263 Gene, 122 (1992) 263-269

0 1992 Elsevier Science Publishers B.V. All rights reserved. 0378-l 119/92/$05.00

GENE 06792

High-level production of active HIV-l protease in Escherichia coli

(Recombinant DNA; gene expression; codon choice; promoters; autocleavage; fusion; AIDS)

Shaukat H. Rangwala, Rory F. Finn, Christine E. Smith, Sharon A. Berberich, William J. Salsgiver,

William C. Stallings, George I. Glover* and Peter 0. Olins

Monsanto Corporate Research, Monsanto Co.. St. Louis. MO 63198, USA

Received by S.R. Kushner: 27 March 1992; Revised/Accepted: 1 July/2 July 1992; Received at publishers: 10 August 1992

SUMMARY

High levels of active HIV-1 protease (PR) were produced in Escherichiu coli, amounting to S-10% of total cell protein.

High production levels were achieved by altering the following parameters: (1) codon preference of the coding region, (2)

A+T-richness at the 5’ end of the coding region, and (3) promoter. To circumvent the toxicity of HIV-l PR in E. coli, the

gene was expressed as a fusion protein with two different proteolytic autocleavage sequences. In both the cases, the fusion

protein could be cleaved in vivo to give an active molecule with the native sequence at the N terminus.

INTRODUCTION

Human immunodeficiency virus (HIV) is the etiological

agent for AIDS and related diseases (Wong-Staal and

Gallo, 1985). The HIV retrovirus genome is approx. 10 kb

in size and contains gag, pol and env genes flanked by long

terminal repeats. The pal gene consists of PR, reverse tran-

scriptase and integrase coding regions (Ratner et al., 1987).

Correspondence to: S.H. Rangwala, Monsanto Co., Mail Zone AA2C, 700

Chesterfield Village Pkwy., St. Louis, MO 63198, USA.

Tel. (314) 537-6574; Fax (314) 537-6480.

* Present address: Protein Biochemistry (L-33), Smith, Klein, Beecham

R & D, 709 Swedeland Rd., King of Prussia, PA 19406-2799 (USA)

Tel. (215) 270-7310.

Abbreviations: aa, amino acid(s); AIDS, acquired immunodeficiency syn-

drome; Ap, ampicillin; bp, base pair(s); CHAPS, {3 [(3-cholamidopro-

pyl)-dimethylammonio]- 1-propanesulfonate); DMSO, dimethylsulfoxide;

DTT, dithiothreitol; gZO-L, phage T7 gene 10 leader RNA: HIV, human

immunodeficiency virus; IGF2, insulin-like growth factor 2; IPTG,

isopropyl-p-D-thiogalactopyranoside; kb, kilobase or 1000 bp; MCS,

multiple cloning site(s); nt, nucleotide(s); oligo, oligodeoxyribonucleotide;

PAGE, polyacrylamide-gel electrophoresis; PolIk, Klenow (large) frag-

ment of E. coli DNA polymerase I; PR, HIV-1 protease( PR, gene(s)

encoding PR; RBS, ribosome-binding site; SDS, sodium dodecyl sulfate;

TFA, trifluoroacetic acid.

Proteins of the retroviruses are synthesized in the form

of a polyprotein precursor which is subsequently processed

by specific virus-encoded PRs (Krausslich and Wimmer,

1988). These enzymes have a highly conserved sequence,

Asp-Thr-Gly, which is characteristic of aspartyl PRs (Pearl

and Taylor, 1987). In the case of HIV-l, it has been dem-

onstrated that the PR encoded by the 5’ portion of the pol

gene is responsible for the proteolytic processing of the gag

and gag-pal polyproteins at specific cleavage sites to yield

mature capsid proteins and the enzymes, PR, reverse tran-

scriptase and integrase (Leis et al., 1988). HIV-l PR has

been shown to be necessary for viral replication, since de-

letion of the portion of the gene encoding PR or mutation

in its active site (Asp+Asn) resulted in non-infectious vir-

ions (Crawford and Goff, 1985; Kohl et al., 1988). These

results indicate that HIV-l PR may be a good target for

designing inhibitors which could be used in combating

AIDS. Many groups have shown that the HIV-l PR ac-

tivity could be blocked in vitro using synthetic peptides

(Billich et al., 1988; Krausslich et al., 1989; Tomasselli

et al., 1990). It has also been shown that the HIV-l repli-

cation in human peripheral blood lymphocytes could be

inhibited by a synthetic HIV-l PR inhibitor (McQuade

et al., 1990).

