FSR QUORUM SENSING - Universidade NOVA de Lisboa · When Quorum Sensing (QS) was discovered it was realized that bacteria have a kind of “social life” and they cooperate and coordinate

Neuza dos Prazeres Lima TeixeiraNeuza dos Prazeres Lima Teixeira

Dissertation presented to obtain the Ph.D degree in BiologyInstituto de Tecnologia Química e Biológica | Universidade Nova de Lisboa

Oeiras,March, 2014

FSR QUORUM SENSING:Role in Enterococcus faecalis Biology & Host Infection

Auth

or:

Neu

za T

eixei

raFS

R Q

UO

RU

M S

ENSI

NG

: R

ole

in E

nter

ococ

cus

faec

alis

Bi

olog

y &

H

ost

Infe

ctio

nO

eira

s, M

arch

, 2014

Neuza dos Prazeres Lima Teixeira

Dissertation presented to obtain the Ph.D degree in BiologyInstituto de Tecnologia Química e Biológica | Universidade Nova de Lisboa

Oeiras, March, 2014

FSR QUORUM SENSING:

Role in Enterococcus faecalis

Biology & Host Infection

From the left to the right: Luís Paulo Rebelo, Maria de Fátima Lopes,

Neuza Teixeira, Constança Pomba, António Jacinto, Miguel Prudêncio

and Francisco Dionísio.

14nd March 2014

Second Edition, March 2014

Stress by Antibiotics and Virulence of Enterococci Laboratory

Instituto de Tecnologia Química e Biológica (ITQB)

Universidade Nova de Lisboa

Avenida da Republica (EAN)

Financial Support from Fundação para a Ciência e Tecnologia (FCT)

Ph.D. Grant: SFRH/BD/65750/2009

ii

iii

Supervisor:

PhD Maria de Fátima Gonçalves Ribeiro dos Santos Silva Lopes

Auxiliary investigator at Instituto de Tecnologia Química e Biológica, Oeiras.

Co-supervisor: PhD Michael S. Gilmore

Sir William Osler Professor at Harvard Medical School, USA

Examining Committee PhD Miguel Prudêncio (Principal Examiner)

Investigator/ Group Leader at Instituto de Medicina Molecular (IMM), Lisboa.

PhD Constança Pomba (Principal Examiner)

Associate Professor at Faculdade de Medicina Veterinária da Universidade Técnica

de Lisboa.

PhD António Jacinto

Principal investigator at Chronic Diseases FCM Nova (CEDOC), Lisboa.

PhD Francisco Díonisio

Auxiliary investigator at Faculdade de Ciências da Universidade de Lisboa.

iv

v

To my supervisor

Fátima Lopes

vi

vii

ACKNOWLEDGMENTS

I would like to express my sincere gratitude to everyone who directly or indirectly

helped me through the development of this thesis. I would also like to acknowledge

the institutes where I worked: ITQB, Shepens Research Eye Institute of Harvard

Medical School and CEDOC.

Special thanks to my great supervisor, Maria de Fátima Silva Lopes. This thesis is

the result of great team work, without you I would never have developed this thesis,

that´s why I dedicate this thesis to you, Fátima. I admire you professionally and

personally, I learned a lot with you. During the 8 years I worked with you, you never

let me down, you were always a great supervisor. Even when you were crossing

difficult times you have never put me aside. You are a special person, a special

friend, thanks for all our discussions about science, live conversations and all the

laughter we had. For me, this PhD is not the end of our team work, it´s the beginning!

Thanks to my co-supervisor, Michael S. Gilmore for having received me in his

laboratory and for having accepted to be my co-supervisor. It was a pleasure working

in your lab and with your team. Thanks for believing in my abilities/skills and in my

work and for helping me during the last four years. Thanks for the advice and wise

words that you have always directed me.

Thanks to my thesis committee, António Jacinto and Francisco Dionísio who

accepted to be part of this work. Special thanks to António for having received me in

his lab at IMM and, later, at CEDOC. António I admire and respect your work and

how you manage your team and now the institute, CEDOC. Thanks for always

saying to me: “You are a part of this team” and for always including me in

congresses and lab retreats, this was very special to me. Thanks for the interesting

viii

discussions about science and for sharing your experiences. I´ll never forget what

you did for me.

Thanks to my collaborators, Kelli Palmer, Lynn Hancock, Jiro Nakayama and

Anna Zaidman-Remy who accepted to work with me and Fátima. We had

interesting discussions about my PhD work.

Thanks to all past colleagues of SAVE laboratory, especially to Sofia Santos,

Paulo Marujo and Teresa Braga for the discussions about science and for being my

friends during that time. From the lab next door to: Beatriz, Marta and Rusa for the

incredible moments and good laughter we had. Special thanks to my friends Paula

Alves and Filipa Silva. Thanks for the nice lunches, dinners and happy moments! I

believe our friendship will persist!

A special thanks to all present and past colleges from António Jacinto lab´s. All of

you contributed for the success of my PhD. I spent great times with you and I learned

a lot about Drosophila and Zebrafish. Thanks to Ana Roberto and Fernanda for

always being ready to help me! Thanks to Lara for the great moments while sharing

the desk, I really spend wonderful moments with you! Thanks for the help that you

gave me in understanding the “Drosophila world”! Thanks to Ana Sofia for helping

me with Drosophila protocols and for always being available to help. To Mariana,

Maria, Angela, Carolina and Telmo for the great time we spent together in fly room

and CEDOC´s sofas! Thanks to Marta Carapuço and Virginia for being great

friends and giving me very wise advices, Thanks!!!

