RESEARCH ARTICLE Open Access

High-level extracellular production ofrecombinant nattokinase in Bacillus subtilisWB800 by multiple tandem promotersZhongmei Liu* , Wenhui Zheng, Chunlei Ge, Wenjing Cui, Li Zhou and Zhemin Zhou*

Abstract

Background: Nattokinase (NK), which is a member of the subtilisin family, is a potent fibrinolytic enzyme thatmight be useful for thrombosis therapy. Extensive work has been done to improve its production for the foodindustry. The aim of our study was to enhance NK production by tandem promoters in Bacillus subtilis WB800.

Results: Six recombinant strains harboring different plasmids with a single promoter (PP43, PHpaII, PBcaprE, PgsiB, PyxiE orPluxS) were constructed, and the analysis of the fibrinolytic activity showed that PP43 and PHpaII exhibited a higherexpression activity than that of the others. The NK yield that was mediated by PP43 and PHpaII reached 140.5 ± 3.9FU/ml and 110.8 ± 3.6 FU/ml, respectively. These promoters were arranged in tandem to enhance the expressionlevel of NK, and our results indicated that the arrangement of promoters in tandem has intrinsic effects on the NKexpression level. As the number of repetitive PP43 or PHpaII increased, the expression level of NK was enhanced upto the triple-promoter, but did not increase unconditionally. In addition, the repetitive core region of PP43 or PHpaIIcould effectively enhance NK production. Eight triple-promoters with PP43 and PHpaII in different orders wereconstructed, and the highest yield of NK finally reached 264.2 ± 7.0 FU/ml, which was mediated by the promoterPHpaII-PHpaII-PP43. The scale-up production of NK that was promoted by PHpaII-PHpaII-PP43 was also carried out in a 5-Lfermenter, and the NK activity reached 816.7 ± 30.0 FU/mL.

Conclusions: Our studies demonstrated that NK was efficiently overproduced by tandem promoters in Bacillussubtilis. The highest fibrinolytic activity was promoted by PHpaII-PHpaII-PP43, which was much higher than that hadbeen reported in previous studies. These multiple tandem promoters were used successfully to control NKexpression and might be useful for improving the expression level of the other genes.

Keywords: Nattokinase, Tandem promoter, Core promoter region, Bacillus subtilis, Recombinant enzyme

BackgroundNattokinase (NK, E.C. 3.4.21.62) was first identified bySumi et al. from “Natto”, which is a popular traditionalJapanese soybean food [1]. NK, as a potent fibrinolyticenzyme, can directly cleave cross-linked fibrin in vitroand inactivate the fibrinolysis inhibitor or catalyze theconversion of plasminogen to plasmin [2, 3]. Studies inrats showed that NK exhibited 5-fold more fibrinolyticactivity than that of plasmin [4]. Compared with otherthrombolytic reagents, including urokinase, tissue typeplasminogen activator (t-PA) and streptokinase, NK has

advantages in preventative and prolonged effects, withfew side effects and stability in the gastrointestinal tract[5]. The NK gene was cloned and characterized, andprotein engineering techniques and site-directed muta-genesis were carried out to improve NK stability [6–10].The NK enzyme is usually industrially produced by thewild-type Bacillus subtilis natto (B. subtilis natto) [11].The species B. subtilis is a good host strain for the

industrial production of the NK enzyme, as NK was iso-lated from B. subtilis natto. B. subtilis is a gram-positivebacterium and is a well-studied host for the expressionof heterologous proteins because of its many attractivefeatures [12]. As a model organism, B. subtilis is widelyused in laboratory studies because it is easy to cultureand has a high-level secretory system. In addition, B.

© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, andreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link tothe Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

* Correspondence: lmeimei1220@hotmail.com; zhmzhou@jiangnan.edu.cnKey Laboratory of Industrial Biotechnology (Ministry of Education), School ofBiotechnology, Jiangnan University, 1800 Lihu Road, Wuxi 214122, Jiangsu,China

Liu et al. BMC Microbiology (2019) 19:89 https://doi.org/10.1186/s12866-019-1461-3

subtilis is a food-grade safety strain and presents nosafety concerns, as reviewed by the U.S. FDA Center.Some efficient expression systems have been con-structed to promote the production of homologousand heterologous proteins in B. subtilis, because of itswell-characterized physiological and biochemical prop-erties and nonpathogenicity [13–15]. B. subtilis strainshas been engineered as extracellular-protease deficientstrains for the overexpression of subtilisin and β-lac-tamase in B. subtilis WB600 [16, 17], the overexpres-sion of staphylokinase and xylanase in B. subtilisWB700 [18, 19], and the overexpression of phospholipaseC in B. subtilis WB800 [20]. In addition, several studieshave reported the secretory overexpression of NK in re-combinant B. subtilis strains [21, 22].As is well known, the promoter-regulated gene

transcription is usually located upstream of the gene.There are two kinds of promoters: the constitutivepromoter that is active in all circumstances and theregulated promoter that become active only in re-sponse to specific stimulation in the cell. Because thepromoter is a crucial aspect of the expression system,many strong promoters have been screened and char-acterized in B. subtilis [23–26]. Recent studies haveincreasingly focused on the strategy to improve theexpression level of recombinant proteins or peptidesby the construction of tandem promoters and pro-moter engineering. Using engineered promoters byaltering the − 10 or − 35 region led to a much higherproduction of recombinant proteins [27, 28]. Widneret al. had studied the gene expression in B. subtilisand found that the expression level of the gene couldincrease by using expression systems that contain twoor three tandem promoters in contrast to a singlepromoter. The study demonstrated that the expres-sion of aprL achieved a high level by combining themutant amyQ promoter with the promoter of thecry3A gene [29]. The thermostable 4-α-glucanotrans-ferase from Thermus scotoductus was overexpressedin B. subtilis, and its productivity was elevated bymore than ten-fold when promoted by adual-promoter system, compared to that of the singleHpaII promoter system [30]. Researchers have investi-gated the strength of single and dual promoters foroverexpression of aminopeptidase in B. subtilis. Inaddition, the dual-promoter PgsiB–PHpaII gave the bestperformance, which was much higher than PHpaII andPgsiB [31]. The system containing a dual-promoterPHpaII-PamyQ′ was found to sustain superior expression ofβ-cyclodextrin glycosyltransferase in a B. subtilis strain(CCTCC M 2016536) [32]. Okegawa and Motohashi suc-cessfully expressed the functional ferredoxin-thioredoxinreductase by using a system containing tandem T7 pro-moters in Escherichia coli [33].

In this study, we aimed to increase the secretoryexpression of NK in B. subtilis WB800 by mediating thegene expression promotion by tandem promoters. Sixconstitutive promoters, PHpaII, PP43, PBcaprE, PluxS, PgsiBand PyxiE, were selected, and a series of expression cas-settes containing single promoters, dual-promoters andtriple-promoters was achieved by arranging promotersin different orders. The efficacies of these multiple tan-dem promoters for controlling the expression of NK arepresented.