Several groups have described bacterial production of

264

HIV-l PR which was produced by autocatalytic process-

ing of a larger precursor ar by fusions with either

fl-galactosidase, dihydrofolate reductase, or p-lactamase

(Giam and Boros, 1988; Hansen et al., 1988; Hostomsky

et al., 1989; Loeb et al., 1989; Korant and Rizzo, 1990). In

most cases, the expression levels were low and the protein

could only be detected by immunoblotting.

This report describes the comparison of a number of

strategies for achieving high-level accumulation of HIV- 1

PR in E. coli.

RESULTS AND DISCUSSION

(a) Effect of synthetic gene on expression of HIV-1 PR Initial attempts at producing active HIV-l PR in E. coli

using a cDNA clone resulted in very low levels of HIV-l

PR which could only be detected by Western blot using

HIV-l PR antibody. In addition, the E. coli cells grew

poorly (data not shown). The cDNA clone (pMON5822)

consisted of a BgZII -NcoI DNA fragment containing the

polgene from the recombinant phage HXB2 (Ratner et al.,

1987) in an expression plasmid described in Table I. Some

of the possible reasons for poor expression included (I) the

flanking region sequences (part of the pal gene), (2) the

toxicity of PR, or, (3) the effect of numerous rare codons

on expression in E. coli. To circumvent the possible prob-

lems of the flanking regions (which contained coding re-

gions for reverse transcriptase and integrase) and the rare

codons, synthetic HIV-l PR genes with E. coli-preferred

codons were assembled, having either Met-Ala-Pro or

Met-Pro sequences at their N-termini. These synthetic

genes were cloned in expression vectors with the glO-L

RBS and either the recA or ZucUV5 promoter, as shown in

Table I. Plasmid constructs were also made by replacing

the first nine codons in the synthetic gene with A+T-rich

codons as shown in Table I. When a synthetic gene was

used, a band corresponding to the HIV- 1 PR could be seen

on a Coomassie-stained gel, and the intensity was stronger

when a gene with A+T-rich codons was used. The results

using Met-Ala-Pro constructs are shown in Fig. 2. Similar

results were obtained with constructs encoding Met-Pro aa

at the N terminus of the PR gene (data not shown). These

results were confirmed by Western blot analysis using poly-

clonal antibodies raised against HIV-l PR. Overall, the use

of a synthetic gene with A+T-rich codons resulted in an

approx. 50- to lOO-fold increase in the levels of HIV-l PR

production, relative to the level obtained using a cDNA

coding region.

(b) Effect of promoter on the expression of HIV-l PR Accumulation of HIV-l PR and the growth of E. coZi

cells containing the HIV-l expression plasmid were im-

TABLE I

Description of HIV-l PR expression plasmids

pMON’ Promoterb N-terminal”

sequence

Codingd

region

5766 ECA

6409 lacUV5

5822 V&4

5823 recA

5863 recA

5868 lacUV5

5869 recA

5877 lacUV5

5878 lacUV5

5879 lacUV5

5882 lacUV5

5888 lacUV5

MAP

MAP

MP

MP

MAP

MP

cDNA

cDNA

synthetic

synthetic

synthetic

synthetic

synthetic”

synthetic’

synthetic’

syntheticg

a Vector construction: standard protocols for DNA cloning and vector

construction as described in Maniatis et al. (1982) were used. All the

expression plasmids used the glO-L (Olins et al., 1988) RBS except

pMON6409 (Klein et al., 1991). Plasmid pMON5766 is similar to

pMON5743 (Olins and Rangwala, 1990) except in MCS where there is

an addition of EcoRV and C&l sites downstream from the Hind111 site.

Plasmids are designated by pMON numbers.

b For driving the expression of HIV-l PR, either the recA (Olins and

Rangwala, 1990) or lacUV5 (Klein et al., 1991) promoter was used.

’ The synthetic HIV-1 PR-encoding genes coded for either Met-Ala-Pro

(MAP) or Met-Pro (MP) sequences at the N terminus.

d The nt sequence of the cDNA and the synthetic PR gene with E. co/i

preferred codons are shown in Fig. 1 e First nine aa in synthetic gene were replaced with A + T-rich codons:

Pro Gln Val Thr Leu Trp E. c&preferred codons: CCC CAG GTT ACC CTC TGG

A + T-rich codons: CCA CAA GTT ACT CTT TGG

Gln Arg Pro

E. co&preferred codons: CAG CGT CCG

A + T-rich codons: CAA CGT CCA

’ PR autocleavage sequence used in pMON5882

Met-Thr-Leu-Asn-Phe//Pro-Gin... (cleavage site between Phe and Pro).

g N-terminal IGF-2 fused to PR cleavage sequence used in pMON5888.

