Gene Expression Profiling Related to Hyphal Growth in a Temperature-Sensitive Mutant of Magnaporthe oryzae

Journal of Integrative Agriculture2013, 12(12): 2189-2196 December 2013RESEARCH ARTICLE

© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.doi: 10.1016/S2095-3119(13)60503-1

Gene Expression Profiling Related to Hyphal Growth in a Temperature- Sensitive Mutant of Magnaporthe oryzae

LI Xue-song1*, XU Fei2*, WANG Hong-kai1 and LIN Fu-cheng1

1 State Key Laboratory for Rice Biology, Biotechnology Institute, Zhejiang University, Hangzhou 310058, P.R.China2 Bioinformatics Lab, Institute of Digital Agriculture, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, P.R.China

Abstract

The rice blast, caused by fungus Magnaporthe oryzae, is a major constraint to the world food security. Hyphal growth is the foundation of fungal development and proliferation of fungi. To investigate genes involved in hyphal growth of this fungus, digital gene expression tag profiling was used to compare a previously generated temperature-sensitive mutant which defect at hyphae growth and reduction on pathogenicity, with its related wildtype strain. 416 genes were detected as differential expression, 178 of which were specifically expressed in Guy-11 but down-regulated expression in the mutant. Functional classification analysis revealed the phenotype mutation may be mainly caused by a defection in translational and vacuole-related processes. The results and the protocol used will improve our knowledge on morphogenesis and promote the further study on M. oryzae pathogenesis.

Key words: differential expressed gene, qRT-PCR, gene ontology, hyphal growth, vacuole

INTRODUCTION

Rice blast, caused by the ascomycete fungus Mag-naporthe oryzae, is an important disease on rice and a serious threat to the world food security (Talbot 2003). Because of its economic significance, vast ef-forts have been made to understand the genetics and molecule nature of this fungus (Tucker and Talbot 2001; Dean et al. 2005), and it has been looked as a model of plant pathogenic fungi (Caracuel-Rios and Talbot 2007). Some genes involved in development of pathogenic process, such as appressorium for-mation, penetration and invasive growth, have been well studied (Caracuel-Rios and Talbot 2007). Mu-tagenesis strategies have been used to investigate the

molecular mechanisms involved in the cell develop-ment and pathogenesis of M. oryzae, such as biolistic transformation, polyethylene glycol (PEG)-mediated transformation, targeted mutation, Agrobacterium tu-mefaciens-mediated transformation (ATMT), and re-striction enzyme mediated integration (REMI) (Mul-lins and Kang 2001; Casselton and Zolan 2002; Jeon et al. 2007). Highly quantitative methods for analysis of gene expression have also been established based on transcriptome of specific developmental stage in M. oryzea, such as serial analysis of gene expression (SAGE) (Kim et al. 2008), RL-SAGE, and massively parallel signature sequencing (MPSS) (Irie et al. 2003; Gowda et al. 2006), to investigate large-scale gene expression involved in early-stage of infection process.

Received 4 January, 2013 Accepted 10 April, 2013Correspondence WANG Hong-kai, E-mail: [email protected]* These authors contributed equally to this study.

2190 LI Xue-song et al.

© 2013, CAAS. All rights reserved. Published by Elsevier Ltd.

Transcriptomic methods are the global analysis of gene expression based on mRNA population of defined cell differentiated stage (Matsumura et al. 2003; Bhadauria et al. 2007; Jeon et al. 2008). Gen-eral methods such as SAGE and microarrays were used for this kind of transcriptome analysis routinely (Matsumura et al. 2006). Recent and ongoing ad-vances in DNA sequencing technology have created new opportunities for measuring gene expression lev-el (Mortazavi et al. 2008; Hong et al. 2011), such as digital gene expression (DGE) tag profiling (Anisimov 2008). DGE method allows gene expression differ-ences to be measured by statistical analysis of rela-tive tag frequencies (Hong et al. 2011). The digital nature of this process supports an unlimited dynamic range, which enables researchers to quantify RNA activity at much higher resolution, capture subtle gene expression changes associated with particular biological processes.