Thanks to all my PhD collegues for the nice moments during the PhD program

classes, our dinners and parties. We spent great times together!! I made very good

friends! Thanks to Margarida Saramago for being my friend and partner in

congresses, we spent a great time together in Greece, I´ll never forget! Thanks to

Claudia Queiroga for being such a good friend, since our first PhD group we never

ix

separated and we built a real friendship. Thanks for all our discussions about

science, life and business Thanks for being by my side in the most difficult

moments of my PhD and of my personal life, you are a really good friend!

Thanks to all past and present InteraQB colleagues, we spent great times organizing

the parties and SunSetSessions! A special thanks to João Damas, Barbara, Lia,

Fábio, Rui, Joana and both Filipa, through InteraQB we built an incredible team and

we built a solid project that is a success in ITQB!

Um grande Obrigado às minhas amigas Ana Margarida Pardelha, Cláudia Xavier e

Rita Fidalgo por terem tido paciência para ouvir todas as minhas preocupações,

reclamações e fúrias! Sem o vosso apoio seria difícil ultrapassar as fases menos

boas do doutoramento. Sempre serão um grande suporte da minha vida, obrigado!

Um grande obrigado à minha irmã, cunhado e sobrinhos por ajudarem a não me

sentir sozinha durante o meu doutoramento e me incluírem sempre nos seus planos!

Um especial obrigado aos meus Pais, por SEMPRE acreditarem em mim e

SEMPRE me apoiarem, mesmo não percebendo bem o que eu fazia no laboratório.

São os meus heróis, admiro-vos muito por serem tão especiais. Obrigado!

Um obrigado doce ao Ricardo Cesário por ter sido SEMPRE o meu suporte, o meu

porto seguro! Pelo amor e carinho incondicional que sempre me deu e por SEMPRE

acreditar em mim. Mesmo nos momentos em que estivemos longe, foste sempre a

pessoa em que me deu a palavra e a força que mais precisava. És a pessoa que

mais me entende, Amo-te!

x

xi

THESIS OUTLINE

The present thesis dissertation is the result of more than four years of research at the

Stress by Antibiotics and Virulence of Enterococci (SAVE) laboratory from Instituto

de Tecnologia Química e Biologica (Oeiras, Portugal); Tissue Morphogenesis and

Repair laboratory from Chronic Diseases FCM Nova (Oeiras, Portugal) and

Departments of Ophthalmology and Microbiology and Immunobiology from Harvard

Medical School (Boston, USA), under supervision of Maria de Fátima Silva Lopes

and Michael S. Gilmore.

The thesis is divided in six chapters. In Chapter I some general concepts of quorum

sensing and Enterococcus genus are introduced. Particular attention is given to

Enterococcus faecalis pathogenesis correlated with quorum sensing Fsr system and

virulence factors it regulates. Additionally, the advantages of using Drosophila

melanogaster as a model organism to study host-pathogen interaction are described.

The Chapters II and III focus on an interesting phenomenon, which is the shutting off

of the QS under certain circumstances. Chapter II focus on a particular diary strain,

E. faecalis LN68, previously reported to show incongruence between gelatinase

genotype and phenotype. We report all experiments performed to explain the reason

of this incongruence. From this work a manuscript was published, which the author of

this dissertation played a major contribution and is the first author. In Chapter III we

describe work produced in order to understand the antagonistic effect of vancomycin,

a cell-wall active antibiotic, on expression of fsr, gelE and sprE genes. This work

resulted in a publication in which the author of this thesis is a co-author.

In Chapter IV we report experiments made to identify all genes regulated, directly

and indirectly, by the Fsr system. To complete the study we also established

Drosophila as a good model to study Fsr virulence. This approach allowed the

identification of new virulence genes in E. faecalis. This work is published in which

the author of this thesis made the majority of the experimental work and is the first

author. The Chapter V described the follow-up work of Chapter IV, and reports the

xii

influence of Fsr system on the Drosophila humoral and cellular immune system

responses. The publication of this work is in preparation.

This PhD thesis is finalized with Chapter VI, a general discussion that correlates all

findings described in the previous chapters, and provides future perspectives for

research on E. faecalis infectivity.

xiii

THESIS PUBLICATIONS

- Teixeira N, Santos S., Marujo P, Yokohata R.,Iyer V. , Nakayama J., Hancock LE,

Serror P. and Maria de Fátima Silva Lopes (2012); The incongruent gelatinase

genotype and phenotype in Enterococcus faecalis are due to shutting off the

ability to respond to the gelatinase biosynthesis-activating pheromone (GBAP)

quorum-sensing signal; Microbiology,158, 519–528 (Doi: 10.1099/mic.0.055574-0).

- Teixeira N., Varahan S., Gorman Matthew J., Palmer L. K., Zaidman-Remy A.,

Yokohata R., Nakayama J., Hancock E. L., Jacinto A., Gilmore M. S., Maria de

Fátima Silva Lopes (2013); Drosophila host model reveals new Enterococcus

faecalis quorum-sensing associated virulence factors; PLoS One 8(5): e64740

(Doi: 10.1371/journal.pone.0064740).

- Ribeiro T., Teixeira N., Yokohata R., Nakayama J., Gilmore M.S. and Maria de

Fátima Silva Lopes (2013); Transcriptomic study Reveals new pathways and

genes involved in Enterococcus faecalis V583 response to a therapeutic dose

of vancomycin, Archives of Microbiology, 4(5:3).(Doi: 10.3823/274).