< - - - N-terminal IGF-2 sequence - - - >

Met-Ala-Tyr-Arg-Pro-Ser-Glu-Thr-Leu-Cys-Gly-Thr-Val-Ser-Phe-Asn-

Phe//Pro-Gln.

Plasmid pMON5822 contains a BglII-NcoI fragment (treated with PolIk)

of phage HXB2 (Ratner et al., 1987) cloned into pMON5766 at the NcoI

site (treated with PolIk). pMON5823 is a deletion of pal gene in

pMON5822 between EcoRV sites, which deletes all of the integrase re-

gion and part of reverse transcriptase. All of the other plasmids mentioned

above used synthetic gene shown in Fig. 1, cloned in the expression vector

pMON5766. Constructs with lacUV5 promoter were made by substitut-

ing the SacII-BglII fragment containing the vecA promoter with synthetic

oligos corresponding to the lacUV5 promoter (Klein et al., 1991). The

Met-Pro sequence at the N terminus was introduced by replacing the

NcoI-BstEII fragment of the synthetic gene with synthetic oligos. A + T-

rich codons with Met-Ala-Pro and Met-Pro N-terminal sequences were

introduced by replacing the NcoI-PvuII fragment in the synthetic gene with

appropriate oligos. pMON5882 and pMON5888 were made by replacing

in NcoI-BstEII fragment of the synthetic gene in pMON5868 with ap-

propriate oligos. Details of the PR autocleave sequences are described in

section e

265

D b

Na CCTCAGGTCACTCTTTGGACCCCTCGTCA~TAAAG II lllll II II lllll II II II II II II II

SY CCATGGCACCGCAGGTTACCCTCTGGCAGCGTCCGCTGGTTACTATCAAA MAPQVTLWQRPLVTIK

Na ATAG @x&AA CTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACA IIIIIIIIIIIIllllllll IIIIIIIIIIIIIII

Sy ATCGGTGGTCAGCTGAAAGAAGCTCTGCTGGACACTGGCGCTGACGACACT 101 IGGQLKEALLDTGADDT 33

Na GTATTAGAAGAAATGAGTTTGCCAGGAAGATGGAAACCAAAAATGATAGGG II I II Illlll III1 II I Illlllll llllIllI II

Sy GTTCTCGAGGA?dTGTCCCTCXXGGGTCGTTGGAAACCGAAAATGATTGGC VLEEMSLPGRWKPKMIG

Na GGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAA II II II II llllllIIlII I II/IIIIIIIIIII II II III

Sy GGTATCGGTGGCTTTATCAAAGTTCGTCAGTATGATCAGATCCTGATCGAA GIGGFIKVRQYDQILIE

200 66

Na ATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTC 243 IIlIIIIIIIIIIIIIIIIIIIIIIII IllllllllII

Sv ATCTGCGGTCACAAAGCTATCGGTACCGTTCTGGTTGGTCCGACCCCGGTT ICGHKAIGTVLVGPTPV

Na AACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTT

42

50 16

93

144

152 50

192

251 83

297 lllll II II I II III IIII lllll Illlllll I I II

Sy AACATCATCGGTCGTAACCTGCTGACCCAGATCGGTTGCACCCTGACTTTC 305 NIIGRNLLTQIGCTLNF 101

h Na . . . . . . . . . . Sy TAATAAGCTT 315

* *

Fig. 1. Comparison of HIV-l PR native (Na) nt sequence to a synthetic

(Sy) sequence containing E. c&preferred codons. The aa are aligned with

first nt of each codon. Restriction sites (b, BstEII; n, NcoI; h, ZZindIII;

p, PvuII) shown correspond to the synthetic gene. The codon choice was

that found in highly expressed E. coli genes (Gouy and Gautier, 1982).

