Upload
ghanshyam-upadhyay
View
42
Download
2
Tags:
Embed Size (px)
Citation preview
Article
Pesticides-induced biochemicalalterations in occupational NorthIndian suburban population
RK Sharma1, G Upadhyay2, NJ Siddiqi3 andB Sharma1
AbstractPesticides are used in agriculture to protect crops from insects–pests. Most of the field workers of NorthIndian population are exposed to commonly used insecticides. In the present study, pesticides induced oxida-tive stress as well as alterations in the level of acetylcholinesterase (AChE) in a total of 70 male healthyagricultural sprayers, exposed to pesticides for about 5 years, were studied and the results were comparedwith 70 controls. The levels of antioxidant enzymes (superoxide dismutase, CAT, glutathione-S-transferaseand glutathione peroxidase), AChE, lipid peroxidation and glutathione (GSH) contents were determined intheir blood erythrocytes (red blood cells (RBCs)). The results indicated significant increase in the levels ofmalondialdehyde as well as the activities of antioxidant enzymes in pesticide-exposed individuals. The levelsof GSH, RBC-AChE activity and plasma antioxidant potential were sharply decreased when compared withcontrol subjects. The ferric-reducing ability of plasma (FRAP) assay was carried out to evaluate the antioxidantpotential of pesticide in exposed as well as healthy controls. A significant positive correlation was observedbetween plasma FRAP value and the activity of AChE from RBCs in pesticides sprayers. Furthermore, theseresults were supported by enhanced messenger RNA expressions of cytochrome P450 isoform 2E1 (CYP2E1)and gutathione-S-transferase isoform pi (GST-pi) in the white blood cells of the randomly selected pesticide-exposed individuals. The decreased GSH level in human red blood cells accompanied by increase in the levels ofthe activities of antioxidative enzymes and over expressions of CYP2E1 and GST-pi is an indicative of oxidativestress in pesticides-exposed individuals. The reduced activity of AChE indicates possible occurrence of pertur-bations in blood as well as neurotoxicity in pesticide sprayers.
KeywordsPesticides; lipid peroxidation; erythrocytes; antioxidant enzymes; AChE; GSH
Introduction
The increased use of pesticides has caused both envi-
ronmental and public health concerns.1 Pesticides are
widely used in agriculture to improve production,
protect stored crops and control disease vectors.
Although pesticides usage has benefits, the health
risks have been associated to nontarget subjects
including humans who are occupationally and/or
environmentally exposed to these agrochemicals.2
These compounds are known to produce toxicity to
different systems in the human body resulting in
hematological and biochemical perturbations.3 In
north Indian population, the exposure of field workers
to the pesticides such as organophosphates (OPs),
carbamates (CMs), organochlorines and pyrethriods
is very common. Occupational exposure of farmers
in particular to these pesticides occurs via dermal
1 Department of Biochemistry, Faculty of Science, University ofAllahabad, Allahabad, Uttar Pradesh, India2 Department of Biology, City College of New York, New York,NY, USA3 Department of Biochemistry, College of Science, King SaudUniversity, Riyadh, Saudi Arabia
Corresponding author:Bechan Sharma, Department of Biochemistry, Faculty of Science,University of Allahabad, Allahabad 211002, Uttar Pradesh, India.Email: [email protected]
Human and Experimental Toxicology32(11) 1213–1227
ª The Author(s) 2013Reprints and permission:
sagepub.co.uk/journalsPermissions.navDOI: 10.1177/0960327112474835
het.sagepub.com
absorption and inhalation.4 Chronic exposure to pesti-
cides is associated with damage to health as these
chemicals are reported to induce oxidative stress via
production of reactive oxygen species (ROS) such
as superoxide anions (O2_c), hydrogen peroxide
(H2O2) and hydroxyl radicals (OH�), carcinogenesis,
neurotoxicity, reproductive and developmental aber-
rations and immunotoxicity.2,5
For last two decades, the pesticide-induced oxida-
tive stress as a possible mechanism of toxicity has
been a focus of toxicological research.6 Strong asso-
ciation of aerial exposure of these pesticides to gen-
otoxicity and onset of neurological symptoms in the
humans have been reported.7,8 These reports have
also indicated that these compounds may cause
alterations in the level of acetylcholinesterase
(AChE) from red blood cell (RBC) membrane,
micronucleus formation, sister chromatid exchanges
in mice and human lymphocytes and chromosomal
as well as mitotic aberrations in peripheral blood
lymphocytes.9–11
Erythrocytes (Red blood cells (RBCs)) have been
used as a convenient tool to evaluate oxidative stress
induced by xenobiotics and prooxidants in terms of
alterations in the biochemical constituents of the
membrane.12 The presence of hemoglobin (Hb), oxy-
gen and polyunsaturated fatty acids makes RBCs
prone to oxidative stress leading to the osmotic fragi-
lity. The RBC membrane integrity is maintained by a
balanced action of the prooxidant chemical species
and the antioxidant defense system.13
The evaluation of xenobiotic-induced oxidative
stress in terms of the alterations in the levels of the
activities of antioxidative enzymes such as cytochrome
P450s (CYPs), superoxide dismutase (SOD), catalase
(CAT), glutathione-S-transferase (GST), glutathione
reductase (GR), glutathione peroxidase (GPx) as well
as the membrane lipid peroxidation (LPO) and fragility
has been widely studied in order to ascertain the extent
of ROS-mediated toxicity.14 The ROS have been
shown to cause apoptosis as well as altered expression
of xenobiotic-metabolizing enzymes.15,16 In fact to
attain a dynamic homeostasis, a balance between the
functions of CYPs, phase II and antioxidant enzymes
with the ROS is maintained. The major xenobiotic bio-
transformation reactions of phase I metabolism are
catalyzed by CYP isoenzymes by hydroxylation, desa-
turation, dealkylation, sulfoxidation and nitroreduc-
tion. CYPs are involved in metabolic activation and
oxidative metabolism of many endogenous and foreign
chemicals resulting in toxic metabolites that in turn
produce toxicity to vital organs in experimental ani-
mals and humans. However, the phase II enzymes
such as GST and uridine diphosphate-glucuronyl trans-
ferase are mainly involved in early cellular defense
against toxicity. The imbalance in it by any means
causes excessive production of reactive intermediates
and ROS that may cause damage to the macromole-
cules.17,18 The impaired dynamic homeostasis due to
increased oxidative stress and DNA damage due to
increased production of ROS has been shown to be
associated with the pesticide-induced health hazards.8
These notions have been supported by some studies
indicating that the prolonged exposure to pesticides
alter the expression and activities of oxidative redox
indices (SOD, CAT, GPx, GR, etc.).19,20
The relationship between free radicals and CYPs is
well documented. The CYP enzymes, being the most
important xenobiotic-metabolizing enzymes, produce
ROS during biotransformation of xenobiotics. Cells
generate ROS such as superoxide anion (O2_c�) and
H2O2 as a result of the metabolism of xenobiotics
by CYP. Both O2_c� and H2O2 may be converted to
a highly reactive hydroxyl radical (OH.�) by iron
(Fe2þ)-catalyzed Haber–Weiss and Fenton reactions.