ResultsConstruction of expression cassettes for overexpressionof nattokinaseSix strong and widely used promoters, PHpaII, PP43, PBcaprE,PluxS, PgsiB and PyxiE, were selected as targets for enhan-cing the production of NK, and their origins and charac-teristics are listed in Additional file 1: Table S1. Theplasmid pSG-PHpaII was constructed in our previous study[31]. Then, the plasmid pSG-pro-NK with no promoterwas constructed first, and five promoters were employedto construct the plasmids pSG-PP43, pSG-PBcaprE, pSG-PluxS, pSG-PgsiB and pSG-PyxiE following the MEGA-WHOP method (Fig. 1a).As shown in Fig. 1b, plasmids harboring multiple pro-

moters in tandem were constructed (pSG-PX-PY-PZ).These six promoters were further inserted into the down-stream region of different promoters to result in fourteenkinds of plasmids in which the NK was controlled bydual-promoters. Based on the NK expression level ofrecombinant strains under the control of dual-promoters,promoter P43 and HpaII were combined in the pattern ofthree and four promoters in tandem, and ten differentkinds of promoters were successfully obtained.In addition, another type of tandem promoter (pSG

-nCPX) was constructed, as shown in Fig. 1c. The coreregion of the promoter (− 10 and − 35 region) was ampli-fied and linked in tandem repeats. All of the plasmidsfor the NK expression that was constructed in this studyare listed in Table 1.

Expression of nattokinase in B. subtilis WB800 with asingle promoterTo compare the abilities of those six promoters topromote NK expression, the six strains harboring thedifferent plasmids, pSG-PHpaII, pSG-PP43, pSG-PBcaprE,pSG-PluxS, pSG-PgsiB and pSG-PyxiE, were cultivated inTB medium. The effects of these single promoters onthe secretory expression level of recombinant NKwere determined by SDS-PAGE and fibrinolytic ana-lysis (Fig. 2). Fibrinolytic activity curves showed thatthe highest activity was achieved at 36 h (Fig. 2a).The highest yield of NK mediated by PHpaII was110.8 ± 3.6 FU/ml, while the maximum NK activity

Liu et al. BMC Microbiology (2019) 19:89 Page 2 of 14

was 140.5 ± 3.9 FU/ml produced by the strain harbor-ing pSG-PP43. The expression levels under the controlof PBcaprE (103.5 ± 4.2 FU/ml) and PluxS (99.2 ± 3.8FU/ml) were similar, second only to the expressionunder the control of PHpaII. The promoter PyxiE (20.2 ±2.0 FU/ml) exhibited the lowest expression level of NKamong the six promoters, and its promoter strength wasonly 14% of PP43. The results of SDS-PAGE and the fibrinplate assay supported the above fibrinolytic analysis results(Fig. 2b and c).

Effects of different dual-promoter systems on nattokinaseexpressionTo investigate whether two of these promoters in tan-dem could enhance NK production, fourteen types ofdual-promoters were constructed. The effects of thesedual-promoter systems on the expression of recombin-ant NK were compared by SDS-PAGE and by measuringthe fibrinolytic activity (Fig. 3). The NK expression fromthese dual-promoters containing two of the same pro-moters was constitutively increased compared with thatfrom a single promoter, such as PP43-PP43 (157.2 ± 3.0 FU/ml) compared with PP43 (140.5 ± 3.9 FU/ml), PHpaII-PHpaII(199.4 ± 4.8 FU/ml) compared with PHpaII (110.8 ± 3.6 FU/

ml), PBcaprE-PBcaprE (120.3 ± 2.4 FU/ml) compared withPBcaprE (103.5 ± 4.2 FU/ml), and PgsiB-PgsiB (48.0 ± 2.2 FU/ml) compared with PgsiB (44.6 ± 2.9 FU/ml). These resultsshowed that the experiments involving PgsiB in tandem orseparately did not exhibit an efficient expression of NK.Intriguingly, the dual-promoter system containing dif-

ferent promoters showed that the order of two promotershas an important effect on the expression of NK. The NKactivity under the control of PHpaII-PyxiE was approxi-mately 166.7 ± 2.5 FU/ml, but the production under thecontrol of PyxiE-PHpaII displayed an obviously opposite ef-fect, in which the expression of NK was undetected (0FU/ml). Similar results were observed in strains harboringpSG-PgsiB-PHpaII (164.9 ± 3.0 FU/ml) and pSG-PHpaII-PgsiB(0 FU/ml), pSG-PBcaprE-PHpaII (175.5 ± 5.0 FU/ml) andpSG-PHpaII-PBcaprE (0 FU/ml), and pSG-PluxS-PHpaII (77.5± 4.0 FU/ml) and pSG-PHpaII-PluxS (0 FU/ml).However, regardless of how PHpaII and PP43 were ar-

ranged in tandem, NK was expressed at a high level inthe recombinant strain B. subtilis WB800. The NK yieldmediated by pSG-PP43-PHpaII reached the highest value(231.7 ± 6.0 FU/ml), which increased by 109% whencompared with PHpaII and 64.9% when compared withPP43. The strain harboring pSG-PHpaII-PP43 exhibited the

Fig. 1 Schematic representation of the expression cassettes. a Map of the pSG(x)-NK vectors. All of the expression cassettes were cloned into thepMA0911-wapA-pro-NK, and the sites of the relevant restriction enzymes were shown. b The schematic diagram of the expression cassettes withtandem promoters. The signal peptide (SP) and the NK gene are represented by gray and black, respectively. The promoters, PX, are representedby arrows. c The expression cassettes with repetitive core regions of promoters. The sequences of core regions (− 35 and − 10) are shown

Liu et al. BMC Microbiology (2019) 19:89 Page 3 of 14

Table 1 Strains and plasmids used in this study

Strains or plasmids Description Source Highest yield of NK (U/mL)

Strains

Escherichia coliJM109

RecA1 pupE44 endA1 hsdR17 gyrA96 relA1 thiΔ(lac-proAB) F′[traD36 proAB+lacIq

lacZΔM15]Lab stock –

Bacillus subtilisWB800

nprE aprE epr bpr mpr::ble nprB::bsr Δvpr wprA::hyg Lab stock –

Plasmids

pMA0911-pro-NK shuttle vector for E. coli/B. subtilis, PHpaII, SPwapA, pro-NK, Apr, Kmr, Lab stock 110.8 ± 5.2