Asterisks mark the stop codons. Methods: N-terminal aa sequence anal-

ysis was done using the protocol of Matsudaira (1987) and Hunkapiller

et al. (1983). Vertical lines connect identical nt.

proved by replacing the recA promoter with the lacUV5

promoter. The results are shown in Fig. 2, lanes C

(pMON5863) and D (pMON5868). Although the expres-

sion levels seem similar, the overall production level was far

better with expression driven by the lucUV5 promoter, since

strains carrying the expression plasmid with the recA pro-

moter grew very poorly (data not shown). We suspect that

small amounts of soluble, active HIV-l PR are expressed

in cells containing plasmids using the recA promoter even

under non-inducing conditions. This material may be toxic

to E. coli, making the cells less capable of producing high

levels of HIV-l PR on induction. In the case of the lacUV5

promoter, which is more tightly repressed than the recA

promoter, no HIV-l PR is made until the promoter is in-

duced. Upon induction, large amounts of HIV-1 PR are

made, which precipitates into an insoluble form (inclusion

bodies) where it is presumably inactive, and hence has no

toxic effect on the E. coli cells.

(c) Effect of N-terminal sequence on the activity of HIV-l PR (Met-Ala-Pro versus Met-Pro)

Depending on the gene used, the activity of the HIV-l

PR recovered from inclusion bodies (after refolding) dif-

fered greatly, even though the accumulation levels were

very similar. Higher activity of the PR could be recovered

using plasmid constructs encoding Met-Pro (pMON5879)

:A B C D E .-----

kDa STSPT~PTS~TS~T~~

25.7

18.4

14.3

6.2

3.0

-

-

Fig. 2. Coomassie-stained 0.1% SDS-15% PAGE of E. coli cells ex-

+ HIV-1

protease

pressing HIV-l PR from various plasmid constructs. The host strain used

was E. coli W3 110 lacZq (obtained from W.C. Tacon). Cells containing the

desired plasmid were grown overnight at 30°C in Luria broth (Maniatis

et al., 1982) containing 200 pg Ap/ml. The following day the cultures were

used to inoculate 25 ml M9 medium supplemented with Casamino acids,

thiamine, and trace minerals (Obukowicz et al., 1988) to a starting cell

density of about 20 Klett units (No. 42 green filter). When the cells had

reached a density corresponding to 150 Klett units, the appropriate in-

ducer was added and the cultures were shifted from 30°C to 37°C. Im-

mediately prior to the addition of the inducer, a l-ml aliquot was taken

which served as a pre-induction sample. Nalidixic acid at a final concen-

tration of 50 pg/ml was used for inducing the recA promoter and 1 mM

IPTG was used for inducing the ZacUVS promoter. The cultures were

grown for 3 h after induction, with aliquots taken every hour. Aliquots

corresponding to 15 pg total cell protein were analyzed. One pg of HIV-l

PR standard was loaded. Plasmid pMON6409 was used as a control for

the ZucUV5 promoter and is the same as pMON5851 (Klein et al., 1991)

except that the gZO-L RBS (XbaI-EcoRV) has been deleted. Samples in

lanes A, B, C, D, and E were from E. coli containing pMON5766,6409,

5863, 5868 and 5878 (see Table I), respectively. A l-ml aliquot of the

induced E. coli cells was harvested by centrifugation, and the pellet was

resuspended in 10 mM Tris.HCl pH 7.5/50 mM NaCl. The cells were

broken by sonication using a microtip sonicator (Heat Systems Ultra-

sonics, NY). The sonication was done in four 20-s bursts. The broken

cells were spun at 10000 rpm for 10 mm in a Sigma-202 MK table-top

centrifuge. The pellet was referred to as the insoluble fraction and the

supernatant as the soluble fraction. P, pellet from the sonicated sample;

S, supernatant from the sonicated sample; T, total cell protein.

at the N terminus of the gene compared to the gene with

Met-Ala-Pro (pMON5878), where no activity was de-

tected. There seems to be a correlation between the PR

activity and the fraction of protein with Pro as the first aa.

The sequencing results obtained from HIV-l PR protein

expressed using pMON5878 (PR gene sequence starts with

Met-Ala-Pro) showed that 50% of the protein contained

Met and 50% contained Ala at the N terminus, with none

containing Pro. In contrast, using pMON5879 (PR gene

sequence starts with Met-Pro) 90% of the protein had Pro

266

Fig. 3. The HIV-l PR dimer viewed approx. down the dyad axis. The color scheme emphasizes a four-stranded P-sheet (red) that forms part of the dimer

interface. The four strands are the N and C termini from the two subunits (yellow and bluish-green). Outer strands are formed from the N termini (res-

idues l-4) of the proteins, and the inner strands, which run antiparallel to each other, are the C termini (aa 95-99). Interdigitation causes the N termi-

nus of one subunit to form parallel p-sheet hydrogen bonds to the C terminus of the other. Methods: the inclusion body pellet was solubilized in solu-

tion containing 7 M guanidine~HC1/50 mM Tris.HCl/l mM EDTAjlO mM DTT pH 9.5. The solubilized pellet was diluted tenfold into a solution

containing 100 mM NaH,PO,/O.S% CHAPS/30% glycerol/l mM EDTAjl mM DTT.

