~ C T E R I Z A T I O N OF THE PROMOTER FOR 'ITE HUMAN FACTOR I

(C3bl C4b INACTLVATOR) GENE.

Bamini Paramaswara

Thesis submitted in conformity with the requirements for the Degree of Master of Science,

Graduate Department of Cellular and Molecular Pathology, in the University of Toronto

8 Copyright by Bamini Paramaswara 1998

1

National Library 191 ofCanada BibSihque nationale du Canada

Acquisitions and Acquisitions et Bibliographie SeMces services bibliographiques

395 Wellington Sîreet 395, nie Wellington OttawaON K 1 A W Ottawa ON K1A 0134 Canada Cariada

The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, districbute or sell reproduire, prêter, distri'buer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/£ilm, de

reproduction sur papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantiai extracts from it Ni la thèse ni des extraits substantiels rnay be printed or othemise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.

Characterization of the promoter for the humin complement factor 1 (C3bl C4b inactivato r) gene.

Factor 1 is an 88 kDa serine protease which regulates the complernent system by

cleaving the C3b and C4b components of C3 and CS convertases. To map the upstream

regdatory regions and the basai promoter of the factor 1 gene, a series of 5' deletion

hgrnents were fused to a CAT reporter gene and tmmientiy expressed in HepG2 cells.

The regions -13 14 to -1 127 and -71 to -46 upstream of the transcription start site (+1)

possessed a silencer activity, while sequences fiom -869 to -3 1 9 positively regulated

factor 1 transcription. The basal promoter was localized to a 74 bp region (-46 to +26).

This region lacks a TATA box, but contains a TdT-like initiator (Inr) element that

overlies the major cap site (+1). CoIlStructs containing the uir (-12 to +9), Inr and

upstrearn region (-63 to +12), and the downstream TATA-like sequence (+26 to +160)

were inactive in CAT assays. Hence, factor I promoter appears to be a TATA-less Lnr-

dependent class II promoter which requires the sequences upstream and downstream for

expression. Oligonucleotides to the Inr, P2 (-12 to +9) and to the TATA-like sequence,

P3 (+89 to +130) interacted with HepG2 nuclear extract in a mobility shift assay to

generate specific complexes with similar mobilities. These complexes could be cross

competed by unlabeled P2 and P3. An oligonucleotide containing the TATA-like

sequence aione (P4) also inhibited the specific band fomed by P3. P2, P3 and P4 share a

common CTGGA sequence which may be responsible for generating the complex. The

functional role of this pentamer in constitutive expression of factor 1 needs to be

investigated.

As 1 move on to the next stage of my career, 1 would like to thank the people who

have contributed to the completion of this thesis. 1 am very grateful to Dr. Minta, my

supervisor, for giving me an oppominity to work in his lab, and for his patience, guidance

and support in completing this project. 1 would also like to thank the members of my

advisory committee, Dr. D.S.R Sarma, Dr. D. Isenrnan, Dr. J. Squire and Dr. B. Ngan for

their constructive criticisms, help and support. 1 am most indebted to Dr. P. Hamel and

his students for their technical and scientific advice.

A very special thanks to Aroon Yusuf for instilhg confidence, moral support and

most of dl, being there for me in t h e s of need. 1 wili always be grateful! Special thanks

to Soma Mondal, O'Neil Waggon, Rhea Hudson, Kathy Boras, Monty Gill, Aiko Sidle

and Subo Perampalam for seeing me tbrough those difficult moments and making this an

enjoyable expenence.

Last, but not least 1 would like to thank my family for their love, support and

encouragement. Everythmg that 1 am today, 1 owe to my Mom!

Abstract Acknowledgements Table of Contents List of Figures List of Abbreviations

OveMew of the complement system Historical perspectives The classical pathway The lectin pathway The alternative pathway The centrai role of C3 The formation of the MAC Control of the Complement System Control at the C 1 level Control at the MAC formation Pathway Control at the level of Convertases MRP of the Complement Activation Fluid phase regdators Biological significance of factor 1 Deficiency of Complement Factor 1 Transcriptional regulation of eukaryotic genes Transcription of complement genes Rationaie and Objectives

VI

vii

Preparation of pBh1474, pBh1287 and pBhl029CAT Ligation Transformation Miniprep of plasmid DNA Preparation of pBh479, pBh23 1 CAT Preparation of pBh132, pBh74CAT Preparation of pBh206CAT Preparation of pBh2 1 CAT Analysis of constructs by DNA sequencing Large scale preparation of plasmid DNA Transient transfections of HepG2 cells

CAT assay 50 p Galactosidase assay 51 Preparation of nuclear extract fiom HepG2 cells 52 Grneration of oligonucleotides for labeling 53 Labeiing of oligonucleotides 53 Electrophoretic Mobility Shift Assay 54

RESULTS Deletion mutagenesis of BI11474 & expression of CAT geme 56 Andysisofpromoteractivityinthesubh~entsofBh231 59 Analysis of ch-acting sequences by EMSA 61

Complement activation pathways

Control of the activation pathway

Degradation of C3b by factor 1

Degradation of C4b by factor I

Processing of factor 1

Promoter sequence of factor 1

Map of restriction sites used in generating 5' deletion constructs in Bh 1474

Promoter activity of 5' deletion mutants

Sequence of the basal promoter

Promoter activity in the sub fragments of the basal promoter

OligonucIeotides used in EMSA (P 1, P2, P3, P4)

EMSA on Pl, P2

EMSA on E2F, and cornpetition of P2

EMSA cornpetition on P3

Aiignment of P2Q3, and P4 sequences to show similarities

PAGE

3

4

18

24

26

29

40

Arg

AP

BBS

BSA

CHSAM

CP

CS

C4bp

ClINH

'=Pm

CR1

CR2

CR3

CYS

DAF

D m !

m

d m

DTT

EDTA

EGTA

ELISA

- Arginine

Alternative pathway

BES buffered saline

Bovine serum albumin

Chloro form: lsoarnylalcohol(24: 1)

Classicd pathway

Complement system

C4 bindiag protein

Cl inhibitor

Counts per minute

Complement receptor type 1

Complement receptor type 2

Complement receptor type 3

C ysteine

Decay accelerating factor

Dulbecco's modified Eagle's medium

Deoxynucleotide triphosphate

Dideoxynucleotide triphosphate

Dithiothreitol

E thy lenediaminetetraacetic acid

Ethylene glycol-bis-N,N,N',N' tetraacetic acid

Enzyme linked immunosorbant assay

vii

GTE

HANE

IL

Inr

kD

LDL

LPS

MAC

MBP

MASP

MCP

MRP

MW

ONPG

PBS

PMSF

PCR

RACE

SCR

SLE

I x TBE

TE

Glucose-Tris.HC1-EDTA solution

Heredi tary angionemtic oedema

Interleukin

Initiator

Kilodalton

Low density lipoprotein

Lipopolysaccharides

Membrane attack complex

Mannose binding protein

MBP associated serine protease

Membrane cofactor protein

Membrane regdatory protein

Molecular weight

O-nitrophenyl B-D galactopyranoside

Phosphate buffered saline

Phenylmethylsulfonyl fluoride

Polyrnerase Chain Reaction

Rapid amplification of cDNA ends

Short consensus repeat

Systemic lupus erythromatosus

0.089M Tris base, 0.089 bonc acid, 2.5mM EDTA, pH 8.0

1 ûmM Tris-HC1, 1 m M EDTA, pH 8 .O

INTRODUCTION

The complement system (CS) is an important humoral effector mechanism of

inflammation and immune response. The system consists of more than thirty plasma and

membrane bound proteins that interact in a highly specific sequence to generate host

defense against bacterial and Wal infections and aid in the clearance of immune

complexes fiom the circulation (Muiler-Eberhard, 1988; Nelson et al., 1966). The CS

may be initiated by three distinct activation pathways, (namely, the Classical, Lectin and

Alternative pathways) which share a common tenainal sequence (Fig. 1). Activation of

the proteins or components of complement may be effected by limited proteolysis or

protein-protein interactions. The activated products may be endowed with one or more

biological functions, such as lysis of microbial organisms, enhancement of vascular

permeability, contraction of smooth muscle, chemotaxis, opsonization, clearance of

immune complexes, modulation of immune responses and neutralization of vinises

(MulIer-Eberhard., 1988).

The biological importance of the CS is underscored in patients in which inherited

complement deficiency states are found in association with increased susceptibility to

bacterial infections and immune complex disorders. The complement system like many

other efEector systems is a "double - edged mord", since in addition to playing an

important role in the maintenance of health, it rnay also contribute to tissue damage if

complement activation is uncontrolled or inappropnately initiated. The complement

cascade is carefully controlled at different levels by several fiuid phase and membrane

bound regulatory proteins (Fig. 2). In this thesis, the mechanism of transcription of a

central regulator of CS, factor 1, was investigated. Factor I is an 88 kDa serine proteinase

FIG. 1 : Complement activation pathways. The classical pathway (CP) of complement

activation may be initiated by both antibody-dependent and antibody-independent

mechanisms and involves the complement components Cl, C4 and C2. The lectin

pathway invo lves maman binding pro tein (MBP), MBP associated serine protease

(MASP), C4 and C2 and the pathway is activated in an antibody-independent marner.

The alternative pathway (AP) is initiated in the presence of complex polysaccharides and

involves factor D, factor B and C3. The classical, altemative and lectin pathways al1

converge on C3 and follow a cornmon terminal pathway leading to the formation of a

Membrane Attack Complex (MAC) which is responsible for target cell lysis.

Fig 2: Regdation of the complement cascade. The membrane bomd regulatory proteins hclude the

decay accelerating factor @Al?), membrane cofactor protein (MCP), cornpiement receptor 1 ((CR) and

CD59. MCP, DAF and CR1 regdate the formation of C3 and CS convertase enzymes. CD59 reguiates the

assembly of the membrane atîack complex (C5b-9). The fluid phase regdators include the Cl inhi'bitor

(Clinh), C4 binding protein (C4bp), factor H 0, factor 1 (Fi), S protein and clusterin, Cl-INH inbibits

activated Cl; C4bp, factor H and I are involveci in cleavage of C4b and C3b; S protein and clusterin

prevent C5b-8 complex formation. h o w s indicate the stages influenced by each reguiator. Diagram

adapted fiom Morgan-, 1995.

which, in the presence of appropriate cofactorç, cleaves the major activation products of

the third and fourth components of complement and thereby regulate the assembly of the

terminal complement sequence and the generation of complement mediated bioiogical

products.

U HISTORICALEEPsPECmS

Complement was f h t described over a century ago as a heat labile senim factor(s)

required for the bactericidal activity of immune senim (Nuttal, 1888; Buchner, 1889;

Ehrlich, 1899). The nature of the complement factor(s) was not known until improved

techniques of protein purification which became available in the late 1950's were applied

to the isolation and characterization of the constituent components. Such studies showed

that antibody-mediated cornplement activation was composed of eleven distinct plasma

proteins (Muller-Eberhard, 1975; Nelson et al., 1966). By the mid-19603, al1 of the

components of the Classical Pathway of complement (CP) had been described and their

interactions established. The existence of a second activation pathway, the Alternative

Pathway (AP), which is independent of antibodies, was described by Pillemer and

coworkers in 1954 (Pillemer et al, 1954). In 19703, detailed structural, functional and

biosynthetic studies on the various components of the CS as well a s the proteins which

regulate the cascade were conducted. With the advent of molecular techniques, cloning at

the cDNA level of all the complement components, control proteins, and receptors

involved in the pathways became possible. Within the last decade an antibody-

independent route of activation of the CP, via a serum lectin [mannau binding protein

(MBP)], and mannan binding protein associated semm proteases (MASP) has been

described and designated as the Lectin pathway.

M M

The fint component of the cornpiement system, Cl, is a large

heteroligomeric complex consisting of a single molecule of Clq (460 kDa), two

molecules each of Clr (85 kDa) and Cls (85 kDa), all held together noncovalently in a

calcium-dependent complex (C 1 q(C 1r.C 1 s)J (Tschopp et al., 1980). C 1 q is composed of

six copies of each of three distinct polypeptide chahs (A, B and C), which are wound

around each other in a triple helix containhg an extended, collagen-like tail and a large

globular head (Ziccardi et al., 1977). C l r and Cls are serine proteases (Reid and Porter.,

198 1). The activation of the classical pathway (CP) is initiated prirnarily by the binding

of the coUagen heads of the C lq moiety of Cl to the Fc portion of IgG or IgM immune

complexes. Activation of Cl cm also be achieved by its direct interaction with a wide

variety of molecules such as polyanions (bacterial lipopolysaccharides, DNA and RNA),

certain small polysaccharides, viral membranes, C-reactive protein, but the physiological

importance of this type of activation is not clear (Law and Reid., 1995). The binding of

Clq to activators induce confornational changes in Cl q and this leads to autoactivation

of a single Clr molecule, which cleaves and activates the second Clr molecule in the

C lq(C l r.C 1 s), complex (Dodds et al., 1978). The activated C lr subsequently activates

C 1s by proteolytic cleavage at a single site (Colomb et al., 1984). Cls cleaves C4 at a

single site nea. the N-terminus of the a chah to release a 9 kDa anaphylatoxin, C4a, and

a large hgrnent, C4b. This results in the activation of the thioester bond in C4b which

allows the transacylation of the C4b hgment to nucleophilic acceptors via an ester or a .

amide linkage (Harrison et al., 1981). The half-Iife of the reactive thioester bond is only

a few seconds, such that the failure of C4b to bind to a suitable d a c e acceptor results in

the hydrolysis of the thioester bond (Campbell et al., 198 1). Hence, the binding of C4b to

surfaces is a very inefficient process and the binding is also restricted to the immediate

vicinity of the activating C 1 complex.

In the presence of magnesium ion, the next component of the CP, C2, a single-

chah plasma protein, associates with fluid phase as well as membrane bound C4b. The

C2 bond to C4b is cleaved by C 1 s with the release of a of mal1 hgment, C2b, into the

fluid phase. The Iarger hgment, C2a, remains associated with C4b to form the CP C3

convertase (C4b2a) (Polley and Muller-Eberhard., 1967). The CP C3 convertase

catalyzes the cleavage of C3 into C3a and C3b.

L A M

Recently, an antibody-independent mechanism for the activation of C4 and C2

which bypasses the C1 complex has been described (Lu et al., 1990; Reid., 1993). The

components of this pathway include serum maman binding protein (MBP) and two

serum MBP associated serine proteases (MASP-1 and MASP-2) (Fig. 1).

MBP is a high molecular weight senun lectin made up of many copies of a single

32 kDa chah (Reid., 1993; Lu et al., 1990). It possess a carbohydrate binding module

whose role in vivo is to bind mannose and N-acetyl glucosamine residues in bacterial ce11

walls. MBP also contaias a triple helical collagen-like regions that has an overall

structural similarity to Clq. Furthemore, MASP-1 and MASP-2 enzymes are similar in

structure to C 1 r and C 1 s respectively and hence there are sîructural as well as fimctional

similarities between Clq-Cl %-C lr, and MBP-MASP complex. Because of the

similarity between MASP-1 and 2 and Clr and Cls, MBP can also interact with Ch,-

C 1 s, and bring about activation of C 1 s (Lu et al., 1990). Activated MBP-MASP complex

cleaves C4 and C2 to generate C3 convertase. The lectin pathway thus provides a rapid

antibody-independent mechanism for complement activation.

fi V A r n r n A Y

The alternative pathway (AP) of the complement system c m be Uiitiated by

complex lipopolysaccharides activators, (such as bacteria, yeast and other fungi) vimes

and virally infected cells as well as by complexes of IgG, IgA and IgE (Pillemer., 1954;

Pangburn and Muller-Eberhard., 1984; Cooper and Nemerow., 1983). The constituents

of the AP include C3, factor B, factor D and properdin (Fig. 1). Factor B is a single chain

plasma serine protein (93 kDa), that is stnicturally and functionally homologous with C2.

The activation of factor B is accomplished by factor D, a 24 kDa s e ~ e protease present

in an active form in plasma Properdin is a 220 kDa protein composed of three or four

identical noncovalently linked subunits (Minta and Lepow., 1974; Gotze., 1975). The

activation of the AP is initiated by two activated forms of C3, C3b, that &ses from the

activation of CP or C3(H20) that arises h m the hydrolysis of the thioester bond of C3 by

water. C3 can be continuously activated at a slow rate in fluid phase in the foilowing

ways: 1) C3 can be cleaved by senun proteases into C3b. 2) mail nucleophiles or H,O

can gain access and react with the thiolester (Pangburn and Muller-Eberhard., 1980). 3).

C3 can also be subjected to non specific pemirbations that leads to conformational

changes and the exposure and hydrolysis of the thiolester bond (Law., 1983). C3 with a

hydrolysed thiolester without the loss of its C3a hgment is referred to as C3i or

C3m20), and its conformation resembles that of C3b. Fluid phase C3(H20) as well as

C3b bound to foreign surfaces interacts with factor B in the presence of magnesium ions

to form C3(H20)B or C3bB complexes (Pangbum and Muller-Eberhard., 1980). Factor D

cleaves factor B that is associated with C3b or C3(H,O) at a single site releasing a 30 kDa

fkgment, Ba, into the surrounding fluid h m a 60 kDa fkgment Bb, which remains

associated with C3b or C3(H20). The resulting complexes C3(H20)Bb and C3bBb are the

AP C3 convertases (Gotze and Muller-Eberhard., 1971; 1976). These enzymes are quite

labile (half-life of approxirnately 3-4 min) and rapidly undergo spontaneous dissociation.

The half-Iife of the AP C3 convertase enzyme is considerably Uicreased (to 10-30 min) by

the binding of properdin (Fearon and Austen., 1975). To date properdin is the only known

protein which stabilizes the AP C3 convertase in contrast to senun factor H, membrane

bound decay accelerating factor (DM), complement receptor 1 (CRI) which dissociates

the convertases. C3 convertase catalyses the cleavage of C3 to C3a and C3b. The C3b

molecules bind to the activating surfaces via thiolester bonds. Each molecule then

interacts with factor B to form additional C3 convertase and thereby establishing a

positive feedback amplification loop.