M. oryzae is a multicellular fungi which can differ-entiate various morphological stages in its whole life cycle, and hyphal growth is the foundation of fungal development and proliferation. But little is known about genes involved in hyphal growth although molecular researches on early-stage of infection pro-cess have extensively made in this fungus (Mondal et al. 2007). Conditional mutation, such as tempera-ture-sensitive (TS) mutation, is a mutation that has wild-type (or less severe) phenotype under certain “permissive” environmental conditions and a mu-tant phenotype under certain “restrictive” conditions (Teyssier et al. 2003; Hoeberichts et al. 2008). It is believed that TS alleles cannot be generated for all proteins and some remain refractory even following extensive mutagenesis (Harris et al. 1992). A tem-perature sensitive mutant of M. oryzae, designed as T-146, was screened by UV mutation in our previous research. T-146 could not growth inoculating at tem-perature higher than 33°C (Wang et al. 2007). Fur-ther studies showed this phenotype was induced by a single allele mutation in the previous classical genetic analysis and defect at hyphal growth, morphogenesis and reduction on pathogenicity. In this study, T-146 was treated 30°C to further investigate the gene ex-pression profiles involved in hyphal growth in this plant pathogen fungus.

RESULTS

Library production and tag annotation

In previous research, a temperature-sensitive (TS) mutant of M. oryzea, T-146, was obtained by UV radi-ation which is able to grow at 25°C (permissive tem-perature) but then stopped growing under 33°C (restrict temperature) (Wang et al. 2007). The result in this study showed that this TS mutant grew slowly when T-146 incubated at 30°C compared with the wild type strain Guy-11 (Fig. 1), and pathogenicity on rice was reduced (data not shown).

Fig. 1 Colony characters of TS mutant T-146 and wild type strain Guy-11 inoculated on CM media for 7 d at 30°C.

Hyphal growth is the bases of fungal life cycle and differentiation, the distinct phenotype of defection of hyphal growth is useful for analysis gene expression of hyphal growth, and we inferred that the defection of fungal growth might be leading to the reduction of pathogenicity. The DGE data of TS mutant T-146 and the wide-type strain Guy-11 were compared to inves-tigate gene expression related to hyphal growth. RNA samples from mycelia of both strains were prepared and two DGE libraries were preformed and sequenced using Illumina Solexa technology.

Basic statistics of the M. oryzae DGE libraries were shown in Table 1. There were 5 482 885 valid tags extracted from the sequencing library of the wild type Guy-11 and 6 103 619 tags from the TS mutant T-146, comprising 99.84 and 99.91% of the total sequence reads, respectively. We consolidated reads into

Gene Expression Profiling Related to Hyphal Growth in a Temperature- Sensitive Mutant of Magnaporthe oryzae 2191


167 650 and 153 049 unique tags from the Guy-11 and T-146 libraries respectively. Approximately half of these nonredundant tags were singlets, while they only represent 1.16-1.43% of total mappable reads. Singlets were removed from further analysis on the basis that they likely represent sequencing errors and there is no statistical support for their presence. Read frequencies of unique tags represented by two or more reads spanned over 6 orders of magnitude.

shown significantly difference (Appendix B). These tags represented 428 DEGs (Including 12 unidentifi-able genes, resulted from nonuniquely mapped tags; these genes were excluded from further analysis) (Fig. 2, Appendix C), represented 416 genes. Since the difference defined by an arbitrary fold change, cut-off was less an indication of biological significance, CCD was employed to determine whether a tag was up- or down-regulated (Lash et al. 2000). Results showed that 239 DEGs up-regulated in the TS mutant T-146 and 178 DEGs were down-regulated. There are 111 unidentified genes among the down-regulated genes. In Fig. 3, showed that there were more genes ex-pressed in T-146, resulted in approximately 6% more DEGs than the wide type.