Many xenobiotics are converted to toxic quinones
by CYP. These quinones are redox-sensitive agents
and are reversibly reduced to semihydroquinones/
hydroquinones, which generate O2_c�.2
Various efforts have been made in past in order to
predict the underlying mechanism of pesticide-
induced toxicity using in vitro and animal model
systems. These predictions may or may not be directly
correlated with humans. Since the consequences of
pesticide exposure could vary from one population
to another or one ethnic group to another depending
upon the environmental conditions, it is inevitable
to assess the toxicity induced by pesticides in North
Indian suburban/rural population, who have been
using different pesticides as spray to protect their
crops from the insects–pests. Using blood cells (RBCs
and white blood cells (WBCs)) of the pesticide-
exposed individuals, we have shown in the present
communication that the field occupants and pesticide
sprayers from a section of North Indian suburban/
rural population exhibit high level of oxidative stress
and increased levels of expressions of cytochrome
P450 isoform 2E1 (CYP2E1) and gutathione-S-trans-
ferase isoform pi (GST-pi). The information from this
work may be exploited for proper strategy design
toward adequate pesticide formulation and usage as
well as better environmental management.
1214 Human and Experimental Toxicology 32(11)
Materials and methods
Chemicals and reagents
Bromophenolblue, 1-chloro-2,4-dinitrobenzene
(CDNB), dithiothreitol, ethidium bromide (EtBr),
ethoxy resorufin (ERF), ethylene-diamine-tetra-acetic
acid (EDTA), glucose-6-phosphate dehydrogenase
(GDH), glutathione (GSH; oxidized), GSH (reduced),
H2O2, nicotinamide adenine dinucleotide phosphate
(NADPH), 4-nitrocatechol, p-nitrophenol, perchloric
acid, pyrogallol, resorufin tetrasodium salt, thiobarbi-
turic acid (TBA) and 2,4,6-tri[2-pyridyl]-s-triazine and
Tris-base were purchased from Sigma-Aldrich (India).
Reverse transcriptase polymerase chain reaction (PCR)
kit was purchased from MBI Fermentas (Amherst ,
New York, USA). Taq polymerase, Taq buffer, deox-
yribonucleotide triphosphates (dNTPs), 100 bp ladder,
the forward and reverse primers for cytochrome P450
isoform 1A1 (CYP1A1), CYP2E1, GST-pi and glycer-
aldehyde 3-phosphate dehydrogenase (GAPDH) were
procured from Bangalore Genei (Bangalore, India).
Some common chemicals were procured locally.
Subjects and sample collection
Institutional Ethics Committee clearance was obtained
for collecting the human blood samples. Informed con-
sent was obtained from all the participants prior to their
inclusion in the study. The blood samples (5 ml) were
collected from 70 male occupational pesticide sprayers
on different farms and orchards and from 70 healthy
males that have no previous or current exposure to
pesticides. All the subjects were residents of Allahabad
and Lucknow or its adjacent areas in North India. The
groups of pesticides most commonly used by order of
frequency were organophosphates (OPs), CMs, orga-
nochlorines and pyrethroids. The purpose of the study
was explained to all the participants and their consents
were taken. A detailed questionnaire including demo-
graphic characteristics was recorded (Table 1). A com-
plete health assessment of each participant was also
performed during the sample collection. It is important
to mention that the farmers included in the study
usually did not wear gloves or masks or any other pro-
tection devices during spraying the pesticides. They
were having previous spraying experience of about
3–8 years. Average exposure duration for sprayers and
farmers was 3–4 h/week. Mixing of chemicals with
bare hands and leakages from the tanks of pesticide
during spraying operations were found to be very com-
mon for these individuals (Table 1).
Sample preparation
Venous blood was collected in the heparinized tubes
from both normal and occupational sprayers as coded
samples from both the control and sprayers. Samples
were transported to the analytical toxicology laboratory
in ice-cold condition immediately after the collection.
The content was centrifuged at 1000g for 10 min for
RBC separation. The buffy coat was removed and the
remaining RBCs were drawn from the bottom and then
the packed RBCs were washed three times with cold
phosphate-buffered saline (pH 7.4). After the final
wash, the RBCs were lysed by hypotonic shock and
different dilutions were used as hemolysate.21 The
analyses of different biochemical indices were carried
out in the hemolysate on the same day.
RNA isolation
The total RNA was extracted from 1 ml blood
obtained from controls and pesticide-exposed individ-
uals using standard procedure. In brief, 1 ml blood
sample was mixed with same volume of TRI BD
reagent kit in ice-cold condition. Chloroform was
added to each sample (0.2 ml ml�1 of TRI BD reagent
used), mixed and kept at room temperature for 10 min.
The sample was centrifuged at 12,000g for 15 min at
4�C. The aqueous phase was collected in fresh tube
and isopropanol was added to it (0.5 ml ml�1 of TRI
BD reagent used). The mixture was mixed gently and
kept at room temperature for 10 min. The samples
were centrifuged again at 12,000g for 10 min at
Table1. Demographic details about the normal as well asoccupational pesticide-exposed subjects.
VariablesHealthycontrols
Pesticidesprayers
Age (years) 31.25 + 3.06 (24–38) 29.73 + 9.39 (18–54)Height (cm) 167 + 4 (162–173) 161 + 3 (151–167)Weight (kg) 64.83 + 9.35(56–81) 53.75 + 8.45 (45–67)Addiction
Tobacco chewers 0 13Smoking 0 2Alcoholic 0 6
EthnicityUrban 54 23Rural 16 47
EducationLiterate 57 52Illiterate 13 18
DietVegetarian 52 43Nonvegetarian 18 27
Experience ofpesticide spraying
0 3–8 years
Sharma RK et al. 1215
4�C. The obtained RNA pellet was washed with 75%ethanol and centrifuged at 7500g for 10 min. The
resulting RNA pellet was dried under electric lamp
and dissolved in diethylpyrocarbonate (DEPC)-
treated water (RNase-free water) and stored at
�80�C till further use. The concentration of RNA was
determined by reading the absorbance at 260 nm.
cDNA preparation
Complementary DNA (cDNA) synthesis from isolated
RNA was performed using oligo dT primers and
RevertAid™ minus Mu-LV reverse Transcriptase Kit
(Thermo Scientific, Life Science Research, USA)
under standard conditions supplied by manufacturer.
In brief, 200 ng of total RNA was mixed with 5 ml of
oligo dT primer (1 mg ml�1), and the final volume was
made up to 11 ml by the addition of RNase-free DEPC-
treated water. The content was mixed gently and incu-
bated for 5 min at 65�C. The mixed content was chilled
on ice for 1 min and then 4 ml of 5X reaction buffer
(supplied with kit), 2 ml of dNTP and 2 ml of RNase-
free DEPC-treated water were added. The mixture was
incubated at 25�C for 5 min. Finally, reverse transcrip-
tase enzyme (1 ml) was added to the mix and incubated
for 60 min at 37�C. The reaction was terminated by
heating the content at 70�C for 5 min. cDNA samples
prepared were stored at �80�C until further use.
Expression analysis
Forward and reverse primers for CYP1A1, CYP2E1,
GST-pi and GAPDH were synthesized as described
previously in the literature.22–24 Primer sequences and
PCR conditions for above mentioned genes are given
in Table 2. The PCR products were visualized on
1.2% (w/v) agarose gel in the presence of EtBr
(20 mg ml�1) and the density of the bands was analyzed
by computerized densitometry system (Alpha Imager
System; Alpha Innotech Corporation, San Leandro,
CA, USA) and normalized to that of GAPDH.