- Teixeira N., Jacinto A. and Maria de Fátima Silva Lopes; Contribution of

melanization to Drosophila survival changes with E. faecalis V583 genomic

content; (in preparation).

xiv

xv

ABSTRACT

When Quorum Sensing (QS) was discovered it was realized that bacteria have a

kind of “social life” and they cooperate and coordinate their activities on the

bodies/environments they infect/live. Many bacteria only become dangerous to us

when they sense that their numbers are high enough to overwhelm human defences.

Only then they release their toxins and cause illness and death. Since this important

discovery, many bacteria (both Gram negative and Gram positive) were identified as

QS participants. In Gram positive bacteria, the Fsr system (Enterococcus faecalis

system regulator) is one example of QS that controls the expression of two virulence

factors, gelatinase and serine protease, important for the prevalence and survival of

E. faecalis during infection. Enterococcus is a peculiar and controversial genus of

Gram-positive lactic acid bacteria. It includes commensal species inhabiting the

gastro-intestinal tracts of humans and animals. However, they are also capable of

causing opportunistic infections including bacteraemia, endocarditis, meningitis,

wound, urinary tract and nosocomial bloodstream infections. E. faecalis is the

predominant species in human/animal associated environments, and therefore the

most studied species of this genus. Recent data indicates that E. faecalis is the third

most commonly isolated nosocomial pathogen (12% of all hospital infections). Over

representation of E. faecalis among clinical isolates may be related to its natural

abundance, to the presence of virulence factors and/or the ability to acquire easily

antibiotic resistances. The two most studied virulence factors are gelE (encoding

gelatinase, GelE) and sprE (encoding a serine protease, SprE). These genes are

present in clinical and diary enterorococal strains but are not always phenotypically

positive. Fsr system and GeE-SprE have been proven important for E. faecalis

virulence but their role in E. faecalis biology and during the infectious process is

poorly understood. Moreover, the opportunistic nature of E. faecalis makes it difficult

to find the perfect animal model to study host-pathogen interactions. This thesis work

was thus designed to fill these knowledge gaps.

xvi

Under certain conditions, E. faecalis shuts down Fsr QS. In order to investigate the

main reasons for this, we studied E. faecalis LN68 strain that has all fsr and gelE-

sprE genes but a negative gelatinase phenotype (Chapter II). The fsr and gelE-sprE

operons were sequenced, and the negative gelatinase phenotype was attributed to a

nonsense mutation (a premature STOP codon). This mutation in the fsrC gene is

translated into a deficient ATPase sensor domain, responsible for sensing and

transducing the signal from the quorum-sensing molecule. This mutation was found

in other enterococcal strains revealing that this is a natural way to shutdown the QS-

associated production of GelE and SprE and suggesting that some benefits may

come from silencing the QS.

In a previous microarray study from our lab in strain E. faecalis V583, fsr-gelE-sprE

genes were found to be down-regulated by vancomycin, a cell-wall active antibiotic,

(Chapter III). In order to check the hypothesis of QS shutdown by vancomycin, we

used E. faecalis V583ΔfsrB, which is unable to produce GBAP but is able to sense it.

Cells from this mutant were collected after incubation (0 min, 10 and 20 min) with

GBAP or with GBAP and vancomycin .Expression levels of gelE, sprE and vanB

genes were evaluated by semi-quantitative RT-PCR. When GBAP was added after

vancomycin none of the Fsr regulated genes, gelE and sprE, was induced,

suggesting that this antibiotic turns FsrC sensor blind to the QS molecule. It was the

first time Fsr system activity was associated with an antibiotic. These two previous

studies indicate that Fsr associated QS is not essential for growth as it is repressed

in some environments.

Previous studies have suggested that Fsr is a global regulator in E. faecalis. To

complete the study of Fsr biology it is therefore essential to know which other genes

are regulated by the Fsr system and to investigate their role in E. faecalis virulence.

To achieve this goal, we did a transcriptomic analysis using isogenic mutants of

V583 variously defective in either Fsr QS or protease expression to identify the

genes directly and indirectly regulated by Fsr (Chapter IV). QS was artificially

induced by addition of the quorum signal, GBAP, exogenously and in a controlled

manner. The Fsr QS system was found to regulate five genes (gelE, sprE, ef1097

xvii

and ef1351-52) and twelve additional genes were found to be dependent on the

presence of the QS-induced proteases. Additionally, the induction of gelE and sprE

resulted in up-regulation of two genes important in cell autolysis – lrgAB – that were

confirmed to be regulated by LytRS.

Drosophila melanogaster has proven useful as a tool to study host-pathogen

interactions, both for bacterial pathogens and human commensals. We therefore

chose this model organism to gather clues on the role of Fsr, and of the genes it

regulates, on host disease and death inflicted by E. faecalis infections. To study the

mechanism of pathogenesis associated with Fsr, proteases and new genes,

Drosophila was first established as an infection model. We then infected the fruit fly

with V583 mutants on the newly found genes. Two new Fsr - associated virulence

factors were found, namely, lrgAB operon and the bacteriocin coding gene ef1097.

We also found that inactivation of Fsr and the two proteases increased fly´s tolerance

to E. faecalis, whereas flies showed similar resistance towards all studied E. faecalis

strains. These results suggest that future approaches to combat the E. faecalis

infection can be through improving host tolerance, providing an alternative, or a

complement, to the use of antibiotics.

