culturing enzymatically-dissociated cells seeded at low density in several concentrations of G418, ranging from 50 to 400 μg/mL, changing the G418-containing medium each day for 10 days. After 10 days, the lowest concentration at which all of the cells are killed should be obvious. n

4. Approximately 10–14 days later, there should be colonies big enough to pick manually.

5. Transfer individual colonies into each well of a 24-well plate and continue to culture the dish until more colonies are ready for manual dissection.

6. After 7 days, colonies in the 24-well plate will be ready for splitting into one well of 6-well plate.

7. Add 500 μL of warm dispase into each well of 24-well plate and incubate at 37°C for 5–15 minutes until the edges of the colonies curl up slightly.

8. Remove dispase and slowly add 500 μL of warm medium and aspirate the media. Repeat two times.

9. Add 500 μL of warm medium and lift up all colonies by gentle pipetting. Transfer cells to a 15 mL tube.

10. Add 1.5 mL of warm medium into mixture and gently pipette to break the colonies into small pieces.

11. Transfer into one well of a 6-well plate and incubate in a humidified 37°C, 5% CO2 incubator until cells are ready to split into one 6-well plate (this will take another week or so).

12. When one well of the 6-well plate is ready to split, save half of the cells for genomic PCR and Southern hybridization to confirm whether the reporter gene is integrated into the right locus.

Procedures 493

n NoteSouthern hybridization is the most definitive method to confirm targeted clones. Ideally, the targeting vector should be designed with Southern analysis in mind. It should contain a restriction site that will allow prob-ing of the locus with a probe that recognizes only the targeted sequence. Southern hybridization may also reveal additional targeting construct sequence that has randomly integrated into the genome. n

Screening for True Positive ClonesGenomic PCR ScreeningDesign primers outside of 5 and 3 homology arms with a GC content of 50% and Tm at 62°C. In order to optimize the genomic PCR conditions, use a set of primers from outside of the 5 and 3 arms in a gradient PCR machine with any high fidelity polymerase. The optimized condition can then be used to screen positive clones. Use a set of primers such as one from the reporter cassette and either primer from outside of the 5 or 3 arm to confirm that the targeting cassette is integrated into the correct locus. Test primers with the same genomic DNA used to amplify the arms using a gradient PCR machine. Internal primers also should have similar GC content and Tm. We have been successful in amplifying DNA when there are true positives using a three-cycle PCR. Steps in three-cycle PCR are: 95°C for 2 minutes for initial denatura-tion; followed by 30–35 cycles of 95°C for 1 minute, the optimal annealing temperature for 1 minute, and 72°C for 1 minute/kb for extension.

Southern HybridizationProbes can be prepared using the DIG System (Roche) for non-radioactive probes. Other modified nucleotides are Cy5-dCTP, fluorescein-, rhodamine-, and courmarin-dUTP, and antibodies against these analogs are also com-mercially available. They can be detected by any chemiluminescent detection system.

Generate the probe with 0.1 ng of template DNA, 0.2 μg of each primer, 5 μL of PCR DIG labeling mix, 5 μL of PCR 10 buffer and 0.5 μL of Enzyme mix and fill to 50 μL with water. The PCR can then be performed for 35 cycles and 1–2 μL of the reaction is then run on a gel to confirm. The probe now can be stored at 4°C in the short term or 20°C for long term.

1. Prepare 0.6–0.8% agarose gel in 1 TAE buffer with ethidium bromide (EtBr). Note that TAE buffer resolves larger fragments better than TBE buffer.

2. Run a gel containing the genomic PCR product at 40–60 V for 5–6 hours or until the desired fragments are well resolved. Carefully trim the gel to remove the blank space on the edge of the gel that contains no DNA. Take a picture showing a fluorescent ruler.

CHAPTER 31: Gene Targeting by Homologous Recombination in hPSCs494

3. Denature the genomic DNA by submerging the gel in 500 mL Denaturation buffer and rocking it gently for 30 minutes.

4. Neutralize the gel in 500 mL Neutralization buffer by rocking gently for 30 minutes.

5. Set up DNA transfer following the layout illustrated in Figure 31.4. 6. Place gel cast upside down in a large tray. 7. Cut four sheets of Whatman paper (size slightly bigger than the width of gel

and long enough to cross gel cast) and soak the papers in transfer buffer. 8. Place two sheets of stacked Whatman papers in one direction and put

another two sheets of stacked Whatman paper in the other direction. 9. Put gel with the open wells facing down to ensure that genomic DNA at

the bottom of well is close to membrane. 10. Overlay Hybond-N membrane (presoaked in 0.4 N NaOH) on top of

the gel. Cut or label a corner of membrane to facilitate orientation later. 11. Put two sheets of presoaked Whatman paper on the membrane and

stack 5 inches of similar size paper towels. Changing the paper towels every 2–3 hours shortens the transferring time.