GSH content
RBC GSH was measured by the method of Beutler.25
This method was based on the ability of the –SH
group to reduce 5,50-dithiobis-2-nitrobenzoic acid
(DTNB), which possesses a molar absorption coeffi-
cient (e ¼ 1.36 � 104 M�1 s�1) and forms a yellow-
colored anionic product whose optical density is mea-
sured at 412 nm. The concentration of GSH is
expressed in milligram per millililer of packed RBCs.
Determination of SOD activity in human RBCs
The activity of human RBC SOD was determined by
slight modification of the method described by Mark-
lund and Marklund.26 In brief, the assay mixture
containing hemolysate (50 ml) was incubated with
2.85 ml of 0.05 M Tris–succinate buffer (pH 8.2) at
37�C for 20 min. Reaction was started by adding
100 ml of 8 mM pyrogallol. The increase in
absorbance was recorded at 412 nm for 3 min at 30s
intervals. An appropriate blank was also run simulta-
neously. The SOD activity is expressed in unit (50%inhibition of pyrogallol autoxidation per minute) per
milligram of Hb.
Determination of CAT activity in human RBCs
The CAT activity in hemolysate of human RBCs was
measured spectrophotometrically by monitoring the
decrease in H2O2 concentration over increasing reac-
tion time as described by Aebi.27 The reaction mix-
ture contains hemolysate diluted 1:50 in 50 mM
phosphate buffer (pH 7.0) and 10 mM H2O2 in a
quartz cuvette. The decomposition rate of the
Table 2. Primer sequences to amplify the genes involved in the pesticide metabolism.
Gene Primers Amplicon Size (bp) Number of cycles Reference
CYP1A1 FP-50TTCCGACACTCTTCCTTCGT30 367 30 Fasco et al.22
RP-50ATGGTTAGCCCATAGATGGG30
CYP2E1 FP-50TTCAGCGGTTCATCACCCT30 77 30 Furukawa et al.23
RP-50GAGGTATCCTCTGAAAATGGTGTC30
GST-pi FP-50GGCTCACTCAAAGCC TCCTG30 246 32 Kuzma et al.24
RP-50AGTGCCTTCACATAGTCATC30
GAPDH FP-50GGTCGGAGTCAACGGATTTGGTCG30 787 – Fasco et al.22
RP-CCTCCGACGCCTGCTTCCCAAC30
CYP1A1: cytochrome P450 isoform 1A1; CYP2E1: cytochrome P450 isoform 2E1; GST-pi: gutathione-S-transferase isoform pi;GAPDH: glyceraldehyde 3-phosphate dehydrogenase; FP: forward primer; RP: reverse primer; bp: base pair.
1216 Human and Experimental Toxicology 32(11)
substrate H2O2 at a final concentration of 10 mmol l�1
was monitored at 240 nm and 25�C after adding
directly the sample in cuvette. The CAT activity was
calculated in units (micromoles of H2O2 decomposed
per minute) per milligram of Hb.
Isolation of WBCs from human blood
The isolation of WBCs was carried out according to the
method described by Boyum.28 The whole blood was
centrifuged at 250g for 20 min at 20�C to remove plate-
lets and plasma. WBCs were isolated from the buffy
coat by dextran sedimentation and further purified with
histopaque density gradient centrifugation at 700g for
30 min at 20�C. WBCs were recovered from histopaque
11191/10771 and washed thrice with Hank’s balanced
salt solution (pH 7.4, 138 mM sodium chloride (NaCl),
2.7 mM potassium chloride, 8.1 mM disodium hydro-
gen phosphate and 1.5 mM potassium dihydrogen phos-
phate) containing 0.6 mM magnesium chloride, 1.0 mM
calcium chloride and 10 mM glucose.
CYP1A1 activity assay in WBCs from humanblood
The activity of CYP1A1 was assayed according to the
method described elsewhere by Pohl and Fouts29 and
Upadhyay et al.17 The activity of CYP1A1 was moni-
tored in terms of ethoxy resorufin-o-deethylase
(EROD) activity spectrofluorimetrically. The incuba-
tion mixture (3 ml) containing phosphate buffer, pH
7.4 (100 mM), glucose-6-phosphate (5 mM), GDH
(1–2 units), magnesium sulfate (5 mM), BSA
(1.6 mg ml�1), ERF (1.5 mM), NADPH (0.6 nM) and
varying concentrations of WBC lysate proteins was
incubated at 37�C for 20 min in water bath. Methanol
of 2.5 ml was added to the incubation mixture to stop
the reaction and vortexed for 30s. The incubation mix-
ture was kept on ice for 2 min. Mixture was centrifuged
at 825g for 10 min and the supernatant was measured at
550 nm excitation and 585 nm emission wavelengths
and the activity was expressed in picomoles of resoru-
fin per minute per milligram of protein.
Measurement of CYP2E1 activity (PNPH assay)in WBCs lysate
CYP2E1 activity was determined according to the
method described elsewhere by Koop,30 with a slight
modification. Reaction mixture containing 4-
nitrophenol (0.2 mM) mixed with 50 mM Tris-
hydrochloric acid (HCl; pH 7.4), 25 mM MgCl2 and
varying concentrations of WBCs lysate proteins was
incubated at 37�C for 5 min. A 20-ml of 50 mM
NADPH was added to initiate the reaction and was
further incubated for 10 min. A 500-ml 0.6 N perchlo-
ric acid was added to stop the reaction. After centrifu-
gation at 825g for 20 min, supernatant was taken and a
100-ml 10 N sodium hydroxide (NaOH) was added
and the absorbance was monitored at 510 nm.
CYP2E1 activity was calculated in terms of nano-
moles of nitrophenol hydroxylation per minute per
milligram of proteins.
GST activity assay
GST activity was measured spectrophotometrically
by the method of Habig et al.31 using CDNB as sub-
strate. In brief, the assay mixture (3 ml) contained 1
mM CDNB in ethanol, 1 mM GSH, 100 mM potas-
sium phosphate buffer (pH 6.5) and sample aliquots.
Activity was determined by measuring an increase
in the absorbance of the reaction mixture at 340 nm.
Enzyme activity was calculated using the extinction
coefficient (e ¼ 9.6 mM�1 cm�1) and expressed as
unites per milligram of Hb.
GPx activity assay
The GPx activity was determined using the method of
Paglia and Valentine.32 The sample was diluted 1:50 in
100 mM phosphate buffer (pH 7.4) containing 1 mM
EDTA and added to the assay tube. The final concen-
trations of the reagents used in the assay were 0.3 mM
GSH, 0.3 mM NADPH, 1.1 U ml�1 GR from Sacchar-
omyces cerevisiae (Sigma, St Louis, Missouri, USA)
and 44.1 mM phosphate buffer (pH 7.4). After 3 min
of incubation at 37�C, the change in absorbance was
monitored at 340 nm after the addition of 1.1 mM (final
concentration) tert-butyl hydroperoxide. GPx activity
was calculated as unit (micromoles of NADPH oxi-
dized per minute) per milligram of Hb.