at its N terminus. It has been observed in E. coli with a

number of proteins, that the N-terminal Met is processed

off efficiently by methionine aminopeptidase, especially

when the second aa is Ala (Easton et al., 1991). Using

pMON5863 (PR gene sequence starts with Met-Ala-Pro)

the expression levels were low, and PR activity could be

detected in the soluble fraction of cell extracts. In contrast,

using pMON5878 (PR gene sequence starts with Met-Ala-

Pro) expression levels were high, but no activity was de-

tected. These results could be explained as follows. It has

been observed that aminopeptidase P present in E. coli

cleaves prior to Pro residues (Yaron and Mlynar, 1968)

but that cleavage is much slower when the aa preceding Pro

is Ala (Yaron and Berger, 1970). In the case of pMON5863,

where the HIV-l PR expression level was very low and the

protein was soluble, it is possible that Met and Ala were

more efficiently cleaved off, whereas in the case of

pMON5878, the high-level expression resulted in the for-

mation of inclusion bodies where the protein was insoluble,

and therefore possibly not accessible to aminopeptidases.

As mentioned earlier, HIV- 1 PR with an N-terminal Pro

is active, while proteins with Met-Ala or Ala extensions are

inactive. These results are consistent with the observation

that the structure of HIV-l PR requires the formation of a

homodimer for its activity (Guenet et al., 1989). The crystal

structure of HIV-l PR shows that the dimer involves the

N and C termini of the protein forming a p-sheet as illus-

trated in Fig. 3. The presence of additional aa residues at

the N (or the C) terminus could inhibit dimer formation by

inducing the adjoining residues to adopt conformations

which are not b-strands. Alternatively, extra residues could

shift the registration of the inter-strand hydrogen bonds in

a manner which would preclude formation of a stable, ac-

tive dimer. A final possibility is that additional residues at

the terminus of one chain could interact with residues in the

central chain segment of the other, in a manner which

destabilizes productive dimer formation.

(d) Synthesis of HIV-l PR as a fusion Since a Pro residue at the N-terminal position of the PR

seems to be important for its activity, a strategy was de-

vised to produce homogenous material starting with Pro.

From our results expressing the complete pal gene

(pMON5863) in E. coli and from other reports (Giam and

Boros, 1988; Hansen et al., 1988; Krausslich et al., 1988;

Mous et al., 1988; Korant and Rizzo, 1989; Loeb et al.,

A

kDa

43.0 -

25.7 -

18.4 -

14.3 -

8.2 -

:: % ij :A B C D E --_- > ETSPTSPTSPTSPTSP

I GF2-orotease 1 fusion

- HIV-1 protease

_A IGF2-protease fusion

A HIV-1 protease

Fig. 4. Coomassie-blue-stained 0.1% SDS-152 PAGE analysis of E.

coli cells expressing HIV-l PR from various plasmid constructs. (Panel

A) The host strain and the growth conditions used were same as described

in Fig. 2. Samples in lanes under A, B, C, D, and E are from E. coli

containing pMON6409 (Fig. 2), 5878,5879, 5882 and 5888 (see Table I),

respectively. P, pellet from the sonicated sample; S, supernatant from the

sonicated sample; T, total cell protein. (Panel B) Western blot analysis of

E. co/i cells expressing HIV-l PR from various constructs. Immunoblot-

ting (Renart et al., 1979) was performed by electroblotting proteins from

SDS gels onto aminophenylthioether paper (Schleicher & Schuell, Keene,

NH). Blots were probed with rabbit antiserum against full-length synthetic

HIV-l PR (a gift from S. Kent), and the complexes were detected with

25 yCi ‘251-labeled protein A (Amersham, Arlington Heights, IL) accord-

ing to the manufacturer’s instructions, followed by autoradiography. Lanes

l-4 contains post-induction samples from cells containing expression

plasmids pMON5878, pMON5879, pMON5882 and pMON5888, re-

spectively.