pSG-pro-NK pMA0911-pro-NK without promoter PHpaII Thisstudy

–

pSG-PBcaprE pSG-pro-NK with promoter PBcaprE Thisstudy

103.5 ± 4.2

pSG-PluxS pSG-pro-NK with promoter PluxS Thisstudy

99.2 ± 3.8

pSG-PgsiB pSG-pro-NK with promoter PgsiB Thisstudy

44.6 ± 2.9

pSG-PyxiE pSG-pro-NK with promoter PyxiE Thisstudy

20.2 ± 2.0

pSG-PP43 pSG-pro-NK with promoter PP43 Thisstudy

140.5 ± 2.5

pSG-2PgsiB pSG-pro-NK with promoter PgsiB-PgsiB Thisstudy

48.0 ± 2.2

pSG-2PBcaprE pSG-pro-NK with promoter PBcaprE-PBcaprE Thisstudy

120.3 ± 2.4

pSG-2PHpaII pSG-pro-NK with promoter PHpaII-PHpaII Thisstudy

199.4 ± 7.1

pSG-2PP43 pSG-pro-NK with promoter PP43-PP43 Thisstudy

157.2 ± 4.0

pSG-PP43-PHpaII pSG-pro-NK with promoter PP43-PHpaII Thisstudy

231.7 ± 6.0

pSG-PHpaII-PP43 pSG-pro-NK with promoter PHpaII-PP43 Thisstudy

210.6 ± 5.2

pSG-PBcaprE-PHpaII pSG-pro-NK with promoter PBcaprE-PHpaII Thisstudy

175.5 ± 5.0

pSG-PHpaII-PBcaprE pSG-pro-NK with promoter PHpaII-PBcaprE Thisstudy

0

pSG-PyxiE-PHpaII pSG-pro-NK with promoter PyxiE-PHpaII Thisstudy

0

pSG-PHpaII-PyxiE pSG-pro-NK with promoter PHpaII-PyxiE Thisstudy

166.7 ± 2.5

pSG-PgsiB-PHpaII pSG-pro-NK with promoter PgsiB-PHpaII Thisstudy

164.9 ± 3.0

pSG-PHpaII-PgsiB pSG-pro-NK with promoter PHpaII-PgsiB Thisstudy

0

pSG-PluxS-PHpaII pSG-pro-NK with promoter PluxS-PHpaII Thisstudy

77.5 ± 4.0

pSG-PHpaII-PluxS pSG-pro-NK with promoter PHpaII-PluxS Thisstudy

0

pSG-3PHpaII pSG-pro-NK with promoter PHpaII-PHpaII-PHpaII Thisstudy

213.3 ± 4.1

pSG-3PP43 pSG-pro-NK with promoter PP43-PP43-PP43 Thisstudy

219.2 ± 7.7

pSG-2PHpaII-PP43 pSG-pro-NK with promoter PHpaII-PHpaII-PP43 This 264.2 ± 7.0

Liu et al. BMC Microbiology (2019) 19:89 Page 4 of 14

second highest expression of 210.6 ± 5.2 FU/ml. The re-sult of the SDS-PAGE analysis (Fig. 3b) was supportedby the above results of the fibrinolytic activity. Theseresults showed that NK expression levels under the con-trol of these double promoters were clearly differentfrom each other.

Effects of different triple-promoters on the nattokinaseexpressionAnalysis of NK production showed that promoters PHpaIIand PP43 could efficiently promote the expression of NK.To further improve NK production, the expressionprofiles of eight recombinant strains with three tandempromoters were determined by enzymatic activities andSDS-PAGE (Fig. 4). As shown in Fig. 4a, the NK expres-sion mediated by pSG-PHpaII-PHpaII-PP43 reached thehighest activity, 264.2 ± 7.0 FU/ml, which was 14%higher than that under the control of the dual-promoterPP43-PHpaII. The triple-promoters PHpaII-PP43-PHpaII (206.3± 7.0 FU/ml) and PP43-PHpaII-PP43 (182.3 ± 5.6 FU/ml)showed similar promoter strengths, and the production

that was promoted by both improved considerably com-pared with the production of PHpaII and PP43. In contrast,PP43-PHpaII-PHpaII (47.5 ± 3.1 FU/ml) did not exhibit anefficient expression of NK, and PHpaII-PP43-PP43 (0 FU/ml)exhibited no expression of NK. These results indicatedthat the arrangement of the promoters in tandem hasintrinsic effects on the expression level of the targetprotein.The NK production of the strain harboring pSG-

PHpaII-PHpaII-PHpaII (213.3 ± 5.1 FU/ml) was increased by92.2% compared with that under the control of pSG-PHpaII,and by 7% compared with that under the control ofpSG-PHpaII-PHpaII. Furthermore, pSG-PP43-PP43-PP43 (219.2± 7.7 FU/ml) enhanced the NK production by 55.9% com-pared with pSG-PP43, and 39.4% compared with pSG-PP43-PP43. The above results of the fibrinolytic activityassays were consistent with those of SDS-PAGE analysis(Fig. 4b).As the number of promoters increased, the level of

NK expression was enhanced up to the triple-promoter.Therefore, we constructed quad-promoter systems, PP43-

Table 1 Strains and plasmids used in this study (Continued)

Strains or plasmids Description Source Highest yield of NK (U/mL)

study

pSG-PP43-2PHpaIII pSG-pro-NK with promoter PP43-PHpaII-PHpaII Thisstudy

47.5 ± 3.1

pSG-PHpaII-2PP43 pSG-pro-NK with promoter PHpaII-PP43-PP43 Thisstudy

199.4 ± 7.1

pSG-2PP43-PHpaII pSG-pro-NK with promoter PP43-PP43-PHpaII Thisstudy

149.4 ± 5.0

pSG-PHpaII-PP43-PHpaII pSG-pro-NK with promoter PHpaII-PP43-PHpaII Thisstudy

206.3 ± 7.0

pSG-PP43-PHpaII-PP43 pSG-pro-NK with promoter PP43-PHpaII-PP43 Thisstudy

182.3 ± 5.6

pSG-4PHpaII pSG-pro-NK with promoter PHpaII-PHpaII-PHpaII-PHpaII Thisstudy

200.0 ± 2.6

pSG-4PP43 pSG-pro-NK with promoter PP43-PP43-PP43-PP43 Thisstudy

222.9 ± 4.8

pSG- 2CPBcaprE pSG-pro-NK with promoter CPBcaprE-PBcaprE Thisstudy

120.3 ± 2.4

pSG-2CPHpaII pSG-pro-NK with promoter CPHpaII-PHpaII Thisstudy

200.8 ± 4.6

pSG-3CPHpaII pSG-pro-NK with promoter CPHpaII-CPHpaII-PHpaII Thisstudy

138.3 ± 3.8

pSG-2CPP43 pSG-pro-NK with promoter CPP43-PP43 Thisstudy

166.7 ± 5.3

pSG-3CPP43 pSG-pro-NK with promoter CPP43-CPP43-PP43 Thisstudy

181.7 ± 6.3

pSG-4CPP43 pSG-pro-NK with promoter CPP43-CPP43-CPP43-PP43 Thisstudy

231.7 ± 8.0

pSG-5CPP43 pSG-pro-NK with promoter CPP43-CPP43-CPP43-CPP43-PP43 Thisstudy

254.2 ± 5.1

Note: The corresponding highest yield of NK for each construct was detected using the 36-h supernatant

Liu et al. BMC Microbiology (2019) 19:89 Page 5 of 14

PP43-PP43-PP43 and PHpaII-PHpaII-PHpaII-PHpaII, to testwhether the enhancement of NK expression would con-tinue by increasing repetitive promoters. The results inTable 2 showed that the NK activity in the super-natant induced by PHpaII-PHpaII-PHpaII-PHpaII decreasedslightly. Moreover, the NK production mediated byPP43-PP43-PP43-PP43 was almost as same as that medi-ated by PP43-PP43-PP43. These results documented thatthe expression level of the target protein will notincrease unconditionally with the increase in thenumber of promoters PP43 or PHpaII.

Nattokinase expression mediated by core region of PHpaIIand PP43 in tandem repeatsThese two promoters, PP43 and PHpaII, had strong abil-ities to overexpress the recombinant NK in B. subtilisWB800. Considering that the length of the promoter af-fects its expression activity, plasmids harboring the coreregion of PP43 or PHpaII in tandem repeats (pSG-nCPX)were constructed, as shown in Fig. 1c. The NK expres-sion activity of plasmids pSG-nCPX was determined bythe fibrinolytic activity and SDS-PAGE analysis (Fig. 5).As shown in Fig. 5a, the NK production of the strain

harboring pSG-2CPHpaII (200.8.2 ± 4.6 FU/ml) was in-creased by 81.2% compared with pSG-PHpaII. However,the NK production promoted by 3CPHpaII (138.3 ± 3.8FU/ml) decreased by 31.1% compared with that pro-moted by 2CPHpaII. It could be seen that the NK expres-sion that was mediated by pSG-5CPP43 (254.2 ± 5.1 FU/ml) was 80.9% higher than that mediated by pSG-PP43.