Quantification of LPO
LPO was measured according to the method of Ester-
bauer and Cheeseman.33 Packed RBCs (0.2 ml) were
suspended in phosphate buffer (pH 7.4). The lysate
(1 ml) was added to 1 ml of 10% trichloroacetic acid
and the mixture was centrifuged for 5 min at 3000 r/
min. The supernatant (1 ml) was added to 1 ml of
0.67% TBA in 0.05 mol l�1 NaOH and heated for
30 min at 90�C. The reaction mixture was cooled and
the absorbance was recorded at 532 nm. The
Sharma RK et al. 1217
concentration of malondialdehyde (MDA) in RBCs
was determined from a standard plot and expressed
as nanomoles per milliliter of packed RBCs.
Determination of FRAP
The ferric-reducing ability of plasma (FRAP) values
were determined following the method of Benzie and
Strain.34 Working FRAP reagent was prepared by mix-
ing acetate buffer (300 mM, pH 3.6), 2,4,6-tri[2-pyri-
dyl]-s-triazine (10 mM in 40 mM HCl) solution and
FeCl3_c6H2O (20 mM) solution in 10:1:1 ratio, respec-
tively. FRAP reagent of 3 ml was mixed with 100 ml of
plasma; the content was mixed vigorously so that the
contents were mixed thoroughly. The absorbance was
read at 593 nm at the interval of 30s for 4 min. Aqueous
solution of known Fe2þ concentration in the range of
100–1000 mM was used for calibration. Using the
regression equation, the FRAP values (micromoles of
Fe(II) per milliliter of the plasma) was calculated.
Determination of the activity of AChE(E.C. 3.1.1.7) in RBCs
The membrane bound AChE activity in the human
RBCs was analyzed following the methods of Ellman
et al.35 and Beutler.25 Packed RBCs were suspended
in 0.154 M NaCl and to this suspension, b-
mercaptoethanol-EDTA stabilizing solution was
added and the hemolysate was frozen overnight. The
hemolysate was thawed preceding the experimental
procedure. The reaction mixture is composed of
50 mM Tris-HCl (pH 7.4) and 5 mM EDTA with
0.5 mM DTNB solution. The reaction was initiated
by adding 0.5 mM acetylthiocholine iodide. The
increase in optical absorbance was monitored at
412 nm, 28 + 1�C and 30s intervals for 3 min using
a ultraviolet–visible double beam spectrophotometer
(Thermo Scientific Chemito Spectroscan UV 2700,
Nasik, India) with quartz cuvette (1 cm light path)
against a blank. Measurements were made in tripli-
cate for each blood sample. One unit of AChE
activity was expressed as nanomoles of substrate
hydrolyzed per minute per gram of Hb under experi-
mental conditions using extinction coefficient (e)13.6 � 104 M�1 cm�1.
Determination of protein content
Protein concentrations were determined by the
Lowry’s method36 using bovine serum albumin
(BSA) as a standard.
Determination of Hb concentration
The conversion of Hb to cyanomethemoglobin by
Drabkin reagent was measured against a standard
curve using a known procedure.37 The results are
expressed as grams per 100 ml Hb.
Statistical analysis
The samples were coded at the time of preparation
and they were decoded before statistical analysis for
comparison. All experiments were carried out in
duplicate. Student’s t test was used for comparisons
between control and exposed groups. The data are
expressed as means + SD, further differences
between control and pesticide worker endpoints
means were analyzed using the Mann–Whitney non-
parametric test and was used to compare the demo-
graphic characteristics of studied populations. The
level of significance was set at p < 0.05. All analyses
were performed with the Prism 5.01 (GraphPad soft-
ware, Inc., La Jolla, CA, USA) statistical software
package.
Results
The mRNA expression pattern in pesticidesprayers
The results of the analysis of messenger RNA
(mRNA) expression of CYP1A1 gene as shown in
Figure 1(a) indicated that it was not significantly
affected in the pesticide-exposed individuals when
compared with healthy controls. The expression pro-
file of a housekeeping gene, GAPDH, has been used
as a reference. The band density ratio of CYP1A1 to
that of GAPDH presented in Figure 1(b) illustrates
the similar pattern. In contrast, the levels of mRNA
expression of CYP2E1 and GST-pi genes were
observed to be increased in the pesticide-exposed
individuals when compared with healthy control.
The CYP2E1 mRNA expression is found to be sig-
nificantly increased in comparison with the control
(Figure 2(a)). The band density ratio of CYP2E1 to
that of GAPDH presented in Figure 2(b) also reflects
the similar effect. GST-pi mRNA expression is also
more in the WBCs of pesticide-exposed individuals
than the normal controls (Figure 3(a)). The band
density ratio of GST-pi to that of GAPDH presented
in Figure 3(b) also corroborate this increasing
expression pattern of GST-pi gene in occupationally
pesticide-exposed individuals.
1218 Human and Experimental Toxicology 32(11)
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
Ban
d de
nsit
y ra
tio
(CY
P1A
1/G
AP
DH
)
0
2
4
6
8
10
12
14
C1
pM r
esor
ufin
/min
/mg
prot
ein
(a)
(b)
(c)
C1 C2 C3 C4 C5 E1 E2 E3 E4 E5
CYP1A1 (367 bp)
GAPDH (787 bp)
C2 C3 C4 C5 E1 E2 E3 E4 E5
C1 C2 C3 C4 C5 E1 E2 E3 E4 E5
Figure 1. Expression profiles of CYP1A1 gene (a, upper panel) and a housekeeping gene, GAPDH (a, lower panel). Thefigures shown in (a) represent levels of mRNA expressed from these genes in the randomly selected control and thesprayer subjects. C1–C5 represent control group and E1–E5 represent group of pesticide-exposed individuals. (b) Bardiagram showing band density ratio of CYP1A1 and GAPDH. (c) Bar diagram showing EROD activity as a spectrofluoro-metric measurement of CYP1A1 activity in the lymphocytes of the control and sprayer subjects. EROD activity was deter-mined as described in Materials and Methods section. GAPDH: glyceraldehyde 3-phosphate dehydrogenase; EROD:ethoxy resorufin-o-deethylase; mRNA: messenger RNA; CYP1A1: cytochrome P450 isoform 1A1.
Sharma RK et al. 1219
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
Ban
d de
nsit
y ra
tio
(CY
P2E
1/G
AP
DH
)
0
0.02
0.04
0.06
0.08
0.1
0.12
0.14
0.16
0.18
nM/m
in/m
g pr
otei
n
(a)
(b)
(c)
C1 C2 C3 C4 C5 E1 E2 E3 E4 E5
CYP2E1 (77 bp)
GAPDH (787 bp)
C1 C2 C3 C4 C5 E1 E2 E3 E4 E5
C1 C2 C3 C4 C5 E1 E2 E3 E4 E5
Figure 2. Expression profiles of CYP2E1 gene (a, upper panel) and a housekeeping gene, GAPDH (a, lower panel). Thefigures shown in (a) represent levels of mRNA expressed from these genes in the randomly selected control and thesprayer subjects. C1–C5 represent control group and E1–E5 represent group of pesticide-exposed individuals. (b) Bardiagram showing band density ratio of CYP2E1 and GAPDH. (c) Bar diagram showing p-nitrophenol-o-hydroxylation(PNPH) activity as a spectrophotometric measurement of the activity of CYP2E1 in the lymphocytes of the control andsprayer subjects. PNPH activity was determined as described in Materials and Methods section. GAPDH: glyceraldehyde3-phosphate dehydrogenase; mRNA: messenger RNA; CYP2E1: cytochrome P450 isoform 2E1.
