Upload
agata
View
212
Download
0
Embed Size (px)
Citation preview
ORIGINAL PAPER
Gabaculine selection using bacterial and plant marker genes(GSA-AT) in durum wheat transformation
Angelica Giancaspro • Daniele Rosellini •
Antonio Blanco • Agata Gadaleta
Received: 18 October 2011 / Accepted: 23 December 2011 / Published online: 11 January 2012
� Springer Science+Business Media B.V. 2012
Abstract Selectable marker genes are widely used for the
efficient transformation of crop plants. In most cases,
selection is based on antibiotic or herbicide resistance
genes because they tend to be most efficient. The Syn-
echococcus hemL gene has been successfully employed as
a selectable marker for tobacco and alfalfa genetic trans-
formation, by using gabaculine as the selective agent. The
gene conferring gabaculine resistance is a mutant form of
the hemL gene from Synechococcus PCC6301, strain GR6,
encoding a gabaculine insensitive form of the glutamate1-
semialdehyde aminotransferase (GSA) enzyme. In the
present study we compared the transformation and selec-
tion efficiency of the common selection method based on
the Streptomyces hygroscopicus bar gene conferring
resistance to Bialaphos�, with both the Synechococcus
hemL gene and a Medicago sativa mutated GSA gene
(MsGSAgr) conferring resistance to phytotoxin gabaculine.
Callus derived from immature embryos of the durum wheat
cultivar Varano were simultaneously co-bombarded with
bar/hemL and bar/MsGSAgr genes. After gene delivery,
the marker genes were individually evaluated through all
the selection phases from callus regeneration to adult plant
formation, and compared for their transformation and
selection efficiency. The integration of the three genes in
the T0 generation was confirmed by PCR analysis with
specific primers for each gene and southern blot analysis.
Both Synechococcus hemL and MsGSA were more efficient
than bar for biolistic transformation (2.8% vs. 1.8% and
1.1% vs. 0.5%) and selection (79% vs. 43% and 87% vs.
50%). Thus, an efficient selection method for durum wheat
transformation was established that obviates the use of
herbicide resistance genes.
Keywords Wheat transformation � Selectable marker �Gabaculine � GSA-AT � hem-L
Introduction
Selectable marker genes (SMGs) are widely used for the
efficient transformation of crop plants. In most cases,
selection is based on antibiotic or herbicide resistance.
These genes are preferred because they tend to be most
efficient. Due mainly to consumer concerns, considerable
effort is being put into developing a suite of strategies (site-
specific recombination, homologous recombination, trans-
position and co-transformation) to eliminate the SMG from
the nuclear or chloroplast genome after selection. Current
efforts concentrate on systems where the SMGs are elim-
inated efficiently soon after transformation. However, these
methods are laborious and not completely reliable. For the
commercialization of transgenic plants, the use of a com-
pletely marker-free technology would be preferable, since
there would be no involvement of SMGs, whose presence
is undesirable in crop plants. Several risk-assessment
reports (Kuiper et al. 2001; Ramessar et al. 2007; European
Union as of January 1, 2009) have shown that neither the
SMGs nor their products are harmful to human and envi-
ronmental health. Nevertheless, removal of these genes
from a transgenic plant is considered as ‘‘good laboratory
practice’’ by many regulatory committees. Approximately
A. Giancaspro � A. Blanco � A. Gadaleta (&)
Department of Environmental and Agro-Forestry Biology and
Chemistry, Section of Genetics and Plant Breeding, University
of Bari Aldo Moro, Via Amendola, 165/A, 70126 Bari, Italy
e-mail: [email protected]
D. Rosellini
Department of Applied Biology, University of Perugia, Borgo
XX giugno 74, 06121 Perugia, Italy
123
Plant Cell Tiss Organ Cult (2012) 109:447–455
DOI 10.1007/s11240-011-0109-2
fifty marker genes used for transgenic and transplastomic
plant research and crop development have been assessed
for efficiency, scientific applications and commercializa-
tion (Miki and McHugh 2004). SMGs can be divided into
several categories depending on whether they allow posi-
tive or negative selection and whether selection is condi-
tional or non-conditional on the presence of external
substrates. Positive SMGs are defined as those that promote
the growth of transformed tissue whereas negative SMGs
result in the death of the transformed tissue. The positive
SMGs that are conditional on the use of toxic agents, such
as antibiotics, herbicides or drugs were the first to be
developed and exploited. More recent developments
include positive SMGs that are conditional on non-toxic
agents that may be substrates for growth or that induce
growth and differentiation of the transformed tissues
(Stoykova and Stoeva-Popova 2010; Thiruvengadam et al.
2011; Qiao et al. 2010). Newer strategies include positive
selectable markers which are not conditional on external
substrates but which alter the physiological processes that
govern plant development (Khan et al. 2010, 2011).
Despite the large number of SMGs that exist for plants,
only a few are used for research and crop development for
this reason additional marker genes are needed that are not
antibiotic or herbicide based due to concerns over potential
increases in antibiotic resistance or effect on natural eco-
systems (Miki and McHugh 2004) Recently, new solutions
have been proposed represented by alternative selection
systems based on genes conferring resistance to chemical
agents different from toxic antibiotics or herbicides. In par-
ticular, the Synechococcus hemL gene has been successfully
employed as a selectable marker in Nicotiana tabacum
(Gough et al. 2001) and M. sativa (Rosellini et al. 2007)
genetic transformation by A. tumefaciens, using gabaculine
as the selective agent. The gene conferring gabaculine
resistance is a mutant form of the hemL gene from
Synechococcus PCC6301, strain GR6, encoding a mutant,
gabaculine insensitive form of the enzyme glutamate1-
semialdehyde aminotransferase (GSA-AT, Hill et al. 1985).