These new findings lead us to further investigate the role of Fsr in the cross-talk with

the Drosophila immune system (Chapter V). We measured the expression of

drosomycin; analyzed the phagocytosis and the melanization during Drosophila

infection (control W1118, W1118HmlΔ>GFP/UAS-Bax and W1118 PPO1Δ, PPO2Δ) with

V583 and V583ΔfsrBΔgelEΔsprE strains. We found that Fsr interfered with the

melanization process. Moreover, Drosophila was only able to survive in the absence

of both Fsr-GelE-SprE factors and melanization. Melanization is used by Drosophila

to combat the pathogens but when exacerbated is also able to cause host injury. We

believe that fly death, caused by E. faecalis carrying Frs-GelE-SprE, is due to

exacerbated host injury by host´s own immune response.

Overall, the work presented in this thesis gives us important clues on the role of Fsr

and QS both in the E. faecalis biology, in its struggle in the environment it inhabits,

as well as in the cross-talk with the host. For future, the data reported in this thesis

xviii

can be further explored to find new therapies to control the E. faecalis infections and

decrease their impact on host death numbers.

xix

RESUMO

Desde a descoberta do Quorum Sensing (QS), percebeu-se que as bactérias têm

uma espécie de “vida social” e que cooperam e coordenam as suas actividades no

hospedeiro/ambiente que infectam/habitam. Muitas bactérias só se tornam perigosas

quando sentem que estão em número suficiente para sobrecarregar a defesa

humana. Em seguida, libertam toxinas e causam doença e, eventualmente, morte. A

partir do momento em que foi feita esta importante descoberta, muitas bactérias

(Gram negativas e Gram positivas) foram identificadas como participantes no QS.

Em bactérias Gram positivas, o sistema Fsr (Enterococcus faecalis system regulator)

é um exemplo de QS que tem como molécula sinal a GBAP (Gelatinase biosynthesis

activating pheromone).O Fsr controla a expressão de dois factores de virulência,

gelatinase e proteinase sérica, importantes para a persistência e sobrevivência de E.

faecalis durante a infecção. Enterococcus é um género peculiar e controverso que

pertence ao grupo de bactérias lácticas Gram-positivas. Este género inclui espécies

comensais que habitam no trato gastrointestinal de humanos e animais. Contudo,

são capazes de causar infecções oportunistas como bacteremias, endocardites,

meningites, feridas, infecções urinárias e infecções nosocomiais da corrente

sanguínea. E. faecalis é a espécie predominante em humanos/animais, e também a

mais estudada. Estudos recentes indicam que E. faecalis é o terceiro patogénico

nosocomial mais comum (12% das infecções hospitalares). A abundante presença

de E. faecalis em isolados clínicos poderá estar relacionada com a sua natureza de

produzirem factores de virulência e/ou com a sua facilidade de adquirirem

resistência a antibióticos. Os factores de virulência mais estudados são gelE

(gelatinase, GelE) e sprE (proteinase sérica, SprE). Embora estes genes estejam

presentes em estirpes clínicas e ambientais de Enterococcus, nem sempre

produzem um fenótipo positivo. O sistema Fsr e as proteases GelE-SprE têm vindo

a ser referenciados como importantes para a virulência de E. faecalis, mas a sua

função na biologia e durante o processo de infecção de E. faecalis é ainda

xx

desconhecida. Além disso, a natureza oportunista de E. faecalis tem tornado difícil a

escolha de um modelo animal perfeito para o estudo da interacção entre o

hospedeiro e o patogénico. O trabalho desta tese foi desenhado para preencher

estas lacunas do conhecimento.

Em certas condições, E. faecalis desliga o QS Fsr. É o caso da estirpe E. faecalis

LN68 que tem todos os genes fsr e gelE-sprE mas apresenta um fenótipo gelatinase

negativo (Capítulo II). Os operões fsr e gelE-sprE foram sequenciados e o fenótipo

gelatinase negativo foi atribuído à presença de uma mutação sem sentido (um

codão STOP prematuro). Esta mutação no gene fsrC afecta o domínio sensor

ATPase, responsável por sentir e traduzir a GBAP. Esta mutação foi também

identificada noutras estirpes de Enterococcus revelando ser uma forma natural de

desligar a produção de GelE e SprE associada ao QS, e sugerindo que esta bactéria

poderá ter benefícios energéticos com o silenciamento do QS.

Num estudo anterior de transcriptómica em E. faecalis V583, os genes fsr-gelE-sprE

foram identificados como serem negativamente regulados pela vancomicina,

antibiótico que inibe a síntese da parede celular, (Capítulo III). Para testar a

hipótese de que o QS é desligado pela presença da vancomicina, usou-se a estirpe

mutante E. faecalis V583ΔfsrB, que é incapaz de produzir GBAP mas sente o seu

sinal e activa a síntese das proteases. Células deste mutante foram recolhidas após

incubação (0 minutos, 10 e 20 minutos) com GBAP ou com GBAP e vancomicina.

Os níveis de expressão dos genes gelE, sprE e vanB foram quantificados por RT-

PCR semi-quantitativo. Quando a GBAP foi adicionada depois da vancomicina

nenhum dos genes regulados pelo Fsr, nomeadamente gelE e sprE, foram induzidos

sugerindo que este antibiótico torna o sensor FsrC cego à molécula QS. Esta

constitui a primeira vez em que a actividade do sistema Fsr foi correlacionada com

um antibiótico. Estes dois estudos previamente descritos demonstraram que o QS

associado ao Fsr não é essencial ao crescimento da bactéria mas é reprimido em

alguns ambientes/condições.