Table 1 Mapping statistics of M. oryzae DGE libraries Guy-11 T-146

Sequence reads 5 491 875 6 109 259Valid tags counts 5 482 885 6 103 619 Unique tags1) 87 510 82 297Mapped unique tags 4 889 5 137 Genes 3 221 3 573DEG associated unique tags 396 428 DEGs2) 370 394 1) Non-single tags.2) Including unidentifiable genes, resulted from nonuniquely mapped tags.

The short reads mapping to the virtual tag library was performed by CLC Genomics Workbench with idles and single substitutions detection. The number of mappable tags in Table 1 presented the genes with good quality and aligned uniquely in the virtual tag library, providing data for 116 430 unique signature tags (Appendix A). However, only a small portion of valid tags have related gene information (307 016 in Guy-11 and 336 657 in T-146), a large number of tags (~94.40%) failed to map to any genes within the annotated reference transcriptome of M. oryzea strain 70-15.

DEG detection and functional classification of DEGs revealing the essential role of gene expression associated with vacuole and ribosome for hyphal growth in M. oryzea

The expressed tags that uniquely aligned to the refer-ence transcripts generated expression data for 4 516 genes (including 20 gene combinations), approxi-mately 41% of the total number of genes (n=11 058) in the annotated genome (Dean et al. 2005). Using a threshold of two-fold change in expression for com-parison of the two samples, 9 794 unique tags have

Fig. 2 Distribution of genes in Guy-11 and T-146. Numbers of significant DEGs were marked in inner cycle.

T-146Guy-11

963 2 245 1 308

5026340

Functional catalogue analysis of the DEGs was carried out by assign them to an appropriate GO slim category (Appendix D). As shown in Fig. 3, these DEGs were grouped into various categories according to their cellular localization. A high portion of them were significantly localized in cytoplasm, membrane system, mitochondrion and nucleus. Also, GO func-tional analysis of DEGs shown an altered picture of biological processes in T-146, such as translation and transcription related gene expression, cell communi-cation and transportation processes including protein targeting, ion transport, signaling transduction, Golgi vesicle transport and transmembrane transport. Gene expression profiling of cell cycle and morphogenesis process changed sharply, metabolism pathway and res-piration process related genes expressed diverse.

According to the definition of TS mutant, the can-



didate TS genes should exist in the expression profile of wide type, but stop expression in the mutant under restrictive temperature. In order to obtain RNA pro-files related to the TS phenotype, samples tested were treated under 30°C (lower than restrict temperature), we expected that at this temperature, expression of related genes contributed to TS phenotype would be sharp down-regulated. Genes in two GO functional categories, related to vacuole and ribosome function, were merely down-regulated in this research (Fig. 4). These results showed that proteins related to vacuole and ribosome were very important for hyphal growth in Magnaporthe oryzea.

Quantitative RT-PCR verification

DGE tag profiling has shown to have low technical variabil i ty (Hoen et al . 2008). To assess the reproducibility and accuracy of DGE analysis, qRT-PCR was performed by a group of randomly picked out DEGs (11 genes) with three replicates each. Six of these genes are hypothetical proteins ( M G G _ 0 0 0 8 0 , M G G _ 0 1 3 6 4 , M G G _ 0 3 2 1 2 , M G G _ 0 7 0 0 5 , M G G _ 0 9 3 2 8 , M G G _ 0 9 8 4 2 ) , o t h e r g e n e s i n c l u d e d : A D P - r i b o s y l a t i o n factor (MGG_01574), formate dehydrogenase

( M G G _ 0 4 0 3 4 ) , N A D P H d e h y d r o g e n a s e (MGG_04569), abhydrolase domain-containing p ro t e in 4 (MGG_06157) , and mi tochondr i a cytochrome b cob (MGG_21013). Results of qRT-PCR showed that a significant correlation was observed between the DGE and qRT-PCR results (Fig. 5).

Fig. 3 Specifically localized DEGs in Guy-11, T-146 and both strains.