The lower sensibility to gabaculine of the mutant form of
GSA-AT enzyme respect to the wild type, is due to two
changes in its primary structure: a deletion of the aminoacids
serine-proline-phenylalanine from positions 5, 6 and 7, and a
methionine to isoleucine substitution at position 248, both
necessary to confer the gabaculine resistance. The GSA-AT
enzyme is naturally found in a wide range of organisms,
including algae, cyanobacteria and higher plants. In plants,
GSA-AT is encoded by the nuclear genome and then trans-
ported to chloroplast, where it catalyses the conversion
of glutamate1-semialdehyde into d-aminolaevulinic acid
(ALA), the universal precursor of tetrapyrrolic compounds
including chlorophyll and phycobilins (Reinbothe and
Reinbothe 1996). The enzyme encoded by the hemL gene is
sensitive to gabaculine, an irreversible inhibitor of a wide
range of pyridoxal-5-phosphate-linked aminotransferases
(Rando 1977). The complete sequence of the gene has been
determined in a little range of organisms including barley
(Grimm 1990), Synechococcus PCC6301 and Escherichia
coli (Grimm et al. 1991). Being a potent inhibitor of GSA-
AT, gabaculine is toxic to a wide range of plants (Hill et al.
1985). Several gabaculine-resistant mutants have been iso-
lated (Kahn and Kannangara 1987; Houghton et al. 1988),
one of which is the GR6 strain of Synechococcus PCC6301
(Grimm et al. 1991). Recently, the GSA gene has been iso-
lated from alfalfa and point-mutated to induce gabaculine
resistance (Ferradini et al. 2011). The use of Synechococcus
hemL gene has never been reported for the genetic trans-
formation of cereals, and only one plant gene, rice aceto-
lactate synthase, has been used as SMG (Ogawa et al. 2008).
The objective of the present work was to test a selection
method based on gabaculine in durum wheat (Triticum tur-
gidum var. durum) biolistic transformation, using both the
cyanobacterial hemL gene and a mutated form of the gene for
the glutamate 1-semialdehyde aminotransferase enzyme
(GSA) of alfalfa. The vector delivered in the transformation
contained a point-mutated form of M. sativa GSA gene
carrying a M to I substitution at position 286. Within the
enzyme binding domain, the M at position 286 in the
M. sativa sequence is completely conserved; on the contrary,
the N terminus differs profoundly, so the SPF deletion
present in hemL cannot be reproduced in plant enzymes.
Therefore it has been decided to test the hypothesis that the M
to I substitution alone was sufficient for gabaculine resis-
tance in alfalfa (Ferradini et al. 2011). In order to test the
gabaculine selection method, both the hemL/gabaculine and
the MsGSAgr/gabaculine selection systems were compared
with the conventional system based on the bar gene from
S. hygroscopicus as the SMG and Bialaphos� as the selective
agent. After gene delivery, the three systems were evaluated
through all the selection phases from callus regeneration to
adult plant formation, and compared for their transformation
and selection efficiencies.
Materials and methods
DNA constructs
The three vectors used in the genetic transformation
experiments were plasmids pAPCK-hemL, pAPCK-35S-
MsGSAgr and pAHC20-bar (Fig. 1). The plasmid pAPCK-
hemL (7,718 bp) carried the coding sequence of the hemL
gene of Synechococcus PC6301 strain GR6, encoding the
mutant gabaculine-resistant GSA-AT enzyme, under the
control of the Dual CaMV 35S promoter and nos termi-
nator (Fig. 1a). The plasmid also includes a 171 bp
448 Plant Cell Tiss Organ Cult (2012) 109:447–455
123
chloroplast transit peptide from the Pisum sativum Rubisco
small unit (Rubisco TP). The plasmid pAPCK-MsGSAgr
(5,700 bp) carried the point mutated GSA gene of M. sativa
conferring resistance to the gabaculine, under the control of
the Dual CaMV 35S promoter and the nos terminator
(Fig. 1b) (Ferradini et al. 2011; Rosellini 2011). The
plasmid pAHC20-bar (UbiBar, 5,505 bp) harboured the
selectable bar gene from S. hygroscopicus encoding
the phosphinotricin-acetyl-transferase (PAT) enzyme,
under the control of maize Ubi1 promoter and first intron
(Christensen and Quail 1996) and nos terminator (Gadaleta
et al. 2006).
The three vectors were cloned into E. coli competent
cells by heat shock, then selected on 19 LB solid medium
containing 50 mg/l ampicillin. Plasmid DNA was extracted
from E. coli by using the QIAGEN Plasmid MAXI Kit
following the manufacturer’s instructions. Each plasmid
was checked for the inserted marker gene by means of
restriction endonuclease digestion and PCR amplification
with specific primer pairs, followed by electrophoretic
separation on 1.8% agarose gel and UV visualization of
DNA bands stained with Gel-Red�.