Estudos anteriormente realizados têm sugerido que o Fsr é um regulador global em

E. faecalis. Para completar o estudo da biologia do Fsr é essencial identificar os

xxi

outros genes que o sistema Fsr regula, e investigar o seu contributo para a

virulência de E. faecalis. Para atingir este objectivo, procedeu-se à análise

transcriptómica usando mutantes isogénicos de V583 no Fsr e nas proteases, para

identificar os genes directamente e indirectamente regulados por este sistema de

QS (Capítulo IV). O QS foi artificialmente induzido pela GBAP, adicionada

exogenamente e de uma forma controlada. O sistema Fsr foi identificado como

regulador de cinco genes (gelE, sprE, ef1097 e ef1351-52). Doze genes adicionais

foram identificados como sendo dependentes da presença das proteases induzidas

pelo QS. Adicionalmente, a indução do gelE e sprE resultou na regulação positiva de

dois genes importantes para a autólise celular – lrgAB- tendo-se confirmado que são

regulados pelo sistema de dois componentes LytRS.

Drosophila melanogaster tem vindo a demostrar ser uma ferramenta útil para o

estudo da interacção do hospedeiro – patogénico, em particular, no estudo de

bactérias patogénicas e comensais humanos. Foi por essa razão que se escolheu

como modelo para estudar a função do Fsr e dos genes que este regula, no

desenvolvimento da doença do hospedeiro e na morte inerente à infecção causada

por E. faecalis. D. melanogaster foi primeiro estabelecida como modelo de infecção

para estudar o mecanismo patogénico associado ao Fsr, proteases e os novos

genes. Em seguida, a mosca da fruta foi infectada com mutantes de V583 nos genes

novos anteriormente identificados. Dois novos factores de virulência associados ao

Fsr foram assim identificados, nomeadamente lrgAB e a bacteriocina ef1097.

Também foi observado que a inactivação do Fsr e das duas proteases aumenta a

tolerância da mosca relativamente a E. faecalis, sido demonstrada resistência similar

para todas as estirpes E. faecalis testadas. Este resultado sugere que o combate de

infecções por E. faecalis poderá passar por beneficiar a tolerância do hospedeiro,

proporcionando uma alternativa ou um complemento ao uso de antibióticos.

Estas novas descobertas levaram-nos a investigar a função do Fsr na comunicação

com o sistema imunitário da Drosophila (Capítulo V). Durante a infecção de

Drosophila (controlo W1118, W1118HmlΔ>GFP/UAS-Bax and W1118 PPO1Δ, PPO2Δ)

com as estipes V583 e V583ΔfsrBΔgelEΔsprE foi medida a expressão da

xxii

drosomicina, analisada a fagocitose e a melanização. Observou-se que o Fsr

interfere com o processo de melanização. Além disso, Drosophila só foi capaz de

sobreviver quando, em simultâneo, não estão presentes nem o Fsr e as proteases

GelE-SprE, nem a melanização. Esta é um mecanismo utilizado pela Drosophila

para combater os patogénicos mas quando exacerbada é capaz de provocar danos

no próprio hospedeiro. É possível que a morte da mosca da fruta causada por E.

faecalis com Fsr-GelE-SprE seja devida às lesões decorrentes de uma exacerbada

resposta imune do hospedeiro.

No geral, o trabalho apresentado nesta tese fornece pistas importantes sobre o

papel do Fsr - QS, tanto na biologia de E. faecalis, na sua forma de sobreviver nos

seus habitats, bem como no cross-talk com o hospedeiro. Para futuro, os resultados

apresentados nesta tese podem ser explorados para a procura de novas terapias

para o controlo de infecções provocadas por E. faecalis de forma a diminuir o seu

impacto sobre a morte do hospedeiro.