1220 Human and Experimental Toxicology 32(11)
Levels of the activities of CYP1A1 and CYP2E1 inpesticide sprayers
The activities of CYP1A1 and CYP2E1 from the
WBCs were assayed by monitoring EROD and extent
of p-nitrophenol hydroxylation (PNPH), respectively,
as described in Materials and Methods section. The
results presented in Figure 1(c) indicated almost no
alteration in the activity of CYP1A1 in pesticide
sprayers. In contrast, the activity of CYP2E1 exhib-
ited significant increase in the pesticide sprayers (Fig-
ure 2(c)) with a good correlation with mRNA
expression pattern (Figure 2(b)).
GSH content in pesticide sprayers
The GSH content in the RBCs was found to be dras-
tically decreased to about half in the pesticide-
exposed individuals when compared with the healthy
controls. The results presented in Table 3 indicated
that the decrease was consistent in all the pesticide-
exposed individuals and was found statistically signif-
icant (p < 0.001).
SOD activity profile in pesticide sprayers
The activity of SOD in the RBCs was found to be
markedly increased to almost two folds in the pesti-
cide sprayers when compared with the healthy con-
trols. The data presented in Table 3 indicated that
this alteration was consistent in all the exposed sub-
jects and was found statistically significant
(p < 0.001).
CAT activity profile in pesticide sprayers
Similar to the trend in the activity of SOD, the CAT
activity in the RBCs was also found to be increased
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
C1 C2 C3 C4 C5 E1 E2 E3 E4 E5
Ban
d de
nsit
y ra
tio
(GST
-pi/G
AP
DH
)
(a)
(b)
C1 C2 C3 C4 C5 E1 E2 E3 E4 E5
GST-pi (246 bp)
GAPDH (787 bp)
Figure 3. Expression profile of GST-pi gene (a, upper panel) and a housekeeping gene, GAPDH (a, lower panel). Thefigures shown in (a) represent levels of mRNA expressed from these genes in the randomly selected control and thesprayer subjects. C1–C5 represent control group and E1–E5 represent group of pesticide-exposed individuals. (b) Bardiagram showing band density ratio of GST-pi and GAPDH. GST: glutathione-S-transferase isoform pi; GAPDH: glycer-aldehyde 3-phosphate dehydrogenase; mRNA: messenger RNA.
Sharma RK et al. 1221
by more than 50% in the exposed individuals than
healthy controls (Table 3). This increase was recorded
to be statistically significant (p < 0.01).
Patterns of the activities of GST and GPx inpesticide sprayers
The data presented in Table 3 indicated that the activ-
ities of GST and GPx in the RBCs of pesticide
sprayers were sharply increased when compared with
those of healthy controls; the fold increase in their
activities being about 2 and 1.5, respectively. The
analysis of the data suggests that the increase in these
indices was consistent and statistically significant
(p < 0.001 for GST and p < 0.01 for GPx).
Lipid peroxidation
In order to investigate the level of oxidative damage
due to LPO, the assay for measurement of MDA for-
mation in the RBCs of pesticide sprayers was con-
ducted as described in Materials and Methods
section. The results presented in Table 3 demon-
strated significant (p < 0.001) increase in the level
of LPO in the pesticide sprayers when compared
with the healthy controls. The increase was consis-
tent in all the representative exposed subjects ana-
lyzed in the study.
Level of total antioxidant capacity in pesticidessprayers in terms of FRAP
The total antioxidant capacity in the pesticides
sprayers was measured in terms of FRAP by the
method of Benzie and Strain34 as described in Mate-
rials and Methods section. The results of the present
study indicated significant (p < 0.001) decline of
51.97% in the blood plasma antioxidation potential
of pesticide-exposed individuals than the normal as
shown in Figure 4.
Level of AChE activity in the human RBCs ofpesticide sprayers
Since the alterations in the AChE activity during oxi-
dative stress have also been reported, the present
study therefore is an attempt to assess the status of the
activity of AChE in the RBCs isolated from occupa-
tionally exposed pesticides sprayers. The data pre-
sented in Figure 5 show low level of AChE activity
in the pesticides sprayers when compared with that
of controls. The pesticides sprayers registered 35%lower level of AChE activity in the RBCs than the
normal individuals.
Correlation between AChE activity and totalantioxidant capacity of plasma (measured asFRAP)
The results shown in Figure 6 represent the correla-
tion between the activity of AChE in the RBCs and
total plasma antioxidant capacity, measured in terms
of FRAP values. The decrease in AChE correlates sig-
nificantly (p < 0.001; r2 ¼ 0.2568) with decrease in
the antioxidant capacity of the plasma in the blood
of pesticide sprayers. These results indicated that the
decline in plasma antioxidant capacity due to
Table 3. Effect of pesticides on the levels of antioxidative indices.a
Subjects
Levels of antioxidative indices
GST(U mg�1 Hb)b
SOD(U mg�1 Hb)c
CAT(U mg�1 Hb)d
GPx(U mg�1 Hb)e
GSH(mg dl�1 prbc)
LPO(nmol ml�1)
Control (70) 4.51 + 0.25 7.74 + 0.22 81.35 + 1.99 17.5 + 0.61 70.66 + 2.01 5.85 + 0.52Pesticide sprayer (70) 9.42 + 0.52f 13.38 + 0.14g 129.38 + 3.3g 27.1 + 0.76g 33.22 + 1.95f 12.1 + 1.31f
GSH: glutathione; SOD: superoxide dismutase; CAT: catalase; GST: glutathione-S-transferase; GPx: glutathione peroxidase; LPO: lipidperoxidation; CDNB: 1-chloro-2,4-dinitrobenzene; H2O2: hydrogen peroxide; Hb: hemoglobin.aThe quantitative estimations of the parameters studied were made in the control as well as the pesticide sprayer subjects as describedin Materials and Methods section. The results represent the average values after conducting three independent experiments. Values areexpressed as means + SEM.bMicromoles of GSH-CDNB conjugate formed per minute per milligram of Hb.cOne unit is equal to 50% inhibition pyrogallol autoxidation per minure per milligram of Hb.dMicromoles of H2O2 consumed per minute per milligram of Hb.eMicromoles of GSH utilized per minute per milligram of Hb.fSignificant changes are expressed as p < 0.001.gSignificant changes are expressed as p < 0.01.
1222 Human and Experimental Toxicology 32(11)
increased pesticides-induced oxidative stress might
be contributing in significant reduction in the activity
of AChE in association with those of pesticides in the
pesticide sprayers (Figure 6).
Discussion
Pesticides are known to cause free radical-mediated
toxicity in organisms via production of ROS.8 The
detrimental effects caused by ROS occur as a conse-
quence of an imbalance between the oxidative and
antioxidant indices in an individual due to
pesticide-induced toxicity.10 Inactivation and
removal of ROS depend on the reactions involving
the antioxidant defense system.5 The capacity of
antioxidant defense is determined by the contribu-
tions of certain vitamins, reduced GSH and antioxi-
dant enzymes.15 The large human population
variations may exist regarding antioxidative capac-
ity of each individual, thus affecting individual’s
susceptibility against deleterious oxidative reac-
tions. However, very limited information exists con-
cerning the biological variation in antioxidative
enzymes in representative population samples.