Detection of gabaculine effect on durum wheat callus
In order to study gabaculine toxic effects and establish the
best concentration suitable for the selection of callus, a
preliminary toxicity test was conducted on the two durum
wheat varieties Svevo and Varano. These varieties were
chosen for their high shoot regeneration potential (Gadaleta
et al. 2002). One hundred two-week-old callus for each
cultivar were grown on a regeneration medium supple-
mented with five gabaculine (Sigma Aldrich) concentra-
tions: 0, 5, 20, 50, 100 lM. The effects of gabaculine on
callus embryogenesis were evaluated by detecting the
number of the regenerated shoots after 4 weeks of in vitro
culture, following growth at 25�C with 16 h of light
(250 lE s-1 m-2 from cool white fluorescent tubes) and
8 h of darkness daily for 3 weeks. Shoots developed from
all the treatments were grown to plants, in order to detect
any effect of gabaculine on the phenotype.
Transformation experiments
The explants used for transformation experiments were
embryogenic callus derived from immature embryos.
Immature seeds were harvested 15–18 days post-anthesis
from durum wheat cv. Varano, surface-sterilized with 70%
ethanol for 5 min and 20% sodium hypochlorite for 15 min,
then rinsed in sterile water. Immature embryos that varied in
size between 0.8 and 1.5 mm in diameter, were aseptically
excised under a stereo dissecting microscope and placed with
the scutellar portion of the embryo exposed on a solid MS
medium. The isolated embryos were cultured for ten days on
a solid initiation medium (MS) to induce the formation of
callus. The protocol for medium composition, callus induc-
tion and maintenance were described by Gadaleta et al.
(2006). Only good quality callus, showing a regular round
shape and a bright yellow colour, were subjected to trans-
formation. A total of four independent co-transformation
experiments were performed using the biolistic device: in the
first two experiments, wheat callus (respectively 616 and 700
pieces) were simultaneously co-bombarded with equimolar
amounts of the two plasmids carrying the hemL and the bar
genes. Two experiments (with 550 and 600 callus) were
conducted bombarding simultaneously embryogenic callus
with the two plasmids carrying the MsGSAgr and the bar
genes, respectively.
The exact quantity of each plasmid to employ for gene
delivery was calculated depending on the molecular weight
according to He et al. (1999). In particular, we used
12.5 lg of pAHC20-bar, 17.5 lg of pAPCK-hemL and
12.9 lg of pAPCK-MsGSAgr. Plasmid delivery was car-
ried out by means of the biolistic device PDS 1000-He
particle gun (BioRad, Richmond, CA) following the pro-
cedure described by Weeks et al. (1993). After
Dual CAMV 35S hemL Nos TerminatorEcoRI
BamHIPstI
EcoRIRubisco TP
II
Dual CAMV 35S MsGSAgr Nos TerminatorEcoRI BamHI AscIII I
A
B
Fig. 1 Schematic representation of the plasmid vectors delivered in
the genetic transformation of durum wheat callus by biolistic device.
a pAPCK-hemL carrying the mutant hemL gene of SynechococcusPCC6301 strain GR6 under the control of CaMV 35S double
promoter and nos terminator from nopaline synthase gene of
Agrobacterium tumefaciens. Rubisco TP is a 171 bp chloroplast
transit peptide from the Pisum sativum Rubisco small unit. b pAPCK-
35S-MsGSAgr carrying the point mutated GSA-AT gene of Medicagosativa under the control of CaMV 35S double promoter and nosterminator
Plant Cell Tiss Organ Cult (2012) 109:447–455 449
123
transformation, the bombarded explants were maintained
for 3 weeks in the dark at 25�C on a ‘‘recovery’’ medium
without any selective pressure.
Callus selection and regeneration
Following the recovery period, selection was performed
separately with gabaculine (Sigma Aldrich) on half of the
callus and bialaphos on the other half, for each of the four
experiments. Callus selected with bar/bialaphos were
plate-cultured on a selection-regeneration solid medium,
consisting of a MS basic substrate supplemented with
0.2 mg/l of 2,4-D and 1 mg/l of bialaphos (Meiji Seika
Kasha, Tokyo, Japan). Conditions of growth were 16 h of
light and 8 h of darkness at 25�C. For the selection with
gabaculine, the callus were transferred to a selection-
regeneration medium containing 0.2 mg/l of 2,4-D and
15 lM gabaculine, and maintained under the same growth
conditions of bialaphos-selection. The regeneration period
varied from 5 to 7 weeks, depending on the selection
system, and allowed some callus to form green spots
developing into little green shoots. Sub-cultures were
performed every 10 days. Both for bialaphos and gabacu-
line selection, two control treatments were performed, by
culturing 50 non transformed Varano callus on the same
selection condition of the bombarded explants (negative
controls) and 50 callus on a non-selective medium (positive
controls).
Following regeneration, callus which developed green
shoots completed the selection in Pyrex culture tubes
containing a rooting medium consisting of a hormone-free
half-strength basic MS medium, supplemented with 3 mg/l
bialaphos for bar selection, and 15 lM gabaculine for
hemL and MsGSAgr selection. Roots developed in a period
comprised between 2 and 4 weeks, then plantlets that
showed healthy growth under selection were transferred
from rooting tubes to pots of soil mixture, maintained in
the growth chamber for about 2 weeks with decreasing
humidity, and finally transferred to the greenhouse. In the
greenhouse, the regenerated wheat lines received supple-
mentary lighting provided by sodium lamps, with a day
temperature of 17–20�C and a night temperature of
14–16�C. Young leaf samples were taken from plants in
vases to be used for the following molecular analyses.