xxiii

ABREVIATIONS

Abbreviation Full form

Δ Deletion

ΔCt Cycling threshold

Ace Adhesion to collagen

agr Accessory gene regulator

AIP Autoinducer peptide

AHL Acyl-homoserine lactone

AIs Autoinducers

AMPs Antimicrobial peptides

A. thaliana Arabidopsis thaliana

AS protein Aggregation substance

Bee Biofilm enhancer

BHI Brain heart infusion

bp Base pairs

°C degree Celsius

C. elegans Caenorhabditis elegans

cDNA Complementary DNA

CFUs Colony forming units

cps cluster Capsular polysaccharides

Cyl Cytolysin

ddl D-alanine-D-alanine ligase

D-Lac D-lactate

D-Ser D-serine

DNA Deoxyribonucleic acid

Drosophila Drosophila melanogaster

Ebp Endocarditis and biofilm associated pili

(e)DNA Extracellular DNA

ElrA Surface protein

epa cluster Enterococcal polysaccharide antigen

EPS Extracellular polymeric substances

E. casseliflavus Enterococcus casseliflavus

xxiv

E. coli Escherichia coli

E. durans Enterococcus durans

E. gallinarum Enterococcus gallinarum

E. faecalis Enterococcus faecalis

E. faecium Enterococcus faecium

Esp Surface protein

fsr E. faecalis regulator

iRNA RNA interference

GBAP Gelatinase biosynthesis activating pheromone

GelE Gelatinase

G. melonella Galleria melonella

GRAS Generally Recognized As Safe

h hours

HK Histidine Kinase

hld virulence factor δ-lysin

JAK/STAT Janus kinase/signal transducer and activator of transcription

LB Luria Bertani Broth

LN68 Strain isolated from Niza milk

LSE4 Strain isolated from Serra da Estrela milk

MDR Multi-Drug Resistance

mg milligram

min minute

ml millilitre

M. luteus Micrococcus luteus

mRNA messenger RNA

M. sexta Manduca sexta

NaCl Sodium Chloride

NCBI National Center for Biotecnology Information

nl nanoliters

ng nanogram

nM nanoMolar

nt Nucleotides

mM milliMolar

OD Optical density

OG1RF E. faecalis OG1RF

PCR Polymerase chain reaction

xxv

PPO Pro-phenoloxidase

PO Phenoloxidase

PRR Pattern recognition receptor

PG Peptidoglycan

(PGRP)-LC Peptidoglycan recognition protein

QA29b Strain isolated from Azeitão cheese

qRT-PCR Quantitative real-time polymerase chain reaction

QS Quorum sensing

S. aureus Staphylococcus aureus

SPHs Serine protease homologues

SprE Serine protease

StrA Sortase

TM Melting temperature

VRE Vancomycin resistant Enterococci

V583 E. faecalis V583

RHK Receptor histidine kinase

RNA Ribonucleic Acid

rDNA Ribossomal RNA

ROS Reactive oxygen species

RR Response Regulator

RT-PCR Reverse Transcriptase-polimerase chain reaction

V. fischeri Vibrio fischeri

V. harveyi Vibrio harveyi

wt Wild-type

XIP Double-tryptophan peptide pheromone

xxvi

xxvii

TABLE OF CONTENTS

Acknowledgments ..................................................................................................... vii

Thesis outline ............................................................................................................. xi

Thesis publications ....................................................................................................xiii

Abstract ..................................................................................................................... xv

Resumo .................................................................................................................... xix

Abreviations ............................................................................................................ xxiii

Table of contents .................................................................................................... xxvii

INTRODUCTION

1. QUORUM SENSING

A Way to Communicate………………………………..………………………………….5

1.1 Different QS Systems Among Bacteria……………………………………………….6

1.2 Enterococcus faecalis Fsr Quorum Sensing System………………………………..8

2. ENTEROCOCCUS GENUS

General Characteristics…………………………………………….……………………12

2.1 Enterococcus spp. - An Opportunistic Pathogen…………………………………...13

3. ENTEROCOCAL VIRULENCE

The Role of Fsr, Gelatinase and Serine Protease………………………………......16

3.1 Animal Models to Study Fsr and Proteases………………………………………...20

4. DROSOPHILA MELANOGASTER

A model to Study Host-pathogen Interaction………………..………………………23

5. AIMs AND SCOPE OF THESE THESIS…………………………………...………...30

6. Bibliography……..…...…………………………………..………………………………32

CHAPTER I

xxviii

SILENCING FSR SYSTEM: A Way to Survive

1. Summary………………………………...……………………………………………….51

2. Introduction………………………………………………………………………………52

3. Material and methods…………………………………………………………………...55

4. Results and Discussion…………………………………………………………………59

5. Acknowledgements……………………………………………………………………..67

6. Bibliography……...………………………………………………………………………68

7. Supplementary data…………………………………………………………………….74

FSR AND VANCOMYCIN:

The antagonistic relation

1. Summary…………………………………………………………………………………81

2. Introduction………………………………………………………………………………82

3. Material and methods…………………………………………………………………...84

4. Results and Discussion………………………………………………………………...86

5. Bibliography……………………………………………………………………………...90

NEW FINDINGS ON FSR SYSTEM: New

virulence genes and their impact during Drosophila infection

1.Summary………………………………………………………………………………….99

2. introduction……………………………………………………………………………..100

3. material and methods………………………………………………………………….103

4. Results…………………………………………………………………………………..110

5. Discussion………………………………………………………………………………118

6. Acknowledgements……………………………………………………………………124

7. Bibliography…………………………………………………………………………….125

8. Supplementary data……………………………………………………………………135

CHAPTER III

CHAPTER IV

CHAPTER II

xxix

FSR SYSTEM AND DROSOPHILA:

The collapse of the immune system

1.Summary………………………………………………………………………………...145

2. Introduction………………………………………………………………………...…...146

3. Material and methods………………………………………………………………….149

4. Results ………………………………………………………………………………….152

5. Discussion………………………………………………………………………………159

6. Acknowledgements……………………………………………………………………162

7. Bibliography…………………………………………………………….………………163

GENERAL DISCUSSION

1. FSR QUORUM SENSING SYSTEM

- Different environments lead different ways to persist………………………….……173

2. FSR REGULON

- New genes and potential virulence factors…………………………………………...177

3. FUTURE PRESPECTIVES

- Fsr system can be a future target for therapy………………………………………..183

4. Bibliography………………...…………………………………………………………..185

CHAPTER V

CHAPTER VI

xxx

INTRODUCTION

CONTENTS

1. QUORUM SENSING

A Way to Communicate ............................................................................................ 5

1.1 Different QS Systems Among Bacteria ............................................................. 6

1.2 Enterococcus faecalis Fsr Quorum Sensing System ........................................ 8


General Characteristics .......................................................................................... 12

2.1 Enterococcus spp. - An Opportunistic Pathogen ............................................ 13


The Role of Fsr, Gelatinase and Serine Protease ................................................. 16

3.1 Animal Models to Study Fsr and Proteases .................................................... 20

4. DROSOPHILA MELANOGASTER ....................................................................... 23

A model to Study Host-pathogen Interaction

5. AIMs AND SCOPE OF THESE THESIS ............................................................... 30

6. BLIBLYOGRAPHY ............................................................................................... 32

Chapter I

4

Neuza Teixeira has written the whole chapter based on the referred bibliography.

INTRODUCTION

5

Cha

pter

I

1. QUORUM SENSING

A Way to Communicate

Many bacteria are known to regulate their cooperative activities and physiological

processes trough a mechanism called quorum sensing (QS), in which bacterial cells

communicate with each other by releasing, sensing and responding to small

diffusible signal molecules. QS as a concept grew out of the work of JW Hastings in

the 1960’s (Hastings & Greenberg, 1999). QS describes a process of cell-to-cell

communication used by bacteria to understand and adapt in their environment and

consequently to apply specific strategies that allow adaptation to environmental

stress in space and time (Fuqua et al., 1994; Skandamis & Nychas, 2012).

