Upload
damian-patrick
View
217
Download
0
Tags:
Embed Size (px)
Citation preview
GENETICS
Pedigrees, Mutations and Karyotypes
Pedigree
Chart that shows how a trait and the genes that control it are inherited within a family
Female
Affected Person
Male
Carrier
Marriage
Connects Children & Parents
Twins
Homozygous Recessive Disorders
Must have two recessive genes to have the disorder
Examples:Tay-Sachs: the body can’t break down a certain lipid so it builds up in the brain; it is a fatal disorder
Cystic Fibrosis: excess mucus accumulates in the digestive tract and lungs
Dominant Allele Disorders
Rare because the offspring usually dies before sexual maturity is reached
If you have at least one dominant gene, you have the disorder
Huntington’s disease: disorder in which the brain deteriorates; doesn’t show symptoms until an individual is in his late 30’s or early 40’s
Genetic Counseling
If a disorder is present in past family members, genetic counselors can give parents the probability of passing the genetic disorder to their children
Genetic counselors construct pedigrees and use tests (i.e. alpha-fetoprotein, PKU) to determine probabilities
Mutations
Changes in the DNA that can involve one or more genes; Mutations can be:
Harmful: cause diseases or deformities
Helpful: organism is better able to survive
Neutral: organism is unaffected
If a mutation occurs in a sperm or egg cell, that mutation is passed onto offspring
If a mutation occurs in a body cell, that mutation affects only the organism and is not passed onto offspring
Gene Mutations
Random changes in the sequence of nucleotides in DNA
It’s a mistake that’s made during replication or transcription
There are 4 types:Base Substitution
Base Deletion
Base Insertion
Jumping Gene
Base Substitution
One base is replaced by another base; this is also called a point mutation
ACGUCAGUA Threonine—Serine—Valine
ACGUUAGUA Threonine—Leucine—Valine
Depending on where the mutation occurs, it may have no affect on the protein
ACGUCAGUA Threonine—Serine—Valine
ACGUCGGUA Threonine—Serine—Valine
Wobble: Base pairing between codon and anticodon in which there is nonstandard pairing at the third position of the codon; allows more than one codon to pair with the same anticodon
Base Deletion
Deletion of a base that disrupts the codons; also called a frameshift mutation
ACGUCAGUA Threonine—Serine—Valine
ACGUAGUAC Threonine--STOP
Base Insertion
Insertion of a base that disrupts the codons; also called a frameshift mutation
ACGUCAGUAC Threonine—Serine—Valine
ACGUCGAGUAC Threonine—Serine– Serine
Jumping Genes
Occur when large stretches of DNA are inserted into the gene; this can disrupt the DNA sequence
ACGTCAGTAC
ACGTCTACTGACGTAAGTAC
Chromosomal Mutations
Involve the entire chromosomeDeletion: a chromosome breaks and a piece of the chromosome is lost
Chromosomal Mutations (cont.)
Duplication: part of a chromosome breaks off and is incorporated into its homologous chromosome; the homologous chromosome now has an extra copy of one of its parts
Chromosomal Mutations (cont.)
Translocation: a part of a chromosome breaks off and attaches to a different, non-homologous chromosome
Chromosomal Mutations (cont.)
Inversion:
a part of a chromosome breaks off, turns around, and reattaches in the reverse order
Genome & Karyotype
Genome: base sequence of all of the DNA in an organism
Karyotype: photograph of all of an organism’s chromosomes
Nondisjunction
Failure of the chromosomes to separate during cell division
If it occurs during mitosis, the individual cell is affected, but the organism is not usually harmed
If it occurs during meiosis, the entire organism is affected
Monosomy & Trisomy
Monosomy: the zygote has only one copy of a particular chromosome
Trisomy: the zygote has three copies of a particular chromosome
In humans, monosomy and trisomy are so disruptive in most chromosomes that it kills the embryo
In some chromosomes, however, the embryo survives, but it has developmental difficulties
Diseases Caused by Nondisjunction
Down’s SyndromeCaused by trisomy of chromosome 21Symptoms include mental retardation and a “moon” face
Trisomy 18Caused by trisomy of chromosome 18Symptoms include a webbed neck, severe mental retardation, and hernia (inguinal, umbilical, and diaphramatic)90% mortality by 1 year
Diseases Caused by Nondisjunction (cont.)
Klinefelter’s SyndromeCaused by trisomy of the sex chromosomes, XXYSymptoms include lack of facial and body hair, rounded body type, and infertility
Turner’s SyndromeCaused by monosomy of the sex chromosomes, XOSymptoms include no sexual development, learning disabilities, infertility, heart & kidney abnormalities
Diseases Caused by Nondisjunction (cont.)
Trisomy 13Caused by trisomy of chromosome 13
Symptoms include severe mental retardation and hernias (inguinal and umbilical)
72% mortality by 1 year
Polyploidy
Nondisjunction occurs in all chromosome pairs
Almost always lethal in animals
Usually has a positive effect in plants
Constructing a Pedigree
Construct a pedigree using the following information. Make sure to shade in the affected individuals and carriers. Number each generation with Roman numerals (I, II, III, etc.) and each individual in a generation with Arabic numerals (1, 2, 3, etc.) Write each individual’s genotype under their symbol.