Lé TIJECllENTRAL oIw3

C3 is the pivotal protein in the CS since it is at this step that the classical, lectin

and alternative pathways converge. C3 is an abundant glycoprotein in normal s e m

(approximately 1.3 mg/ ml). It is a 185 kDa heterodimer composed of a 1 15 kDa a chah

linked to a 75 kDa P chah by a single disulfide bond (Muller-Eberhard and Nilsson.,

1960). The activation of Cf (Fig. 3) is the most critical event of the complement cascade,

because it permits the interactions of the terminal components to fom the membrane

attack complex (MAC) which is responsible for target ceU lysis and it generates C3a and

C3b which mediate many of the important host-defense fùnctiom of the CS.

The cleavage of C3 between amino acid residues 726 and 727 (Arg-Ser) by either

CP (C4b2a) or AP (C3bBb) C3 convertase leads to the release of a 9 kDa hgment (C3a)

and the activation of an intrarnolecular thioester bond in the large fragment, C3b (Law

and Levine., 1977). The exposed thioester bond of C3b can associate with factor B and P

to fom additional AP convertase and with CP C3 convertase (C4b2a) or to AP C3

convertase (C3bBb) to form CS convertase (C4b2a3b or C3bBb3b) (Medicus et al.,

1976a; Kim et al., 1992). The binding of C3b molecules to the Fd portion of antibodies

can aid in the clearance of immune complexes by the cells of the reticuloendothelial

system. The deposition of C3b on the surfaces of pathogenic microorganisrns results in

their opsonization and enhancernent of phagocytosis. Deposition of C3b on virus

particles also facilitates their neutraikation (Cooper et al., 1988). C3a, is an

anaphylatoxin (Lepow et al., 1970). It can bind to membrane specific C3a receptors on

mast cells, basophils, eosinophils and neutrophils to trigger release andior formation of an

array of inflammatory agents (including histamine, serotonin, platelet activating factor,

prostaglanduis, leukotrienes, lysosomal enzymes and cytokines) that are responsible for

smooth muscle contraction, increased vascular permeability, edema, hypermia, pain and

fever (Hugli., 1975; 86). C3a has been shown to inhibit B ce11 responses via the

production of prostaglandins (Law and Reid., 1995).

tz I3ULEm-oN OF -- C o -

The assembly of the membrane attack complex is initiateci by the cleavage of the

fifth component of complement, C5, by the CP CS convertase (C4b2a3b) or the AP CS

convertase (C3bBb3b) to generate C5a and CSb (Cooper and Muller-Eberhard., 1970).

CS is a heterodimer consisting of a covalently linked a chah (130 ma) and P chah (80

kDa) (Nilsson et al., 1972, Tack et al., 1976). CS convertase cleaves near the amino

terminal of the a chab to release CSa, a 15 kDa peptide with anaphylatoxin and

chemotactic properties. The anaphylatoxin activity of C5a is a hundred and a thousand

fold more potent than that of C3a and C4a respectively. This anaphylatoxin efFects of

C3a, C4a and C5a are regulated by carboxypeptidase N, which cleaves the carboxy

terminal arginine residue to yield the "desarg" product (Hugli., 1 986). C 5 b retains

residual chemotactic activity and the ability to bind to receptors and activate basophils.

This suggests that CS& is a long lived inducer of inflammation (Burgi et al., 1994).

Binding of C5a to specific membrane receptors on neutrophils augments oxidative bunt

activity, arming these cells with reactive oxygen radical for killing phagocytosed bac teria.

C5b transiently expresses binding sites for C6 and C7 (Muller-Eberhard., 1986). The

bindiig of C6 (a 125 kDa single chah protein) to C5b results in the formation of a Cm6

complex which has a capacity to bind to C7. The attachment of C7 causes

conformational changes in the C5b6 complex exposing a hydrophobic membrane binding

site, such that the complex c m now insert into the lipid bilayers of adjacent membranes.

The C5b67 complex hc t ions as an inte@ membrane receptor for C8.

CS is composed of three polypeptide chahs- a (64 kDa), P (64 kDa) and y (22

kDa) ch&. The a and y c h a h are covalently linked whereas the P chah is

noncovalently associated with the a chah (Kolb and Muller-Eberhard., 1976). The P

chab of C8 binds to C7 in C5b67 complex and the resulting complex C5b678 becomes

deeply buried in the membrane and may cause some membrane leakiness (Podack et al.,

1979; Shin et al., 1977) but has limited ability to initiate lysis. The h a l component in

the complement cascade, C9 is a 71 kDa single chab plasma protein. C9 molecule

interacts with the C5b-8 complex via C8a, and unfolds fiorn its globular, hydrophilic

form to an elongated amphipathic form that transverses the membrane and exacerbates

membrane leakiness (Mayer., 1980). Unfolding of C9 also exposes binding sites that

enable additional C9 molecules to bind, unfold and insert into the membranes. With the

recruitment of additional C9 molecules, up to 18 per complex, the transmembrane pore

(MAC) with a hydrophilic interior and hydrophobic exterior is formed (Podack and

Tschopp., 1982; Tschopp et al., 1982). The transrnembrane channel allows influx of

water and ions into the target cells, leading to osmotic lysis.

tB CDNTROL S Y S ~

The activation of the complement systern is tightly controlled at multiple stages of

the pathway by Buid phase a s well as membrane bound proteins. These regulaton

prevent the depletion of complement components, the overproduction of biologically

active fragments and the destruction of host cells (Fig. 2).

1.8.1 C O N T R O O

The macromolecular C 1 complex is regulated by C 1 inhibitor (C 1 INH) present in

plasma and body fluids. Cl INH is a 105 kDa single chain glycoprotein and a member

of the serpin farnily of proteins (Davies et al., 1986). C 1 INH rapidly foms a covalent 1 : 1

complex with both activated C 1 r and C 1 s, resulting in the generation of a (C 1 -INH)-C 1 r-

C 1 s-(C 1 -INH) compIex (Ziccardi and Cooper., 1979). This efficiently removes C 1 r and

Cls nom the activated Cl complex.

1.8.2 ~ ~ W W J d OFTHE F ~ ~ A T T O N OF MAC

The temiinal complement sequence may be controlled in three ways. Firstly the

bindiag of C5b67 complex to ce11 membrane is prevented by the rapid decay of the

membrane binding site in the Cm67 complex in the fluid phase. Secondly, the

attachment of the Cm67 complex to membranes is M e r prevented by the binding of

plasma vitronecth and clusterin to the C5b67 complex. Vitronectin (or S-protein) is a

sticky, acidic senun glycoprotein which binds to C5b67 and prevents its association with

membranes (Dahlback and Podack., 1 985). Clusterin (SP40,40) (83 ma) is ano ther

sticky plasma protein that inhibits C5b67 in a non specific manner (Jeme and Tschopp.,

1992). The most efficient fluid phase inhibitor of C5b67 is Cg. The binding of CS to

fluid phase nascent C5b-7 complex prevents its subsequent insertion into the membranes.

(Nemerow et al., 1979). Finally, there are two membrane proteins (Cg binding protein

and CD 59) present on host cells that inhibit MAC formation. The 65 kDa C8 binding

protein, binds to C8 and intaferes with the subsequent assembly of MAC (Zalman et al.,

1986). CD59 inhibits the incorporation of C9 molecules into the CS-8 complex and

prevents the development of the poly C9 lytic lesions (Davies et al., 1989; Meri et al.,

1990). As a consequence of naturd decay and presence of these inhibitory proteins, the

bulk of C5b-7 formed fails to attach to membranes and decays in the fluid phase as large,

soluble terminal complement complexes (TCC) containing al1 of the terminal

components, S protein and clusterin (Podack., 1977; Bhakdi et al., 1988).

1.8.1 C O ~ O L A T T C O N V E R T A S E S

Regulation at the level of the C3 and C5 convertases of the CP and AP is

mediated by Buid phase proteins (factor 1, factor H, C4bp, properdin) and by membrane

bound proteins (MCP, DAF and CRI). The activity of the convertase enzymes are

controlled in three ways. Firstly, the convertases are labile and the proteolytic subunits

(C2a and Bb) dissociate irreversibly kom C4b and C3b. However, the binding of

properdin to C3b stabilizes the AP C3 and CS convertases and protects the complexes

nom decay-dissociation (Smith et al., 1984). Secondly, the dissociation of the complexes

are accelerated by the binding of fztor H, C4bp, MCP, CR1 and DAF to the C3b or C4b

moiety. Thirdly, once the proteolytic subunits have been dissociated, factor H, C4bp,

MCP, and CR1 can act as cofacton for factor 1 mediated cleavage of bond C3b and C4b.

DAF however does not serve as a cofactor for factor 1 mediated cleavage of C3b or C4b.

These mechanisrns Limit the formation of C3 and CS convertases enzymes and the

activation of the terminal complement sequence.

L E - H B G w O R S OF AC"TWATT0N

The membrane proteins, DAF, MCP and CR1 restrict complement activation on

host cells at the Ievel of C3 and CS convertases. These proteins contain variable numbers

of a short consensus repeat (SCR). each of which is about 60 residues in length and is

characterized by a fkmework of highly conserved residues including four cysteines that

form two intrachain disulfide bonded loops. Factor B, C4bp and CR2 also contain the

SCR motifs. The genes encoding these SCR contalliing proteins are al1 clustered on

chromosome 1 band q23 of man (Klickstein et al., 1985) and are referred to as the

Regulators of Comptement Activation ( K A ) cluster.

DAF is a 70 kDa protein expressed on ail peripheral blood cells, endothelium and

various rnucosal epithelial cells (Medof et al., 1986). DAF is anchored to the outer leaflet

of the membrane bilayer through a glycosyl phosphatidylinositol (GPI) anchor (Davitz et

al., 1986; Medof et al., 1986). The amino terminal extracellular part of DAF consists of

four SCR domains (Nakano et al., 1992) which is followed by a 70 amino acid long

serine-threonine-proline nch (STP-nch) sequence (Lublin et al., 1 98 8). The

postranscnptional processing of DAF results in the removal of a 24 amino acid sequence

nom the carboxy tenninus and the addition of a GPI anchor (Morgan et al., 1991). DAF

binds to accelerate the dissociation C2a and Bb fiom the CP and AP convertases

(Nicholson., 1992). The activity of DAF is abolished by the removal of SCR 2-4 and the

STP-rich region, but not by the rernovai of SCR 1 (Coyne a al., 1992). The DAI? gene is

40 kb in length, contains 1 1 exons (Post et al., 1990) and is located in the RCA cluster on

chromosome lq23. Genetic deficiency of DAF does not cause paroxysmal nochunal

hemoglobinuna as suggested before, but the erythrocytes of such individuals are slightly

more susceptible to lysis than nomals, in vitro. Most patients however develop

gastrointestinal problems, such as, protein-losing enteropathy and Crohn's disease

(Asghar 1 995).

MCP (reviewed by Lublin and Atkinson., 1989) is a 45-70 kDa widely distributed

protein which is expressed b y leukocytes, lymphocytes, epithelial cells and fibrob lasts

(Seya et al., 1988; McNeaniey et al., 1989). MCP displays an unusual pattern of

migration on SDS-PAGE. The protein expressed on nomal cells resolve as two diffuse

bands of approximately 56 and 66 kDa in molecular weight. Two other forms, 76 and 35

kDa are found on certain ce11 types. The amino terminus extracellular portion of MCP is

composed of four SCR and contains the binding site for C3b and C4b (Adams et al.,

199 1). The SCR's are followed by STP (Morgan and Caras 199 l), and a track of twelve

amino acid sequence of unknown significance. The carboxyl terminus is made up of the

trammembrane region, intracytoplasmic anchor and one of the two altematively spliced

cytoplasmic tails. Like DAF, MCP is processed (removal of the 34 amino acid

hydrophobie signal sequence) to foxm the mature protein. MCP can interact with bound

C4b and C3b (Seya et al., 1986) but has greater &ty for C3b. The binding of MCP to

C3b results in the dissociation of AP C3 convertase. MCP also acts as a cofactor in the

cleavage of C4b and C3b by factor 1 (Seya and Akinson., 1989; Seya et al., 1990; Lubiin

and Coyne., 1991). The binding site for C3b in MCP resides in SCR 3 and 4. The MCP

gene is 43 kb in size and contains 14 exons and 13 introns (Bora et al., 1989). Inherited

deficiency of MCP has not yet been reported.

CRI (CD 35) (reviewed by Femn and Aheam., 1989) is not as widely expressed

as is DAF or MCP, but it is present on erythrocytes, monocytes, neutrophils, B

lymphocytes, some T lymphocytes, and podocytes. It is a single chah membrane protein

which exists in four polymorphic foms (160, 190, 220 and 250 ma). CR1 consist of a

signal peptide, an extracellular domain, trammembrane region and a cytoplasmic

domain. Contiguous blocks of seven SCRs form a larger highly homologous repeating

array called a long homologous repeat (LHR). The most common form of CR1 is

composed of 30 SCRs. CR1 has three binding sites for C4b and two binding sites for

C3b which are located in each of the f k t three LHRs. The presence of these distinct

ligand recognition sites suggests that each receptor rnolecule cm interact multivalently

with complexes containing multiple C4b and C3b molecules. CR1 regulates the

complement cascade by acceierating the dissociation of both CP and AP C3 convertases

and by acting as a cofactor in the factor 1 mediated cleavage of C3b into iC3b and

subsequently to C3dg and C4b to C4c and C4d (Fearon., 1977; Pangbum et al., 1977;

Iida and Nussenzweig 1981). The binding site for interaction of CR1 to C3b has been

mapped by deletion and site directed mutagenesis. The deletion of SCR 8-9 and 15-16

resulted in the loss of C3b binding activity and deletion of SCR 1-2 ablated C4 binding

activïty (Krych et al., 1994). CR1 on erythrocytes plays an important role in the

clearance of immune complexes and enhancement of phagocytosis of C3b and C4b

coated particles (Petersen et al., 1985).

HOOC+ $ chain (75 kDa)

O C3a HS CC

1 a-chain ( 1 10 kDa) I I I I s-7 ç --....--....-.-. S

1 B chain 1

l Factor I + cofactors

1 6 chain 1

1 0 chain 1

Fig. 3: Degradation of third component of complement C3. C3 is cleaved by C3 convertase to praduce C3a and C3b. Factor 1 in the presence of cofactors,factor H, MCP, or CR1 cleaves the a' chain of C3b to refease a 3 kDa peptide, C3f and to produce iC3b. iC3b is further degraded by factor I into C3dg and C3c mainly in the presence of C R I . Adapted from Sidle., t 995.

Lu THE A-AmoN

Factor H is a 150 kDa single chain s e m protein consistirtg entirely of 20 SCR

(Ripoche et al., 1988). It interacts with C3b through three different binding sites located

within SCR 1-4, 6-1 0 and 16-20 (Sharma and Pangbum 1996). By binding to C3b, it

dissociates Bb fiom C3b in the AP C3 convertase (Pangbum and Muller-Eberhard., 1978)

and prevents the interaction of B with C3b to form C3 convertase. Factor H also acts as a

cofactor in the cleavage of C3b by factor 1 (Weiler et al., 1976; Pangbum et al., 1977) and

exhibits a weak cofactor activity in the factor 1 mediated cleavage of C4b and C4b2a

(Pangburn., 1986). The rnechanism by which factor H fulfills these functions are

presently unclear. It has been reported that factors B and H compete for their substrate

C3b. Whether the bound C3b has higher afnnity for factor H or factor B depends on the

presence of neutral and anionic polysaccharides on the ce11 surfaces. On human cells,

factor H recognizes polyanions such as sialoglycoproteins and glycosaminoglycans and

binds to C3b with greater affinity. This binding causes conformational changes in C3b

which increases the affinity of factor 1 to C3b (Carreno et al., 1989). The factor H gene is

105 kb in length and is composed of 22 exons. Patients with homozygous factor H

deficiency have undetectable CP and AP activities, and exhibits low levels of C3 and

factor B. C5-C9 levels are also greatly depressed. The cluiical manifestations of factor H

deficiency are glomedonephritis, recment lung infections, hemolytic urernia syndrome,

meningitis and sepsis.

The predominant form of C4bp is composed of seven identical 75 kDa a chain

and a 45 kDa P chah linked together by disuifide bonds near their carboxy tennini

(Chung et al., 1985) and it assembles into a a, f3, cornplex (Hillarp and Dahback., 1988).

The C4bp a chain amino terminus is composed of 549 amino acid which contains eight

SCR and a 54 residue carboxy terminus which lacks SCRs (Chung et al., 1985). SCR 1-3

in the amino terminus are critical for murine C4bp binding (Ogata et al., 1993). The P

chain, composed of 3 SCR (Hillarp and Dahlback., 1990), does not interact with C4b.

The primary role of C4bp is to regulate the CP C3 convertase by accelerating the

dissociation of C2a h m C4b and senring as a cofactor in factor 1 mediated cleavage of

C4b to C4d and C4c (Nagasawa et al., 1980). The gene encoding the a and P chahs are

linked closely in a head to tail anangement in the RCA cluster (Pardo-Manuel et al.,

1990). The a chain is encoded by 12 exons (Rodriguez-de-Cordoba et al., 1991),

whereas the p chah is encoded by five exons (Hillarp et al., 1993). The a and P chah

genes probably arose by gene duplication.

Table 1: Complement gene size, chromosomal locations and deficiencies. Table adapted from Morgan, 1995.

C 1 q (A&B chahs) Clr, Cls

- Factor B

Prop erdin - MBP

22 kb (41 ex) 22/16 kb 20 kb (18 ex)

6 kb (18 ex)

6.5 kb (4 ex)

42 kb (41 ex)

GENE LOCATION

SLE in majority pyogenic infections incl. meningitis

As above; SLE, many are healthy

Neisserial infections; Rarely other pyogenic infections

Pyogenic infections Glomedonephritis, SLE

Nisseriai infections; Rarely SLE

Nisseriai infections

ml!

FI FH

ClINH

C4bpa C4bp B S protein Clusterin

imP

DAF

MCP CRI CD59

63 kb (12 ex) 105 kb (22 ex)

16 kb (8 ex)

40 kb (12 ex) 10 kb(8 ex)

GENE LOCATION DEFICIENCIES

As C3 deficiency Glomdonephritis Hemolytic uremia, meningitis and sepsis

Gastrointestinal pro b lems protein losing enteropathy Crohn's disease

Note: Abbreviations: AP, alternative pathway; CP, classicai pathway; ex, exons HANE, hereditary angioneurotic edema; MRP, membrane regulatory proteins; PNH, paroxysmal nocturnal hemoglobulinuria; PRP, plasma regulatory proteins; SLE, systemic lupus erythromatosus.