Characterization of regenerated T0 plants
Genomic DNA was extracted from leaf samples of T0
plants regenerated from bialaphos and gabaculine selection
(from both hemL and MsGSAgr genes), and from non-
transgenic controls according to the protocol described by
Dellaporta et al. (1983). DNA concentration was deter-
mined using a UV–Visible spectrophotometer detecting
adsorbance at a 260 nm wavelength. Purity of genomic
DNA was assessed reading the 260/280 nm absorption
ratio, with a value of approximately 1.8 indicating a good
quality. DNA integrity was also checked on 0.8% agarose
gel stained with Gel-Red� (Sigma Aldrich).
In order to assess the presence of bar, hemL and MsGSAgr
and identify the transformed T0 plants, the genomic DNA of
all the regenerated plants were amplified with primer pairs
specific for each gene. Primers employed for pAHC20-bar
(bar-F: 50GTCTGCACCATCGTCAACC 30; bar-R: 50GA-
AGTCCAGCTGCCAGAAAC 30; He et al. 1999), produced a
420 bp amplicon from the bar gene coding sequence at an
annealing temperature of 59�C. The primers used to screen the
hemL gene (hemL-F: 50GCAGTTTGAGGCGGGCTTTA 30;hemL-R: 50ATCGCAAGACCGGCAACAG 30; Rosellini
et al. 2007) gave a 208 bp PCR product at an annealing
temperature of 67�C. The primer pairs for MsGSAgr gene
(GSA-F: 50CCAGCTTTGGTGCACCTTGTC 30; GSA-R:
50ATCGCAAGACCGGCAACAG 30; Ferradini et al. 2011)
gave a 1,130 bp PCR product at an annealing temperature of
62�C. In order to avoid improper amplification of GSA-AT
endogenous wheat gene, forward and reverse primers for the
pAPCK-hemL and pAPCK-MsGSAgr plasmids were
designed on hemL and MsGSAgr coding sequence and nos
terminator, respectively.
Non transgenic control plants were PCR amplified.
Further negative controls were represented by a PCR
reaction-mix free of DNA and by the genomic DNA of the
wild-type durum wheat cultivar Varano; positive controls
consisted in plasmids pAPCK-hemL, pAPCK-MsGSAgr
and pAHC20-bar, respectively for the hemL, MsGSAgr and
bar genes.
All the PCR analyses were carried out in a 25 ll total
reaction volume containing 100 ng template DNA, 250 nM
of each primer pair, 200 lM of each dNTP, 1.5 mM
MgCl2, 19 Buffer (10 mM Tris–HCl, pH 8.3; 10 mM
KCl), and 1 unit of Taq DNA polymerase (Euroclone Eu-
roTaq). Amplifications were conducted in a Perkin Elmer
DNA Thermal Cycler with the following protocol: 1 cycle
of denaturation at 94�C for 3 min, followed by 35 cycles of
(94�C for 1 min, annealing at the appropriate temperature
for 1 min, extension at 72�C for 2 min), and final extension
at 72�C for 10 min. Amplification products were analyzed
by electrophoresis in 1.5% (w/v) agarose gels stained with
Gel Red� dying solution. Transformed T0 plants carrying
the bar, MsGSAgr and hemL genes were identified by the
presence of amplicons at the expected molecular sizes.
Southern blot analysis
DNA from bombarded and control plants was isolated, as
described above, and were digested with restriction
enzymes that cut only ones. The digestion products were
450 Plant Cell Tiss Organ Cult (2012) 109:447–455
123
separated by electrophoresis in a 0.8% agarose gel (1 V/
cm, 4�C), transferred to a nylon membrane by capillarity
and fixed to the membrane by UV cross-linking. Prehy-
bridization was carried out at 42�C for 4 h in a solution
containing: 59 SSC (NaCl 0.75 M, sodium citrate PCR
assays) and labelled with dig-dNTPs during the PCR
reaction. The washing conditions after hybridization were
markedly stringent (0.3 mM sodium citrate, 3 mM NaCl,
0.1% SDS and 65�C). Two probes were synthesized, one
from the hemL coding sequence to part of the Nos terminator
(amplified using the primers GCAGTTTGAGGCGGGC
TTTA and ATCGCAAGACCGGCAACAG) and the second
one from MsGSAgr coding region using the primers: CCA
GCTTTGGTGCACCTTGTC and ATCGCAAGACCGGC
AACAG) probe after stripping. Hybridization signals were
visualized with antidigoxigenine alkaline phosphatase con-
jugate (Boehringer).
Results and discussion
Effect of gabaculine on durum wheat callus
regeneration
In order to establish the best gabaculine concentration to
use for callus selection after transformation with the hemL
or MsGSAgr marker genes, different concentrations of the
toxin were tested on callus regeneration efficiency. The
toxicity assay was performed on two durum wheat culti-
vars, Svevo and Varano, in order to identify a possible
genotype-dependent response to gabaculine resistance.
These two varieties were selected because they are char-
acterized by a high percentage of plant regeneration from
tissue culture (Gadaleta et al. 2002).
Gabaculine inhibited regeneration of both cv. Svevo and
Varano by decreasing green spot formation, shoot devel-
opment and adult plant formation at all the four tested
concentrations (Table 1). 5 lM gabaculine allowed the
formation of many shoots, from 45% of callus for Svevo
and 70% of callus for Varano. At this low toxin concen-
tration, the shoots were green like the controls, and they
were able to form roots and develop into adult plants; these
were phenotypically indistinguishable from the controls,
with bright green and fully expanded leaves.