QS cell-to-cell signaling results from production of small, diffusible signal molecules

called autoinducers that are secreted at a basal level during bacterial growth by

emitter cells. This signal accumulates in the surrounding environment. When the

concentration of these signal molecules reaches a threshold level (the quorum level),

the signal molecule binds to receptors on or in the bacteria cell and alter gene

expression (Figure 1) (Skandamis & Nychas, 2012).

A B

Figure 1 - Diagram of quorum sensing. (A) At low cell density, the concentration of the autoinducer (blue

dots) is relatively low and the expression of a regulated product (red dots) is restricted. (B) At high cell density, the

concentration of the autoinducer is high and expression of the regulated bacterial product is induced or derepressed

(http://commons.wikimedia.org/wiki/File:Quorum_sensing_diagram.png).

Chapter I

6

QS control genes that are beneficial when expressed by groups of bacteria acting in

synchrony. The list of processes that bacteria coordinate by QS is extensive. These

activities are generally unproductive when carried out by small number of cells.

Bacteria use quorum sensing communication circuits to regulate a diverse array of

physiological activities that include symbiosis, virulence, competence, conjugation,

antibiotic production, motility, sporulation, and biofilm formation (Rutherford &

Bassler, 2012).

One classical example of QS is the production of bioluminescence by the marine

bacteria Vibrio fischeri, a symbiont of Hawaiian bobtail squid Euprymna scolopes

(Nealson & Hastings, 1979; Reading & Sperandio, 2006). V. fischeri lives in squid

light organ (nutrient-rich environment) and is only beneficial to the bacteria to

synthesize the light producing enzymes (luciferase) when certain number of

autoinducers inside the squid light organ are detect. In contrast, autoinducers do not

accumulate to any significant level in free ocean and V. fischeri does not make light.

On the other hand, light production by the bacteria enables the squid to eliminate its

shadow in the ocean and thus the light is used as squid in a strategy to evade

predators (Bassler, 1999; Reading & Sperandio, 2006).

1.1 Different QS Systems Among Bacteria

QS systems in bacteria have been generally divided into at least three classes: (1)

LuxI/LuxR-type QS in Gram negative bacteria which use acyl-homoserine lactones

(AHL) as signal molecules; (2) oligopeptides-two-component-type QS in Gram

positive bacteria, which use small, often post-translationally modified peptides as a

signal molecule; and (3) luxS-encoded autoinducer 2 (AI-2) QS in both Gram

negative and Gram positive bacteria (Li & Tian, 2012).

Gram negative bacterial, typically use AHL molecules as autoinducers, and each

species has distinct AHL to communicate with members of its own species. AHLs are

produced by LuxI-type proteins and AHLs diffuse freely across cell membrane. At

INTRODUCTION

7

Cha

pter

I

high concentration, the autoinducer binds to a transcription factor of the LuxR type in

the cytoplasm, and this LuxR-AHL complex binds to a specific promoter thereby

activating gene expression for group-specific processes, like bioluminescence (lux)

(Figure 2) (Bassler & Vogel, 2013; Bassler, 1999).

In Gram positive bacteria there are two types of QS systems. The first type uses

autoinducer peptides (AIP), called peptide pheromones. Gram positive bacteria

normally produce a signal peptide precursor, which is cleaved and the active AIP is

then exported through a peptide-specific ABC transporter into their environment. AIP

is recognized by the input domain of a typical sensor element of a histidine kinase

(HK) two-component signal transduction system. HK phosphorylates the response

regulator (RR) which binds to the promoter of genes of interest (Figure 2).

Figure 2 - Quorum-sensing signalling pathways in Gram negative (A) and Gram positive bacteria

(B). (A) LuxI/LuxR in a Gram-negative bacteria. The autoinducer (black dots) synthesized through pathways

involving LuxI, is released, and then reenters into bacteria and binds to receptors (LuxR) that alter cellular response

elements. (B) QS in Gram positive bacteria. Amino acids or short peptides (wavy lines) are exported and then bind

to cell surface-bound sites that activate phosphorylation cascades, leading to transcriptional changes (Raffa et al.,

2005) (http://www.accessscience.com).

Another common feature of many QS systems is the involvement of a dedicated

ATP-binding cassette (ABC) exporter in the secretion of the peptide pheromone.

Very often, the genes encoding the precursor of the peptide pheromone and the

genes encoding the proteins involved its detection through a the two-component

Chapter I

8

sensing system, as well as those involved in the secretion of peptide, are

transcriptionally linked, and the synthesis of the peptide signal forms an

autoregulatory loop (Figure 2) (Waters & Bassler, 2005).

In recent years, a second type of QS system has been identified in several groups of

Gram-positive streptococci. This system is called ComRS, and uses a small double-

tryptophan peptide pheromone (XIP) as a signal molecule. XIP is internalized by an

oligopeptide ABC transporter typified by Opp/Ami, and interacts with transcriptional

regulator ComR, a proximal regulator of sigX that encodes a master regulator or

alternative sigma factor SigX (ComX). Later , the competence genes for genetic

transformation are activated (Li & Tian, 2012).

In additional to these QS systems, another QS type called autoinducer 2 (AI-2) has

been described in both Gram negative and Gram positive organisms. This type of QS

system enables inter-species signaling. AI-2 was first characterized in marine

bacterium Vibrio harveyi and contributes to regulation of cell-density-dependent

bioluminescence. The synthesis of AI-2 depends on a luxS encoded synthase, which

is a metabolic enzyme involved primarily in the conversion of ribosyl-homocysteine

into homocysteine and 4,5-dihydroxy-2,3-pentanedione (DPD), the precursor of AI-2.