1.21 BIQLOGICAL S I m I F m ! w m OF CO- FACTOR 1

Factor I is a central regulator of the complement cascade. It is present in nomal

human plasma in an active form at a concentration of 35 ug/ml. Factor I activity is aiso

present in the sera of lower vertebrates (amphibians, reptiles and fishes) (Kaidoh and

Gigli., 1987). The activity of factor I is modulated by its substrates and cofactors. In the

presence of cofactors, factor H, CRI, MCP, factor 1 cleaves the a' chah of C3b to

generate C3f and iC3b (Fig 3) (Ross et al., 1982; Law et al, 1979, Harrison and

Lachmam, 1980) (Fig 3). The inactivation of C3b prevents the formation of the AP

C3K5 convertases and the positive feedback amplification of the AP. iC3b is further

cleaved by factor 1, mainly in the presence of CR1 to generate C3c and C3dg (Medicus

etal., 1983). Factor 1 has been show to play an important role in preventing spontaneous

activation of the complement via the AP by cleaving C3(H20) in the presence of factor H.

In the presence of cofactors CRI, MCP and C4bp factor 1 is also capable of cleaving C4b

to generate C4c and C4d (Nagasawa et al., 1980) (Fig 4).

The degradation products of C3b (iCfb, C3f, Cfdg, and C3c) mediate several

important biological fûnctions upon binding to specific ce11 surface recepton. The

binding of C3b or iC3b coated particles to CR1 receptors on phagocytes result in

opsonization. iC3b. C3dg and C3d are important ligands for complement receptor 2

(CR2), a 140 kDa glycoproteh expressed on B cells, some T cells and follicular

dendritic cells (Ross and Polly., 1975; Fischer et al., 1991). The interactions of iC3b,

C3dg and C3d with CR2 has been implicated in the regulation of B ceus humoral

immune responses. The binding of the polyvalent C3dK3dg to CR2 has been show to

- - - - -

a' chain 93 kDa

B chain 1

C4a

1 Y chain 1

F I

- Fig 4: Degradation of fourth component of complement C4. Cleavage of C4 by C l s results in generation of C4a and C4b. C4b is cieaved by factor I in the presence of cofactors C4bp. CR1 or MCP into C4c and C4d. Adapted frorn Ebanks., 1995.

dchain 84kDa 1 1 , 1

Factor I and cofactors

enhance the proliferation of preactivated B celis and this effect can be inhibited by

monovalent C3dC3dg (Bohnsack and Cooper., 1988). Polyvalent C3dg is also capable

of priming human B lymphocytes for anti-IgM-induced proliferation. iC3b can bind to

CR3 which is a member of integrin family composed of a 170 kDa a chain and a 95 kDa

p chain. This interaction facilitates the opsonization and phagocytosis of foreign

substances. iC3b is dso a ligand for CR4 which is a member of the family of leukocyte

adhesion receptor molecules expressed on rnyeloid cells and some activated lymphocytes.

The physiological role of CR4 is not clear, but seems to be simiIar to that of CR3. C3f is

an anaphylatoxin which exerts its biological effects by binding to C3a receptors.

Factor I is synthesized in hepatocytes, primary cultures of blood monocytes,

endothelial cells, fibroblasts, synoviocytes, Raji lymphoblastoid cells and transfected

COS4 cells (Goldberger et al., 1984; Julen et al., 1992; Gulati et al., 1994; Wong et al.,

1995). The protein is synthesized as a single polypeptide chah precursor with a linear

organization of NH,-signal peptide-heavy chain-linking peptide-light chah-COOH. The

precursor protein undergoes N-linked glycosylation and two step proteolytic cleavage to

become mature factor 1 (Goldberger et al., 1984). The fust cleavage results in the

removal of the signal peptide which is 18 amino acid in length (Fig 5). The second

cleavage results in the removal of the M e r peptide by paired amino acid cleaving

enzyme (PACE) and this converts the proprotein 1 to mature factor 1 (Wong et al., 1995).

The mature factor 1 is a heterodimer consisting of disulphide linked heavy and light

c h a h with molecular weights of 50 000 and 38 000 respectively. The heavy chah

contains 3 1 8 amino acid residues and is composed of a linear arrangement of three

domains [factor 1 module (FIM), C D 5 and LDLr] that has been found in other proteins.

The amino terminal domain (FIM) is also found as a tandem repeat at the carboxyl

terminus of the sixth and seventh component of complement (C6 and C7) (DiScipio et

al., 1984; DiScipio et al., 1989; Reid and Day., 1989). The middle CD5 domain is

structuraily similar to the CD5/CD6 domain found in membrane proteins, such as, the

differentiation antigens on human (CD5, CD6), mouse (Ly-1) T and specialized B

lymphocytes (3 copies each) (de Bniijn and Fey., 1985; Huang et al., 1987; A d o et al.,

1991; Freeman et al., 1990); as the scavenger receptor cysteine-rich (SRCR) module

found in the macrophage scavenger receptor (1 copy) (Dangott et al., 1989) and in sea

urchin sperm peptide "sperac?" receptor (4 copies) (Yamamoto et al., 1985). The C-

temiinal domain is a tandem repeat of LDL receptor (LDLr) type A domains (Al and

A2). This domain is also found in the LDL receptor (7 tandem copies) (Sudhof et al.,

1985a; Stanley et al., 1985), C6, C7, C8a, C8P and C9 (single copies) (Stanley et al.,

1986; Rao et al., 1987; Howard et al., 1987), in rat kidney membrane glycoprotein GP330

(Raychowdhury et al., 1989) and in human LDL-receptor related protein, LRP/P2

macroglobulin receptor (Herz et al., 1988) as different cluster repeats. Factor 1 is the only

known serine protease with these domains and to date the function of these domains in

factor I are unknown.

The active site of factor 1 resides in the light ch&. This 243 amino acid residue

polypeptide shows sequence homology with the catalytic subunits of other serine

proteases. The catalytic triad in factor 1 is made of histidine (362), aspartate (41 1) and

serine (507) (Davies et al., 1 98 1 ; Catterall et al., 1 987).

The size of the human factor 1 transcript is approximately 2.4 kb (Goldberger et

ai., 1984). The cDNA is 1971 bp in size and contains the sequence coding for the primary

translation product of factor 1 mRNA (Goldberger et al., 1987; Catterail et al.,I987). In

addition, it contains a 14 bp 5' untranslated sequence and a 200 bp 3' untranslated region,

including two polyadenylation signals. Alignrnent of the cDNA derived prirnary

structure of hurnan (Goldberger et al, 1987., Catterall et al 1987). Xenopus

(Kunnath-Muglia et al, 1993)] chicken and mouse factor 1 (Minta et ai, 1996) has

revealed an overd1 conservation of primary structure and domain organization of factor 1

in each species with the exception of the region between LDLR A2 and the linker peptide

(Minta et ai., 1996). This region in the mouse factor 1 cDNA contains 27 bp and 21 bp

sequences which are not present in human factor I cDNA. In Xenopus the inserts are

present as 66 bp and 21 bp respectively. These variable regions in factor 1 have been

designated as the "divergent" or D segments, there being two D segments in human m l ,

H2), four in Xenopus (X 1 -X4), four in mouse (M 1 -M4) and one in chicken.

Human factor I gene spans 63 kb of DNA and comprises of 13 exons and 12

introns (Vyse et al, 1994). The gene has been mapped to chromosome 4q25 (Goldberger

et al., 1987; Shiang et al., 1989). Exon 1 encodes the S'UT and the signal peptide. Exons

2-9 codes for the heavy chain and exons 9-13 codes for the light chain. The serine in the

catalytic triad is encoded by exon 13, histidine by exon 11 and aspartate by exon 12

(Vyse et al, 1994).

Recently, a 4 kb 5' flanking region of human factor 1 gene has been cloned f?om a

human hepatoma genomic library and the 3' 1474 bp (Bh1474) region has been

sequenced (Minta et al., 1998). This sequence contains several putative consensus

AP-1 11-6 RE

l C W K ~ T l R X t X T A ~ T A r r r C A T A A A T P I 3 i A T A TATA box

INV RPR 3b

INV RPT 3a

c r r c A A c c c r r A A r n ~ T T ~ T A 7 - - m ~ m HPR-I b HPR-1 a

T A T ~ T ~ ~ ~ I I A P L P * * X . INV RPT 2b INV RPT 2a AP-1

I S E AP-2

I S E AP-1 HXR-2c - HXR-Pb GAS IFN-GR€ Inr -

CCAAT T E CCAAT T E L + 1 - - - - CTF-NF1

HXR-2a - INV RPT 1 b INV RPT l a

~mcAGmwum---

inv NF-kB HXR-1 b

TCE

Hind III I

Fig 6:Putative consensus sequences in Bh1474. The major cap site is designated as +1 and the minor cap site at -27 and -45 are denoted by: 1

CCAAT box CCAAT box CF-NF1

AP- 1 ISE

CCAAT box CTF-NF1

CCAAT box

TATA box

sequences (including CAAT boxes, GC rich sequences, AP 1 sites, IL-1 response

element, I L 6 response element and an AP-2 site (Fig 6). Primer extension analysis has

revealed a major cap site at the position indicated as +1 in Fig 6 (152 bp upstream of

ATG) and two minor cap sites at -27 bp and -45 bp h m the major cap site (Minta et al.,

1998). Vyse et al (1994) has also reported a 426 bp 5' flankg sequence of the factor 1

gene. By RACE-polymerase chah reaction, they have detexmined the cap site to be

located 28 bp upstream of the ATG start codon. Bh1474 cloned upstrearn of pCAT

enhancer reporter plasmid has been shown to direct the expression of the CAT reporter

gene in HepG2 cells (Minta et al., 1998).

2.12 DEFICIENCY OF C O M P J , E . N T FACTOR 1

Inherited deficiency of factor 1 has been reported in 23 individuals kom 19

different pedigrees and shown to follow an autosomal recessive pattern of inheritance

(Ross and Densen., 1984; Rasmussen., 1988; Bo- et al., 1993; Vyse et al., 1994). The

deficiency is associated with uncontrolled activation of the amplification loop of the

alternative pathway leading to consurnption of C3, and factor B. The concentration of C3

and factor B in factor 1 deficient patients are 13-34% and 4-9% of normal respectively.

Factor 1-deficient s e m is incapable of solubilizing prefomed immune complexes and

exhibits reduced opsonic and chemotactic activities (Rasmussen., 1 988). The clinical

manifestations of factor 1 deficiency are similar to C3 deficiency. Factor 1 affected

individuals have propensity to suffer recurrent pyogenic infections by N. meninetides

(Bonnin et al., 1993) and S. pnewnonia (Abramson et al., 1971; Teisener et al ., 1984)

iocreased incidence of glomemlonephritis and systemic lupus erythromatosus-like illness

(West., 1989) due to impaired complement mediateci fiuictions.

The molecular basis of hereditary complement factor 1 deficiency is at present not

completely understood. Vyse et al (1995) has recently studied the molecuiar basis of

factor 1 deficiency. In one pedigree, two siblings were found to be homoygous for the

same tramversions (adenine to thymine) at nucleotide 1282 in the cDNA. This mutation

caused histidine 400, a semi-conserved residue in the serine protease family, to be

replaced by leucine. This alteration prevented the secretion of factor 1. In the second

pedigree, one allele was found to cary the same mutation as seen in the fint pedigree, the

second allele had a donor splice site mutation that caused a deletion of mRNA encoded

by the fifth exon. This deletion resulted in the premature termination of the factor 1

mscript.

1-13 TWSCBlPTlON OF EUKARYOTIC GWES

Transcription of protein encoding genes is a finely tuned and highly controlled

process. In eukaryotes, initiation of messenger RNA synthesis by RNA polymerase II

(Pol II) is governed by two classes of DNA sequence elements: the core promoter which

contains the binding site for Pol II and controls the location of the site of transcription

initiation and upstream and downstream elements which regulate the rate at which Pol II

initiates new rounds of transcription fiom the core promoter. These DNA sequences

direct the action of two classes of transcription factors: the general transcription factors,

GTFs, (TFIIA, TFIIB, TRID, TFIE, TFDF, TFW) and DNA binding transcription

activators (such as the glutamine-rich activator Spl, and the proline-rich activator

CTF/NFl) which are not essential for basal transcription but rnediate the action of

upstream promoter elements. The binding of speci fic activators to promoter elements

stimulate the recruitment of basal transcription factors in a stepwise manner to form the

preinitiation complex. According to Choy and Green, the activators function at two

stages. First, to recruit the general transcription factor TFIIB, and at a later stage after the

entry of TFIIB (Choy and Green 1993). A different model of transcriptional activation

has been proposed based on the existence of a pre-assembled Pol II transcription complex

(holoenzyme) in vivo which is composed of Pol II and a number of accessory factors

(Koleske and Young., 1994). According to this model, the transactivators interact with

different surfaces of the holoenzyme complex and brings the Pol II transcription

machinery to the template in one-step. By influencing and stabilizing the formation of

the activated initiation complex, the activators enhance the rate at which each round of

transcription is initiated (Emili and Ingles., 1995).

The core promoter of most mammalian genes transcribed by Pol II contains a

TATA box at -25-30 bp upstream of the transcription initiation site which can

independently speciS the location and the direction of transcription initiation

(Breathnach and Chambon., 1981). The TATA box is specifically recognized by TATA-

binding protein (TBP) of TFID which initiates the formation of the preinitaition

complex. TFIID is a multisubunit complex (reviewed by Burley and Roeder., 1996)

composed of TBP and seven tightly associated factors refmed to as TBP-associated

factors (TAFs) (Dynlacht et al., 1991; Pugh and Tijian., 1991 ; Tanese et al., 199 1). TBP

is one of the most highly conserved proteins in eukaryotic evolution (reviewed by

Hernandez., 1993). The binding of TBP to the minor groove of the TATA element

causes striking distortion in DNA which d o w s the stepwise assembly of other GTFs to

fom the preinitiation cornplex. TAFs are responsible for relaying signais fiom activators

to the basal rnachinery.

A series of experiments perfomed by Smale and Baltimore in 1989 led to the

identification of a second core promoter element, the initiator. This element was uiitially

identified in the TATA-less terminal deoxynucleotidyl transferase (TdT) promoter.

Initiators (Inr) are weakly conserved elements that usually encompass the transcription

start site. They are functionally analogous to the TATA box in that they can detemnine

the location of the transcription start site, direct basal transcription by Pol II and

communicate with at least some upstream activators to initiate high levels of accurate

transcription (Smale., 1994). Inr elements have been classified into different groups

based on the factors they bind and their sequence similarity to the ones that are well

characterized, such as the TdT Inr, adeno-associated virus p5-lnr and the ribosornai

protein Inr (reviewed by Weis and Reinberg., 1992).

The transcription factors which interact with the Inr have not been cteady defined.

Two proteins have been proposed: Pol II itself and TAFs of TFIID. TAF,lSO and

TAF,,250 have been shown to participate in the recognition of the Inr element and

downstream core elements (Verrijzer et al., 1994; 1995). Thus, the core eiements, the

TATA box and the Inr element seem to be recognized by TFD[D. In some genes however,

the Inr element is also recognized by sequence specific DNA bliding proteins, such a s

TFII-1, E2F, and ml, but these proteins do not appear to be respomible for basai uir

activity (KoIimar and Famham., 1 993).Although a large number of genes contain either a

TATA box or an Inr element, some genes have been reporteci which contain both

elernents, such as, the adenovins major late ptomoter. Some of the TATA-less genes

however contain A+T rich sequences that, although differing h m the original TATAAA

consensus, still appear to function as a TATA box. Several genes have also been reported

to lack both a TATA box and an Inr element, but yet retains the ability to direct Pol II to

initiate transcription f?om a single start site.

1,14 W S C R I P T I O N C ~ M E I J m E W G E N S

To date the promoters of only a few complement gens have been characterized.

The mouse C4 gene promoter has been shown to belong to an expanding group of RNA

polymerase II promoters that lacks a canonical TATA box at the -30 region. It contains a

typical Inr element at position -1 to +12 and an additional downstream element (three

direct AGAC repeats) which appears to be important for transcription. An upstream E-

box (-73 relative to transcription start site +1) has been reported to enhance transcription

(Miyagoe et al., 1994).

The prornoter of human C2 gene has ody been partially characterized. The

activity was shown to be contained in a 228 nucleotide sequence which lacked a TATA

box (Sullivan et al., 1994).

The promoter of the mouse C3 gene has many structurai similarities to that of the

human C3 promoter. Both promoters contain a TATA box located at position -30 bp that

is essential for its constitutive expression (Vik et al., 1991).

Deletion analysis of the 5' flanking region of the human factor B gene indicated

the importance of sequences located between 178 and 260 bp upstream of the

transcriptional initiation site. A typical TATA box was located at position -22 relative to

the transcriptionai start site (Wu et al., 1987).

The gene encoding the human maman binding protein contains four exons

spanning 6.5 kb of DNA. Putative TATA and CCAAT boxes are located at -41 and -82

bp upstream of the transcriptional start site (Sastry et al.. 1989).

The promoters of the genes encoduig the regulatory complement proteins have not

been fully characterized. Arnong the ones studied, the Cl-INH gene promoter lacks a

typical TATA box, but contains a potential Inr element at position -3 to +5 (Zahedi.,

1994). Whereas the human C4BPa gene promoter appears to be TATA-less, the murine

gene possess a putative TATA box at position -26. Both promoters have sequences

matching the consensus motif for liver enriched transcription factor, HNF-1 (Courtois et

al., 1988). The promoter of the human factor H gene also appears to lack canonical

TATA and CCAAT boxes, but contains an Inr element which is simila. to the CR1 uir (6

out of 8 match) (William and Vik., 1997). The 5' flanking region of the human DAF

gene lacks both a TATA box and a CCAAT box at their typical locations. However, a

TATA variant-TTAA is located at position -31. This sequence occurs in a sirnilar

position in the adenosine deaminase gene promoter, where it is speculated to act as a

TATA box variant (Thomas and Lublin., 1993). The MCP promoter also lacks a TATA

box, but has several putative ch-acting regulatory elements (Cui et al., 1993).