267

1989), it was demonstrated that the PR autocleavage site

is functional in E. coli to give active PR. However, as

shown in this report, the levels of PR accumulation using

pMON5863 were poor. In order to make large quantities

of PR, the synthetic HIV-l PR gene used in the construct

pMON5868 was fused with an autocleavage sequence re-

cognized by HIV-l PR (corresponding to part of the C

terminus of the PR gene). The resulting plasmid

pMON5882 is described in Table I. The PR made in E. coli

[pMON5882] accumulated in inclusion bodies, and was

active upon solubilization and refolding. However, aa se-

quence analysis of the protein revealed that only partial

autocleavage had occurred as only 11 y0 of the protein pos-

sessed Pro at the N terminus. Since the difference in size

between the uncleaved and cleaved material was very small,

it was difficult to separate the two forms.

In order to be able to separate the mature protein from

the fusion protein, a larger fusion was added to the N

terminus of the synthetic HIV-l PR gene. This fusion cor-

responded to the first 10 aa of bovine IGF-2 protein (Eas-

ton et al., 1991) followed by 7 aa of the PR autocleavage

sequence. The reason for using the IGF-2 gene fragment

was that it had been optimized for translation initiation in

E. coZi (Easton et al., 1991). The autocleavage sequence

used is present in the virus and contains 7 aa from the C

terminus of the gag gene. The resulting plasmid,

pMON5888, is described in Table I. As expected, high

levels of expression were obtained. SDS-PAGE analysis

with Coomassie brilliant blue R250 staining and Western

blot analysis using HIV-l anti-PR antibody showed that

the mature protein could be separated from the fusion pro-

tein, as illustrated in Fig. 4A and B. The aa sequence anal-

ysis of the mature protein revealed that it possessed a Pro

at its N terminus, indicating that the autocleavage site was

correctly recognized. Using the peptide substrate TIM-

MQR, the protein was shown to be active.

In order to demonstrate that the PR made using

pMON5888 was active on a larger protein substrate, a

portion of the gag-pal gene carrying a single cleavage site

was cloned into an expression plasmid (Fig. 5). This sub-

strate could be expressed by in vitro transcription/

translation (Fig. 6), since the glO-L ribosome binding site

also contains a promoter for T7 RNA polymerase. Using

this Gag-PO1 fragment as a substrate, it was shown that the

HIV-l PR derived from either pMON5882 or pMON5888

was active on a large substrate, producing two fragments

of the predicted sizes. Cleavage of the Gag-PO1 fusion was

sensitive to the aspartyl PR inhibitor pepstatin (Fig. 6, lane

D), as would be expected for HIV-l PR. Hence, the HIV- 1

PR produced by these expression plasmids is consistent

with the predicted activity of the native enzyme. The HIV- 1

PR derived from pMON5888 is currently being used as a

reagent for the design of inhibitors.

268

Ncol EcoRV

--Phe-Pro- -

+

aaT - stop

autocleavage site

Fig. 5. Schematic representation of an expression plasmid containing a

portion of the pol gene, including a single HIV-l PR cleavage site at the

5’ end of the gene. The construct pMON5876 was made by truncating

the C-terminal portion of the PR gene by replacing the PpuMI-EcoRV

portion in pMON5823 with a synthetic oligo linker having PpuMI-EcoRV

compatible ends. The linker introduces a stop codon at aa’* of the HIV-l

PR gene and deletes the C-terminal portion.

kDa

43.0 -

25.7 -

18.4 -

6.2 -

3.0 -

ABC DE F

Fig. 6. Protease digestion of Gag-PO1 fragment. Gag-PO1 ‘%-labeled sub-

strate was generated by an in vitro transcription/translation reaction using

linearized pMON5876 in the presence of [35S]methionine at 1.8 pCi/pl

(+ template); an identical reaction was done without pMON5876 DNA

(- template). Transcription/translation reaction mixtures (k templates)

were incubated in the presence or absence of HIV-l PR purified from E.

coli [pMON5888] cells (lanes A, B, E and F). Similar results were ob-

tained with PR purified from E. coli [pMON5882] cells (data not shown).

The incubation buffer contained 20 mM phosphate pH 6.4/20x glycerol/

0.1 Y0 CHAPS/l.5 mM DTT. In order to demonstrate that the cleavage

of the substrate is PR-specific, the PR inhibitor pepstatin was added

(dissolved in DMSO), to a Iinal concentration of 12 mM (lane D). A

control containing DMSO without pepstatin is included (lane C). After

30 min at 30°C an equal volume of SDS-PAGE sample buffer was

added to stop the reaction. Approximately 15 pCi from each digestion was

separated by 0.1 y0 SDS-15% PAGE under reducing/denaturing condi-

tions. The gel was hxed in methanol/acetic acid/water, incubated in

‘Enlightening’ (NEN Corp.) for 30 min and dried onto filter paper. The

dried gel was exposed to x-ray film overnight at -70°C. Methods: HIV-l

PR assays were done using synthetic peptide substrate, TIMMQR, as

described in Krausslich et al(1989).