The expression level of NK increased with the increasein the number of core regions of PP43 up to five. TheSDS-PAGE analysis showed that the NK expressivequantity in the supernatant produced by pSG-nCPHpaII(Fig. 5b) and pSG-nCPP43 (Fig. 5c) was consistent withthe results of the NK activity assay. These results sug-gested that the core regions of PP43 and PHpaII couldproduce and enhance the expression level of NKefficiently.

Scale-up expression of nattokinase in a 5-L fermenterusing the strain harboring pSG-PHpaII-PHpaII-PP43Our results indicated that the highest overexpression levelof NK was produced by the triple-promoter PHpaII-PH-paII-PP43. Based on the results of the optimization of thecultivation conditions in shaking flask experiments (datanot shown), the scale-up of recombinant NK productionwas completed in a 5-L fermenter using the strain harbor-ing pSG-PHpaII-PHpaII-PP43. The process for the cultivationin the fermenter is shown in Fig. 6. The cell densityreached the highest OD600 value of 33.0 ± 0.4 at 20 h.Similar to the cell growth, NK production was signifi-cantly increased and reached the highest value of 816.7 ±30.0 FU/ml at 20 h, which was the highest value everreported. NK production was about two-fold higher in the5-L fermenter compared to that of the shaking flaskexperiments. These results indicated that the strain har-boring pSG-PHpaII-PHpaII-PP43 had great potential for theindustrial production of NK.

Fig. 2 Effects of different single promoters on the overexpression of NK. (a) Fibrinolytic activities of NK in the supernatant. The recombinantstrains having different single promotes were cultured in TB medium for 72 h with periodical sampling. b SDS-PAGE analysis. Recombinant strainshaving different single promoters were cultured in the TB medium for 36 h, and then the cells and the supernatant culture were separated bycentrifugation. Supernatant (15 μL) was loaded into each lane. Lane M: standard marker proteins; Lane 1–6: PHpaII; PP43; PBcaprE; PluxS; PgsiB and PyxiE.The arrow indicates that the NK bands correspond to 36-h supernatant. c Fibrin plate analysis. Transparent zones produced by the enzymeactivity of NK and its variants in the supernatant, which was induced for 36 h, were examined by the fibrin plate method, which was conductedat 37 °C for 4 h. 1–6: PHpaII; PP43; PBcaprE; PluxS; PgsiB and PyxiE

Liu et al. BMC Microbiology (2019) 19:89 Page 6 of 14

Fig. 3 Overproduction of NK under the control of the dual-promoter systems. a Fibrinolytic activities of NK in the supernatant. b SDS-PAGEanalysis. Lane M: standard marker proteins. The position of the NK protein bands is indicated by an arrow. Recombinant strains having differentdual-promotes were cultured in the TB medium for 36 h, and then the cells and the supernatant culture were separated by centrifugation

Fig. 4 Analysis of the NK production mediated by different triple-promoter systems. a Fibrinolytic activities of NK in the supernatant. b SDS-PAGEanalysis of the culture supernatant. Recombinant strains promoted by different triple-promoters were cultured in the TB medium for 36 h, andthen cells and the supernatant culture were separated by centrifugation. Lane 1–8: PP43-PP43-PHpaII, PP43-PHpaII-PHpaII, PHpaII-PP43-PP43, PP43-PHpaII-PP43,PP43-PP43-PP43, PHpaII-PHpaII-PP43, PHpaII-PP43-PHpaII, and PHpaII-PHpaII-PHpaII; Lane M: standard marker proteins. The arrow indicates NK bands

Liu et al. BMC Microbiology (2019) 19:89 Page 7 of 14

DiscussionSix promoters having high expression strength were se-lected to overexpress the NK enzyme in B. subtilis WB800,and the overexpression of NK mediated by those singlepromoter systems exhibited significantly different levels. Inour study, the highest expression level of NK driven by asingle promoter was 140.5 ± 3.9 FU/ml as induced by PP43.

The order of the strength of the six single promoters medi-ating NK expression in B. subtilis was PP43 > PHpaII >PBcaprE > PluxS > PgsiB > PyxiE. However, Guan et al. reportedthat the activity of the single promoter PP43 was lower thanthat of PluxS and PyxiE for aminopeptidase expression in B.subtilis [31]. In addition, Zhang et al. reported that PyxiEexhibited higher expression strengths than PP43, both in B.

Fig. 5 Effects of the multi core regions of PHpaII and PP43 in tandem on NK production. a The fibrinolytic activities of NK in the supernatant.Recombinant strains harboring promoters of repetitive core regions were cultured in TB medium for 36 h, and then cells and the supernatantculture were separated by centrifugation. The SDS-PAGE analysis of the NK expression mediated by the repetitive core regions of PHpaII (b) andPP43 (c). The arrow indicates the NK bands corresponding to the 36-h supernatant, and 15 μL supernatant was loaded into each lane

Table 2 Nattokinase yield under the control of tandem repeats containing whole sequence or core region of PHpaII and PP43Single Whole promoter region

in tandemCore promoter regionin tandem

Promoter Activity (FU/mL) Promoter Activity (FU/mL) Promoter Activity (FU/mL)

PHpaII 110.8 ± 5.2 2PHpaII 199.4 ± 7.1 2CPHpaII 200.8 ± 4.6

3PHpaII 213.3 ± 4.1 3CPHpaII 138.3 ± 3.8

4PHpaII 200.0 ± 2.6

PP43 140.5 ± 2.5 2PP43 157.2 ± 4.0 2CPP43 166.7 ± 5.3

3PP43 219.2 ± 7.7 3CPP43 181.7 ± 6.3

4PP43 222.9 ± 4.8 4CPP43 231.7 ± 8.0

5CPP43 254.2 ± 5.1

Liu et al. BMC Microbiology (2019) 19:89 Page 8 of 14

subtilis and E. coli [23]. The expression level of the targetgene is naturally determined by the promoter, signalpeptide and host, and many studies have suggested thatthe effect of the promoter strength on the heterologousexpression varies. Our results are consistent with theeffect of a promoter varying with the change in the targetgene [34]. The growth curves of strains containing a singlepromoter were approximately same (Additional file 1: Fig-ure S1), and this result confirmed that the expression cas-settes with different promoters, not the cell amount,caused the different expression levels of NK.The NK expression level driven by a dual-promoter

PP43-PP43 reached 157.2 ± 3.0 FU/ml, which was 10%higher than that induced by the single promoter PP43.Similar results were observed between the dual-promoterPBcaprE-PBcaprE and the single promoter PBcaprE and thedual-promoter PgsiB-PgsiB and the single promoter PgsiB.However, the strength of the dual-promoter containingtwo PHpaII was 1.8-fold higher than that of the single pro-moter. The two promoters PP43 and PHpaII exhibitedhigher promoter activity for NK expression than that ofthe other promoters. We further carried out the experi-ments of arranging PHpaII and PP43 by combining three orfour promoters in tandem. As shown in Table 2, ourresults indicated that the NK expression level was notassociated with the numbers of tandem repeats of the pro-moters. The NK production under the control of PP43-PP43 was increased by 11.9% compared with that pro-moted by PP43, and the NK production mediated byPP43-PP43-PP43 increased by 39.4% compared with thatpromoted by PP43-PP43. However, the NK expression levelincreased by only 1.7% when promoted by PP43-PP43