To date, the basai pmmoter of the factor I gene and the cis-acting elements and

cognate DNA binding proteins which regulate the constitutive and inducible expression

of the gene have not been fùlly characterized. Mutations in the regulatory regions of

genes have been shown to represent an important class of lesions causing human genetic

diseases. Such mutations have been associated with either an increase or decrease in the

transcriptionai activity of the affected gene mediated by the aitered binding of transacting

factors to specific DNA sequences in the promoter region. In this study, the technique of

deletion mutagenesis was used to map the basal promoter sequences required for the

constitutive expression of the factor 1 gene. Electrophoretic Mobility Shift Assay was

then used to localize cis-acting sequences which interact with HepG2 nuclear factors to

regulate the transcription of the factor 1 gene.

MATERIAL AND METHODS

PREPARATION OF pBh1474CAT, pBh1287CAT, pBhl029CAT

CONSTRUCTS BY RESTRICTION ENZYMES

The 5' 1474 bp flanking region of the human factor 1 gene (Bh1474) was obtained

by digesting 20 pg of the pBh1474 CAT enhancer constxuct with 40 U of HindlD

ovemight at 3 7 ' ~ . pBh1474CAT enhancer was kindly provided by Ms. May Fung in our

laboratory. 5' tnincated fragments of Bh1474 were prepared by deletion mutagenesis

using restriction endonucleases (Fig 7). A 1287 bp fï-agment was generated by cleaving

the pBh 1474CAT enhancer reporter plamid with Banll and HindlII. A A 029 bp fragment

was obtained by restricting the pBh1474CAT enhancer construct with BgM and HindII

(Fig 7) . The digested products were electrophoresed on a 0.8% low melt agarose (Sigma)

in 1xTA.E dong with 1 kb DNA markers (Gibco BRL) for two hours at 65 volts. The gel

strips containing the desired DNA bands (1474, 1287, and 1029 bp) were excised, melted

and passed through NACS columns (Pharmacia) that have been equilibrated with 1 ml of

2 M and 5M NaCl solutions. The columns were washed with 10 ml of 0.5 M NaCl

solution and the bound DNA was eluted with 0.4 mi of 2 M NaCl solution. The eluted

hgments were precipitated oveniight with two volumes of 100% ethanol. The DNA was

pelleted by centrifugation at 15,000 rpm for 15 min at 4OC, washed with 70% ethanol, air

dried and dissolved in 10 pl of Tris-EDTA buffer (TE), pH 8.0 (10 rnM Tris-HC1, pH

8.0, 1 mM EDTA). The concentration of the DNA was estirnated by agarose gel

electrophoresis in the presence of ethidium bromide by comparing the fluorescence of the

DNA with that of a known standard DNA (Sambrook et al., 1989).

Fig 7: Map of restriction sites in pBh 1474 that were used in generating 5' deletion construcl.

To facilitate subcloning, the 3' overhang of 1287 bp hgment was rernoved by

incubating 2.5 yg of DNA with 3 pl of 10x T4 polymemse b a e r , 3 pl of 0.5 mM dNTP

mixture (dCTP, dATP, dGTP, and dTTP) and 2 U of T4 polymerase (New-England Bio

Labs) in a total volume of 30 pl at 370C for 15 min as described by Davies et al. (1 986).

The reaction mixture was extracted with phenol: chisam (chlorofonn: isoamy ldcohol,

24: 1 1 : 1 The DNA was precipitated ovemight with one-tenth volume of 3 M sodium

acetate (pH 5.2) and two volumes of 100% etbanol. The DNA was pelleted, washed, air

dried and dissolved in TE to a final concentration of 0.25 &pl.

The 5' protmding ends of 1287 bp and 1029 bp hgments were blunted by a fil1

in reaction with Klenow fi-agment DNA polymerase 1 (Gibco BRL). Approximately, 2.5

yg of each hgrnent was incubated with 3 pl of 10 x Klenow buffer, 3 U of Klenow, 3 pl

of 0.5 mM dNTP mixture and 3 pl of 10 m M DTT in a total reaction volume of 30 pl at

37'C for 15 min as described by Sambrook et al. (1989). The enzyme was heat

inactivated and the mixture was extracted with phenol: chisam. DNA was precipitated

with ethanol, washed, air dried and dissolved in 10 pl of TE.

2.1.1 LIGATION: 10 pg of pCAT basic reporter plasmid (Promega) was linearized

with 20 U of HindIII to allow subcloning of the 1474 bp hgment. To facilitate the

subcloning of the other two hgrnents, 1287 bp and 1029 bp, pCAT was linearized with

Sul1 and the 5' protruding ends were blunted as described above. Two micrograms of

1474 bp insert was incubated with 0.5 pg of pCAT basic vector linearized with H . d m

in a 20 pl ligation mixture containing l x ligation buffer, 2.5 U of T4 ligase. The 1287 bp

and 1029 bp inserts were incubated with 0.5 pg of pCAT basic vector Iinearized with

Sa11 in the same reaction buffer. Ligation was carried out for 16 hrs at 14OC.

TRANSFORMATION: Ten microliters of ligation mixture was incubated

with 100 pl of competent HB 101 cells on ice for 30 min. Then 0.9 rnls of Lauria-Bertani

broth (LB) (without ampicillin) was added to each mixture and the cells were grown at

37°C on a rotating dnun for one hour. Aliquots of the reaction mixture were plated on

1.5% agar plates containing 100 pg/ml ampicillin and incubated overnight at 37%

2.1.3 SMALL SCALE PREPARATION OF PLASMID DNA FROM E B l O l

CELLS: Muiipreparation of plasmid DNA was performed by the aikali lysis

method (Sambrook et ai., 1989). Essentially, ampicillin resistant colonies of transformed

HI3 101 cells were picked and innoculated into a 3 ml LB broth containhg 100 pg/ml

ampicillin and grown overnight at 37°C. 1.5 ml of the bacterial culture was spun briefly

and the pelleted cells were resuspended in 100 ul of GTE solution (50 mM glucose, 25

mM Tns.HCL (pH &O), 10 rnM EDTA (pH 8.0) and incubated for 5 min at room

temperature. The cells were lysed with 200 pl of aikaline lysis solution (0.2 N NaOH,

1% SDS) at room temperature for 5 min. Fhally, 150 pl of 3.5 M potassium acetate, pH

7.5 was added to the mixture and incubated on ice for 5 min to aUow plasmid DNA to

reanneal. The mixture was centrifugecl at 15,000 rpm for 5 min at 4OC . The supernatant

was extracted with phenol:chisam, and DNA was precipitated with two volumes of

ethanol. The DNA was recovered by centrifugation and the pellet was washed with 70%

of ethanol, air dried and resuspended in 30 pl of TE containing DNase fiee pancreatic

RNase (20 pg/ml). Al1 three constmcts were analyzed for the presence of insert by

restricting with HindIlI and the orientations were determined by restricting with A f l .

and HindlU.

PREPARATION OF pBh479CAT AND pBh231CAT CONSTRUCTS

pBh479CAT constnict was generated by cleaving 2 pg of purified pBh1287

CAT with 8 U of Nsil and Pstl. This released an 808 bp hgment. The vector still

containing a 479 bp 3' end of Bhl287 was eluted fiom agarose gel, the ends were blunted

and then religated to generate pBh479CAT.

pBh231CAT constnict was also derived fiom Bh1287CAT by cleaving with

BstEII and Pst l . This released a 5' 1 O56 bp fiagrnent and the vector containing the 23 1

bp 3'end of Bhl287 was isolated and religated by blunt-end ligation.

a PREPARATION OF pBhl32, pBh74CAT CONSTRUCTS BY PCR

AMPLIFICATION

A 132 bp hgment (+26 to +160) and a 74 bp hgment (-63 to +IO) were

amplified by PCR and subcloned into pCAT basic reporter plasmid to create pBhl32CAT

and pBh74 CAT constructs respectively. PCR reactions were camied out in 500 pl

microfbge tubes and contained 1 pg of template @Bh1474CAT), 0.1 FM of the sense

primer (SP), 0.1 p.M of the antisense primer (ASP) in a total reaction volume of 50 pl

containing 10 mM Tris-HC1 (pH 8.0), 50 mM KC 1, 1.5 mM MgCl, 20 pM of each d N ï P

(dATP, dTTP, dGTP, and dCTP) and 2 U of Taq polymerase (Perkin Elmer Cetus). The

primers were tagged with restriction sites (underliued) to facilitate subclonhg. The

p h e r s used for PCR amplification of the 132 bp fragment were:

SP: 5' GGA TCCAAGCTlLTCTGCAGCCAAGCTCTTTAGGAGG 3'

ASP: 5'

BamRI HittdlZI Psti

GATGAGTCGACAAGCTTCATGTTGGAGGTGTTCG 3 '

Saf I HindïU

The primers used for PCR amplification of the 74 bp hgment were :

SP: 5' GAGAAGCTTCTGCAGATGCATCCCTCAGCTCT?TAATGG 3'

ASP: 5' GTCGACTCTAGAGAAAGAATTTGGCTGAAACCT 3'

SafI XbaI

The reactions were layered with 50 pl of mineral oil and PCR amplification was

carried out in a Perkin Elmer Cetus Themai Cycler through 35 cycles of denaturation (2

min at 94OC), a~eal ing (2 min at So°C) and polymerization (3 min 72OC). The mixture

was electrophoresed on an agarose gel and the amplified hgment was gel purified,

digested with the appropriate restriction enzyme and subcloned into pCAT basic vector.

The constructs were transfomed into HBlOl cells and colonies containing the

recombinant plasmids with the inserts in the nght orientation were assessed by

sequencing from the 3' end using an antisense primer complementary to 1297-2362 5'

end of the CAT gene (5' CCATT'ïTAGCTTCCTTAGCTC 3').

PREPARATION OF pBh206CAT CONSTRUCT

A pBh206CAT construct containhg nucleotide -46 to +160 of the factor I

promoter and lacking the Spl/AP-2 Iike sites was generated by 3 3 ' exonuclease III

digestion of linearized pBh231CAT. Forty micrograms of pBh23 1CAT construct was

digested with 80 U of BstEU and 80 U of Sphl to generate a hearized vector with a 5'

and a 3' overhang. The 3' recessed end of the vector generated by BstEII was then

digested at a unifonn rate by exonuclease III whereas the 3' overhang was protected from

exonuclease III digestion. The BstELI/Sphl digested vector was gel purified and the DNA

was dissolved in stede water to give a concentration of 0.1 pg /pl. Forty microliters of

the linearized plasmid DNA was incubated with 160 U of exonuclease III (Pharmacia).

Five microliters aliquots were removed every 20 sec and mixed with 15 pl of S1 nuclease

mixture [IO p1 of 2x SI nuclease buffer, 2.5 51 of S1 nuclease (Boehringer Mannheim)

and 25 pl of water] and M e r incubated for 30 min at room temperature. The S1

nuclease action was stopped with S1 nuclease stop buffer [0.3 M Tris base and 0.05 M

EDTA (pH £?.O)] and the samples were heated to 70°C for 10 min. To facilitate iigation,

the ends were flushed by the addition of 1 pl of Klenow mixture [20 rnM Tris-HCI (pH

&O), 100 mM MgCl,] and incubation at 37OC for 5 min. In the absence of (INTP's, the

3 '-5 ' exonuclease activity of Klenow predominates. One rnicroliter of 0.5 mM cNTP mù<

was then added and the mixture was M e r incubated for 5 min at 3 7 C for the Klenow

polymerase activity to predominate. DNA was religated by the addition of 6 U of T4

ligase and Ix T4 ligase bufTer.

PREPARATION OF pBh21CAT CONSTRUCT

Twenty one base pair sense and antisense oligonucleotides (-12 to +9), containing the

major cap site, TdT-üke Inr and CTF/NFl elements w e ~ e synthesized (as s h o w beiow)

with restriction site add-ons to facilitate unidirectional cloning into pCAT basic vector.

SP: 21 bp sense primer:

HindDI Pstl Nsil mal S U

21 bp anti sense primer:

5' GTCGAmCTAGACAAAmGGCTGAAATCCATGCATCTGCAGAAGmGG 3' - Nsil Psti HindLII

Complementary sense and antisense oligonucleotides (25 pg in 50 pl of 150 mM NaCI)

were mixed and heated to 80°C for 5 min and allowed to anneal by slowly coohg to

room temperature. The DNA was precipitated overnight in two volumes of ethanol and

recovered by centrifbgation. The DNA was digested with Pst1 and f i l , extracted with

pheno1:chisa.m and precipitated with ethanol to remove the liberated oligonucleotides.

The double stranded 21 bp oligonucleotide was then subcloned into pCAT basic vector

that had been cut with Pst1 and fial.

ANALYSIS OF CONSTRUCT BY DNA SEQUENCING

Bh206, Bh132. Bh74 and Bh21 CAT constnicts were sequenced nom the 3' end

to verifjr their identity and orientation. DNA sequencing was performed by the dideoxy

method (Sanger et al.. 1977) using a DNA sequencing kit (USB corporation, Cleveland,

Ohio). An antisense primer (5' CCATM'TAGCTTCCTTAGCTC 3') complementary to

1297-2362 5' end of the CAT gene of the pCAT basic vector was used to prime the

reaction. Three to five micrograms of DNA to be sequenced was denatured with 2 N

NaOH, the primer was then annealed to the ternplate. Using sequenase enzyme, the

DNA was labeled for 5 min with 10 pCi of [a3%] dATP (>IO00 uCi/mmol, Amersham)

and d N T P ' s ( d m , dCTP and dGTP). The labeling reaction was terminated with the

addition of dideoxy nucleotide triphosphates ( d m ) and the mixture was

electrophoresed on a 24 cm x 40 cm 8% polyacrylamide gel containing 7 M urea in

lxTBE (10.8 g Tris base, 5.5 g bonc acid, 4 ml 0.5 M EDTA, pH 8.0) for 2-4 hours. The

gel was fixed in 10% acetic acid/10% methanol, dned and subjected to autoradiography.

LARGE SCALE PREPARATION OF PLASMID DNA

Maxiprep of DNA was carried out according to Sambrook et al. (1989)

Transfonned HBlOl cells containing recombinant pCAT basic reporter vector with the

promoter inserted in the nght orientation was grown ovemight at 37°C with agitation in

one liter LB broth containing 100 pg/ml ampicillin. The cells were pelleted by

centrifugation at 5,000 rpm for 10 min at 4OC and resuspended in cold GTE b a e r (8

dSOO ml culture) and incubated on ice for 10 min. 10 ml of keshly made alkaline lysis

buffer was added and the mixture was M e r incubated on ice for 10 min. Then 9.5 ml

of cold 3M potassium acetate, pH 7.5 was added and the mixture was incubated on ice for

another 10 min. The cellular debns and bacterial DNA were removed by cemtrifiging the

mixture at 15,000 rpm for 25 min at 4OC in an SS 34 rotor. The supernatant was fiItered

through cheese cloth and DNA was precipitated with 0.6 volume of isopropanol at room

temperature for 30 min. DNA was recovered by cenmgation at 10,000 rpm for 25 min

at room temperature, washed with 70% ethanol, air dned and dissolved in 4 ml of TE per

500 ml of original culture.

Cesium chloride (4.95 g/500 ml of original culture) and 450 p1 of ethidum

bromide (10 mg/& stock solution) were added to the DNA solution in TE, dissolved, and

the mixture was then centrifbged at 3,000 rpm for 30 min at room temperature. The

supernatant was tramferreci into 5 ml quick seal polyallomer VTi 80 tubes (Beckman)

and centrifbged overnight at 50,000 rpm in a Beckman VTi 65 rotor at room temperature.

The plasmid DNA band fiom each tube was removed with a hypodennic needle and

placed into a 50 ml centrifuge tube, diluted with 3 volumes of TE and extracted 3-4 tirnes

with equal volumes of n-butanol (until the top butanol layer was clear) to remove the

ethidium bromide. The aqueous phase containhg the plasmid DNA was then precipitated

with two volumes of ethanol. The DNA was recovered by centrifugation at 3,000 rpm

for 30 min at 4'C, air dned and dissolved in 500 pl of TE buffér. The solution was

extracted twice with phenol: chiasm, once with chisam and the plasmid DNA was

precipitated with 3M sodium acetate, pH 5.2 (one-tenth the volume) and two volumes of

ethanol. DNA was recovered by cenhfugation at 15,000 rpm for 10 minutes at 4OC. The

pellet was washed with 80% ethanol, air dried and dissolved in TE buffer. The purity and

the concentration of the DNA was determined by spectrophotometry. Ten microliters of

the purified plasmid DNA was diluted in 990 pl water and the O D at 260 nm and 280 nm

were measured (1 O.D. 260 = 50 pg/ml). The 260 nrn to 280 nm ratio was used to

estimate the purity of the DNA samples.

TRANSIENT TRANSF'EXTIONS OF HEPG2 CELLS

pC AT p lasrnids containhg B h sequences were transient1 y tram fected into HepG2

cells using the calcium phosphate coprecipitation technique (Sambrook et ai., 1989).

HepG2 cells were grown in Dulbecco's modified Eagie's medium (DMEM),

supplemented with 10-20% fetal calf serum and 500 U penicillin, in a humidified

incubator at 37°C in the presence of 95% air/5% CO, Twenty-four hr pnor to

transfection, HepG2 cells were seeded in 60 mm plates at a density of 3 x 106 to obtain a

50-70% confluent plate. Fifieen rnicrograms of cesium purified plasmid DNA was

mixed with 4 pg of pRSV J.3 galactosidase (Promega) and 50 pl of 2.5 M calcium chloride

in a total volume of 500 pl. Five hundred microliters of 2x BBS (N,N-bis[2-

hydroxy ethyl]-2 aminoethanesu1 fonic acid (B ES) buffered saline), pH 7.5 was p laced in

15 ml round bottom stenle tubes, and bubbled gently with a pipette while adding the

DNA-calcium chloride mixture. The tubes were then vortexed and allowed to incubate at

room temperature for 20 min for microprecipitates to form. The adherent HepG2 cells

were fed with 2 ml of nesh media The DNA precipitate was gently distributed over the

ceUs and the cultures were incubated at 3?C, in the presence of 3% CO,. After 5 hr

incubation, the ceils were shocked with 10% glycerol in medium for 3 min, washed three

times with phosphate buffered saline (PBS) (8 g NaCI, 0.2 g KCI, 1.4 g NaHPO,, and 0.2

g KH2P04 per Mer) and then cultured for 48 hrs in a 37OC incubator in the presence of

5% CO,. The cells were scraped with a rubber policeman into 1 ml TEN buffer (40 mM

Tris-Cl, pH 7.4, 1 m M EDTA, pH 8.0, and 150 mM NaCl) and microfigeci at 12,000 rpm

for 30 sec at 4OC. The ceii pellets were resuspended in 100 ul of 0.25 M Tris-HCl (pH

8.0) and subjected to three rounds of rapid fieeze and thaw cycles to lyse the cells. The

tubes were microfbged at 12,000 rpm at 4OC for two min to pellet cellular debns. niuty

microliters of the supernatant was saved for B galactosidase assay, and the remaining 60

pl of the ce11 extract was heated for 5 minutes at 60°C to degrade endogenous

deacetylases and then used for the CAT assay.