12. Put about 500 g of weight on top of paper towels. Make sure the stacks do not fall during transfer.

13. Add plenty of 0.4 N NaOH to the tray and let it transfer for at least 6–8 hours or overnight.

14. Disassemble transfer stack and crosslink genomic DNA using an auto crosslinker. Air-dry the membrane.

FIGURE 31.4Southern blot. Blot is set up from bottom to top. A large dish is filled with 0.4N NaOH. Gel is placed on the top of the gel cast up side down. Place two pieces of wick-blotting paper cut to the width of the gel and length such that the wick is in contact with the bottom of the dish. Cut membrane to the exact size of the gel, with a nick in the corner for orientation and place it on the top of the gel. Membrane is now in contact with the bottom of gel. Two pieces of blotting paper cut to the exact size of the gel are placed on the top of the membrane. Bubbles are gently removed by rolling over it with a glass pipette. Stack with similar size paper towels and change it every 2–3 hours.

Reagents and Supplies 495

15. Incubate the membrane with pre-warmed Pre-hybridization buffer at 42°C for 30 minutes.

16. Denature the probe by heating at 100°C for 5 minutes and chill on ice until hybridization is ready.

17. Change Pre-hybridization buffer with fresh Hybridization buffer with probe and incubate overnight at 42°C.

18. The next day, wash the membrane with Washing buffer I for 10 minutes, 3 times at 68°C.

19. Wash the membrane with Washing buffer II for 10 minutes 1–2 times.20. Wash the membrane with Washing buffer III for 10 minutes once.

Note: Washing buffers II and III can be skipped if signals are weak.21. Wash the membrane with 1 PBS briefly.22. Incubate the membrane with blocking solution for 30 minutes on a rocker.23. Change blocking buffer (2–5% non-fat dry milk in blotting buffer pH

7.4) with antibody solution (anti-DIG-AP antibody at 200 mU/mL in 1–5% non-fat dry milk in Blotting buffer pH 7.4) and incubate for 30 minutes at room temperature with gentle rocking.

24. Wash the membrane at room temperature for 15 minutes with 4–5 changes of blotting buffer.

25. Place the membrane with DNA side up on a transparency film and apply 1 mL of diluted CSPD solution.

26. Incubate the membrane for 15 minutes at 37°C to enhance luminescent reaction and expose to X-ray film or scan image.

REAGENTS AND SUPPLIESRecommended Reagents

Item Supplier Catalog # Note

One Shot® Top10 Electrocompetent E. Coli

Life Technologies C4040-50

AccuPrime Pfx Super Mix Life Technologies 12344-040Restriction enzymes Life Technologies

and New England Biolabs

Various

ZymocleanTM Gel DNA Recovery Kit

Zymo Research D4007

Geneticin® G418 Life Technologies 11811 Complete kill curve for accurate dosage

mTeSR1 Stem Cell Technologies

05850 StemPro could potentially be used but has not been tested in this protocol

TeSR Stem Cell Technologies

05860 StemPro could potentially be used but has not been tested in this protocol

CHAPTER 31: Gene Targeting by Homologous Recombination in hPSCs496

Item Supplier Catalog # Note

0.25% Trypsin-EDTA Solution

Life Technologies 25200-056

Fetal Bovine Serum – ES cell qualified

Life Technologies 10439

Dulbecco’s Phosphate Buffered Saline without Magnesium and Calcium

Life Technologies A12856-01

DMEM/F12 with GlutaMAX Life Technologies 10565-018Dispase Life Technologies 17105-041Geltrex Life Technologies 12760-01350 TAE Life Technologies 24710030DIG System Roche 1745832Anti-digoxigenin (DIG)-AP Roche 1093274CSPD Chemiluminescence System

Roche 1755633

Recombinant human bFGF

Invitrogen 13256-029

Collagenase, Type IV, microbial

Invitrogen 17104-019

Pen/Strep (100) Invitrogen 15070-063 Optional

RECIPES20 SSPE

Component Amount

NaCl 175.3 gNaHPO4 26.6 gEDTA 9.4 g

1. Weigh out and combine the above reagents.2. Add water to 1.0 L.3. Stir to dissolve.4. Adjust pH to 7.4 with NaOH.

Denaturation Buffer

Final Concentration Component AmountStock Concentration

1.5 M NaCl 300 mL 5 M0.5 M NaOH 40 mL 12.5 N

1. Combine the above reagents.2. Add water to 1.0 L.

Recipes 497

Neutralization BufferFinal Concentration Component Amount Stock Concentration

1.5 M NaCl 300 Ml 5 M0.4 M Tris-HCl 40 mL 10 M

1. Combine the above reagents.2. Add water to 1L.

Pre-Hybridization and Hybridization BufferFinal Concentration Component Amount Stock Concentration