-PP43-PP43. Furthermore, NK production decreased underthe control of four PHpaII in tandem compared with theexpression controlled by three tandem promoters. The re-sults were in agreement with studies that suggested thatthe length of the promoter affects its expression activity[35]. Although the cooperation mechanism of the tandempromoters was not clear, the increased production of NKsuggested that this strategy of gene expression based ontandem promoter is an effective way to improve promoteractivity.The core region of a promoter plays an important role

in regulating transcription initiation and is the minimalportion of a promoter that is required to properly initi-ate transcription [36]. To understand the effect of thelength of repetitive whole-sequence promoters contain-ing PP43 or PHpaII in tandem on the expression level ofNK, a series of promoters with core-region repeats(nCPP43 and nCPHpaII) were constructed. The wholesequence of PHpaII is 284 bps; however, the core-regionsequence of PHpaII is only 31 bps. The NK productionmediated by 2PHpaII and 2CPHpaII almost reached thesame level, which suggested that the core region ofPHpaII could efficiently initiate the NK overexpression.However, it was unexpected that the strength of 3CPHpaIIfor NK expression was 35.2% lower than that of 3PHpaII.Further studies will be needed to explore the differencebetween the whole sequence and the core regions of PHpaIIfor the level of gene expression. In addition, the whole se-quence of PP43 is 300 bps, and the core region of PP43 is29 bps. The NK expression mediated by the whole se-quence of PP43 in tandem increased to that mediated by4PP43. The NK production that was initiated by core

Fig. 6 Analysis of fermentation of NK in the recombinant strain harboring pSG-PHpaII-PHpaII-PP43. The fermentation was carried out in a 5-Lfermenter, and the cell growth and NK activity were measured by taking a sample every 2 h

Liu et al. BMC Microbiology (2019) 19:89 Page 9 of 14

promoters of PP43 in tandem gradually increased as thenumber of core regions increased. It was found thatboth strong promoters, PP43 and PHpaII, have distinctcharacterization and differential expressions of NK.The analysis of the expression level of NK induced bymore core regions of PP43 in tandem will be carriedout.Obviously different effects on NK production are

caused by different arrangements in the dual-promotersystem. The promoter is recognized by the σ factor ofRNA polymerase to initiate gene transcription. Several σfactors have been defined in B. subtilis. It has been re-ported that σA- and σB-promoters can function coopera-tively. The promoter synergism resulting from thedouble promoters was found only when the σB-promoterwas located upstream of the σA-promoter, and the ex-pression level of reporter gene was severely reduced byswitching the locations of the σA- and σB-promoters[37]. Since PgsiB is σB-dependent (Additional file 1: TableS1), NK production promoted by PgsiB-PHpaII (164.9 ± 3.0FU/ml) compared with that by PHpaII (110.8 ± 3.6 FU/ml) and that by PHpaII-PgsiB (0 FU/ml), suggested thatPHpaII might be a σB-dependent promoter. Similarphenomena were observed in the results of NK expres-sion mediated by PBcaprE-PHpaII (175.5 ± 5.0 FU/ml) andPHpaII-PBcaprE (0 FU/ml), by PluxS-PHpaII (77.5 ± 4.0 FU/ml) and PHpaII-PluxS (0 FU/ml), predicting that PluxS andPBcaprE are σB-dependent promoters. Whereas PyxiE isσA-dependent (Additional file 1: Table S1), results of NKproduction promoted by PHpaII-PyxiE (166.7 ± 2.5 FU/ml),compared with that by PyxiE-PHpaII (0 FU/ml) and thatby PyxiE (20.2 ± 2.0 FU/ml), suggested that PHpaII mightalso be recognized by σA RNA polymerase. Therefore,promoters PHpaII and PP43 might be recognized by bothσA and σB RNA polymerases. Our results showed thatthe NK expression that was promoted by the dual-pro-moter system makes a large difference, which could bedue to the synergistic effect of the double promoters.Studies have shown that triple-promoters could mark-

edly increase the expression level of heterogeneousgenes [29, 38]. We operated by combining both strongpromoters in the form of three promoters in tandem.Eight strains harboring a triple-promoter system con-taining PHpaII and PP43 were generated, from which theNK production showed different levels. Among these 8strains, one strain harboring the plasmid pSG-PHpaII-PP43-PP43 lost the ability to express NK, and one strainharboring the plasmid pSG-PP43-PHpaII-PHpaII exhibitedlow activity of NK expression (47.5 ± 3.1 FU/ml). Theother six strains harboring the plasmid containing atriple-promoter exhibited relatively high production ofthe secreted NK, and the NK expression of four strainswere higher than 200 FU/ml. The growth curves ofstrains containing triple-promoters were approximately

the same (Additional file 1: Figure S2), and these resultsconfirmed that the expression cassettes, but not the cellnumbers, caused the different levels of NK productionwith different promoters. On account of the RNA poly-merase gene transcription mechanism under the pro-moter action being very complex, the problem of how toproduce this synergy has yet to be further studied. Inthis study, the highest NK production was mediated by atriple-promoter PHpaII-PHpaII-PP43 and achieved 264.2 ±7.0 FU/ml, which is much higher than that reported inprevious studies [39, 40]. This strain is a potential strainfor the industrial production of NK. In addition, the highyield of NK could promote its application in medicineand in supplementary nutrition. A series of plasmids forNK expression in B. subtilis were constructed in thisstudy, and they have great potential to be used for NKexpression or the expression of other genes in industrialapplications. The results of the various initial activitiesof multiple tandem promoters for NK expression alsoprovide additional information on the synergistic inter-action of promoters.

ConclusionsIn this study, we generated and characterized thesecretory expression of NK under the control of differ-ent promoters, including six single promoters and aseries of promoters with the whole sequence or core re-gions in tandem. The expression level of NK mediatedby one of these different promoters led to a remarkabledifference in B. subtilis WB800. Among the six singlepromoters, NK production mediated by PHpaII and PP43exhibited a higher level than the others. The arrange-ment of these promoters in tandem produced variouseffects on NK expression. We successively used thetriple-promoter PHpaII-PHpaII-PP43 to increase the pro-duction of NK to 264.2 ± 7.0 FU/ml in B. subtilisWB800, which was the highest expression level ever re-ported. Our study provided an efficient way to increaseNK production in Bacillus subtilis based on tandempromoters.

Materials and methodsPlasmids, strains and growth conditionsThe plasmid pMA0911-pro-NK, an E. coli/B. subtilisshuttle plasmid with the HpaII promoter and wapAsignal peptide, was used to clone and express NK. E.coli JM109 served as a host for cloning and plasmidpreparation. B. subtilis WB800 is deficient in eightextracellular proteases and was used as a host for theNK expression. Bacillus subtilis 168 (B. subtilis 168)containing the promoter (PP43) was stored in our la-boratory. Transformants were selected on LB agar(0.5% yeast extract, 1% tryptone, 1% NaCl and 2%agar), supplemented with 100 μg/mL ampicillin for E.