CATASSAY

CAT assays were performed according to Gorman et al., 1982. Briefly, 60 pl of

the ce11 extracts fiom transfected HepG2 cells were incubated at 370C for 3 hr with 3 pl of

"C chloramphenicol, 5 pl of n-butyryl CoA and 0.25 M Tris-HCI (pH 8.0) in a total

volume of 125 pl. The reaction mixture was extracteci with 500 pl of ethyl acetate and

vacuum dried. The material was resuspended in 20 pl of ethyl acetate and spotted on a

20 x 20 cm Baker-flex silica Gel 1B2 coated sheet for thin layer chromatography (TLC)

in a chamber containing chloroform:methanoi (97:3). The plates were air dried and

subjected to autoradiography ovemight at -80°C with intensifjmg screens. The

autoradiogram spots corresponding to the butrylated and unbutrylated chloramphenicol

products were then scraped and counted. In certain experiments, the butrylation of

chloramphenicol was quantified by extracting the reaction mixture with 300 pl of mixed

xylenes followed by scintillation counting. The n-butyryl chloramphenicol partitions into

the xylene phase, while the unmodified chloramphenicol remains predominantly in the

aqueous phase. The top xylene phase was tramferrecl into a fksh tube and back extracted

by the addition of 100 pl of kesh 0.25 M Tris-HCI (pH 8.0). After separating the two

layers by centrifugation, 200 pl of the top xylene layer was added to 5 ml of scintillation

cocktail fluid and counted in a liquid scintillation counter. The counts per minute (cpm)

obtained is a measure of the butyrylated chloramphenicol products.

2Ja P GALACTOSIDASE ASSAY

B gal activity in ce11 lysatu of traDsfected HepG2 cells was assayed according to

Sambrook et al. (1989) and used to correct for transfection efficiency. The assay is based

on the hydrolysis of the glycosidic bond of O-nitrophenyl P-D galactopyranoside

(ONPG) to release P galactose and O-nitrophmol (Kennedy., 1967). The O-nitrophenol

is responsible for the appearance of the fauit yellow color in the reaction mixture.

Essentially, 30 pl of ce11 extract was mixed with 3 pl of lOOx magnesium solution (0.1 M

MgCl,, 4.5 M P rnetacaptoethanol) and 66 pl of a solution of ONPG (Sigma) (4 mg/ml

of 0.1 M sodium phosphate pH 7.5) in a microtitre plate well. The mixture was incubated

at 370C for 45-60 min or until a faint yellow color developed and reaction was stopped

with the addition of 100 pl of 1 M sodium carbonate. The optical density was measured

at 405 nrn using an ELISA plate reader (Molecular Devices). Cell extracts from mock

transfection or buffer was used to blank the ELISA plate reader.

P R E P M O N OF NUCLEAR EXTRACT FROM HEP G2 CELLS

Nuclear extract was prepared fkom HepG2 cens according to Schreiber et al.,

(1989). A 100 mm confluent culture of HepG2 cells was ûypsinized and the cells were

transferred into a microfùge tube and sedimented. The ce11 pellet was washed twice with

PBS, resuspended in 400 pl of hypotonie buffer A (10 mM Hepes (pH 7.9). 10 mM KCI,

0.1 mM EDTA, 0.1 rnM EGTA, 1 m M DTT and 1 mM PMSF) and incubated on ice for

15 min. Twenty five microliters of cold 10% NP-40 was added to the cells and the cells

were vortexed for 10 sec to break the ce11 membrane* The nuclei were sedimented at 4OC

for 30 sec at 10,000 rpm, resuspended in 50 pl of ice cold buffer C (20 m M Hepes (pH

7.9), 400 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT and 1 rnM PMSF) and

rocked for 15 min at 4'C. The tube was centrifuged at 4*C for 5 min at 10,000 rpm and

the supernatant (nuclear extract) was stored in aliquots at -80°C.

Protein concentration of the extract was deteRnitled using Bio Rad Protein Assay

Kit (BioRad Laboratones). The Bio Rad dye reagent was diluted with 4 parts of distilled

water and filtered through Whatman filter papa to remove parliculate matter. Bovine

Semm Albumin (BSA) (1.45 rng/ml, H,O) was used to establish a standard curve.

Dilutions of nuclear extract in buffer C were mixed with 5 ml of the diluted dye reagent,

vortexed and allowed to incubate at room temperature for 30 min. The absorbance of the

mixture was measured at 595 nm. The protein concentration of nuclear extract was

estimated from the BSA standard curve, which was linear usudy between 3-8 &pl.

GENERATION OF OLIGONUCLEOTIDES FOR LABELING

Sense and antisense oligonucleotides (Pl, P3 and P4) were custom synthesized

(AGCT, Toronto) with 5' overhangs to facilitate labeling with Klenow and [u-~*P]~ATP

(3000 Ci/mmol, Amersha.). Oligonucleotide Pl is a 38 bp sequence spanning Bh1474

fiom -53 to -9 and contains the two CCAAT boxes, AAVp5-Inr, a pyrimidine rich

sequence and two minor cap sites. P2 is a 21 bp sequence (-9 to +12) containing the

TdT-like Inr element, the major cap site and the CTFMF1-like consensus. P3 is a 45 bp

sequence (+89 to +130) that contains a TATA-üke sequence located 53 bp upstream of

the ATG codon and a weak cap site. P4 is a 23 bp oligonucleotide (+84 to +107) that

contains the TATA-like sequence alone. Ten micrograms of complementary sense and

antisense oligonucleotides were dissolved in 150 mM NaCl, heated at 80°C for 5 min and

allowed to reanneal by leaving the mixture to cool to room temperature. The double

stranded DNA was then precipitated with two volumes of ethanol and recovered by

centrifugation. P2 was digested with Xbal and Pst1 to generate a 5' overhang. Double

stranded 27 bp E2F oligonucleotide (GATTTAAGTTTCGCGCCCTTTCTCAA) was

kindly provided by Dr. Hamel and used as control in electrophoretic mobility shift assays.

,?J3 LABELING OF OLIGONUCLEOTIDES

Double stranded oligonucleotides were labeled at the 5' end with Klenow and [a-

32~]dATP as described by Sambrook et al., (1989). Pl, P2, P3 and E2F (200-500 ng)

were incubated with 3U of Klenow, 1.5 pl of 10x Klenow bae r , 10 m M of each dNTP

(dCTP, dGTP and dTTP) and 30 pCi of [ a - 3 ? ] d ~ ~ ~ in a total volume of 15 p1 for 30

min at room temperature. The labeled oligonucleotides were separated nom

unincorporated [ ~ J ' P ~ ~ A T P by spin column chromatography on Nick Columns

(Pharmacia) equilibrated with 10 mM Tris-HC1, pH 8.0, containing ImM EDTA. One

microliter of the labeled probe was mixed with scintillation fluid for counting in a (LKB

12 19 Rack Beta Liquid Scintillation Counter) spectrophotometer. Each labeied probe

was diluted to contain 20,000 cpm/pl.

2.24 ELECTROPHORETIC MOBILITY SHIFI' ASSAY (EMSA)

EMSA was perfomed accorduig to the method describecl by Zhang and

Lichtenheld., 1997. Twenty thousand counts per minute of radiolabeled double stranded

oligonucleotide was incubated with a known concentration of HepG2 nuclear extract, 1

pg41 poly dI-dC (Pharmacia) in either buffer Z (8 mM Hepes (pH 8.0), 20 mM MgC12,

100 mM KCI, 1 mM EDTA, 2 mM DTT, 200 mM ZnSO,, 100 pg/ml BSA and 20%

glycerol, in a final volume of 20 pl) (Zhang and Lichtenheld., 1997) or buffer M (60 mM

Hepes, pH 7.9, 6 mM EDTA, 1 mM DTT, 750 @ml, 10% glycerol, 40 rnM KCI, 2.5

rnM MgCl, 20 mM NaCl in a final volume of 21 pl) (GU et al., 1994). Mer 20 min

incubation at room temperature, the DNA-protein complexes were separated by

electrophoresis on a 5% polyacryIamide gel in OSxTBE buffer- The gel was dried and

visudized b y autoraciiography . Unlabeled double stranded oligonucleo tides at 1 0-50

molar excess were used in cornpetitive experirnents. The 132 bp (+26 to 1160) hgment

used as a cornpetitor was excised f?om Bh132CAT construct with Hindlll.

To map the basal promoter and define functionally important cis-acting DNA

elements in the 5' flanking region of the human factor 1 gene, a series of 5' tnincated

fragments were subcloned in the right orientation upstream of the CAT gene in the pCAT

basic reporter plasmid. Al1 the deletion mutants have a variable 5' end but a cornmon 3'

end, e n h g at +160 (with respect to the transcriptional start site designateci as +1) (Fig 8,

left panel). The constnicts were transiently transfected into HepG2 cells and assayed for

CAT activity. As shown on Fig 8, right panel, the pBh1474CAT constmct exhibited an

eighteen fold increase in CAT activity relative to promoterless pCAT and was also 2.7

times as active as the pSV40CAT positive control. pBhl287CAT, containing Bh1474

with a 187 bp 5' deletion, was thirty five times as active as pCAT basic and thus twice as

active as pBh1474CAT. The promoter strength of pBhl029CAT was similar to that of

pBh1287CAT. Removal of the 5' 550 bp fkom pBh1029 to generate Bh479 however

resulted in about 42% loss of promoter activity. The activities of pBh479CAT, and

pBh231CAT were similar to that of pBh1474CAT. The activity of pBh132CAT was

comparable to that of the promoterless pCAT constnict. This suggests that some of the

critical elements of the core promoter resides in a 99 bp region spanning -71 to +28 (Fig

9). This sequence contains two putative CCAAT boxes at -12 and -35, an Spl/AP-2 like

sequence at -62, a TdT-initiator-Like element (Inr) overlying the major cap site (+1), a

pyrimidine rich sequence overlying a minor cap site (-28). a sequence resernbling an

adeno-associated virus p5 (AAVp5)-Inr (-36) and a putative CTF/NF-1 located very close

to the TdT like-Inr element.

pCAT basic D

Rcliiivc Pmmoicr Activiiy (Fold Above pCAT Basic)

Fig 8: Left panel: Deletion construcs of pBh1474 were subcionrd upstrcam of the CAT gene of pCAT basic vector. pBhl2aICAT and pBhl029CAT were genented by cleaving pBhl474 with Ban I I Bçl I I respectively. pBh479 and pBh231CAT were obtained from pBh1287CAT by cleevinç with Nsi 1Pst 1 and BstEIUPst 1 and re-ligating the vector. pBhl32CAT was PCR amplified and subcloned. Right panel: Shows the relative pornoter activity of each construct expressed relative to pCAT basic, a promoterless CAT v-r. HepG2 cells were co-transfected with reporter plesmid and pRSV &Ga1 by calcium phosphate CO-

pcecipitation. To adjust for transfection eniciency, CAT expression obtained by LSC was normalizcd tu O- Ga1 activity. The data represents the average, SEM of three independent experiments.

-7 1 Sp-1 CCAAT BOX - 2 0

TGG~-CTC~AATGGW GGCCA i i i ~~ITGGTTTCAGIT ----- - 0 - -----

AAVp5-lnr Pyrimidine rich sequence AP-2

CCAAT BOX

TdT llke Inr CTF-NF1

Fig 9: Location of putative elements in the 99bp region (-71 to +28) of Bh231. The removal of this region frorn Bh231 resulted in loss of prom- oter activity. Adapted from Bh1474 sequence (fig 6).

In an attempt to M e r characterize the 99 bp sequence to determine the location

of regdatory elements that are essential for factor I expression in hepatocytes, three

subfi-agments of Bh23 1 (Bh206, Bh74 and Bh21) were prepared (Fig 10, left panel),

ligated to pCAT basic vector and assayed for promoter activity (Fig IO right panel).

BU06 (-46 to +160) lacking the 5' 25 bp sequence of Bh23 1 was generated using

Exonuclease III digestion to determine if the SplIAP-2 sequence at the 5' end of Bh23 1

plays a role in factor 1 transcription. A 74 bp hgment (-63 to + 10) was PCR amplified,

subcloned into pCAT and assayed to determine whether the sequence containhg the TdT-

like Inr, AAVp5-Inr, a putative CTF/NE: 1 and two CCAAT box consensus could serve as

factor 1 basal promoter. A double stranded 21 bp oligonucleotide (-12 to +9) containing

the major cap site, TdT-like In. and the CTF/NFl site was synthesized, subcloned into

pCAT and assayed for CAT activity to determine if the sequences surroundhg the

initiator element were sufficient in directhg factor 1 gene expression.

As shown in Fig 10 right panel, the CAT activity of pBh206CAT was seventy six

fold greater than that of pCAT basic control and five fold higher than that of pBh23 1 CAT

indicating the presence of silencer element(s) between -71 to -46. These results taken

together with those in Fig 9 indicate that some cntical elements of the core promoter

resides in a 74bp sequence nom 4 6 to +28. In addition, pBh74CAT and pBh21CAT

were inactive in the CAT assays, suggesting that sequences in Bh206, upstream of Inr

alone, are not sufncient to exhibit promoter activity. Hence, the sequences dowflstream

of the Inr are required for the transcription of the factor 1 gene.

pCAT basic. TU- fike Inr

TATA4 ike S q - CAT

+t60

RcIarwc Promotcr Activilv t FolJ Abovc pCAT Basic)

Fig 10: Left panel: CAT coiistnicrs of p B h l 3 1. pBh206CAT was gcnernted froiii pBh23 LCAT by exo III nuclease digestion. Bh74 was PCR miplilied and subcloned unidircctionally into pCAT basic vector. A 21 bp complimentary oligonucleoiidc was synthesizcd annealed and subcloned into pCAT basic vector to generatc pBhSlCAT. Right panel: The celntivc pro~iioter activity of each construci is expresxd as fold increase above pCAT basic. HepG2 cdls were CO-tnnsfected with reporter constructs and pRSV beta Ga1 by calcium phosphate precipitation CAT e ~ ~ c e s s i o n wvs mmlized to beta Ga1 activity to conect for trandection eficienq. The chta stiown is the mean + SEM of three independent ex'periments. f romter activity was ana1ysed by TLC and LSC. Data show is obtained by LSC.

Control of eukqotic gene expression at the transcriptional level involves the

binding of nuclear proteins to sequence specific sites on the promoter and other

regdatory regions of the gene. In this study, cornpetitive electrophoretic mobility shift

assay (EMSA) was used to localize cis-acting elements upstream and downstream of the

transcription start site in Bh206 that may be important for factor 1 expression in HepG2

cells. Three double stranded oligonucleotides (P 1 -P3) spannllig the BI1206 factor 1

promoter (Fig 11) were interacted with HepG2 nuclear extract and assessed for DNA-

protein band formation in mobility shift gel .

EMSA of Pl, P2 and P3 with HepG2 nuclear extract were performed

using two different buffers, buffet Z (Zhang and Lichtenheld, 1997) and bufFer M (Gill et

ai., 1994). As shown in Fig. 12, P2 and P3 both interacted with HepG2 nuclear extract to

form two distinct bands, a slow migrating band @and 1) and a fast migrating band @and

2). In contrast, Pl interacted with nuclear extract to generate only the fast migrating band

(band 2). Band 1 and band 2 formed with P2 and P3 had simila. electrophoretic

mobilities, but the intensity of band 1 was much stronger with P2 than with P3. Since,

the intensites of band 1 and 2 were greater in experiments using b-er Z than bufFer M

(Fig 12), funue experiments were conducted using Buffer 2. The mobility of band 2

fonned with P 1, P2, and P3 were similar. The specificity of these bands were assessed by

using an

n 1 m

- 4 6 TdT-ltke In! Inverted repeats TATA-like sequence +160 CTF-NF1

Fig II: Location of oligonucleotides used for Mobility Shift Assays. A 38bp (Pl), 21bp (P2), 45bp (P3) and 23bp (P4) seme and axaisense oiigonucleotides were synthesized and annealed to generate double stranded oligonucleotides. Pl (-53 to -9) vans Lhe two CCAAT boses found upstream of the Mtiator element P2 (-9 to + 12), contains the TdT Inr-like element AAVpS-Inr. pyrimidine rich sequence and tk CTF- NF1 site which overiies the major cap site. P3 (+89 to 134) contains the TATA like sequerice located 53bp upsvearn of the ATG codon and minor cap site. P4 (+84 to + 107) contains the dorvnstream TATA-like sequence.

Band 1

Band 2

Fig 12: EMSA of the interactions of labeled double stranded oligonucleotide P l (-53 to - 9). P2 (-9 to +12) and P3 (+89 to +134) with HepG2 nuclear exaact (NE). Pl and P2 were synthesized and amealed to generate double s m d e d oligonucleotides with 5 . overhang. P2 was also synthesized, annealed and digested with Xba 1 and Pst 1 to generate a 5' overhang. Pl , P2 and P3 were labeled with Klenow and a3'p ATP. Each double stranded Iabeled oligonucleohde (20,000 cpm) was incubated with 3 ug of HepGZ NE and 1 pg/$ poly dI-dC for 20 min at room temperature in two different buffers (Z&M) and electrophoresed on a 5% polyacrylamide gel. The gels tvere dned and autondiopaphed overnight. Buffer M contained 60 mM Hepes (pH 7.9). 6 mM EDTA. ImM Dm. 750 pgiml BSA. 10% glycerol, 40 rnM KC1, 2.5 m.!! MgCl,. 20 mM NaCl. Buffer Z contained 8 rnM Hepes (pH 8). 1 mM EDTA. 2 mM DTT. 100 &ml BSA. 20°h glycerol. 100 mM KCl. 20 mM MgCl,. 200 mM ZnSO,. Lane 1: PZ+NE+buffer Z: lane 2 : PZ+NE+buffer M; lane 3: Pl+NE+buffer 2; lane 4: Pl+NE+buffer M; lane j:

64

unrelated oiigonucleotide, E2F. Radiolabeled E2F interacted with HepG2 nuclear extract

to generate a DNA-protein complex whose mobility was similar to band 2 (Fig I3a).