The pesticides exposures may directly or indirectly
modify the antioxidant defense capability of exposed
subjects and thus affect their susceptibility to oxida-
tive stress. Oxidative damage, therefore, may be
attributed to the consequences of insufficient antioxi-
dant potential. Pesticides are well known to target
RBCs by altering their intactness and fluidity of cell
membranes.13 The susceptibility of RBCs and lym-
phocytes to oxidative stress due to exposure to pesti-
cides is a function of overall balance between the
degree of oxidative stress and the antioxidant defense
capability.10,16 Because of the potential deleterious
effects of free radicals and hydroperoxides, perturba-
tions that stimulate LPO and weaken antioxidant
defense capability may cause an increase in cellular
susceptibility to oxidative damage.12,14
The involvement of oxidative stress in the altera-
tion of membrane integrity has been well documen-
ted. The endogenous cellular antioxidants (GSH) and
antioxidant enzymes such as SOD, CAT, GST, GPx
and so on are involved in the regulation of dynamic
homeostasis and are therefore target of various xeno-
biotics.21 Efforts made in past have shown positive
Figure 4. Level of antioxidant potential in the RBCs ofpesticides sprayers by assaying FRAP; the values are shownas a function of antioxidant potential in pesticides sprayerswhen compared with control. Student’s t test was used forcomparison between control and exposed groups. Theresults are presented as mean + SD values derived from70 control and 70 pesticide-exposed individuals. FRAP val-ues are expressed as micromoles of Fe (II) per milliliter ofplasma. FRAP: ferric-reducing ability of plasma; RBC: redblood cell.
Figure 5. Level of AChE activity in the erythrocytes ofpesticides sprayers. AChE activity was assayed using theprocedure as described in Materials and Methods section.Student’s t test was used for comparison between controland exposed groups. The results are presented asmean + SD value derived from 70 control and 70 pesticide-exposed individuals. The unit of AChE activity is expressedas micromoles of acetylthiocholine iodide hydrolyzed perminute per gram of hemoglobin at 37�C. **The level of sig-nificance at p < 0.01. AChE: acetylcholinesterase.
Sharma RK et al. 1223
association of antioxidant defense system with mem-
brane LPO under the influence of pesticide.38,39
Among various antioxidant mechanisms in the body,
SOD, CAT, GPx and GST are thought to be the major
enzymes that protect cells from ROS. There is a sug-
gestion that the activity of antioxidant enzymes may
play an important role in determining the pesticide-
induced toxicity in occupational sprayers.4,8,16
We assessed the level of endogenous cellular anti-
oxidant (GSH) and membrane LPO. GSH is actively
involved in the removal of LPO products. Enhanced
susceptibility of cell damage following exposure to
toxic chemicals could be related to the efflux of GSH
precursors and hence diminished GSH biosynth-
esis.40,41 The concentration of GSH is the key deter-
minant of the extent of toxicant-induced cellular
injury. On the other hand, increased peroxide level
is linked with membrane disruption in various tissue
and organs and has been positively correlated with the
gravity of the disease and extent of cellular damage.42
The results from the present study showed a
decreased level of GSH in pesticide-exposed individu-
als when compared with healthy controls, which could
cause accumulation of LPO products that in turn may
increase oxidative burden to cellular homeostasis
resulting in enhanced cellular damage. This observa-
tion got support by the examination of membrane LPO
(present investigation) that was considerably increased
in sprayers when compared with healthy controls.
GST is a phase II enzyme, which is involved in the
detoxification of the products of the phase I reactions.
An increased expression of GST-pi and the activity of
total GST in sprayers as observed in present study could
be a compensatory response to overcome the toxic reac-
tions following pesticide exposure.19 It may be further
supported by the fact that GST has high affinity for the
LPO products and help reduce the ROS burden.39,43
Another enzyme, GPx, is the major antioxidant
molecule involved in the catalysis of detoxification
of endogenous metabolic peroxides and H2O2. Addi-
tionally, it is involved in the redox cycling of GSH
in the presence of GR and NADPH as a coen-
zyme.43,44 The increased activity of GPx in human
RBCs (sprayers) as observed in present study could
be due to decreased GSH level and/or increased GPx
activity. It probably indicates an adaptive measure to
tackle any ROS-mediated toxicity due to pesticide
accumulation. However, the increased activity of GPx
as detected in the present study also could be due to
increased production of H2O2 in pesticide-exposed
individuals.45
Furthermore, other antioxidant enzymes such as
SOD and CAT along with GSH, GST and GPx are
also known to efficiently scavenge toxic-free radicals
and are partly responsible for protection against LPO
due to acute or chronic pesticide exposure.46
Increased levels of these enzymes in the present study
reflect an activation of the compensatory mechanism
for the protection against ROS through the effects of
pesticides on progenitor cells.
Alteration in the activity of phase II and antioxidant
enzymes prompted us to assess the expression and
activity of CYPs that have been reported previously
to be involved in free radical generation and oxidative
stress.19,20 CYP2E1 is reported to enhance the toxic
effect of many toxicologically important substrates,
including ethanol, carbon tetrachloride and acetamino-
phen by their biotransformation into reactive metabo-
lites. It is directly associated with free radical
production such as superoxides and H2O2 in some pre-
vious studies.47–49 However, CYP1A1 is reported to be
potentially involved in the metabolism of various
drugs, carcinogens and xenobiotics.50 CYPs are also
involved in organophosphorus activation through oxi-
dative desulfuration of P¼S bonds and the increase
in their activity could also represent another contribut-
ing factor to the imbalance between injuries and
defenses. CYP2E1 are reported to activate N-alkyl-
20 22 24 26 28 30 32 34 36 38 400.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1.0
AchE activity(µmol acetylcholine iodide hydrolysed/ min/g Hb)
FR
AP
(µ m
ole
Fe(
II)/
ml p
lasm
a)
p< 0.001r2= 0.2568
Figure 6. Correlation plot between AChE activity andtotal antioxidant capacity of plasma (measured as FRAP).AChE activity and FRAP assays were conducted asdescribed in Materials and Methods section. The unit ofAChE activity has been expressed as micromoles of acet-ylthiocholine iodide hydrolyzed per minute per gram ofhemoglobin at 37�C. FRAP values are expressed asmicromoles of Fe (II) per milliliter of plasma. p < 0.001;r2 ¼ 0.2568. AChE: acetylcholinesterase; FRAP: ferric-reducing ability of plasma.
1224 Human and Experimental Toxicology 32(11)
nitrosamines, substances also present in tobacco,
whereas there are no strong evidences that CYP1A1
is also involved in this process.51–53 In the present
investigation, the increased activity of CYP2E1
appeared to constitute a risk factor only for sprayers
who smoke because its activity increased in sprayers
and not in controls, possibly by the formation of carci-
nogenic DNA adduct with nitrosamines activation
products.11 Moreover, they can also cause type I dia-
betes mellitus by their cytotoxic effects on pancreatic
beta-cells.2,54
In the present study, the mRNA expressions of
CYP1A1, CYP2E1 and GST-pi were monitored in
some randomly selected controls and pesticides-
exposed subjects. The results displayed no significant
alteration in the expression and activity of CYP1A1,
which clearly indicated that this CYP isoform was not
involved in this process. However, mRNA expressions
and activities of CYP2E1 and GST-pi were consider-
ably increased in pesticide-exposed individuals when
compared with the healthy controls, which reflected
the ROS-mediated peroxidative damage in pesticide
sprayers. The role of CYP2E1 and GST in regulating
the level of free radical production is well documented
in alcoholics.47–49 The present study clearly indicates
that the occupationally pesticide-exposed population
may be under threat of oxidative stress.