BothT-146Guy-11

Golgi a

ppara

tus

Cell co

rtex

Cell w

all

Cellula

r bud

Chromoso

me

Cytopla

sm

Cytoske

leton

Endom

embra

ne sy

stem

Endop

lasmic

reticu

lum

Extrace

llular

regio

n

Membra

ne

Membra

ne fra

ction

Mitoch

ondri

al en

velop

e

Mitoch

ondri

on

Nucleo

lus

Nucleu

s

Plasma m

embra

ne

Ribosom

e

Site of

polar

ized g

rowt

Vacuole

GO terms

0

10

20

30

40

50

60

70

80

DEG

s

Fig. 4 Up- and down-regulated DEGs in T-146 compared to Guy-11.

-50-40-30-20-10

01020304050

Down-regulated Up-regulated

Extrace

llular

regio

n

Cell w

all

Bembra

ne fra

ction

Nucleu

s

Chromoso

me

Nucleo

lus

Cytopla

sm

Mitoch

ondri

on

Mitoch

ondri

al en

velop

e

Vacuole

Endop

lasmic

reticu

lum

Golgi a

ppara

tus

Ribosom

e

Cytoske

leton

Plasma m

embra

ne

Cellula

r bud

Cell co

rtex

Endom

embra

ne sy

stem

Membra

ne

Site of

polar

ized g

rowth



DISCUSSION

Investigation of genes responsible for developmental stages of M. oryzae has previously been studied by some transcriptome strategies. Transcriptome analysis at the early stage of infection have been made using ESTs and SAGE in M. oryzea. Kim et al. (2008) com-pared the transcript profiling between compatible and incompatible interaction by SAGE technology when rice inoculated with the fungus M. oryzea. A total of 910 tag sequences and resulting genes were shown to be up-regulated in the incompatible interaction than in the compatible interaction (Kim et al. 2008). Matsu-mura et al. (2006) showed that only 74 tags were ex-pressed in infected rice leaves during infection process in blast disease (Matsumura et al. 2003). Irie et al. (2003) carried out SAGE to identify genes responsible for appressorium formation and host invasion in the presence or absence of cAMP (Irie et al. 2003). Re-sults showed that 5 087 tags including 2 889 unique tags were isolated from cAMP-treated conidia, where-as untreated conidia yielded 2 342 unique tags out of a total of 3 938. Their results showed that cAMP treatment resulted in up- and down-regulation of genes corresponding to 57 and 53 unique tags, respectively. Mathioni et al. (2011) identified 4 973 genes that were differentially expressed in mycelia grown in complete medium (Mathioni et al. 2011). In present research, we found 4 889 tags representing 3 221 genes in wild-type strain and 5 137 tags representing 3 573 genes in

TS mutant T-146, in which the gene number is closely similar with the results under artificial cultural condi-tions obtained by Mathioni et al. (2011) and Irie et al. (2003), confirmed the conclusion in previous research-es that under cultural condition, the number of genes expressed in M. oryzea is less than stress conditions, and varied in different cultural conditions (Gowda et al. 2006).

Studies on gene function involved with hyphal growth in M. oryzae have been carried out by several researchers recently for it is the foundation of fungal development and proliferation. Wang et al. (2011) investigated a gene in M. oryzae, MoNEM1, which is homologous to the NEM1 (nuclear envelope morphol-ogy protein 1) gene of baker’s yeast (Saccharomyces cerevisiae). Knock-out mutant of this gene exhibited reduced mycelial growth and conidiation but no influ-ence on pathogenicity (Wang et al. 2011). A gene en-code a putative carnitine acylcarnitine carrier protein, MoCRC1, was found to be essential for pathogenicity and required for growth on minimal medium contain-ing sodium acetate or olive oil in M. oryzae (Yang et al. 2012). Roles of chitin synthase genes for vir-ulence and hyphal growth in M. oryzae was inves-tigated by Kang et al. (2012). Two out of 7 chitin synthase genes can influence on hyphal growth, but only one of them, Chs6, was impact on both hyphal growth and pathogenicity (Kang et al. 2012). Ge-nome-wide gene expression analysis related with hyphal growth was carried out using digital gene ex-pression tag profiling in this research, results showed that 178 DEGs were down-regulated in the TS mu-tant and 111 genes were unidentified among them. It is confirmed that TS phenotype is resulted from the sharp down-regulated genes since the function of temperature-sensitive protein can be reduced in high temperature condition (Wang et al. 2007). GO functional categories analysis indicated that genes with merely down-regulation were related to vacuole and ribosome function. A number of genes in the two functional categories known to be involved in pathogenicity, e.g., CYP1 (Viaud et al. 2002) and HEX1 (Soundararajan et al. 2004), were down-regu-lated sharply in T-146. This proved that some genes involved in hyphal growth are required for fungal virulence in M. oryzea.