A stronger inhibition of regeneration was observed at 20
and 50 lM gabaculine: the two treatments showed the
same inhibitory effect, allowing the development of shoots
for only 20 and 40% of total callus for cv. Svevo and
Varano, respectively. The increased toxicity of gabaculine
also resulted in an change of shoot colour, which were pale
green or, in some cases, chlorotic. In particular, at 20 lM
the percentage of pale green shoots was higher than that of
the chlorotic ones (75% for cv. Svevo and 62% for cv.
Varano), whereas at 50 lM this percentage dropped to
25% for both varieties (Fig. 2). In the following stages of
regeneration, only pale green shoots were able to develop
into plantlets, but they were clearly distinguishable from
the controls, showing a ‘‘weak’’ aspect with little, coiled, or
chlorotic leaves.
As expected, 100 lM gabaculine was toxic for both
durum wheat varieties: the toxin completely inhibited shoot
formation on callus of cv. Svevo, whereas allowed regen-
eration for the only 23% of Varano callus. In this case, the
developed shoots were completely chlorotic and none of
them could develop roots and form adult plants. In genetic
transformation experiments, the quantity of selective agent
added in the culture medium is chosen to allow an efficient
discrimination between transgenic and not transgenic tis-
sues, by inhibiting the growth of the not transformed cells,
while stimulating the proliferation of the transformed ones.
The concentration of the selective substance must not be
too high, as it could lead to the death of the not transformed
cells and the subsequent release of toxic metabolites in the
surrounding medium which could reduce the regeneration
efficiency of the transgenic explants. Based on the results
of preliminary toxicity assay, we established that the best
gabaculine concentration to select wheat callus trans-
formed with hemL and MsGSAgr marker genes was
15 lM. The choice of such concentration in the regenera-
tion medium was due to the fact that 5 lM revealed no
toxic for callus, while 20 lM had a too drastic selective
effect, by allowing the formation of only pale green or
chlorotic plants. Our choice is similar with what reported
by Gough et al. (2001) for the genetic transformation of
Table 1 Effect of different
gabaculine concentrations on
durum wheat callus
regeneration (cv. Svevo and
Varano)
a Regenerating callus = callus
forming green spotsb Developed
plantlets = plantlets developed
from regenerated calli
Gabaculine
concentration
(lM)
Tested
callus
(N�)
Regenerating
callusa (%)
Developed
plantletsb
(%)
Regenerating
callusa
(%)
Developed
plantletsb
(%)
cv. Svevo cv. Varano
0 100 55 100 85 100
5 100 45 100 70 100
20 100 20 75 40 62
50 100 20 25 40 25
100 100 0 0 23 0
Plant Cell Tiss Organ Cult (2012) 109:447–455 451
123
tobacco. In their work they established that a gabaculine
concentration between 5 and 25 lM was suitable for the
detection of not transformed N. tabacum plants susceptible
to the toxin. On the other hand, in the agro-transformation
of alfalfa, Rosellini et al. (2007) employed a 25 lM con-
centration, which was slightly higher than the minimum for
complete inhibition of regeneration. This suggest a differ-
ent susceptibility of plant species to gabaculine intrinsic
genomic resistance.
Comparison of bar/Bialaphos and hemL/gabaculine
selection systems for wheat transformation
In the present work the innovative hemL/gabaculine
selection system was compared with the traditional pro-
cedure based on S. hygroscopicus bar gene as the select-
able marker and Bialaphos herbicide as the selective agent.
A total of two co-transformation experiments were carried
out by simultaneously delivering into wheat callus plas-
mids pAHC20-bar and pAPCK-hemL carrying the bar and
the hemL marker genes, respectively. In each experiment
one thousand embryos were dissected from wheat imma-
ture seeds and induced to callus formation, but only good
quality explants showing round shape and bright yellow
colour were used for transformation experiments. Callus
were cultured for 3 weeks on a ‘‘recovery’’ medium
without any selective pressure after transformation, in
order to repair the mechanical damages of bombardment
and increase the survival of transformants. Then, selection
was separately performed with bialaphos on half callus and
gabaculine on the other half. Regenerated explants from
both selection systems were grown to maturity. A total of
16 plants were obtained in the first experiment, 6 from
gabaculine and 10 from bialaphos selection. In the second
experiment, 33 plants were developed of which 19 selected
with hemL and 14 with bar. The presence of hemL and/or
bar marker genes was confirmed in each T0 plant by PCR
analysis of genomic DNA (Fig. 3a, b). Based on PCR
results, the two selectable makers were compared for their
transformation efficiency, which was calculated as the
number of T0 transgenic plants on the total number of
bombarded callus (Table 2). Our results demonstrated that
biolistic transformation and selection with hemL gene
worked as the traditional bar selection systems using bi-
alaphos in this particular regime. Analysis of southern blot
conducted on one plant of T2 progeny of the 19 plants
resulted positive with PCR reaction showed an hybridiza-
tion signal with the hemL probe. Eight plants showed two
insertion points (Fig. 4), one plants had the 3 insertion
point while for 10 of them a single transgene copy.
In addition to transformation efficiency, the two marker
genes were compared also for their selection ability during
all the different stages of plant regeneration, by estimating
the regeneration, shoot formation, and rooting frequency.