5 SSPE 250 mL 20

0.1% N-Lauroylsarcosine 100 mL 1%0.02% SDS 0.2 mL 10%1 Blocking buffer 100 mL 10

Note: blocking buffer is included in DIC kit.

1. Combine the above reagents.2. Add water to 1L.

Washing Buffer IFinal Concentration Component Amount Stock Concentration

1 SSPE 50 mL 20

1% SDS 100 mL 10%

1. Combine the above reagents.2. Add water to 1L.

Washing Buffer IIFinal Concentration Component Amount Stock Concentration

0.5 SSPE 25 mL 20

1% SDS 100 mL 10%

1. Combine the above reagents.2. Add water to 1.0 L.

Washing Buffer IIIFinal Concentration Component Amount Stock Concentration

0.1 SSPE 5 mL 20

1% SDS 100 mL 10%

1. Combine the above reagents.2. Add water to 1.0 L.

CHAPTER 31: Gene Targeting by Homologous Recombination in hPSCs498

Blotting BufferFinal Concentration Component Amount Stock Concentration

0.15 M NaCl 30 mL 5 M

25 mM Tris-HCl 25 mL 10 M0.1% Tween20 1 mL 100%

1. Combine the above reagents.2. Add water to 1.0 L.

READING LISTBu, L., Jiang, X., Martin-Puig, S., et al., 2009. Human ISL1 heart progenitors generate diverse

multipotent cardiovascular cell lineages. Nature 460, 113–117.

Bu, L., Gao, X., Jiang, X., et al., 2010. Targeted conditional gene knockout in human embryonic stem cells. Cell Res. 20, 379–382.

Davis, R.P., Ng, E.S., Costa, M., et al., 2008. Targeting a GFP reporter gene to the MIXL1 locus of human embryonic stem cells identifies human primitive streak-like cells and enables isola-tion of primitive hematopoietic precursors. Blood 111, 1876–1884.

Hockemeyer, D., Soldner, F., Beard, C., et al., 2009. Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nat. Biotechnol. 27, 851–857.

Irion, S., Luche, H., Gadue, P., et al., 2007. Identification and targeting of the ROSA26 locus in human embryonic stem cells. Nat. Biotechnol. 25, 1477–1482.

Palmiter, R.D., Behringer, R.R., Quaife, C.J., et al., 1987. Cell lineage ablation in transgenic mice by cell-specific expression of a toxin gene. Cell 50, 435–443.

Pelletier, J., Sonenberg, N., 1988. Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature 334, 320–325.

Ruby, K.M., Zheng, B., 2009. Gene targeting in a HUES line of human embryonic stem cells via electroporation. Stem Cells 27, 1496–1506.

Szymczak, A.L., Workman, C.J., Wang, Y., et al., 2004. Correction of a multi-gene deficiency in vivo using a single “self-cleaving” 2A peptide-based retroviral vector. Nat. Biotechnol. 22, 589–594.

Thomas, R., Capecchi, M.R., 1987. Site-directed mutagenesis by gene tar- geting in mouse embryo-derived stem cells. Cell 51, 503–512.

Urbach, A., Schuldiner, M., Benvenisty, N., 2004. Modeling for Lesch-Nyhan disease by gene tar-geting in human embryonic stem cells. Stem Cells 22, 635–641.

Xue, H., Wu, S., Papadeas, S.T., et al., 2009. A targeted neuroglial reporter line generated by homologous recombination in human embryonic stem cells. Stem Cells 27, 1836–1846.

Yagi, T., Nada, S., Watanabe, N., et al., 1993. A novel negative selection for homologous recom-binants using diptheria toxin A fragment gene. Anal. Biochem. 214, 77–86.

Zou, J., Maeder, M.L., Mali, P., et al., 2009. Gene targeting of a disease-related gene in human induced pluripotent stem and embryonic stem cells. Cell Stem Cell 5, 97–110.

Zwaka, T.P., Thomson, J.A., 2003. Homologous recombination in human embryonic stem cells. Nat. Biotechnol. 21, 319–321.