Fig. 5 qRT-PCR verification of some DEGs detected by DGE tag profiling.



CONCLUSION

In this study, the transcriptome of M. oryzae Guy-11 and a TS mutant T-146 were compared using the recently developed NGS-based DGE tag profiling technology, providing new gene expression pattern during fungal growth in M. oryzae. DGE tag profiling has revealed the subcellular biological processes are significantly changed in the TS mutant T-146, especially in ribosomal function, mRNA translation and vacuole-related processes. These data indicated that vacuole and cytoplasm were very important to hyphal growth and some genes identified here are involved in fungal virulence in the process of rice-fungal interaction. This study expended our knowledge of fungal growth at molecular level, and many unidentified genes discovered in this research will serve as a valuable resource to refine their functional characterization.

MATERIALS AND METHODS

Sample preparation

M. oryzae wild type strain Guy-11 and the TS mutant T-146 were incubated on complete medium (CM) at 30°C with a 12 h photophase. The fungal biomass were collected following the method used by Xu et al. (2011).

Total RNA was extracted using the standard Trizol method from the collection. RNA integrity was checked by Agilent 2100 Bioanalyzer (Agilent, Germany).

DGE library construction and sequencing

Sequence tag preparation was performed with Illumina Gene Expression Sample Prep Kit (Illumina, USA) following the manufacturer’s instruction. The single-chain tag molecules were sequenced by the Illumina HiSeq 2000 System (Illumina, USA) after denaturation. And 3 millions of raw reads were generated with 35 bp (Barrett et al. 2009). The data were deposited in NCBI’s GEO and accessible through GEO series accession number GSE35840.

Tag extraction and mapping

All tags were extracted and mapped to the M. oryzae virtual tag library (Appendix E) by CLC Genomics Workbench (CLC bio, http://www.clcbio.com/). Trimmed tag counts were generated from the 35-bp sequenced library using the

SAGE screen method implemented in the software (Akmaev and Wang 2004), idles were allowed with left ends fixed in this procedure. Tags with count below 2 were excluded from further analysis. Single substitutions or idles were allowed when aligning sampled tags to virtual tags.

Detection of differential expressed genes and GO categorization

Comparative count display (CCD) was used to identify differential expressed tags between Guy-11 and T-146 with fold change level >2 (Lash et al. 2000). Differences were considered statistically significant at P<0.05. Sequences of differential expressed genes (DEGs) were extracted from M. oryzae genome for GO functional categorization.

To assign the appropriate GO term ids, amino acid sequence identity between the M. oryzae sequences and the GO database sequences was determined by the Blastx program in the WU-BLAST 2.0 package at an E value less than 10-5 (Altschul et al. 1997). GO terms information for the homologs in the GO database sequences with the best hit was used combined with considerations of the amino acid percent identity 30% and HSP length 100 for each pair (Kabsch and Sander 1984; Rost 1999). A GO evidence code of IEA (Inferred from Electronic Annotation) was automated assigned to each homolog genes in M. oryzae. DEGs were picked for GO slim counting by using the SGD GO slim category. P 0.05 was used to assign the DEGs with most likely associated GO functional annotation (Boyle et al. 2004).