The average values of these parameters for the two
experiments are reported in Table 3. In the initial steps of
regeneration, gabaculine revealed a stronger selective
agent than bialaphos, in fact both callus regeneration and
shoot formation frequencies were lower with the gabacu-
line than the herbicide. Only 9.5% of the bombarded callus
were able to form green spots in presence of gabaculine,
and only 40.8% of them developed into a shoot. On the
contrary, regeneration and shoot formation percentages on
bialaphos selection system were respectively 14.2 and
69.4%.
The effectiveness of the two selective agents was
inverted in the subsequent stages of regeneration, in fact
bialaphos showed a stronger selective pressure than gaba-
culine during the rooting phase, when the rooting formation
percentage was 68% on gabaculine and 30% on bialaphos
medium. Final selection efficiency, calculated as the
number of T0 plants integrating the marker gene divided by
Fig. 2 Regeneration of durum wheat callus (cv. Svevo) on gabaculine-free culture media showing a green colour (a) and on a 50 lM gabaculine
culture media looking pale green (b)
452 Plant Cell Tiss Organ Cult (2012) 109:447–455
123
the total number of regenerated explants, was higher for
gabaculine (78.9%) than for bialaphos (42.8%), thus sug-
gesting a valid use of the hemL gene as an efficient alter-
native to the traditional bar gene in wheat genetic
transformation.
Comparison of bar/Bialaphos and MsGSAgr/gabaculine
selection systems for wheat transformation
Two co-transformation experiments were carried out by
simultaneously delivering into wheat callus plasmids
pAHC20-bar and pAPCK-MsGSAgr carrying the bar and
the M. sativa mutated GSA marker genes, respectively.
Seven hundred embryos were excised in each experiment
but only embryogenic callus were bombarded, namely 500
in the first bombardment and 600 in the second one. Gene
delivery experiments and selection for MsGSAgr and bar
evaluation were conducted in the same way as for the
hemL-bar comparison. Selection with gabaculine or bi-
alaphos was conducted on 250 callus in the first experi-
ment, while on 300 in the second one. The integration of
the transgenes was confirmed by PCR analysis on the
genomic DNA of the regenerated plants (Fig. 3c). A total
of 7 gabaculine-resistant plantlets were obtained in the two
experiments, 6 of which contained the MsGSAgr gene;
besides, 6 bialaphos-resistant plantlets were regenerated, of
which only 3 integrated the bar gene. The average biolistic
transformation frequencies obtained using the two select-
able markers were 1.1% for the MsGSAgr gene and 0.5%
for bar (Table 2). In whole experiments, transformation
was confirmed by inheritance of the transgene as deter-
mined by PCR analysis of progeny DNA and southern
hybridization. Southern hybridization was conducted on
one plant of T2 progeny of each transgenic line for MsG-
SAgr gene resulted first positive to PCR reaction. Analysis
1 2 3 4 5 6 7 8 9 10 11 12 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
A
208 bp
B 1 2 3 4 5 6 7 8 9 10 11 12 13
420 bp
1 2 3 4 5 6 7 8 9 10 11 12
C
1130 bp
Fig. 3 PCR analysis for the detection of the hemL, bar and MsGSAgrgene integration. a 12 T0 plants regenerated from gabaculine selection
showed the expected amplicon from the hemL gene (208 bp, arrow).
Lane 1 100 bp molecular weight Ladder; lane 2 no DNA; lane 3plasmid pAPCK-hemL-nptII; lane 4 cv. Varano genomic DNA; lanes5–8, 10–16: transgenic plants; lane 9 control PCR reaction with no
primer. b PCR analysis for the detection of gene integration in 9 T0
plants regenerated from bialaphos selection. The expected amplicon
from the bar gene (420 bp, arrow) is shown. Lane 1 100 bp molecular
weight Ladder; lane 2 no DNA; lane 3 cv. Varano genomic DNA;
lanes 4–8, 10 transgenic plants; lanes 9, 11, 12 escapes; lane 13plasmid pAHC20. c PCR analysis for the detection of the MsGSAgrgene integration in 7 T0 plants regenerated from gabaculine selection.
The expected amplicon (1130 bp, arrow) is shown. Lane 1 kDNA/
EcoRI, HindIII molecular weight Ladder; lanes 2–5, 7, 8 transgenic
plants; lane 6 escape; lanes 9, 10 plasmid pAPCK-35S-MsGSAgr;
lane 11 no DNA; lane 12 cv. Varano genomic DNA
Table 2 Efficiency of durum wheat (cv. Varano) biolistic transfor-
mation with hemL or MsGSAgr marker genes, ach compared with barselectable gene
Experiment Selection
system
Selected
callus
(N�)
Transgenic
plants
(N�)
Transformation
efficiencya
(%)
hemL vs. bar
I hemL/gabaculine
308 4 1.3
II hemL/gabaculine
350 15 4.3
Mean 2.8
I bar/Bialaphos
308 2 0.6
II bar/Bialaphos
350 11 3.1
Mean 1.8
MsGSAgr vs. bar
I MsGSAgr/gabaculine
250 3 1.2
II MsGSAgr/gabaculine
300 3 1.0
Mean 1.1
I bar/Bialaphos
250 1 0.4
II bar/Bialaphos
300 2 0.6
Mean 0.5
a Transformation efficiency was calculated as the number of trans-
genic plants (PCR-positive plants) divided by the total number of
selected explants
Plant Cell Tiss Organ Cult (2012) 109:447–455 453
123
of southern blot with the MsGSAgr probe showed the
expected fragment. All the six plants resulted positive with
PCR reaction showed an hybridization signal. Four of them
had a single-copy insertions while the other 2 showed two
insertion points. As observed for the hemL gene, also with
M. sativa-derived GSA gene the selection with gabaculine
was an efficient system at least as bar marker and bialaphos
selection in the present concentration. A better selection of
gabaculine was observed in the early stages of regeneration
(Table 3), in fact, both callus regeneration and shoot for-
mation frequencies were lower on gabaculine-containing
media than on the herbicide. After 4 weeks of culture,
gabaculine selection showed 13% of callus with green
spots, and 28.6% of them developed into a shoot. Besides,
bialaphos allowed 20.5% of total bombarded callus to
regenerate, and 36.4% of these latter produced green
shoots. Selection efficiency, calculated for both methods as
the number of T0 plants containing the selectable marker
gene divided by the total number of regenerated plantlets,
was for gabaculine selection (87.5%), and for bialaphos
selection (50%). The Synechococcus hemL gene has
already been showed to be an efficient selectable marker in
agro-transformation of tobacco (Gough et al. 2001) and
alfalfa (Rosellini et al. 2007). In the present work we
suggest for the first time a valid use of hemL and above all
MsGSAgr genes as selectable markers also in durum wheat
biolistic transformation. Our results are in accord with a
number of published papers on biolistic transformation of
wheat with several marker genes, which reported trans-
formation efficiencies ranging from 1 to 3% (Barro et al.