OPs and CMs are known pesticides extensively
being used in agricultural practices and fields. They
are known inhibitors of the activity of AChEs as they
modulate the serine residue present at the active site
of the enzyme. It results in an excessive accumulation
of the neurotransmitter, acetylcholine, at the nerve
endings and cause blockade of nerve impulse trans-
mission. The activity of AChE in human RBCs may
be considered as a biomarker for evaluating the cen-
tral cholinergic status.2 In addition, the alterations in
the AChE activity during oxidative stress have also
been reported. The results of the present study are in
consonance with these reports as it reflected low level
of AChE activity in the pesticide sprayers when com-
pared with the healthy controls.
Conclusion
The results of present study are indicative of impair-
ment in the balance between the oxidative and antiox-
idant indices resulting in altered cellular homeostasis
and physiology in the pesticides sprayers. The
enzymes such as CYP2E1 and GST-pi were found
to be over expressed, whereas CYP1A1 remained
uninfluenced. The present findings also emphasize
the need to study the expression profiles of these
genes in large population of different ethnic groups
occupationally exposed to different pesticides and
residing in various parts of world in order to ascertain
their roles in ROS-mediated toxicity. Since the occu-
pationally exposed subjects involved in this study also
used tobacco, smoking and alcohols infrequently, the
contribution of these factors to whatsoever extent in
eliciting negative impact of the pesticides may not
be ruled out. The information obtained from this study
may be used to guide public health laws and policies
in the work place and residential communities. It may
also be exploited for proper strategy design to mini-
mize the risk of pesticide-mediated occupational
health hazards to pesticide users as well as toward
adequate pesticide formulation and usage for better
environmental management.
Funding
Financial support in the form of research fellowship from
University Grant Commission (UGC), New Delhi, India,
was provided to RKS. This research was supported in part
by a grant to NJS from the Research Center, Center for
Female Scientific and Medical Colleges, Deanship of Sci-
entific Research, King Saud University, Riyadh, Saudi
Arabia.
Conflict of interest
The authors declared no conflicts of interest.
References
1. Anwar WA. Biomarker and human exposure to pes-
ticides. Environ Health Perspect 1997; 105:
801–806.
2. Agrawal A and Sharma B. Pesticide induced oxidative
stress in mammalian systems. Int J Biol Med Res 2010;
1(3): 90–104.
3. Remor AP, Totti CC, Moreira DA, Dutra GP, Heuser
VD and Boeira JM. Occupational exposure of farm
workers to pesticides: biochemical parameters and
evaluation. Environ Int 2009; 35: 273–278.
4. Bhanti M and Taneja A. Contamination of vegetables
of different seasons with organophosphorous pesti-
cides and related health risk assessment in northern
India. Chemosphere 2007; 69: 63–68.
5. McCauley LA, Anger WK, Keifer M, Langley R, Rob-
son MG and Rohlman D. Studying health outcomes in
farmworker populations exposed to pesticides.
Environ Health Perspect 2006; 114: 953–960.
Sharma RK et al. 1225
6. Banerjee BD, Seth V and Ahmed RS. Pesticide-induced
oxidative stress: perspectives and trends. Rev Environ
Health. 2001; 16(1): 1–40.
7. Kamel F and Hoppin JA. Association of pesticide
exposure with neurologic dysfunction and disease.
Environ Health Perspect 2004; 112: 950–958.
8. Muniz JF, McCauley L, Scherer J, Lasarev M, Koshy
M, Kow YW, et al. Biomarkers of oxidative stress and
DNA damage in agricultural workers: a pilot study.
Toxicol Appl Pharmacol 2008; 227: 97–107.
9. Sharma RK and Sharma B. In-vitro carbofuran
induced genotoxicity in human lymphocytes and its
mitigation by vitamins C and E. Dis Markers 2012;
32: 153–163.
10. Zeljezic D, Vrdoljak AL, Kopjar N, Radic B and
Kraus SM. Cholinesterase inhibiting and genotoxic
effect of acute carbofuran intoxication in man: a case
report. Basic Clin Pharmacol Toxicol 2008; 103:
329–335.
11. Das PP, Shaik AP and Jamil K. Genotoxicity induced
by pesticide mixtures: in-vitro studies on human per-
ipheral blood lymphocytes. Toxicol Ind Health 2007;
23: 449–458.
12. Mansour SA, Mossa AT and Heikal TM. Effects of
methomyl on lipid peroxidation and antioxidant
enzymes in rat erythrocytes: in vitro studies. Toxicol
Ind Health 2009; 25: 557–563.
13. Rai DK, Rai PK, Rizvi SI, Watal G and Sharma B.
Carbofuran-induced toxicity in rats: protective role of
vitamin C. Exp Toxicol Pathol 2009; 61: 531–535.
14. Singh M, Sandhir R and Kiran R. Erythrocyte antiox-
idant enzymes in toxicological evaluation of com-
monly used organophosphate pesticides. Indian J Exp
Biol 2006; 44: 580–583.
15. Hernandez AF, Gomez MA, Perez V, Garcıa-Lario JV,
Pena G, Gil F, et al. Influence of exposure to pesticides
on serum components and enzyme activities of cyto-
toxicity among intensive agriculture farmers. Environ
Res 2006; 102: 70–76.
16. Prakasam A, Sethupathy S and Lalitha S. Plasma and
RBC antioxidant status in occupational male pesticide
sprayers. Clin Chim Acta 2001; 310: 107–112.
17. Upadhyay G, Kumar A and Singh MP. Effect of sily-
marin on pyrogallol and rifampicin-induced hepato-
toxicity in mouse. Eur J Pharmacol 2007; 565:
190–201.
18. Upadhyay G, Singh AK, Kumar A, Prakash O and
Singh MP. Resveratrol modulates pyrogallol-induced
changes in hepatic toxicity markers, xenobiotic metabo-
lizing enzymes and oxidative stress. Eur J Pharmacol
2008; 596: 146–152.
19. Patel S, Singh V, Kumar A, Gupta YK and Singh MP.
Status of antioxidant defense system and expression of
toxicant responsive genes in striatum of maneb and
paraquat-induced Parkinson’s disease phenotype in
mouse: mechanism of neurodegeneration. Brain Res
2006; 1081: 9–18.
20. Singh C, Ahmad I and Kumar A. Pesticides and metals
induced Parkinson’s disease: involvement of free radi-
cals and oxidative stress. Cell Mol Biol 2007; 53: 19–28.
21. Lopez O, Hernandez AF, Rodrigo L, Gil F, Peno G,
Serrano JL, et al. Changes in antioxidant enzymes in
humans with long-term exposure to pesticides. Toxicol
Lett 2007; 171: 146–153.