Quantitative RT-PCR analysis

Quantitative RT-PCR (qRT-PCR) was performed on the same strain RNA samples used to prepare DGE libraries. Total RNA was extracted following Trizol protocol (Invitrogen Corporation, Carlsbad, USA), followed by RNA clean-up using the DNA Eraser. 1 µg of total RNA were used for cDNA reverse transcription (Primescript RT reagent Kit With gDNA Eraser, TaKaRa, Japan). qPCR reaction was performed using the SYBR Premix Ex TaqTM Kit (TaKaRa, Japan). The Primers used for q-PCR were designed from published sequences using online design software (http://www.idtdna.com/site) and listed in Table 2.

The thermal cycling conditions were as following: an initial denaturation step at 95°C for 30 s, then 40 cycles at 95°C for 5 s, and 58°C for 31 s. β-Tubulin was selected as the internal reference. Quantification of the relative changes in gene expression used the method described by Kim et al. (2008).

AcknowledgementsThis study was supported by the Natural Science Foundation of Zhejiang Province, China (Y3110028 and LQ12C14003).



Appendix associated with this paper can be available on http://www.ChinaAgriSci.com/V2/En/appendix.htm

ReferencesAkmaev V R, Wang C J. 2004. Correction of sequence-

based artifacts in serial analysis of gene expression. Bioinformatics, 20, 1254-1263.

Altschul S F, Madden T L, Schäffer A A, Zhang J, Zhang Z, Miller W, Lipman D J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research, 25, 3389-3402.

Anisimov S V. 2008. Serial analysis of gene expression (SAGE): 13 years of application in research. Current Pharmaceutical Biotechnology, 9, 338-350.

Barrett T, Troup D B, Wilhite S E, Ledoux P, Rudnev D, Evangelista C, Kim I F, Soboleva A, Tomashevsky M, Marshall K A, et al. 2009. NCBI GEO: archive for high-throughput functional genomic data. Nucleic Acids Research, 37, D885-D890.

Bhadauria V, Popescu L, Zhao W S, Peng Y L. 2007. Fungal transcriptomics. Microbiological Research, 162, 285-298.

Boyle E I, Weng S, Gollub J, Jin H, Botstein D, Cherry J M, Sherlock G. 2004. GO::TermFinder - open source software for accessing Gene Ontology information and finding significantly enriched Gene Ontology terms associated with a list of genes. Bioinformatics, 20, 3710-3715.

Caracuel-Rios Z, Talbot N J. 2007. Cellular differentiation and host invasion by the rice blast fungus Magnaporthe grisea. Current Opinion in Microbiology, 10, 339-345.

Casselton L, Zolan M. 2002. The art and design of genetic

screens: filamentous fungi. Nature Reviews Genetics, 3, 683-697.

Dean R A, Talbot N J, Ebbole D J, Farman M L, Mitchell T K, Orbach M J, Thon M, Kulkarni R, Xu J R, Pan H, et al. 2005. The genome sequence of the rice blast fungus Magnaporthe grisea. Nature, 434, 980-986.

Gowda M, Venu R C, Raghupathy M B, Nobuta K, Li H, Wing R, Stahlberg E, Couglan S, Haudenschild C D, Dean R, et al. 2006. Deep and comparative analysis of the mycelium and appressorium transcriptomes of Magnaporthe grisea using MPSS, RL-SAGE, and oligoarray methods. BMC Genomics, 7, 310.

Harris S D, Cheng J, Pugh T A, Pringle J R. 1992. Molecular analysis of Saccharomyces cerevisiae chromosome I. On the number of genes and the identification of essential genes using temperature-sensitive-lethal mutations. Journal of Molecular Biology, 225, 53-65.