Thus, band 2 may probably be due to nonspecific binding.

in cornpetitive EMS& '*P labeled P2 and 32P labeled P3 probes were competed

with 10 molar excess of Bhl32 and unlabeled double stranded oligonucleotides. As seen

in Fig 13b, the formation of band 1 by labeled P2 was unaffected by 10 molar excess of

P l but completely inhibited by IO molar excess of unlabeled PZ, P3 and the downstrearn

fragment Bh132. Band 2 was only pda l ly inhibited by unlabeled P2, P3, and Bh132,

but not by Pl. To determine whether unlabeled P2 could also inhibit the formation of

band 1 in P3, radiolabeled P3 was interacted with nuclear extract and competed with

unlabeled P2. As shown in Fig 14, band 1, DNA-protein complex formed by the

interaction of HepG2 nuclear extract with labeled P3, was completely inhibited by 10

molar excess of unlabeled P2, P3, P4 ( s u b h p e n t of P3) and Bh132, but not by P l .

Band 2 was partially inhibited by unlabeled P2, P3, P4 and Bh132 but not by P l .

Alignment of the nucleotide sequences of P2, P3 and P4 showed that TCAGC

pentamer was present in both P2 and P3 and a CTGGA motif was present in P2, P3 and

P4 (Fig. 15).

Fig 13: (A) Interaction of E X wiih HepG2 nuclear e m c c (NE). Twenty ihousand CPM of 3 2 ~ lakled E2F (lane 1) was incubated witli HepG2 NE, 0.36 ug (lane 2) and 0.18ug (lane 3) for 20 min at rwm temperature. The mixtures were eleciroplioresed on a 5% polyacrylarnide gel for 2 lus. The gel ws drid and autoradiographed ovemiglit. (B). Cornpetitive EMSA of P2. "P labeled P2 (20,000 CPM) was incubated at m m temperature for 25 min witli 0.18 ug of HepG2 NE in the absence and presence of 10 molnr escess of Bh132 and double m d e d Pl, PZ, and P3. Lane 4: P2 probe; lane 5 : PZ probe + NE; lane 6: PZ probe + NE + unlabeled Pl; lane 7: P2 probe + NE + unlabeled P2; lane 8: PZ + NE + Bli 132; lane 9: P2 + NE + P3. The reactions tvere elatrophoresed on a 5% polyacxylamide gel for 2 hrs, dried and autoradiographed ovemight.

Fig 14: Coinpeiiiivc EMSA of P3. Twcnty il~ousand C P M of "P lnbclcd P3 (P3 probe) $vas incubated ~vith 0.18 ug of HepGZ nuclear estract (NE) in ihc absence and prcscnce of 10 molnr escess of unlakled Bh132 and double sirandcd P3 and P4. Lanc 1: P3 probc; Iane 2: P3 probc + NE; lanc 3: P3 probe + NE + unlabeled P3; lanc 1: P3 probe + NE +unl:ibcled P 1: Innc 5: P3 probe + NE+ unlabcled Bh132: lane 6: P j probe + NE + unlabeled P-l: lane 7: P3 probc + NE+ unlabclcd P?.

P4 AAATTTCAAAAGAATACCTGGAG - +84 +1 07

Fig 15: Alignment of P2. P3 and P4 oligonucleotides used in Mobiiity Shift Assays. CTGGA motif is common to al1 the nucleotides.

DISCUSSION

Complement factor 1 is a plasma serine protease which plays an essential role in

the regulation of both the classical and altemative complement pathways by cleaving C3b

and C4b and preventing the assembly of C3 and CS convertase enzymes, the terminal

sequence and resultant cell darnage. In this study, transcriptional control elernents that

are essential for factor 1 expression in hepatocytes were investigated. As discussed

before (page 32), the transcriptional control regions of eukaryotic protein encoding genes

can be grouped into two categories: the upstream and downstream regulatory elements

and the core promoter. Each gene carries an array of proximal and distal regulatory

elements that can bind sequence specinc DNA binding proteins to activate or repress

transcription initiation (Tijian and Maniatis, 1994). The core promoter on the other hand

nucleates the assembly of an initiation complex containing RNA polyrnerase II and an

array of accessory proteins (T'FILA, TFIIB, TFIID, TFIIE, TFIIF, TFEH). To identiQ

sequences in the 5' flanking region of the factor I gene involved in its expression, 5'

tnuications of the factor 1 promoter region were linked to a CAT reporter plasmici,

transfected into HepG2 cells and assayed for CAT actwity. The 1474 bp 5' flanking

region of the factor 1 gene (Bh1474) was 18 fold more active in CAT activity relative to

pCAT basic controi and also 2.7-fold more active than pSV40CAT in driving the

expression of the CAT gene in HepG2 cells. Deletion mutagenesis experiments indicated

that the elernents essential for basal transcription raide in a 74 bp sequence from -46 to

+28. In addition, three upstream regions were identified which may participate in the

regulation of the expression of the gene. Removal of the h t 179 bp region from the 5'

end of Bh1474 resulted in a two-fold increase in the promoter activity, suggesting the

70

presence of negative controlling element(s) in this region. A closer examination of the

179 bp region shows a sequence resembling the rat collagen silencer consensus

(CACCTCC) (Chou et al., 1991) at position -1304 and -1250 (Y8 match). When the

sequences between -869 and -3 19 were deleted, a two fold decrease in promoter strength

was observed. This suggests the presence of an enhancer elcment(s) in this region. A

putative CCAAT box motif (7/9) located in this region between -665 to -672 may be a

likely candidate. Finaily, the removal of a 25 bp sequence between -71 to -46 resulted in

5 fold increase in promoter activity, suggesting the presence of another negative

regulatory elernent(s). This region contains an AP-2 element which partially overlaps an

Spl site. Since the removal of this region resulted in an upregulation of factor 1

transcription, it is unlikely that the members of the Spl family of proteins are involved.

AP-2 transcription factors have been shown to exert inhibitory effects. However, since

AP-2 itself is not expressed in HepG2 cells (Cunming and Clemmons., 1995), it is

possible that other members of the AP-2 family of proteins may be involved. The

identity of the regulatory elements in these three regions and their role in the

transcriptional regulation of factor 1 gene remains to be M e r investigated.

The deletion mutagenesis analysis also demonstrated that elements essential for

core promoter activity reside in a 74 bp region located between -46 and +28. This region

contains (a) two CCAAT boxes located at - 12 and -35 (8/9 and 7/9 match respectively),

(b) a TdT-like Inr element, [5/8 match with the TdT Inr element (CTCANTCT) (Smale et

al., 1990)l overlying the major transcription star t site, (c) AAVpS-Inr-iike sequence

(CTCCATTTT) (Shi et al., 1991) located at 4 0 (719 match), and (d) a pyrimidine rich

sequences (TTTCAGTTA) at position -30 which is homologous to eukaryotic consensus

71

transcription initiator sequence (YYCAYTY) (6/7 match) (Smale and Baltimore., 1989).

Since this region lacks a TATA box, but contains a TdT-like Inr located at the major

transcription start site, it is possible that factor 1 promoter is a TATA-less Inr dependent

class 11 promoter.

Initiators are weakly conserved elements that overlap the transcription start site

and are hctionally analogous to the TATA box (Reviewed by Weis and Reinberg.,

1992; Smale., 1994). The mitical nucleotides in the Inr elernent are the A at +1 and the T

at +3 and significant Inr activity is exhibited when the 5'-ANT-3' (N-is any nucleotide)

is surrounded by two to three pyrimidines at position -1 to -5, +4 and +S. The

pyrimidines at +4, +5,4 and -2 appear to be more important than the ones at -3.4, and -5

(Srnale., 1994). An examination of sequence surroundhg the major cap site (-5

ATTTCAGCCA +5) of the factor I gene shows an A at +1, a C instead of a T at +3, (both

of which are pyrimidines) and pyrimidines located at +4, -1 and -2. Thus, the factor 1

Lnr is quite homologous to other functional initiators (Smale., 1989, Kollmar and

Fadam. , 1993; Means and Famham., 1990).

Several studies have shown that sequences upstream a d o r downstream of the tnr

may be crucial for promoter activity. In this shidy, a CAT constmct containing the

sequences surromding the major transcription initiation site (Bh21) and a construct

containing the major cap site and two upstream CCAAT-like sequences (Bh74) were both

unable to support transcription. Furthemore, the Bh 132CAT constnict that contained the

region from +26 to +160 domtream of the major start site was ais0 unable to support

transcription. This suggests that sequences both upstream of +26 and downstream of the

cap site are required for factor 1 promoter activity in HepG2 ceus.

72

To detemine the location of proximal regulatory elements in the Bh206 factor 1

promoter sequence that may be involved in factor 1 expression, three double stranded

oligonucleotides complernentary to (a) the two CCAAT box consensus elements

upstream of the Inr (-53 to -9) Pl; (b) the Inr element (-12 to +9), P2 and (c) the

downstream TATA-Like sequence and a minor cap site (+89 to +130), P3 were

radiolabeled and incubated with HepG2 nuclear extract and assessed for DNA-protein

binding in a mobility shift assay. PZ and P3 both formed two DNA-protein complexes

@and 1 and band 2) with sirnilar mobilities. Pt only formed a singe band whose

migration pattern was simiIar to band 2. An unrelated probe, EZF, aIso generated a single

complex when interacted with HepG2 nuclear extract with migration pattern similar to

band 2. Since a11 the probes as well as E2F exhibited this band, it is possible that the

complex in band 2 may be due to nonspecific interactions. Band 1 in P2 and P3 appeared

to be specific, since they could be competed by their unlabeled oligonucleotides and the

band was not evident with E2F. The complex in band 1 formed with P2 could be

Uihibited by unlabeled P3 and the band 1 complex formed with P3 could also be cross-

competed with unlabeled P2. This raises the possibility that P2 and P3 may be

interacting with a common nuclear factor to generate band 1. Alignment of P2 and P3

oligonucleotides showed two pentamers -TCAGC- and -CTGGA- in both sequences. An

unlabeled double stranded O ligonucleo tide containhg the TATA-like sequence and the

CTGGA motif (P4) but not the TCAGC pentarner inhibited the formation of the

interactions of P2 or P3 with nuclear extracts. This observation tends to suggest that the

CTGGA motif may be responsible for the generation of band 1. The -CTGGA- motif,

found downstream of the transcription start site, has been shown to be important in the

73

transcriptionai regdation of two TATA-less genes, the TdT gene (+2

TTCTGGACAC+Il) and human porphobilinogen deaminase gene (Beaupain et al..

1990; Weis and Reinberg., 1992). This CTGGA motif is present upstream of the Inr in

P2, but the same motif is also present downstream of the In. in P3 and P4. The

possibility that the transcription factor may interact with multiple motifs on the factor 1

promoter cannot be at present eliminated.

The identity of the nuclear factor in band 1 is at present unknom. To date a

number of sequence specific DNA binding proteins have been recognized to bind to the

Inr element and to aid in the assembly of the preiaitiation complex. These include RNA

polymerase II itself (Carcarno et al.,1991), E2F (Means et al., 1992), YY1 (Usheva and

Shenk, 1994), upstream stimdating factor (USF) (Du et al., 1993) and initiator factor,

TFII-1 (Roy et a1.,1993). YY1, TFII-1 and USF have been shown to stimulate

transcription through the Inr element in those TATA-less initiator dependent class II

promoters where the factors were initially recognized (Du et al., 1993). TFII-1, 120 kD

protein, has been shown to bind to Inr element of the adenovirus major late promoter

(Ad-ML), the TdT and the human immunodeficiency virus promoter (Roy et al., 199 1).

Since factor 1 contains an initiator element resembling the TdT h, it is possible that band

1 may be a complex of P2 and TFII-1. TFII-1 has been shown to recognize the USF

binding site in the major late promoter with greater affinity than USF itself and this

interaction is thought to be through a different motifs (Roy et ai., 1991). Since TFII-1

contains multiple binding motif, it is possible that this protein codd recognize other

consensus sequences. YY1 has been reported to bind to the AAVpS-lnr element

(CTCCATm). A sequence homologous to the AAVpS-In. is present at -35 close to

74

one of the rninor cap sites (Fig 9). In this study, a stable DNA-protein complex was not

detected between nuclear extract and P 1, an oiigonuc leotide containing this motif.

The Ets family of transcription factors have also been show to bind specifically

to a sequence (UA GGA A/T) which is similar to the common motif CTGGA. These

factors are important for transcription from certain TATA-less promoters. Ets proteins

have been implicated in regdation of gene expression during a variety of biological

processes, such as growth control, transformation, T-ce11 activation and developmental

prograrns in many organisms (Wasylyk et al., 1993).

Foo t printing analysis on various Inr-dependent promot ers have estab lished the

role of TBP-associated factors (TAF), components of TFIID, as the uIr recognition

factors. TAFI50 and TAF60, in addition to binding to the Inr element, also contact the

downstream regions (Gilrnour et al., 1990). Several studies have also shown that TATA-

like elements located downstream of the transcriptional start site can bind TBP and play a

role in the assembly of the pre-initiation complex of Inr dependent class II promoters

(Carcamo et al., 1990). It is possible that the inverted repeat localized between the Inr

element and the TATA-like sequence in the factor 1 promoter region may serve to place

the Inr-like and TATA-like elements in close proximity such that the TBP binds to the

TATA-like sequence while the TAFs contact the Inr. The possible cooperation of the Inr

and TATA-like sequence in the assembly of the preinitiation complex should therefore be

explored in the factor 1 promoter. The role of T F D in Inr-dependent gene transcription

may offer an explanation for the requirernent of the downstream region in factor 1

expression.

c This study has identified the core pmmoter and three regulatory regions in the

S'flanking region of the factor 1 gene. Further studies employing Linker scanning

mutagenesis should be used to M e r id&@ other fiuictionally relevant sequences in

the BU06 plasmid as well as in the three upstream regulatory regions.

Site-directed mutagenesis of putative cis sequences in Bh206, such as the two

CCAAT boxes, Inr, TATA-Like sequence, the CTGGA and TCAGC pentamer repeats,

should also be used to m e r delineate the functional relevance of these sequences in the

constitutive expression factor 1. Identified functionai cis-sequences shodd be assessed

for their ability to bind nuclear extract in mobility shifi assays. Super shift assays can

then be employed to identie the transcription factor(s) involved in factor 1 expression.

CAT assays as well as mobility shift assays should also be used to analyze the tissue-

specific expression of factor 1.

Since the Bh1474 promoter contains potential consensus elements such as

glucocorticoid response element (GRE), y-IFN response element, y-IFN activating

sequence (GAS), interferon stimulating response element (ISRE), IL4 response element,

IL-6 response element and several AP 1 sites (Fig 6), the potential effects of

glucocorticoids, and idammatory cytokines (including y-UN, IL- 1, IL-6, TNF and

retinoic acid) in the regulation of expression of the factor 1 gene should be investigated.

REFERENCES

Abramson N., Alper C.A., Lachrnann P.J., Rosen F.S. and Jandl J.H. (1971).

Deficiency of C3 inactivator in man. J. Imrnunol. 107: 19.

Adams E.M., Brown MC, Nunge M., Krych M. and Atkinson S.P. (199 1).

Contribution of the repeating domains of membrane cofactor protein (CD46) of

the complement system to ligand binding and cofactor activity. I. Immunol. 147:

3005.

Aruffio B.A., Melnick M.B., Linsley P.S., and Seed B. (1991). The lymphocyte

glycoprotein CD6 contains a repeat domain structure and characteristic of a new

farnily of ce11 surface and secreted proteins. J. Exp. Med. 1 74: 949.

Asghar S.S. (1995). Membrane regdators of complement activation and their

aberrant expression in diseases. Laboratory Investigation 72: 254.

Beaupain D., Eleouet J., Romeo P. (1990). Initiation of transcription of the

erythroid promoter of the porphobilinogen deaminase gene is regulated by a cis-

acting sequence around the cap site. Nucleic Acid Res. 18: 6509.

Bhakdi S., Fassbender W., Hugo F., Carreno M.P., Berstecher C., Maiasit P. and

Kazatchkine M..D. (1 98 8). Relative inefficiency of terminal cornplement

activation. J. h u n o l . 141 : 3 1 17.

Bohnsack J.F., and Cooper N.R. (1988). CR2 ligands modulate human B ce11

activation. J. Tmmunol. 141 : 2569.

Bonnin A.J., Howard J., Zeitz and Gewurz A. (1993) Complement factor 1

deficiency with recurrent aseptic meningitis. Arch. Intem. Med. 1 53 : 1380.

Buchner H. (1 8 89). Ueber di nahere Naturder bektenentodtendon substanz im

blutsem. Central Bakter Parasitol. 6: 561

10, Bora N.S., Lubin D.M., Kumar B.V., Hockett R.D., Holers V.M. and Atkinson

J.P. (1989). Stmchiral gene for human membrane cofactor protein (MCP) of

complement maps to within 100 base pair of the 3' end of C3blC4b receptor gene.

J. Exp. Med. 169: 597.

11. Breathnach R. and Chambon P. (1981). Urganization and expression of

eukaryotic split genes coding for proteins. Ann. Rev. Biochem. 50: 349.

12. Burley and Roeder. (1996). Transcription factor IID. Am. Rev. Biochem. 65:

769.

13. Burgi B., Brunner T., Dahinder C. A. (1994). The degradation products of the

C5a anaphylatoxin C5a desarg retains basophil activating properties. Eur. J.

Immunol. 24: 1583.

14. Campbell R.D., Gagnon J., Porter R.R. (1981). Amino acid sequence around the

thiol and reactive acyl groups of human complement component C4. Biochem. J.

199: 359.