Liu et al. BMC Microbiology (2019) 19:89 Page 10 of 14

coli JM109 or 50 μg/mL kanamycin for B. subtilisWB800. E. coli JM109 was cultivated in LB mediumsupplemented with 100 μg/mL ampicillin. B. subtilisWB800 was incubated in TB medium (2.4% yeast ex-tract, 1.2% tryptone, 0.4% glycerol, 17 mM KH2PO4,

and 72 mM K2HPO4) additionally containing 0.02%CaCl2 and 50 μg/mL kanamycin. All of the strainswere cultivated at 37 °C under shaking conditions at200 rpm. Cell densities were measured using a UV-1800/PC spectrophotometer (MAPADA InstrumentCo., Ltd., Shanghai, China). Strains and plasmids usedin this study are summarized in Table 1.

Construction of recombinant plasmidsPrimers used in this study were synthesized by Shang-hai Sangon Biotech Co., Ltd. and are listed in Table 3.A deficiency of the promoter PHpaII from the plasmidpMA0911-pro-NK was carried out following megapri-mer PCR of the entire plasmid (MEGAWHOP) [41,42] using primers P0-F and P0-R. The PCR productwas digested by DpnI, and the resulting plasmid wastransformed into JM109 to yield plasmid pSG-pro-NKwithout a promoter (Table 1).The promoter P43 gene was cloned from the gen-

omic DNA of B. subtilis 168 with primers P1 and P2.The amplified product was cloned into pSG-pro-NKby the MEGAWHOP protocol, yielding plasmid pSG-PP43. The other single promoters (PBcaprE, PgsiB, PyxiE

and PluxS) were synthesized by Shanghai Sangon

Biotech Co., Ltd. and were employed to construct theplasmids pSG-PBcaprE, pSG-PgsiB, pSG-PyxiE and pSG-PluxS, respectively, using the same procedures as forpSG-PP43.The six single promoters were further employed to

construct 14 kinds of expression cassettes under thecontrol of two promoters in tandem. The plasmid pSG-PP43-PHpaII was constructed by two steps. The fragmentof P43 was amplified from pSG-PP43 using primers P1and P11, and then the PCR product was inserted upstreamof the promoter HpaII in pMA0911-pro-NK following theMEGAWHOP protocol, thereby yielding pSG-PP43-PHpaII.The same procedures were used to construct the otherdual-promoter plasmids.To construct the triple-promoter plasmid pSG-PHpaII-

PHpaII-PP43, the fragment of HpaII was amplified frompMA0911-pro-NK with primers P12 and P13 and thenwas inserted into the front of the promoter PHpaII-PP43in pSG-PHpaII-PP43 following the MEGAWHOP proto-col. The other triple-promoter plasmids and two quad-promoter plasmids (pSG-4PHpaII and pSG-4PP43) wereobtained after being treated in the same manner as forpSG-PHpaII-PHpaII-PP43.The plasmids pSG-nCPX harboring the multiple tan-

dem core promoter regions were synthesized by Shang-hai RuiDi Biological Technology Co., Ltd. All plasmidswere constructed and cloned in E. coli JM109 and weresequenced by Shanghai RuiDi Biological TechnologyCo., Ltd.

Table 3 Oligodeoxynucleotides used in this study

Primers Sequence (5′-3′) Description

P0-F GGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTGTCGACATGAAAAAAAGAAAGAGGCGAAAC Upstream for pMA0911-wapA-pro-NK construction

P0-R CCTTTTAAAGTTTCGCCTCTTTCTTTTTTTCATGTCGACACTCAAAAAATCTCCACCTTTAAACC Downstream for pMA0911-wapA-pro-NKconstruction

P1 GGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTTGATAGGTGGTATGTTTTCGCTTGAAC Upstream of PP43

P2 CCTTTTAAAGTTTCGCCTCTTTCTTTTTTTCATGTCGACGTGTACATTCCTCTCTTACCTATAATGG Downstream of PP43

P3 GGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTTGCCGAATTCCATGAACGAGACTTAAAACG Upstream of PBcaprE

P4 CCTTTTAAAGTTTCGCCTCTTTCTTTTTTTCATGTCGACTCGGTTCCCTCCTCATTTTTATACCAACTTG

Downstream of PBcaprE

P5 GGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTGATCGTCACAATGCGCCATCAAACCG Upstream of PluxS

P6 CCTTTTAAAGTTTCGCCTCTTTCTTTTTTTCATGTCGACGGATCCCACTTTATGGACGCCGCAGTGTCTG

Downstream of PluxS

P7 GGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTCTATCGAGACACGTTTGGCTGG Upstream of PgsiB

P8 CCTTTTAAAGTTTCGCCTCTTTCTTTTTTTCATGTCGACTTCCTCCTTTAATTGGTGTTGGTTGTTGTATTC

Downstream of PgsiB

P9 GGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTGATCATTTAATTGAAGCGCGCGAAGC Upstream of PyxiE

P10 CCTTTTAAAGTTTCGCCTCTTTCTTTTTTTCATGTCGACGCTCTTCCCGCCTTTCGGACTGTGGGTGG

Downstream of PyxiE

P11 GGGACAGGTAGTATTTTTTGAGAAGATCGTGTACATTCCTCTCTTACCTATAATGG Downstream for PP43-PHpaII

P12 GGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTGATCTTCTCAAAAAATACTACCTGTCCC Upstream of PHpaII

P13 GGGACAGGTAGTATTTTTTGAGAAGATCTAAATCGCTCCTTTTTAGGTGGCACAAATGTG Downstream or PHpaII-PHpaII-PP43

Note: Homology arms of targeting vectors for gene insertions were underlined

Liu et al. BMC Microbiology (2019) 19:89 Page 11 of 14

Overexpression of the recombinant nattokinase in B.subtilis WB800Plasmid transformation was carried out according to themethod as previously reported [43, 44]. A single colonywas inoculated into 10 ml LB medium (including 50 μg/ml kanamycin) and were grown overnight at 37 °C, 200rpm. The culture was transferred into 100 mLTBmedium as a final OD600 value of 0.2(v/v), and then wascultivated at 37 °C for 84 h under a shaking condition at200 rpm for the expression of NK. The supernatant wascollected for the following research by centrifugation(10,000 rpm, 5 min) at 4 °C.

Fed-batch cultivation in 5-L fermenterFed-batch cultivations were carried out in a 5-L bioreac-tor, and the initial medium was 2 L (2% glycerol, 2% soy-bean peptone, 0.1% NaH2PO4, 0.2% Na2HPO4, 0.02%CaCl2, and 0.05% MgSO4) containing 50 μg/ml kanamy-cin. The pre-inoculum culture was 50mLTB mediumincluding 50 μg/mL kanamycin, which was incubated at37 °C under a shaking condition at 200 rpm. After 12 h,the culture was inoculated into the 5-L fermenter. Theinoculation volume was 8%. The cultivated conditionwas maintained at 37 °C, and the dissolved oxygen (DO)was performed above 30% under the control of the inletair and the exponential feeding of glycerol and soybeanpeptone. During the cultivation process, the pH wascontrolled at 7.0 through the automatic addition of 50%ammonium solution. Samples were taken every 2 h.

Fibrin plate analysisA qualitative analysis of the fibrinolytic activity was car-ried out according to the fibrin plate method [45]. Inbrief, 10 ml agarose solution (1%) and 10 ml bovine fi-brinogen solution (1.8 mg/ml in 50 mM Tris-HCl buffer)were incubated separately at 60 °C, and 10 U thrombinwas added into the agarose solution and mixed. Theagarose solution and fibrinogen were mixed, and theplate was put at room temperature for 2 h to form fibrinclots. Holes were made in the fibrin plate, and 40 μl en-zyme was added in each hole. The fibrin plates wereplaced at 37 °C for 4 h to detect the fibrinolytic activity.