Hoeberichts F A, Vaeck E, Kiddle G, Coppens E, van de Cotte B, Adamantidis A, Ormenese S, Foyer C H, Zabeau M, Inzé D, et al. 2008. A temperature-sensitive mutation in the Arabidopsis thaliana phosphomannomutase gene disrupts protein glycosylation and triggers cell death. Journal of Molecular Biology, 283, 5708-5718.

Hong L Z, Li J, Schmidt-Küntzel A, Warren W C, Barsh G S. 2011. Digital gene expression for non-model organisms. Genome Research, 21, 1905-1915.

Irie T, Matsumura H, Terauchi R, Saitoh H. 2003. Serial analysis of gene expression (SAGE) of Magnaporthe grisea: genes involved in appressorium formation. Molecular Genetics and Genomics, 270, 181-189.

Jeon J , Choi J , Park J , Lee Y H. 2008. Functional genomics in the rice blast fungus to unravel the fungal pathogenicity. Journal of Zhejiang University Science (B), 9, 747-752.

Jeon J, Park S Y, Chi M H, Choi J, Park J, Rho H S, Kim S, Goh J, Yoo S, Choi J, et al. 2007. Genome-wide functional analysis of pathogenicity genes in the rice blast fungus. Nature Genetics, 39, 561-565.

Kabsch W, Sander C. 1984. On the use of sequence homologies to predict protein structure: identical pen t apep t ide s can have comple t e ly d i f f e r en t conformations. Proceedings of the National Academy of Sciences of the United States of America, 81, 1075-1078.

Kim S G, Kim S T, Kim S K, Kang K Y. 2008. Gene expression profiling in rice infected with rice blast fungus using SAGE. Plant Pathology Journal, 24, 384-391.

Kong L A, Yang J, Li G T, Qi L L, Zhang Y J, Wang C F, Zhao W S, Xu J R, Peng Y L. 2012. Different chitin synthase genes are required for various developmental and plant infection processes in the rice blast fungus Magnaporthe oryzae. PLoS Pathogens, 8, e1002526.

Lash A E, Tols toshev C M, Wagner L, Schuler G D, Strausberg R L, Riggins G J, Altschul S F. 2000. SAGEmap: a public gene expression resource. Genome Research, 10, 1051-1060.

Table 2 The primers used for qPCRPrimer name Sequence (5´ 3´)MGG_00080qpcr_up TGGGATAATTGACATCGGGTGMGG_00080qpcr_dn GAGTGATAAGTACGAAGTACGGTGMGG_01574qpcr_up ACCAGATACCAACAGCCAAGMGG_01574qpcr_dn GTTACCAAGTACCAGAAGCGGMGG_04034qpcr_up ACTCCTGGTTGGGTTTTCTGMGG_04034qpcr_dn CAGGCTTGTGGTATCTGGAAGMGG_09328qpcr_up TGATTGAGGCAGGTAAACGGMGG_09328qpcr_dn AGATAACGGGAAGCATGACAGMGG_04569qpcr_up CTCACCAATACCACAGAGCAGMGG_04569qpcr_dn GCTCTTTATCCTCTAATGCCCCMGG_01364qpcr_up ACTCCATCTTTGCCCCTAATGMGG_01364qpcr_dn AGCTTGTCAAATACGTCCGAGMGG_03212qpcr_up GTCAACGCTGGTACTATCTCAGMGG_03212qpcr_dn GGTTTCAGGCTCTCACTATCGMGG_06157qpcr_up AAACTTTGAGCCCCTTACCCMGG_06157qpcr_dn ACAAACCAATCCTCAGCCTCMGG_07005qpcr_up CGTACTGGTTTGTGATTGGCMGG_07005qpcr_dn GAGAGGTTGGAAGAGTTGGTGMGG_21013qpcr_up ATGATGGCTATCGGTTTCMGG_21013qpcr_dn TCTTGCCCTATTCAAGGTMGG_09842qpcr_up GTTGACTGTTGAGGCTTTGCMGG_09842qpcr_dn CCTTCAAATCTGCTTTCACCC



Mathioni S M, Beló A, Rizzo C J, Dean R A, Donofrio N M. 2011. Transcriptome profiling of the rice blast fungus during invasive plant infection and in vitro stresses. BMC Genomics, 12, 49.