(e) Conclusions

(1) Codon usage: a synthetic gene with E. coli- preferred

codons increased the expression levels of HIV-l PR in E.

coli significantly over the cDNA sequence.

(2) A+T-richness: replacing the first nine codons in the

synthetic gene with A+T-rich codons further improved the

expression levels of HIV-l PR in E. coli.

(3) Promoter: use of the tightly regulated promoter

lacUV5, rather than the recA promoter, decreased the toxic

effect of HIV-l PR on E. coli growth and increased the

accumulation levels.

(4) Addition of Met or Met-Ala to the N-terminal Pro

residue (which is the first aa in the native PR) decreased

or eliminated the PR activity in the peptide substrate assay.

(5) Use of a fusion with an HIV-l PR autocleavage site

resulted in active PR with the correct N-terminal aa.

ACKNOWLEDGEMENTS

We would like to thank Debbie Connors, Dudley Mc-

Mackins, Kamila Kavka and Tom Rogers for providing

synthetic oligos.

REFERENCES

Billich, S., Knoop, M., Hansen, J., Strop, P., Sedlacek, J., Mertz, R. and

Moelling, K.: Synthetic peptides as substrates and inhibitors of human

immune deficiency virus-l protease. J. Biol. Chem. 263 (1988) 17905-

17908.

Crawford, S. and Goff, S.P.: A deletion mutation in the 5’ part of the pol

gene of Moloney murine leukemia virus blocks proteolytic processing

of the gag and pol polyproteins. J. Viral. 53 (1985) 899-907.

Easton, A.M., Gierse, J.K., Seetharam, R., Klein, B.K. and Kotts, C.E.:

Production of bovine insulin-like growth factor 2 (bIGF2) in

Escherichia coli. Gene 101 (1991) 291-295.

Giam, C.Z. and Boros, I.: In vivo and in vitro autoprocessing of human

immunodeficiency virus protease expressed in Escherichia coli. J. Biol.

Chem. 263 (1988) 14617-14620.

Gouy, M. and Gautier, C.: Codon usage in bacteria: correlation with gene

expressivity. Nucleic Acids Res. 10 (1982) 7055-7074.

Guenet, C., Leppik, R.A., Pelton, J.T., Moelling, K., Lovenberg, W. and

Harris, B.A.: HIV-l protease mutagenesis of asparagine 88 indicates

a domain required for dimer formation. Eur. J. Pharmacol. 6 (1989)

443-452.

Hansen, J., Billich, S., Schulze, T., Suckrow, S. and Moelling, K.: Par-

tial purification and substrate analysis of bacterially expressed HIV-1

protease by means ofmonoclonal antibody. EMBO J. 7 (1988) 1785-

1792.

Hostomsky, Z., Appelt, K. and Ogden, R.C.: High-level expression of

self-processed HIV-l protease in Eschenkhiu coli using a synthetic

gene. Biochem. Biophys. Res. Commun. 161 (1989) 1056-1063.

Hunkapiller, M.W., Hewick, R.M., Dreyer, R.J. and Hood, L.E.: High-

sensitivity sequencing with a gas-phase sequenator. Methods Enzy-

mol. 91 (1983) 399-413.

Klein, B.K., Hill, S.R., Devine, C.S., Rowold, E., Smith, C.E. and Olins,

P.O.: Secretion of active bovine somatotropin in Escherichia coli. Bio-

technology 9 (1991) 869-872.

269

Kohl, N.E., Emini, E.A., Schleif, W.A., Davis, L.J., Heimbach, J.C.,

Dixon, R.A.F., Scolnick, E.M. and Sigal, I.S.: Active human immu-

nodeficiency virus protease is required for viral infectivity. Proc. Natl.

Acad. Sci. USA 85 (1988) 4686-4690.

Korant, B.D. and Rizzo, C.J.: Expression in E. coli of the AIDS virus

aspartic protease through a protein fusion. Biol. Chem. Hoppe-Seyler

371 (1990) 271-275.