1998; Blechl and Anderson 1996; Bliffeld et al. 1999; Ortiz
et al. 1996; Witrzens et al. 1998).
Conclusion
In the present work a new selection system for transgenic
plant was established for the first time in durum wheat,
using a plant-derived marker gene. The use of new alter-
native markers in transformation experiments allow
researchers to stack successively transgenes. Our system
used the phytotoxin gabaculine as the selective agent and
the M. sativa GSA gene, mutated for gabaculine resistance
(MsGSAgr), as the selectable marker. The efficiency of the
system based on gabaculine was evaluated by using as the
selectable marker both the bacterial gabaculine-resistant
hemL gene from Synechococcus strain GR6, and the plant-
derived point mutated GSA gene from alfalfa, the present
experiments showed that the GSA gene is as a good can-
didate as selection system in plant genetic transformation.
Acknowledgments This work was supported by Ministero
dell’Universita e della Ricerca, project PRIN 2007 and Universita
degli Studi di Bari Aldo Moro, Italy, projects Ateneo 2007, 2008.
1
1600 bp
2200 bp
2 3 4 5 6 7 8
Fig. 4 Southern blot analysis of transgenic wheat. DNA extracted
from leaves of the 8 T2 plants and digested with NcoI (NewEngland
Biolabs) that cuts once in the plasmid pAPCK-hemL. Digestion
products were separated by electrophoresis in a 0.8% agarose gel
(1 V/cm, 4�C). The 8 transgenic lines showed two copy of the
transgene
Table 3 Average selection efficiency, regeneration, shoot formation
and rooting frequencies in durum wheat transformation experiments
employing hemL/gabaculine or MsGSAgr/gabaculine systems, com-
pared to bar/Bialaphos selection
Selection
system
Regeneration
frequencya %
Shoot
formation
frequencyb %
Rooting
frequencyc %
Selection
efficiencyd %
hemL vs. bar
hemL/
gabaculine
9.5 40.8 68.0 78.9
bar/
Bialaphos
14.2 69.4 29.8 42.8
MsGSAgr vs. bar
MsGSAgr/
gabaculine
13.0 28.6 61.5 87.5
bar/
Bialaphos
20.5 36.4 20.0 50.0
a Regeneration frequency = percentage of callus forming green spotsb Shoot formation frequency = percentage of regenerated explants which
developed shootsc Rooting frequency = percentage of shoots which developed rootsd Selection efficiency = percentage of transgenic plants (PCR-positive plants)
on the total number of regenerated plants
454 Plant Cell Tiss Organ Cult (2012) 109:447–455
123
References
Barro F, Cannel ME, Lazzeri PA, Barcelo P (1998) The influence of
auxins on transformation of wheat and analysis of transgene
integration patterns of transformants. Theor Appl Genet 97:
684–695
Blechl AE, Anderson OD (1996) Expression of a novel high-
molecular-weight glutenin subunit gene in transgenic wheat. Nat
Biotechnol 14:875–879
Bliffeld M, Mundy J, Potrykus I, Futterer J (1999) Genetic
engineering of wheat for increased resistance to powdery
mildew disease. Theor Appl Genet 98:1079–1086
Christensen AH, Quail PH (1996) Ubiquitin promoter-based vectors
for high-level expression of selectable and/or screenable marker
genes in monocotyledonous plants. Transgenic Res 5:213–218
Dellaporta SL, Wood J, Hicks JB (1983) Isolation of DNA from
higher plants. PMB Rep 4:19–21
Ferradini N, Nicolia A, Capomaccio S, Veronesi F, Rosellini D
(2011) A point mutation in the Medicago sativa GSA gene
provides a novel, efficient, selectable marker for plant genetic
engineering. J Biotechnol 156:147–152
Gadaleta A, Blechl A, Nguyen S, Blanco A (2002) Embriogenic
callus induction and plant regeneration variability among Italian
durum wheat cultivars. In: Proceedings of EUCARPIA Cereal
Section Meeting Salsomaggiore, Italy, pp 440–442
Gadaleta A, Giancaspro A, Blechl AE, Blanco A (2006) Phospho-
mannose isomerase, pmi, as a selectable marker gene for durum
wheat transformation. J Cereal Sci 43:31–37
Gough KC, Haves WS, Kilpatrick J, Whitelam GC (2001) Cyano-
bacterial GR6 glutamate-1-semialdehyde aminotransferase: a
novel enzyme-based selectable marker for plant transformation.