Matsumura H, Bin Nasir K H, Yoshida K, Ito A, Kahl G, Krüger D H, Terauchi R. 2006. SuperSAGE array: the direct use of 26-base-pair transcript tags in oligonucleotide arrays. Nature Methods, 3, 469-474.

Matsumura H, Reich S, Ito A, Saitoh H, Kamoun S, Winter P, Kahl G, Reuter M, Kruger D H, Terauchi R. 2003. Gene expression analysis of plant host-pathogen interactions by SuperSAGE. Proceedings of the National Academy of Sciences of the United States of America, 100, 15718-15723.

Mondal K, Dastidar A G, Singh G, Madhusudhanan S, Gande S L, VijayRaghavan K, Varadarajan R. 2007. Design and isolation of temperature-sensitive mutants of Gal4 in yeast and Drosophila. Journal of Molecular Biology, 370, 939-950.

Mortazavi A, Williams B A, McCue K, Schaeffer L, Wold B. 2008. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nature Methods, 5, 621-628.

Mullins E D, Kang S. 2001. Transformation: a tool for studying fungal pathogens of plants. Cellular and Molecular Life Sciences, 58, 2043-2052.

Rost B. 1999. Twilight zone of protein sequence alignments. Protein Engineering, 12, 85-94.

Soundararajan S, Jedd G, Li X, Ramos-Pamploña M, Chua N H, Naqvi N I . 2004. Woronin body funct ion in Magnaporthe grisea is essential for efficient pathogenesis and for survival during nitrogen starvation stress. The Plant Cell, 16, 1564-1574.

Hoen P A, Ariyurek Y, Thygesen H H, Vreugdenhil

E, Vossen R H, de Menezes R X, Boer J M, van Ommen G J, den Dunnen J T. 2008. Deep sequencing-based expression analysis shows major advances in robustness, resolution and inter-lab portability over five microarray platforms. Nucleic Acids Research, 36, e141.

Talbot N J. 2003. On the trail of a cereal killer: Exploring the biology of Magnaporthe grisea. Annual Review of Microbiology, 57, 177-202.

Teyssier E, Hirokawa G, Tretiakova A, Jameson B, Kaji A, Kaji H. 2003. Temperature-sensitive mutation in yeast mitochondrial ribosome recycling factor (RRF). Nucleic Acids Research, 31, 4218-4226.

Tucker S L, Talbot N J. 2001. Surface attachment and pre-penetration stage development by plant pathogenic fungi. Annual Review of Microbiology, 39, 385-417.

Viaud M C, Ba lhadère P V, Ta lbo t N J . 2002 . A Magnaporthe grisea cyclophilin acts as a virulence determinant during plant infection. The Plant Cell, 14, 917-930.

Wang H K, Lin F C, Li D B. 2007. Genetic analysis on temperature sensitive mutants in Magnaporthe grisea. International Conference on Integration of Science & Technology for Sustainable Development, 1, 152-155.

Wang Y, Jiao T, Liu X, Lin F, Wu W. 2011 Functional Characterization of a NEM1-like gene in Magnaporthe oryzae. Journal of Integrative Agriculture, 10, 1385-1390.

Xu F, Liu X H, Zhuang F L, Zhu J, Lin F C. 2011. Analyzing autophagy in Magnaporthe oryzae . Autophagy, 7, 525-530.

Yang J, Kong L, Chen X, Wang D, Qi L L, Zhao W, Zhang Y, Liu X, Peng Y L. 2012. A carnitine-acylcarnitine carrier protein, MoCrc1, is essential for pathogenicity in Magnaporthe oryzae. Current Genetics, 58, 139-148.

(Managing editor ZHANG Juan)

Documents

Gene Expression Profiling Related to Hyphal Growth in a Temperature-Sensitive Mutant of Magnaporthe oryzae