15. Catterall CF., Lyons A.L., Sim RB., Day A.J., Harris T.J.R (1957).

Characterization of primary amino acid sequence of human complement control

protein factor 1 nom an analysis of cDNA clone. Biochem. J 242: 849.

16. Carcamo J., Maldonado E., Ahu M., Ha I., Kasai Y.. Flint J. and Reinberg D.

(1 990). A TATA like-sequence located downstream of transcription initiation site

is required for expression of an RNA polymerase II transcnbed gene. Genes and

Dev. 4: 1611.

17. Carcamo J., Buckbinder L., and Reinberg D. (1991). The initiator directs the

assembly of a transcription factor 1 ID-dependent transcription complex. Roc.

Natl. Acad. Sci. USA 88: 8052.

18. Carreno M.P., Labarre D., Maillet F., Jozenfowicz M., and Kazatchkine. (1989).

Regdation of the human alternative complement pathway: Formation of a ternary

complex between factor H, surface-bomd C3b and chernical groups on

nonactivating d a c e s . Eur. J. unmMol. 19: 2145.

19. Chou J.L., Romahel Rey and Tsui L. (1991). Characterization of the promoter

region of the cystic fibrosis transmembrane conductance regulator gene. I. Biol.

Chm. 266: 24471.

20. Chung L.P., Bentley D.R., and Reid K.B.M. (1985). Molecula. cloning and

characterization of the cDNA coding for C4-biading protein, a regdatory protein

of the classicai pathway of human complement system. Biochern. 1.230: 133.

2 1. Choy B. and Green M. (1 993). Eukaryotic activator function during multiple

steps of preinitiation cornplex assembly. Nature 366: 53 1.

22. Colomb M.G., Arlaud G.J., Villiers CL. (1984). Activation of C 1. Philos.

Trans. R. Soc. London 306: 283.

23. Cooper N.R-, and Muller-Eberhard HJ. (1970). The reaction mechanism of

human C5 in immune hemolysis. J. Exp Med. 132: 775

24. Cooper N.R., Moore MD., and Nenerow G.R. (1988). Tmmunobiology of CR2,

the B lymphocyter receptor for Epstein-Barr virus and the C3d complement

hgment. Annual Review of Immunology 6: 85.

Cooper N.R., Nemerow G.R. (1983). Complernent, h s e s and virus infected

cells. Sprhger Semin. Immunopathol. 6: 327.

Courtois G., Baumhueter S., Crabtree G.R. (1988). Punfied hepatocyte nuclear

factor 1 interacts with a family of hepatocyte-specific promoters. Roc. Natl.

Acad. Sci. USA. 85: 7937.

Coyne K.E., Hall S.E., Thompson S., Arce M.A., Kinoshita T., Fujita T., Anstee

D.J., Rosse and Lublin D.M. (1992). Mapping of epitopes, glycosylation sites

and complement regdatory domains in human decay accelerating factor. J.

Lmmunol. 149: 2906.

Cui W., Hourcade D., Post T.W., Greenlund A.C., Atkinson J.P. and Kumar V.

(1 993). Characterization of the promoter region of the membrane CO factor protein

(CD46) gene of the human complernent system and cornparison to a membrane

CO factor protein-like genetic element. J. h u n o l . 1 5 1 : 4 137.

Cunming D. and Clemmons D. (1995). Transcription factor AP-2 regulates

human Insulin like growth factor binding protein 5 gene expression. J. Biol.

Chem. 270: 24844.

Dahlback B., and Podack E.R. (1985). Characterization of human S protein, an

inhib itor of the membrane attack complex. Biochemistry 25 : 6740.

Dangott L.J, Jodan J.E., Bellet RA. and Garberg D.L. (1989). Cloning of the

mRNA for the protein that crosslinks to the egg peptide speract. Proc. Natl Acad.

Sci. USA- 86: 2128.

Davies A.E. (1981). The C3b inactivation of the human cornpiement system:

homology with serine proteases. FEBs Lett. 134: 147.

33. Davies A.E., Whitehead A.S., Hanison R.A, Dauphinais A.. Bruns G.A.P.,

Cicardi M. and Rosen F.S. (1986). Human inhibitor of the fïrst cornponent of

complement, C 1 : Characterization of cDNA clones and localization of the gene

to chromosome 1 1 . Proc-Natl. Acad-Sci. USA. 83: 3 16 1.

34. Davies M.A., Simmons DL., Hale G., Harrison R.A., Tighe H., Lachmaun P.J

and Waldrnann H. (1 989). CD59, an LY-6 like protein expressed in human

lymphoid cells regulates the action of the membrane attack complex on

homologous ceils. J.Exp. Med. 170: 637.

35. Davies M.A., Low M.G and Nussenzweig V. (1986). Release of decay-

accelerating factor PAF) fiom the cell membrane by phosphatidylinositol-

specific phospholipase C (PPLC). Selective modification of a complement

regdatory protein. J. Exp. Med. 163: 1 150.

36. de Bruijin M.H., and Fey G.H. (1985). Human complement component C3.

cDNA coding sequence derived primary structure. Proc. Natl. Acad. Sci. USA.

83: 708.

37. DiScipio R G., Gehring M.R., Podack E.R, Kan C.C., Hugli T.E. and Fey G.H.

(1984). Nucleotide sequence and derived amino acid sequence of human

complement component. Proc. Natl. Acad. Sci. USA. 81: 7298.

38. DiScipio R. G., and Hugli T.E. (1989) The molecular architecture of Human

complement component C6. J. Biol. Chem. 264: 16197.

39. Dodds A.W., Sim R.B., Porter RA. and Kerr M.A. (1978). Activation of the k t

cornponent of human complement (Cl) by antibody-antigen aggregates.

Biochem. J. 175: 383.

Du, H., Roy A. L., and Roeder R. G. (1993). Human transcription factor USF

stimulates transcription through the initiator elements of the HIV-1 and the AdML

promoters. EMBO J. 12: 501.

Dynlacht B.D., Hoey T. and Tijian R. (1991). Isolation of CO-activators

associated with the TATA-binding protein that mediates transcriptional activation.

Ce11 66: 563.

Ebanks R. (1995). Studies on the localization and characterization of the CS and

C2 binding sites in the fourth component of complement. Thesis. U of T.

Ehrlich P., Morgenoth J. (1899). Zur theorie der lysenwirkung. Berlin Klin

Wschr 36: 6.

Emili A. and Ingles C.J. (1995). The RNA polymerase II carboxy-tenninal

domain links to a bigger and better holoenzyme. Current Opinion in Genetics and

Development. 5: 204.

Fearon D.T. (1 977). Purification of C3b inactivator and demonstration of its two

polypeptide chah structure. J. Immunol. 119: 1248.

Fearon D.T., Austen K.F. (1975). Properdin bhding of C3b and stabilization of

the C3b- dependent C3 convertase. J. Exp. Med. 142: 856.

Fearon D.T., Ahearn J.M. (1989). Complement receptor 1 (C3bK4b receptor;

CD39 and complement receptor 2 (C3d/Epstein-Barr vins receptor, CD21)

Curr. Topics Microbiol. Immunol. 153: 83.

Fischer E., Delibrias C., Kazatchkine M.D. (1991). Expression of CR2 (the

C3dgEBV receptor, CD21) on normal human peripherai blood T lymphocytes.

J. Immunol. 146: 865.

Freeman M., Ashkenas J., Rees D.J.G., Kingsley D.M., Copeland N.G-, Jenkins

N.A., and Krieger M. (1990). An ancient, highly conserveci family of cysteine-

rich protein domains revealed by cloning type 1 and type II murine macrophages

receptors. Proc. Natl. Acad. Sci. USA. 87: 8810.

Gill R.M., Hamel P.A., Zhe J., Zacksenhaus E., Gallie B.L. and Phillips R.A.

( 1994). Characterization of the human RB 1 promoter and of elements involved in

transcriptional regdation. Ce11 growth and differentiation 5: 467.

Gilmour D. S., Dietz T. J., and Elgin S. C. R. (1990). UV crosslinking identifies

four polypeptides that require the TATA box to bind to the Drosophila hsp7O

promoter. Mol. Cell. Biol. 10,4233.

Goldberger G., Arnaout M.A., Kay R., Rita M., and Colten H.R. (1984)

Biosynthesis and postsynthetic processing of Human C3bK4b inactivator (Factor

1) in three hepatoma ce11 lines. J. Biol. Chem. 259: 6492.

Goldberger (3.9 Bruns G.A.P, Rita M., Edge M.D. and Kwiatkowski D.J. (1987)

Human complement Factor 1. J. Biol. Chem. 282: 1.

Gonzalez S., and Lopez-Larrea C. (1996). Characterization of the human C6

promoter. J. Immunol. 157: 228.

Gotze O., and Muiler-Eberhard H.J. (1976). The alternative pathway of

complement activation. Adv. Immunol. 24: 1.

Gotze O., and Muller-Eberhard H.J. (1971). The C3 activation system: An

alternative pathway of complement activation. J. Exp. Med. 1 34: 90s.

Gotze 0. (1975). Proteases of properdin system. In proteases and biological

control. Edited by E. Reich, D.B Rifier and E. Shaw. pp 155-272. Cold Spring

Habor Labomtory, Cold Spring Harbor, New York.

Gulati P., Guc D., Lemercier C., Lappin D. and Whaiey K. (1994). Expression of

the components and regulatory proteins of the classical pathway of complement in

normal and diseased synovium. Rhematol. Int. 14: 13.

Harrison R.A., Thomas M.L., and Tack B.F. (1981). Sequence detennination of

the thiol ester site of the fourth component of human complement. Roc. Natl.

Acad. Sci. USA. 78:7388.

Harrison RA. and Lachmann P.J. (1980). The physiological breakdown of the

third component of hurnan complement. Mol. Immunol. 17: 9.

Hemandez N. (1993). TBP, a universai eukaryotic transcription factor? Genes

Dev. 7: 1291.

Herz J., Hamann U., Rogne S., Myklebost O., Gausepohl H. and Stanley K.K.

(1988). Surface location and high &ty for calcium of a 500 kD liver

membrane protein closely related to the LDL-receptor suggest a physiological role

as lipoprotein receptor. EMBO. 7: 41 19.

Hillarp A., Pardo-Manuel F., Ruiz RR, Rodriguezde-Cordoba S. and Dahlback

B. (1 993). The human C4b-binding protein beta-chah gene. J. Biol. Chem. 268:

15017.

Hillarp A. and Dahlback B. (1988). Novel subunit in C4b-binding protein

required for proteins binding. J. Biol. Chem. 263: 12759.

65. HiUarp A. and Dahlback B. (1990). Cloning of cDNA coding for the f3 chain of

human complement component C4b-binding protein. Sequence homology with

the a chah Proc. Natl. Acad. Sci. USA. 87: 1 183.

66. Howard O.M.Z., Rao A.G. and Sodetz J.M. (1987). Complementary DNA and

derived amino acid sequence of the beta subunit of human complement protein

C8. Identification of a close structura1 and a n c e s a reiationship to the alpha

subunit and C9. Biochemistry 26: 3565.

67. Huang H.J.S., Jones N.H., Strominger J.L., and Herzenberg. (1987). Molecular

cloning of LY-1, a membrane glycoprotein of mouse T-lymphocyte and a subset

of B cells: molecular homology to its human counterpart Leu-1/T1 (CD5). hoc.

Natl. Acad- USA. 84: 204.

68. Hugli T. E. (1 986). Biochemistry and biology of anaphlylatoxin. Complement 3:

111.

69. Hugli T.E. (1975). Human anaphylatoxin (C3a) f?om the third component of

complement: primary structure. J. Biol. Chem. 250: 8293.

70. Iida K., and Nussenzweig V. (1981). Complement receptor is an inhibitor of the

complement cascade. J. Exp. Med. 153: 1 138.

71. Jeme D., and Tschopp J. (1992). Clusterin: the intriguing guises of a widely

expressed glycoprotein. Trends Biochem. Sci. 17: 154.

72. Julen H., Dauchel C., Lamercier C., Sim R.B., Fontaine M., and Ripoche J.

(1992). In vitro biosynthesis of complement factor I by human endothelid cells.

Eur. J. Tmmunol. 22: 213.

Kaidoh T. and Gigli 1. (1987). Phylogeny of C4b-C3b cleaving activity. Similar

bgmentation patterns of human C4b and C3b produced by lower animal. J.

Immunol. 139: 194.

Kennedy E.P. (1967). Mechanism of hydrolysis of O-nitrophenyl P galactoside

of staphylacocus aueus and its significance for theories of sugar transport.

Proc. Natl. Acad. Sci. USA. 58:225.

Kim Y.U., Carroll M.C., Isenman D.E., Nonka M., Pranoon J., Ago P., Takeda J.,

houe K., Kinoshita T. (1992). Covalent binding of C3b and C4b within the

classical complement pathway C5 convertase. Determination of amino acid

residues involved in ester-Mage formation. J. Biol. Chem. 267: 4 1 7 1.

Klickstein L.B., Wong W.W., Smith LA., Morton C., Fearon D.T., Weis J.H.

(1985). Identification of long homologue repeat in human CRI. Complement

2: 44.

Kolb W.P., Muller-Eberhard H.J. (1976). The membrane attack complex

mechanism of complement: the three polypeptide chab structure of the eighth

component. J.Exp. Med. 143: 1 13 1.

Koleske A.J. and Young RA. (1994). An RNA polymerase Ki holoenzyme

responsive to activators. Nature 368: 466.

Koliman R., Famham P.J. (1993). Site specific initiation of transcription by

RNA polymerase II. Proc. Soc. Exp. Biol. Med. 203: 127.

Kxych M.L., Clemenza D., Howdeshell R, Hauhart D., Hourcade and Atkinson

J.P. (1994). Analysis of the fiuictional domains of complement receptor type 1

(C3b/C4b receptor; CD35) by substitution mutagenesis. J. Biol. Chem. 269:

13273.

81. Kunnath Muglia L.M., Chang G.H., Day A.J., Ezekowitz R.A.B. (1993)

Characterization of Xenopus laevis complement factor 1 structure - conservation

of modular structure except for an unusual insert not present in human factor 1.

Mol. Imrnunol. 30: 1249.

82. Law S.K., and Levine RP. (1977). Interaction between the third cornplement

protein and ce11 surfaces. Proc. Natl. Acad. Sci. USA. 74: 270 1 .

83. Law S.K. (1983). Non-enzymatic activation of the covalent binding reaction of

the complement protein C3. Biochernical J. 2 1 1 : 3 8 1.

84. Law S.K., Lichtenberg N.A., Levine R.P. (1979). Action of the C3b inactivator

on the ce11 bound C3b. J. Immiuiol. 123: 1388.

85. Law S.K., and Reid K.B.M. (1995) Cornplment. EU press, Oxford UK.

86. Lepow I.H., Willms-Kretschmerk, Patrick R.A. and Rosen F.S. (1970). Gross and

ultrastruchual observations of lesions produced by intradermal injection of human

C3a in man. Amencan Journal of Pathology 6 1 : 13.

87. Lublin D.M., and Coyne ICE. (1991). Phospholipid anchored and transmembrane

forms of either decay accelerating factor or membrane cofactor protein show

equal efficiency in protection from complement-mediated ce11 damage. J. Exp.

Med. 174: 35.

Lublin D.M., Liszewski M.K., Post T.W., Arce M.A., LeBeau M.M., Rebentisch

M.B. (1 988). Molccular cloning and chromosomal localization of human

membrane cofactor protein (MCP). J. Exp. Med. 168: 1 88

Lublin D.M. and Atkinson J.P. (1989). Decay-accelerating factor: biochemisûy,

molecular biology and bctions. Ann. Rev. Immunol. 7: 35

Lu J.H., Thiel S., Wiedemann H., Timpl R and Reid K.B.M. (1990). Binding of

the pentamerhexamer forms of mannan binding protein to zymogen activities the

proenzyme Clr,C 1 s, complex of the complement pathway of complement without

the involvement of Clq. J. Immunol. 144: 2287.

Mayer M.M. (1980). Transmembrane channels produced by complement

proteins. Am. NY. Acad. Sci. 358:43.

McNearney T., Ballard L., Seya T., and Atkuison. (1989). Membrane cofactor

protein of complement is present of on human fibroblast, epithelial, and

endotheiial cells. J. Clin. Invest. 84: 538.

Means A. and Famham P. (1990). Transcription initiation fiom the dihydrofolate

reductase promoter positioned by HlP 1 binding at the initiation site. Mol. Ce11

Biol. 10: 652.

Means A.L., Slansky J.E., McMahon S.L., Knuth M.W and Farnham P.J. (1 992).

The HIP-1 binding site is required for growth regulation of the dihydrofolate

reductase gene promoter. Mol. Celi Biol. 12: 1054.

Medicus R.G., Melamed J., h o u t M.A. (1983). Role of human factor 1 and

C3b receptor in the cleavage of surface-bound C3bi molecules. Eur. J. of

h u n o l . 13(6): 465.

Medicus R.G., Scheiber RD., Gotze 0. and Muller-Eberhard H.J. (1976a). A

molecular concept of the properdin pathway . Proc. Natl. Acad. Sci. USA 73 : 6 1 2.

Medof M.E., Walter E.I., Roberts W.L., Haas R. and Rosenberry T.L. (1986).

Decay accelerating factor of complement is anchoreci to cells by a C-temiinal

glycolipid. Biochern. 25: 6740.

Meri S., Morgan B.P., Davies A., Daniels R.H., Olavesen M.G., Waldmann H.,

Lachmann P.J. (1990). Human protectin (CD59) an 18,000- 20,000 molecular

weight complement lysis restricting factor, inhibits CS-8 catalysed insertion of

C9 into bilayer. hnmunol. 71 : 1.

Minta J.O. and Lepow I.H. (1974). Shidies on the subunit structure of human

properdin. Immunochemisûy 1 1 : 36 1-8.

&ta J.O., Wong M., Kozak CA, Kunnath-Muglia and Goldberger G. (1996)

cDNA cloning, sequencing and chromosomal assignment of the gene for mouse

complement factor I (C3bIC4b inactivator): Identificatim of a species specific

divergent segment in factor 1. Molecula. Immmology 33: 10 1.

Minta J.O., Fung M., Turner S., Eren R, Zemach L., Rits M., Goldberger G..

(1 998). Cloning and characterization of the promoter for the human complement

factor 1 (C3bX4b Inactivator) gene. In Press.