Plant Cell Rep 20:296–300
Grimm B (1990) Primary structure of a key enzyme in plant
tetrapyrrole synthesis: Glutamate 1-semialdehyde aminotrans-
ferase. PNAS 87:4169–4173
Grimm B, Kannangara CG, Smith AJ, Smith M (1991) Gabacline-
resistant glutamate 1-semialdehyde aminotransferase of Syn-echococcus. J Biol Chem 19:12495–12501
He GY, Rooke L, Steele S, Bekes F, Gras P, Tatham AS, Fido R,
Barcelo P, Shewry PR, Lazzeri PA (1999) Transformation of
pasta wheat (Triticum turgidum L var durum) with high-
molecular weight glutenin subunit genes and modification of
dough functionality. Mol Breed 5:377–386
Hill CM, Pearson SA, Smith AJ, Rogers LJ (1985) Inhibition of
chlorophyll synthesis in Hordeum vulgare by 3-amino-2,3-
dihydrobenzoic acid (gabaculine). Biosci Rep 5:775–781
Houghton JD, Turner L, Brown SB (1988) Biosynthesis of ALA in
Cyanidium caldarium: characterisation of tRNAglu, ligase,
dehydrogenase and GSA. Carlsberg Res Commun 54:131–143
Kahn A, Kannangara CG (1987) Gabaculine-resistant mutants of
chlamydomonas rheinhardtii with elevated glutamate 1-semial-
dehyde aminotransferase activity. Carlsberg Res Commun
52:73–81
Khan RS, Thirukkumaran G, Nakamura I, Mii M (2010) Rol (root
loci) gene as a positive selection marker to produce marker-free
Petunia hybrida. Plant Cell Tissue Organ Cult 101:279–285
Khan RS, Alam SS, Munir I, Azadi P, Nakamura I, Mii M (2011)
Botrytis cinerea-resistant marker-free Petunia hybrida produced
using the MAT vector system. Plant Cell Tissue Organ Cult
106:11–20
Kuiper HA, Kleter GA, Noteborn HP, Kok EJ (2001) Assessment of
the food safety issues related to genetically modified foods. Plant
J 27:503–528
Miki B, McHugh S (2004) Selectable marker genes in transgenic
plants: applications, alternatives and biosafety. J Biotechnol
107:193–232
Ogawa T, Kawahigashi H, Toki S, Handa H (2008) Efficient
transformation of wheat by using a mutated rice acetolactate
synthase gene as a selectable marker. Plant Cell Rep 27:
1325–1331
Ortiz JPA, Reggiardo MI, Ravizzini RA, Altabe SG, Cervigni GDL,
Spitteler MA, Morata MM, Elias FE, Vallejos RH (1996)
Hygromycin resistance as an efficient selectable marker for
wheat stable transformation. Plant Cell Rep 15:877–881
Qiao G, Zhou J, Jiang J, Sun Y, Pan L, Song H, Jiang J, Zhuo R,
Wang X, Sun Z (2010) Transformation of Liquidambar formo-sana L. via Agrobacterium tumefaciens using a mannose
selection system and recovery of salt tolerant lines. Plant Cell
Tissue Organ Cult 102:163–170
Ramessar K, Peremarti A, Gomez-Galera S, Naqvi S, Moralejo M,
Munoz P, Capell T, Christou P (2007) Biosafety and risk
assessment framework for selectable marker genes in transgenic
crop plants: a case of the science not supporting the politics.
Transgenic Res 16:261–280
Rando RR (1977) Mechanism of the irreversible inhibition of
c-aminobutyric acid-a-ketoglutaric acid transaminase by the
neurotoxin gabaculine. Biochemistry 16:4604–4610
Reinbothe S, Reinbothe C (1996) Regulation of chlorophyll biosyn-
thesis in angiosperms. Plant Physiol 111:1–7
Rosellini D (2011) Selectable marker genes from plants: reliability
and potential. In Vitro Cell Dev Biol-Pant 47:222–223
Rosellini D, Capomaccio S, Ferradini N, Savo Sardaro ML, Nicolia
A, Veronesi F (2007) Non-antibiotic, efficient selection for
alfalfa genetic engineering. Plant Cell Rep 26:1035–1044
Stoykova P, Stoeva-Popova P (2010) PMI (manA) as a nonantibiotic
selectable marker gene in plant biotechnology. Plant Cell Tissue
Organ Cult 105:141–148
Thiruvengadam M, Hsu WH, Yang CH (2011) Phosphomannose-
isomerase as a selectable marker to recover transgenic orchid
plants (Oncidium Gower Ramsey). Plant Cell Tissue Organ Cult
104:239–246
Weeks JT, Anderson OD, Blechl AE (1993) Rapid production of
multiple independent lines of fertile transgenic wheat (Triticumaestivum). Plant Physiol 102:1077–1108
Witrzens B, Brettell RIS, Murray FR, McElroy D, Li Z, Dennis ES
(1998) Comparison of three selectable marker genes for
transformation of wheat by microprojectile bombardment. Aust
J Plant Physiol 25:39–44
Plant Cell Tiss Organ Cult (2012) 109:447–455 455
123