Fibrinolytic activity determinationThe fibrinolytic activity was determined using themethod described by the Japan Nattokinase Association(http://j-nattokinase.org/jnka_nk_english.html). In brief,1.4 mL Tris-HCl (0.05M, pH 8.0) and 0.4 mL fibrinogensolution (0.72%) were pre-incubated in a 37 °C waterbath for 5 min. Thereafter, 0.1 mL thrombin solutionwas added, followed by the addition of 0.1 mL dilutedsample after 10 min. The mixture was incubated at 37 °Cfor an hour. Finally, trichloroacetic acid solution (0.2M)was added and incubated at 37 °C for 20 min to stop the

reaction. The supernatant was transferred into a microt-est tube after centrifugation (12,000 rpm, 10min), andthe absorbance of the supernatant at 275 nm was readand recorded. One unit (1 FU) was defined as theamount of the enzyme that increased the absorbance ofthe filtrate at 275 nm by 0.01 per minute. The analysis offibrinolytic activity was independently carried out intriplicate, and the data are presented as the mean ± s.d.

SDS-PAGE analysisSamples were incubated at room temperature for 30 minwith 5 × SDS-PAGE loading buffer and protease inhibi-tor PMSF (phenylmethane sulphonyl fluoride). Then, thesamples were heated at 100 °C for 5 min and were ap-plied into 12% SDS-PAGE with 5% stacking gels. Finally,the gels were stained by Coomassie Blue R-250.

Additional file

Additional file 1: Table S1 Characterization of single promoters usedfor the NK production. Figure S1 The growth curves of recombinantstrains harboring different plasmids with a single promoter. Figure S2The growth curves of recombinant strains containing a triple-promoter.(DOCX 297 kb)

AbbreviationsLB: Luria-Bertani medium; NK: Nattokinase; PBcaprE: aprE promoter; PgsiB: gsiBpromoter; PHpaII: HpaII promoter; PluxS: luxS promoter; PP43: P43 promoter;PyxiE: yxiE promoter; SDS-PAGE: Sodium dodecyl sulfate-polyacrylamide gelelectrophoresis; SP: The wapA signal peptide; TB: Terrific Broth medium

AcknowledgementsNot applicable.

FundingThis study was funded by National Key R&D Program of China(2016YFE0127400), the Fundamental Research Funds for the CentralUniversities (JUSRP51713B), the national first-class discipline program of LightIndustry Technology and Engineering (LITE2018–04), the Priority AcademicProgram Development of Jiangsu Higher Education Institutions, the 111 Pro-ject (No. 111–2-06) and National natural science foundation of China(3140078).

Availability of data and materialsThe authors confirm that all data underlying the findings are fully availablewithout restriction. All relevant data are within the paper and itssupplementary information.

Authors’ contributionsZL conceived the idea, designed this study, analyzed the data, and was amajor contributor in writing the manuscript. WZ participated in revising themanuscript. CG performed the experiments, including construction ofplasmids and expression cassettes, overexpression and fermentation,analyzed the data. WC participated in the experiments of constructingexpression systems. LZ participated in the fermentation experiment ofnattokinase. ZZ conceived of the study, participated in its design, andcoordination. All authors have read and approved the final manuscript.

Ethics approval and consent to participateNot applicable.

Consent for publicationNot applicable.

Liu et al. BMC Microbiology (2019) 19:89 Page 12 of 14

Competing interestsThe authors declare that they have no competing interests.

Publisher’s NoteSpringer Nature remains neutral with regard to jurisdictional claims inpublished maps and institutional affiliations.

Received: 13 August 2018 Accepted: 18 April 2019

References1. Sumi H, Hamada H, Tsushima H, Mihara H, Muraki H. A novel fibrinolytic

enzyme (nattokinase) in the vegetable cheese Natto; a typical and popularsoybean food in the Japanese diet. Experientia. 1987;43(10):1110–1.

2. Fujita M, Nomura K, Hong K, Ito Y, Asada A, Nishimuro S. Purification andcharacterization of a strong fibrinolytic enzyme (Nattokinase) in thevegetable cheese Natto, a popular soybean fermented food in Japan.Biochem Bioph Res Commun. 1993;197(3):1340–7.

3. Urano T, Ihara H, Umemura K, Suzuki Y, Oike M, Akita S, Tsukamoto Y, SuzukiI, Takada A. The profibrinolytic enzyme subtilisin NAT purified from Bacillussubtilis cleaves and inactivates plasminogen activator inhibitor type 1. J BiolChem. 2001;276(27):24690–6.

4. Fujita M, Hong KS, Ito Y, Fujii R, Kariya K, Nishimuro S. Thrombolytic effect ofNattokinase on a chemically-induced thrombosis model in rat. Biol PharmBull. 1995;18(10):1387–91.

5. Sumi H, Hamada H, Nakanishi K, Hiratani H. Enhancement of the fibrinolyticactivity in plasma by oral administration of nattokinase. Acta Haematol.1990;84(3):139–43.

6. Nakamura T, Yamagata Y, Ichishima E. Nucleotide sequence of the SubtilisinNAT gene, aprN, of Bacillus subtilis (natto). Biosci Biotechnol Biochem. 1992;56(11):1869–71.

7. Yanagisawa Y, Chatake T, Chiba-Kamoshida K, Naito S, Ohsugi T, Sumi H,Yasuda I, Morimoto Y. Purification,crystallization and preliminary X-raydiffraction experiment of nattokinase from Bacillus subtilis natto. ActaCrystallogr F Struct Biol Commun. 2010;66(12):1670–3.

8. Cai Y, Bao W, Jiang S, Weng M, Jia Y, Yin Y, Zheng Z, Zou G. Directedevolution improves the fibrinolytic activity of nattokinase from Bacillusnatto. FEMS Microbiol Lett. 2011;325(2):155–61.

9. Unrean P, Nguyen N. Metabolic pathway analysis and kinetic studies forproduction of nattokinase in Bacillus subtilis. Bioprocess Biosyst Eng.2013;36:45–56.

10. Zheng ZL, Ye MQ, Zuo ZY, Liu ZG, Tai KC, Zou GL. Probing the importanceof hydrogen bonds in the active site of the subtilisin nattokinase by site-directed mutagenesis and molecular dynamics simulation. Biochem J. 2006;395(3):509–15.

11. Dabbagh F, Negahdaripour M, Berenjian A, Behfar A, Mohammadi F, ZamaniM, Irajie C, Ghasemi Y. Nattokinase: production and application. ApplMicrobiol Biotechnol. 2014;98(22):9199–206.

12. Nagarajan V. System for secretion of heterologous proteins in Bacillussubtilis. Methods Enzymol. 1990;185:214–23.

13. Wright AV, Leuschner RGK, Robinson TP, Hugas M, Cocconcelli PS, Richard-Forget F, Klein G, Licht TR, Nguyen-The C, Querol A, Richardson M, et al.Qualified presumption of safety (QPS): a generic risk assessment approachfor biological agents notified to the European food safety authority (EFSA).Trends Food Sci Tech. 2010;21(9):425–35.

14. Pohl S, Harwood CR. Heterologous protein secretion by Bacillus species:from the cradle to the grave. Adv Appl Microbiol. 2010;73:1–25.

15. Zweers JC, Barak I, Becher D, Driessen AJM, Hecker M, Kontinen VP, Saller MJ,Vavrova L, Dijl JM. Towards the development of Bacillus subtilis as a cell factoryfor membrane proteins and protein complexes. Microb Cell Factories. 2008;7:10.