Miyagoe Y., Galibert M., Georgatsou E., Fourel G. and Meo T. (1994). Promoter

elements of mouse complement C4 gene cntical for trancriptional activation and

start site location. J. Biol. Chern. 269: 8268.

Morgan P. (1 995). Physiology and pathophysiology of complement progress and

trends. Critical reviews in Clinical Lab. Sciences 32: 265.

Morgan P., Raab H., Kohr W.J. and Caras LW. (1991). Glycophospholipid

membrane anchor attachment. Molecular anaiysis of the cleavage/attachment site.

J. Biol. Chem. 266: 1250.

Morgan P. and Caras LW. (1991). Fusion of sequence elements h m non-

anchored proteins to generate a hilly functional signal for

glycophosphatidylinisitol membrane anchor attachment. J. Ce11 Biol. 1 1 5 : 1 595.

Muller-Eberhard H.J. (1975). Complement. Annu. Rev. Biochem. 44: 697.

Muller-Eberhard H.J., Nilsson U. (1960). Relation of a P glycoprotein of human

senun of the complement systern. J.Exp. Med. 1 1 1 : 2 1 7.

Muller-Eberhard H.J. (1988) Molecular organization and function of the

cornplement syçtem. AM. Rev. Biochem. 57: 32 1.

Muller-Eberhard H.J. (1986). The membrane attack complex of cornplement.

Ann. Rev. h u n o l . 4: 503.

Nakano Y., Sumida K., Kikuta N., Muira H., Toba T., and Tomita. (1992).

Complete determination of disulfide bonds localized within the short consensus

repeat units of decay accelerating factor (CD55 antigen). Biochem. Biophy. Acta

11 16: 235.

Nagasawa S., Ichihara C., and Stroud R (1980) Cleavage of C4b and C3b

inactivator: production of a nicked form of C3b and C4b, as an intemediate

cleavage product of C3b by C3b inactivator. J. Immunol. 125578.

1 12. Nelson R.A., Jensen J, Gigli 1, and Tamura N. (1 966). Methods for the

separation, purification and measurement of nuie cornponents of hemolytic

complement in guinea-pig senun. Immunochemistry 3: 1 1 1.

113. Nemerow G.R., Yamamoto K., Lint T.F. (1979). Restriction of C-mediated

membrane damage by the eigth component of complement: a dud role for C8 in

the complement attachment sequence. J.Immuno1. 123 : 1 245.

1 14. Nicholson-Weller A. (1 992). Decay accelerating factor (CD55). In Parker CM

ed. Membrane defenses against attack by complement and perforins. pp 7-30.

Berlin Springer.

115. Nilsson U.R., Tomar R.H., Taylor F.B. Jr. (1972). Additional shidies of human

CS development of a modified purification method and characterization of the

purified product by polyaczylamide gel electrophoresis. Immunochemisîry 9:

709.

116. Nuttal G. (1888). Experimente Uber die bakterienferdilichen einflusse des

thienschen korpers. Z Hyginfektionskr 4: 3 54.

117. Ogata R.T., Mathias P., Bradt B..M., and Cooper N.R. (1993). Murine C4b-

binding protein. Mapping of the ligand binding site and the N-terminal of the pre-

protein. J. Lmmunol. 150: 2273.

118. Pangburn M.K., Schreiber R.D. and Muller-Eberhard H.J. (1977) Human C3b

inactivator: isolation, characterization and demonstration of an absolute

requirement for s e m protein for cleavage of C3b and C4b in solution. J. Exp.

Med. 144: 257.

119. Pangbum M.K., and Muller-Eberhard H.J. (1978). Complement C3 convertase:

ceU surface Cestriction of B1H control and generation of restriction of

neuroaminidase treated cells. Proc. Na& Acad. Sci. USA 75: 2416.

120. Pangbum M.K., Muller-Eberhard H.J. (1984). The alternative pathway of

complement. Springer Semin. Immunopathol. 7: 163.

12 1. Pangbum M.K. (1 986). Differences between the binding sites of the complement

regulatory proteins DAF, CRI and factor H on C3 convertases. J. Immunol. 136:

2216.

122. Pangbum MK, Muller-Eberhard H.J. (1 980). Relation of a putative thioester

bond in C3 to activation of the alternative pathway and binding of C3b to

biological targets of complement. J.Exp. Med. 152: 1 102.

1 23. Pardo-Manuel F., Rey-Campos J., Hillarp A., Dahlback B. and Rodriguez-de-

Cordoba. (1 990). Human genes for the alpha and beta c h a h of complement

C4b-binding protein are closely linked in a head-to-tail mgement. Proc. Natl.

Acad. Sci. USA. 87: 4529.

124. Petenen F., Baatnip G., Jepsen H.H. and Svehag S.E. (1985). Complement

mediated solubilization of immune complexes and their interaction with

complement C3 receptors. Complement 2: 97.

125. Pillemer L., Blim L., Lepow, IH., Ross O.A., Todd E.W., Wardlaw A.C. (1954).

The properdine system and immunity. 1. DemoIlStration of a new serum protein

and its role in immune phenornena Science 120: 279.

126. Polley M.J., Muller-Eberhard H.J. (1 967). Enhancement of the hemolytic

activity of the second component of human complement by oxidation. J. Exp.

Med. 126: 1013.

127. Podack E.R., Biesecker G., Muller-Eberhard H.J., Membrane attack cornplex of

complement: generation of high affinity phospholipid binding sites by fusion of 5

hydrophilic plasma protek. Roc. Natl. Acad. Sci. USA. 76: 897.

128. Podack E.R., and Tschopp J. (1982). Polymerization of the ninth component of

complement (Cg) with a tubula. ultrastructure resembling the MAC of

complement. Proc. Natl. Acad. Sci. USA. 79: 574.

129. Podack E.R. (1977). The C5b-9 cornplex: formation, isolation properties and

subunit composition. J. Immunol. 1 19: 2024.

130. Post T.W., Arce M..A., Liszewski M.K., Thornpson ES., Atkinson J.P. and

Lublin D.M. (1990). Structure of the gene for human cornplanent protein decay

accelerating factor. J. Immunol. 144: 740.

13 1. Pugh B.F. and Tijian R (1991). Transcription nom a TATA-less prornoter

requires a multisubunit TFIID cornplex. Genes and Dev. 5: 1935.

132. Rao A.G., Howard O.M., Ng S C , Whitehead A.S., Colten H.R. and Sodetz J.M.

(1987). Complementary DNA and derived amino acid sequence of the alpha

subunit of human complement protein C8: evidence for the existence of a separate

alpha subunit messager RNA. Biochem. 26: 3556.

133. Rasmussen M, Teisner B., Jepsen H., Svehag S., Knudsen F., Kirstein H. and

Buhl M. (1988). Three cases of factor 1 deficiency the effect of treatment with

plasma. Clin. Exp. Immunol. 74: 13 1.

134. Raychowdhwy R, Niles J.L., McCluskey RT. and Smith J.A. (1989).

Autoimmune target in Hegmann nephritis is a glycoprotien with homology to the

LDL receptor. Science 244: 1 163.

135. Reid K.B.M., and Porter. (1981). The proteolytic activation systems of

complement. AMU. Rev. Biochem. 50: 433.

136. Reid K.B.M., and Day A.J. (1989). Structure-function relaîionships of the

complement cornponents. Irnmunol. Today 10: 1 77.

137. Reid K.B.M. (1993). Structure-function relationships in the collectins. Biochem.

Soc. Trans. 21: 464.

138. Ripoche I., Day AL, Harris T.J.R. and Sim RB. (1988). The complete amino

acid sequence of huma. complement factor H. Biochem. 1.249: 593.

1 39. Rodriguez-de-Cordoba S., Sanchez-Corral P. and Rey-Compos J. (1 99 1).

Structure of the gene coding for the alpha polypeptide chain of the huma.

complement component C4b-binding protein. J. Exp. Med. 173 : 1073.

140. Ross S.C. and Densen P. (1984). Complement deficiency states and infection:

epidemology, pathogenesis and consequences of Neissenal and other infections in

an immune deficiency. Medicine 63: 243.

141. Ross G.D., Lambris J.D., Cain J.A., and Newman S.C. (1982). Generatioo of

three different fragments of bound C3 with purified factor 1 or serum 1.

Requirernent for factor H vs CR1 cofactor activity. J. Immunol. 129: 205 1.

142. Ross G.D., and Polley M.J. (1975). Specincity of human Lymphocyte

complement receptors. J. Exp. Med. 145: 1 163.

Roy A.L., Meisterernst M., Pognonec P., Roeder R.G. (1991). Cooperative

interaction of an hitiator- binding transcription intiation factor and the helix-loop-

helix activation USF. Nature 354: 245.

Roy A. L., Malik S., Meisterenst M., and Roeder R. G. (1993). An alternative

pathway for transcription initiation involving TF 1 1 - 1. Nature 365 : 3 55.

Sambrook J., Fritsch E.F., and Maniatis. (1989). Molecular cloning. A

Laboratory manual. Second edition. Cold Spring Harbor Laboratory Ress, Cold

Spring Harbor, NY.

Sanger F., Nicklen S., and Coulson A. R. (1977). DNA sequencing with chain-

tenninating inhibitors. Proc. Natl. Acad. Sci. USA. 74: 5463.

Sharma A. and Pangbum M.K. (1996). Identification of three physicaly and

functionally distinct binding sites for C3b in human complement factor H by

deletion mutagenesis. hoc. Natl. Acad. Sci. 93: 10996.

Sastry K., Heman G.A., Day L., Deignam E., Bruns G., Morton C.C., Ezekowitz

R.A.B. (1989). The human mannose binding protein gene. Exon structure

reveals its evolutionary relationship to a human pulmonary surfactant gene and

locakation to chromosome 10. J. ExpMed. 170: 1 175.

Schreiber E., Manhias M., Muiler M.M., Schaflker W. (1989). Rapid detection

of octamer binding protein with "mini-extract" prepared from a mal1 number of

cells. Vol 17 (15): 6419.

Scott V., Clark A. and Docherty K. (1994). Methods in molecular biology. Vol.

3 1. Protocols for gene analyçis. Edited by Harwood A.J. Humania Press

Inc. Totowa N.J.

Seya T., and Akinson I.P. (1989). Functional properties of membrane cofactor

protein of complement. Biochem. J. 264: 58 1.

Seya T., Turner J.R., Atkinson J.P. (1986). Purification and characterization of a

membrane protein (gp 45-70) that is a cofactor for cleavage of C3b and C4b. J.

Exp. Med. 163: 837.

Seya T., Hara T., Matsumoto M., Sugita Y. and Akedo H. (1990). Complement

mediated tumor ce11 damage induced by antibodies against membrane cofactor

protein (MCP, CD 46). 1. Exp. Med. 172: 1673.

Seya T., Ballard L.L., Bora N. S., Kumar V., Cui W. and Atkinson J. P. (1988).

Distribution of membrane cofactor protein of the complement of human

peripheral blood cells. An altered form is found on granulocytes. Eur. J.

Immunol. 139: 1260.

Shi Y., Seto E., Chang L.S., and Shrenk T. (1 99 1). Transcriptional repression by

W 1 , a human GLI-Kruppel rdated protein and relief of repression by

Adenovirus El A protein. Ce11 67: 377.

Shin M.L., Paznekas W..A., Abramovitz AS. (1977) On the mechanisrn of

membrane damage by complement: exposture of hydrophobie sites on activated

complernent proteins. J. Imnunol. 1 19: 13 58.

Shiang R., Murray J.C., Morton C., Buetow K., Wasmuth J., Olney A.H., Sanger

W., and Goldberger G. (1989). Mapping of the Human complernent factor 1 gene

to 4qZ. Genomics 4: 82.

Sidle A. (1995). Huma. complernent component C3: Mapping of contact

residues for C3 binding proteins by site-directed mutagenesis. Thesis. U of T

Smale, S. T. (1994). Core promoter architecture for eukaryotic protein-coding

genes. In Transcription: Mechanisms and Regdation, R C. Conaway and J. W.

Conaway, eds. (New York: Raven Press), pp. 63-8 1.

Smale S.T., Schmidt M., Berk A. and Baltimore D. (1990). Transcriptional

activation by Spl as directed through TATA or Initiator: specific requirment for

mammalian transcription factor IID. Roc. Natl. Acad. Sci. USA. 87: 4509.

Smale, S.T. and Baltimore D. (1989). The initiator as transcriptional control

element. Ce11 5 7: 1 03.

Smith C.A., Pangbum M.K., Vogel C. W., and Muller-Eberhard H.J. (1984).

Molecular architecture of human properdin, a positive regulator of the alternative

pathway of complement. J. Biol. Chem. 259: 4282.

StanIey K.K., Kocher H.P., Lu50 J.P., Jackson P., Tschopp L (1985). The

sequence and topology of human complement component Cg. EMBO 4: 375.

Stanley K.K., Page M., Campbell A.K., and Luzio J.P. (1986). A mechanism for

the insertion of the complement component C9 into target membranes. Mol.

Immmol. 23: 45 1.

Sudhof T.C., Goldstein J.L., Brown M.S., and Russel D.W. (1985a). The LDL

receptor gene: A mosaic of exons shared with different proteins. Science 228:

8 15.

Sullivan K-E., Wu L.C., Campbell R.D., Vdle D. (1994). Transcriptional

regulation of the gene for the second complement component of human

complement: promoter analysis. Eur. J. Immunol. 24: 393.

167. Tack B.F. and Prahl J.W. (1976). Third component of human complement

purification h m plasma and physiochemical characerization. Biochemist. 15:

4513,

168. Tanese N., Pugh B.F. and Tijan R. (1991). Coactivators for a proline rich

activator purified fiom the multisubunit human TRID complex. Genes and Dev.

5 : 2212.

169. Teisner B., Brandslund I., Foikersen J., Rasmussen LM., Poulsen L.O., Svehag

S.E. (1984). Factor 1 deficiency and C3 nepbritic factor: Immunochemical

findings and association with Nisseria meaingitides infection in two patients.

Scand. J. Immunol. 20: 291.

1 70. Thomas D., and Lubin D. (1 993). Identification of 5' flanking regions affecthg

the expression of the huma. decay accelerating factor gene and th& role in tissue

specific expression. J. Immunol. 150: 15 1.

171. Tijian R., and Maniatis T. (1994). Transcriptional activation: a complex puzzle

with few easy pieces. Cell77: 5.

172. Tshcopp J., Muller-Eberhard H.J. and Podack E.R. (1982). Formation of

transmembrane tubules by spontaneous polymenzation of the hydrophilic

complement component protein Cg. Nature 298: 534.

173. Usheva A., and Shenk T. (1994). TATA-binding protein independent initiation:

W1, TFIlB and RNA polymerase II direct basal transcription on supercoiled

template DNA. Cell76: 11 15.

174. Venijzer C.P., Yokomori K., Chen J-L and Tijian R (1994). Drosophila TAF,

150: similarity to yeast gene TSM-1 and specific binding to core promoter DNA.

Science 264: 93 3.

175. Vemjzer C.P., Yokomon K., Chen T.L. and Tijian R. (1 995). Binding of TAFs

to core elements directs promoter selectivity by RNA polymerase II. Ce11 81:

1115.

176. Vik D.P., Amiguet P., Moffat G.J., Fey M., Amiguet-Barras F.,Wetsel R.A., Tack

B.F. (1 99 1). Structural features of the human C3 gene: htrordexon organization,

transcriptional start site and promoter region sequence. Biochem. 30: 1 080.

177. Vyse T.J., Spath P.J., Davies KA., Morley B.J., Philipp P., Athanassiou P., Giles

C., and Walport M.J. (1994) Hereditary complement factor 1 deficiency. QJM

385.

178. Vyse T.J., Bates G.P., Walport M.J., and Morley B.J. (1994) The organization of

the Human complement factor 1 gene (IF): A member of the serine protease gene

family. Genomics 24: 90.

179. Weiler J.M., Daha M.R., Austen KF. and Fearon D.T. (1976). Control of the

amplification convertase of cornplement by the two plasma protein BM. hoc.

Natl. Acad. Sci. USA. 80: 3461.

180. Weis and Reinberg. (1992). Transcription by RNA polymerase II: Initiator

directed formation of transcription competent complexes. FASEB, Vol. 16: 3300.

181. West C.D. (1989) The complement profile in Clinical Medicine. Complement

Inflamm. 6: 49.

William S.A. and Vik D.P. (1997). Characterization of the 5' flanking region of

the human complement factor H gene. Scand. J. h u n o l . 45: 7.

Wong M., Goldberger G., Isenman D. and Minta J.O. (1995) Processing of

Human factor I in COS-1 ceils CO-transfected with factor 1 and paired basic amino

acid cleaving enzyme (PACE) cDNA. Mol. Immunol. 32: 379.

Zahedi K., Prada A.E., Davies A.E. (1 994). Transcriptional regdation of the C 1 -

inhibitor gene by gamma interferon. J. Biol. Chem. 269 (13): 9669.

Wasylyk B., Hahn S.L., and Giovane A. (1993). The Ets family of transcription

factors. Eur. J. Biochem. 21 1: 7.

Wu L.C., Morley B.J. and Campbell RD. (1987). Cell-specific expression of

the human complement protein factor B gene: Evidence for the role of two

distinct 5'-flanking elements. Celi 48: 33 1.

Yamamoto T., Davies CG., Brown M.S., Schneider W.J., Casey M.L., Goldstein

J.L. and Russel D. W. (1 985). The human LDL receptor: a cysteine-rich protein

with multiple Alu sequences in its mRNA. Ceil 39: 27.

Zalman L. S., Wood L. M., and Muller Eberhard H. J. (1986). Isolation of a

human erythrocyte membrane protein capable of inhibithg expression of

homologous complement trammembrane channnels. Froc. Natl. Acad. Sci.

USA 83: 6975.

Zhang Y ., Lichtenheld M.G. (1 997). Non kikr ceII-specific transcription factors

silence the perforin promoter. Journal of Tmmunol. 158: 1734.

Ziccardi RJ., and Cooper N.R. (1979). Active disassembly of the first

complement component, C 1, by C 1 inactivator. J. Tmmunol. 123: 788.

9 1 Ziccardi R.J., and Cooper N.R (1977). The subunit composition and

sedimentation properties of human C 1. J. h u n o l . I 1 8: 2047.