22. Fasco MJ, Treanor CP, Spivack S, Figge HL and
Kaminsky LS. Quantitative RNA-polymerase chain
reaction-DNA analysis by capillary electrophoresis
and laser-induced fluorescence. Anal Biochem 1995;
224: 140–147.
23. Furukawa M, Nishimura M, Ogino D, Chiba R, Ikai I,
Ueda N, et al. Cytochrome p450 gene expression levels
in peripheral blood mononuclear cells in comparison
with the liver. Cancer Sci 2004; 95: 520–529.
24. Kuzma M, Jamrozik Z and Baranczyk-Kuzma A.
Activity and expression of glutathione S-transferase
pi in patients with amyotrophic lateral sclerosis. Clin
Chim Acta 2006; 364: 217–221.
25. Beutler E. Red cell metabolism: a manual of biochemical
methods. 3rd ed. Orlando, FL: Grune and Stratton, 1984.
26. Marklund S and Marklund G. Involvement of the
superoxide anion radical in the autoxidation of pyro-
gallol and a convenient assay for superoxide dismu-
tase. Eur J Biochem 1974; 47: 469–474.
27. Aebi HE. Catalase in-vitro. Meth Enzymol 1984; 105:
121–126.
28. Boyum A. Isolation of mononuclear cells and granulo-
cytes from human blood. Scand J Clin Lab Invest
1968; 21: 77.
29. Pohl RJ and Fouts JR. A rapid method for assaying the
metabolism of 7-ethoxyresorufin by microsomal sub-
cellular fractions. Anal Biochem 1980; 107: 150–155.
30. Koop DR. Hydroxylation of p-nitrophenol by rabbit
ethanol-inducible cytochrome-P450 isozyme 3a. Mol
Pharmacol 1986; 29: 399–404.
31. Habig WH, Pabst MJ and Jakoby WB.
Glutathione-S-transferase, the first enzymatic step in
mercapturic acid formation. J Biol Chem 1974; 249:
7130–7139.
32. Paglia DE and Valentine WN. Studies on the quantita-
tive and qualitative characterization of erythrocyte glu-
tathione peroxidase. J Lab Clin Med 1967; 70:
158–169.
1226 Human and Experimental Toxicology 32(11)
33. Esterbauer H and Cheeseman KH. Determination of
aldehyde lipid peroxidation products: malonaldehyde
and 4-hydroxynonenal. Meth Enzymol 1990; 186:
407–421.
34. Benzie IFF and Strain JJ. The ferric reducing ability
of plasma (FRAP) as a measure of antioxidant
power ‘‘the FRAP assay’’. Anal Biochem 1996;
239: 70–76.
35. Ellman GL, Courtney KD, Andres V Jr, and Feath-
erstone RM. A new and rapid colorimeteric determi-
nation of acetylcholinesterase activity. Biochem
Pharmacol 1961; 7: 88–95.
36. Lowery OH, Rosebrough NJ, Farr AL and Randall RJ.
Protein measurement with the folin phenol reagent.
J Biol Chem 1951; 193: 265–275.
37. Drabkin D. The standardization of hemoglobin mea-
surement. Am J Med Sci 1949; 217: 710–711.
38. Rai DK, Sharma RK, Rai PK, Watal G and Sharma B.
Role of aqueous extract of Cynodon dactylon in pre-
vention of carbofuran induced oxidative stress and
acetyl cholinesterase inhibition in rat brain. Cell Mol
Biol 2011; 57(1): 135–142.
39. Tavazzi B, Pierro D and Amorini AM. Energy metabo-
lism and lipid peroxidation of human erythrocytes as a
function of increased oxidative stress. Eur J Biochem
2000; 267: 684–689.
40. Ross D. Glutathione, free radicals and chemotherapeu-
tic agents. Pharmacol Ther 1988; 37: 231–249.
41. Sener G, Toklu HZ, Sehirli AO, Ogunc AV, Cetinel S
and Gedik N. Protective effects of resveratrol against
acetaminophen-induced toxicity in mice. Hepatol Res
2006; 35: 62–68.
42. Guven A and Gulmez M. The effect of kefir on the
activities of GSH-Px, GST, CAT, GSH and LPO levels
in carbon tetrachloride-induced mice tissues. J Vet
Med B 2003; 50: 412–416.
43. Hubatsch I, Ridderstrom M and Mannervik B.
Human glutathione transferase-A4-4: an alpha class
enzyme with high efficiency in the conjugation of
4-hydroxynonenal and other genotoxic products of
lipid peroxidation. Biochem J 1998; 330: 175–179.
44. Mirault ME, Tremblay A, Beaudoin N and Tremblay
M. Overexpression of seleno-glutathione peroxidase
by gene transfer enhances the resistance of T47D
human breast cells to clastogenic oxidants. J Biol
Chem 1991; 266: 20752–20760.
45. Geiger PG, Lin F and Girotti AW. Selenoperoxidase-
mediated cytoprotection against the damaging effects
of tert-butyl hydroperoxide on leukemia cells. Free
Radic Biol Med 1993; 14: 251–266.
46. Agrawal D, Sultana P and Gupta GSD. Oxidative
damage and changes in the glutathione redox system
in erythrocytes from rats treated with hexachiorocyclo-
hexane. Food Chem Toxicol 1991; 29: 459–462.
47. Lieber CS. Cytochrome P-4502E1: its physiological
and pathological role. Physiol Rev 1997; 77: 517–544.
48. Mari M and Cederbaum AI. Induction of catalase,
alpha, and microsomal glutathione S-transferase in
CYP2E1 over-expressing HepG2 cells and protection
against short-term oxidative stress. Hepatology 2001;
33: 652–661.
49. Montoliu C, Sancho-Tello M, Azorin I, Burgal M,
Valles S, Renau-Piqueras J, et al. Ethanol increases
cytochrome P450 2E1 and induces oxidative stress in
astrocytes. J Neurochem 1995; 65: 2561–2570.
50. Guengerich FP and Shimada T. Oxidation of toxic and
carcinogenic chemicals by human cytochrome P-450
enzymes. Chem Res Toxicol 1991; 4: 391–407.
51. Camus AM, Geneste O, Honkakoski P, Bereziat JC, Hen-
derson CJ, Wolf RC, et al. High variability of nitrosamine
metabolism among individuals: role of cytochromes
P450 2A6 and 2E1 in the dealkylation of N-nitrosodim
ethylamine and N-nitrosodiethylamine in mice and
humans. Mol Carcinogenesis 1993; 7: 268–275.
52. Kushida H, Fujita KI, Suzuki A, Yamada M, Endo T,
Nohmi T and Kamataki T. Metabolic activation of
N-alkylnitrosamines in genetically engineered Salmo-
nella typhimurium expressing CYP2E1 or CYP2A6
together with human NADPH-cytochrome P450
reductase. Carcinogenesis 2000; 21: 1227–1232.
53. Hou DF, Wang SL, He ZM, Yang F and Chen ZC.
Expression of CYP2E1 in human nasopharynx and its
metabolic effect in vitro. Mol Cell Biochem 2007; 298:
93–100.
54. Murdock L, Barnett DJ, Arnett CR and Barnett Y. DNA
damage and cytoxicity in pancreatic b-cells expressing
human CYP2E1 following exposure to N-nitroso com-
pounds. Biochem Pharmacol 2004; 68: 523–530.
Sharma RK et al. 1227