Krausslich, H.G. and Wimmer, E.: Viral proteinases. Annu. Rev. Bio-

them. 57 (1988) 701-754.

Krausslich, H., Ingraham, R.H., Skoog, M.T., Wimmer, E., Pallai, P.V.

and Carter, C.A.: Activity ofpurified biosynthetic proteinase of human

immunodeficiency virus on natural substrates and synthetic peptides.

Proc. Natl. Acad. Sci. USA 86 (1989) 807-811.

Laemmli, U.K.: Cleavage of structural proteins during assembly of the

head of bacteriophage T4. Nature 227 (1970) 680-685.

Leis, J., Baltimore, D., Bishop, J.M., Coffin, J., Fleissner, E., Goff, S.P.,

Oroszlan, S., Robinson, H., Skalka, A.M., Temin, H.M. and Vogt,

V.: Standardized and simplified nomenclature for proteins common

to all reteroviruses. J. Virol. 62 (1988) 1808-1809.

Loeb, D.D., Hutchinson III, CA., Edgell, M.H., Farmerie, W.G. and

Swanstrom, R.: Mutational analysis ofhuman immunodeficiency virus

type 1 protease suggests functional homology with aspartic protein-

ases. J. Virol. 63 (1989) 111-121.

Maniatis, T., Fritsch, E.F. and Sambrook, .I.: Molecular Cloning. A

Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring

Harbor, NY, 1982.

Matsudaira, P.: Sequence from picomole quantities of proteins electrob-

lotted onto polyvinylidene difluoride membranes. J. Biol. Chem. 262

(1987) 10035-10038.

McQuade, T.J., Tomasselli, A.G., Liu, L., Karacostas, V., Moss, B.,

Sawyer, T.K., Heinrickson, R.L. and Tarpley, W.G.: A synthetic

HIV- 1 protease inhibitor with antiviral activity arrest HIV-like particle

maturation. Science 247 (1990) 454-456.

Messing, J.: A multipurpose cloning system based on the single-stranded

DNA bacteriophage M13. Recombinant DNA Technical Bulletin,

NIH publication No. 79-99, Vol. 2, No. 2, 1979, pp. 43-48.

Mous, J., Heimer, E.P. and Le Grice, S.F.J.: Processing protease and

reverse transcriptase from human immunodeficiency virus type I

polyprotein in Escherichiu coli. J. Virol. 62 (1988) 1433-1436.

Obukowicz, M.G., Turner, M.A., Wong, E.Y. and Tacon, W.C.: Secre-

tion and export of IGF-1 in Escherichia coli strain JMlOl. Mol. Gen.

Genet. 215 (1988) 19-25.

Olins, P.O. and Rangwala, S.H.: Vector for enhanced translation of for-

eign genes inEscherichia coli. Methods Enzymol. 185 (1990) 115-119.

Olins, P.O., Devine, C.S., Rangwala, S.H. and Kavka, K.S.: The T7

phage gene 10 leader RNA, a ribosome-binding site that dramatically

enhances the expression of foreign genes in Escherichiu coli. Gene 73

(1988) 227-235.

Pearl, L.H. and Taylor, W.R.: A structural model for the retroviral pro-

teases. Nature 329 (1987) 351-354.

Ratner, L., Fisher, A., Jagodzinski, L.L., Mitsuya, H., Liou, R., Gallo,

R.C. and Wong-Staal, F.: Complete nucleotide sequences of func-

tional clones of the AIDS virus. AIDS Res. Hum. Retroviruses 3

(1987) 57-69.

Renart, J., Reiser, J. and Stark, G.R.: Transfer of proteins from gels to

diazobenzyloxymethyl-paper and detection with antisera: a method

for studying antibody specificity and antigen structure. Proc. Natl.

Acad. Sci. USA 76 (1979) 3116-3120.

Tomasselli, A.G., Olsen, M.K., Hui, J.O., Staples, D.J., Sawyer, T.K.,

Heinrikson, R.L. and Tomich, C.C.: Substrate analogue inhibition

and active site titration of purified recombinant HIV-l protease. Bio-

chemistry 29 (1990) 264-269.

Wong-Staal, F. and Gallo, R.C.: Human T-lymphotropic retroviruses.

Nature 317 (1985) 395-403.

Yaron, A. and Berger, A.: Aminopeptidase-P. Methods Enzymol. 19

(1970) 521-534.

Yaron, A. and Mlynar, D.: Aminopeptidase-P. Biochem. Biophys. Res.

Commun. 32 (1968) 658-663.