16. Xiao L, Zhang RH, Peng Y, Zhang YZ. Highly efficient gene expressionof a fibrinolytic enzyme (subtilisin DFE) in Bacillus subtilis mediated bythe promoter of alpha-amylase gene from Bacillus amyloliquefaciens.Biotechnol Lett. 2004;26(17):1365–9.

17. Wu XC, Lee W, Tran L, Wong SL. Engineering a Bacillus subtilis expression-secretion system with a strain deficient in six extracellular proteases. JBacteriol. 1991;173(16):4952–8.

18. Phuong ND, Jeong YS, Selvaraj T, Kim SK, Kim YH, Jung KH, Kim J, Yun HD,Wong SL, Lee JK, Kin H. Production of XynX, a large multimodular protein ofClostridium thermocellum, by protease-deficient Bacillus subtilis strains. ApplBiochem Biotechnol. 2012;168(2):375–82.

19. Ye RQ, Kim JH, Kim BG, Szarka S, Sihota E, Wong SL. High-level secretoryproduction of intact, biologically active staphylokinase from Bacillus subtilis.Biotechnol Bioeng. 1999;62(1):87–96.

20. Durban MA, Silbersack J, Schweder T, Schauer F, Bornscheuer UT. High levelexpression of a recombinant phospholipase C from Bacillus cereus in Bacillussubtilis. Appl Microbiol Biotechnol. 2007;74(3):634–9.

21. Nguyen TT, Quyen TD, Le HT. Cloning and enhancing production of adetergent- and organic-solvent-resistant nattokinase from Bacillus subtilis VTCC-DVN-12-01 by using an eight-protease-gene-deficient Bacillus subtilis WB800.Microb Cell Factories. 2013;12:79.

22. Wu SM, Feng C, Zhong J, Huan LD. Enhanced production of recombinantnattokinase in Bacillus subtilis by promoter optimization. World J MicrobBiotechnol. 2010;27(1):99–106.

23. Zhang AL, Liu H, Yang MM, Gong YS, Chen H. Assay and characterization ofa strong promoter element from B. subtilis. Biochem Biophys Res Commun.2007;354(1):90–5.

24. Li W, Li HX, Ji SY, Li S, Gong YS, Yang MM, Chen YL. Characterization of twotemperature-inducible promoters newly isolated from B. subtilis. BiochemBiophys Res Commun. 2007;358(4):1148–53.

25. Yang M, Zhang W, Ji S, Cao P, Chen Y, Zhao X. Generation of an artificialdouble promoter for protein expression in Bacillus subtilis through apromoter trap system. PLoS One. 2013;8(2):e56321.

26. Han L, Suo F, Jiang C, Gua J, Li N, Zhang N, Cui W, Zhou Z. Fabrication andcharacterization of a robust and strong bacterial promoter from a semi-rationally engineered promoter library in Bacillus subtilis. Process Biochem.2017;61:56–62.

27. Cheng J, Guan C, Cui W, Zhou L, Liu Z, Li W, Zhou Z. Enhancement of ahigh efficient autoinducible expression system in Bacillus subtilis bypromoter engineering. Protein Expres Purif. 2016;127:81–7.

28. Guan C, Cui W, Cheng J, Zhou L, Liu Z, Zhou Z. Development of an efficientautoinducible expression system by promoter engineering in Bacillussubtilis. Microb Cell Factories. 2016;15:66.

29. Widner B, Thomas M, Sternberg D, Lammon D, Behr R, Sloma A.Development of marker-free strains of Bacillus subtilis capable ofsecreting high levels of industrial enzymes. J Ind Microbiol Biot. 2000;25(4):204–12.

30. Kang HK, Jang JH, Shim JH, Park JT, Kim YW, Park KH. Efficient constitutiveexpression of thermostable 4-a-glucanotransferase in Bacillus subtilis usingdual promoters. World J Microbiol Biotechnol. 2010;26:1915–8.

31. Guan C, Cui W, Cheng J, Liu R, Liu Z, Zhou L, Zhou Z. Construction of ahighly active secretory expression system via an engineered dual promoterand a highly efficient signal peptide in Bacillus subtilis. New Biotechnol.2016;33:372–9.

32. Zhang K, Su L, Duan X, Liu L, Wu J. Highlevel extracellular proteinproduction in Bacillus subtilis using an optimized dualpromoter expressionsystem. Microb Cell Factories. 2017;16:32.

33. Okegawa Y, Motohashi K. Expression of spinach ferredoxin-thioredoxinreductase using tandem T7 promoters and application of the purifiedprotein for in vitro light-dependent thioredoxin-reduction system. ProteinExpres Purif. 2016;121:46–51.

34. Blazeck J, Alper HS. Promoter engineering: recent advances in controllingtranscription at the most fundamental level. Biotechnol J. 2013;8:46–58.

35. Yue X, Cui X, Zhang Z, Hu W, Li Z, Zhang Y, Li Y. Effects of transcriptionalmode on promoter substitution and tandem engineering for theproduction of epothilones in Myxococcus xanthus. Appl MicrobiolBiotechnol. 2018;102:5599–610.

36. Li M, Wang J, Geng Y, Li Y, Wang Q, Liang Q, Qi Q. A strategy of geneoverexpression based on tandem repetitive promoters in Escherichia coli.Microb Cell Factories. 2012;11:19.

37. Phanaksri T, Luxananil P, Panyim S, Tirasophon W. Synergism ofregulatory elements in sigma(B)- and sigma(a)-dependent promotersenhances recombinant protein expression in Bacillus subtilis. J BiosciBioeng. 2015;120(4):470–5.

38. Wei WZ, Xiang H, Tan HR. Two tandem promoters to increase geneexpression in Lactococcus lactis. Biotechnol Lett. 2002;24(20):1669–72.

39. Suwanmanon K, Hsieh PC. Isolating Bacillus subtilis and optimizing itsfermentative medium for GABA and nattokinase production. Cyta-J Food.2014;12(3):282–90.

40. Wei X, Zhou Y, Chen J, Cai D, Wang D, Qi G, Chen S. Efficient expression ofnattokinase in Bacillus licheniformis: host strain construction and signalpeptide optimization. J Ind Microbiol Biotechnol. 2015;42(2):287–95.

Liu et al. BMC Microbiology (2019) 19:89 Page 13 of 14

41. Miyazaki K, Takenouchi M. Creating random mutagenesis libraries usingmegaprimer PCR of whole plasmid. BioTechniques. 2002;33(5):1033–41036–1038.

42. Miyazaki K. MEGAWHOP cloning: a method of creating randommutagenesis libraries via megaprimer PCR of whole plasmids. MethodsEnzymol. 2011;498:399–406.

43. Anagnostopoulos C, Spizizen J. Requirements for transformation in BacillusSubtilis. J Bacteriol. 1961;81(5):741–6.

44. Bott KF, Wilson GA. Development of competence in the Bacillus subtilistransformation system. J Bacteriol. 1967;94(3):562–70.

45. Weng M, Zheng Z, Bao W, Cai Y, Yin Y, Zou G. Enhancement of oxidativestability of the subtilisin nattokinase by site-directed mutagenesis expressedin Escherichia coli. Biochim Biophys Acta. 2009;1794(11):1566–72.

Liu et al. BMC Microbiology (2019) 19:89 Page 14 of 14