The LuxR protein is a cytoplasmic receptor and transcription activator. Homologues

of luxS have been found in many species of bacteria, suggesting that AI-2 QS is

widely spread among prokaryotes (Li & Tian, 2012).

1.2 Enterococcus faecalis Fsr Quorum Sensing System One example of QS with a cell density-dependent two-component regulatory system

mechanism in Gram positive bacteria is the Fsr system in Enterococcus faecalis (E.

faecalis regulator). This QS system, first described by Qin et al, controls the

expression of pathogenicity-related extracellular proteases, gelatinase (gelE) and

serine protease (sprE), and has been suggested to also regulate biofilms formation

and other genes important for virulence (Nakayama et al., 2001a; Nakayama et al.,

INTRODUCTION

9

Cha

pter

I

2001b; Nakayama et al., 2006; Qin et al., 2000; Qin et al., 2001). The fsr locus

consists of four genes fsrA, fsrB, fsrD and fsrC, which collectively regulate the

expression of gelE and sprE . The fsr locus has significant similarity to the accessory

gene regulator (agr) locus of staphylococci that includes within it the virulence factor

δ-lysin (hld) and regulates expression of a number of additional exotoxins (Figure 3).

In the Fsr system, a cyclic peptide, gelatinase biosynthesis-activating pheromone

(GBAP), acts as the autoinducer.

Figure 3 – Fsr Quorum Sensing. A schematic diagram with proposed mechanism of fsr activation and its effect

on gelatinase and serine protease synthesis (www.agr.kyushu-u.ac.jp/lab/microbt/Research/QuorumSensing.html).

The GBAP is translated from fsrD and then cyclized by FsrB resulting in the mature

form of GBAP (Figure 4). It has been proposed that the transport of GBAP outside of

the cell occurs through FsrB. When the concentration of GBAP outside the cell

reaches a threshold level, around 1 nM, it triggers the two-component regulatory

system consisting of a transmembrane histidine kinase (FsrC) and a response

regulator (FsrA). FsrC senses the GBAP level and phosphorylates FsrA, which then

binds promoters P1 and P2 inducing the expression of fsrBDC and gelE-sprE

Chapter I

10

transcripts (Figure 3) (Nakayama et al., 2001a; Nakayama et al., 2001b; Nakayama

et al., 2006; Qin et al., 2000; Qin et al., 2001).

Qin et al (2000) reported that the gelatinase phenotype requires the concomitant

presence of the fsr and gelE (Qin et al., 2000). In the years following this finding,

several studies reported the loss of the gelatinase phenotype in different

Enterococcus strains. In some cases, this phenomenon was found to be associated

with a deletion of part of Fsr operon, but in other cases incongruence between the

genotype and the phenotype was reported. All these reports indicate that the loss of

GelE phenotype, in the presence of an apparently complete fsr operon, occurs both

in natural and laboratory subcultured E. faecalis isolates (Eaton & Gasson, 2001;

Galloway-Pena et al., 2011; Lopes Mde et al., 2006; Nakayama et al., 2002).

Figure 4 – Structure and properties of GBAP (Gelatinase Biosynthesis Activating Pheromone).

GBAP is a cyclic peptide pheromone in E. faecalis with 11 aminoacid residues and a cyclic peptide containing a

lactone linkage. The lactone ring is indispensable for the activity (Nakayama et al., 2001b).

In 2006, Bourgogne et al. made a transcriptomic study comparing OG1-RF (a

clinical E. faecalis isolate) with its isogenic fsrB deletion mutant and suggested that

fsr is more than a regulator of the gelE and sprE protease genes (Bourgogne et al.,

2006). Moreover, the effect of fsrB mutation had different effects on overall

transcription depending on the growth phase, which points to fsr as a major regulator

of many functions in the cell. This study revealed that besides the proteases, Fsr also

regulates directly a bacteriocin ef1097, and ef0954-0957 (bopABCD) a transcriptional

INTRODUCTION

11

Cha

pter

I

regulator of biofilm formation in plastic surface. The detailed mechanism of gene

regulation and pathogenesis associated with Fsr system and proteases are currently

incomplete (Bourgogne et al., 2006).

Recent transcription studies have also shown that fsr and gelE–sprE expression is

modulated during some stress conditions, namely in blood (Vebo et al., 2009), urine

(Vebo et al., 2010) and vancomycin (unpublished data from our Lab).

Chapter I

12


General Characteristics

The name “entérocoque” was first used in 1899 by Thiercelin to identify a new

species of Gram positive coccus found in the human gut (Thiercelin, 1899).

Enterococci are lactic acid Gram positive bacteria, with ovoid shape (coccus) that

grows in short chains, pairs or as single cells. They are facultative anaerobic

bacteria, catalase negative and can grow between 10-45ºC, although their optimal

temperature is 35-37ºC. Most enterococcal species are able to grow in the presence

of 6, 5% of NaCl, at pH 9, 6 and 40% of bile salts. They are homo-fermentative; and

produce lactic acid from glucose (Mundt, 1986).

The identification of species from the genus Enterococcus by physiological tests

has always been problematic because of their considerable phenotypic diversity.

Furthermore, identification of species by conventional tests often requires long

incubation times. Genotypic identification methods using the 16S and 23S rDNA

genes are more accurate; although they cannot differentiate between all

Enterococcus species (e.g. Enterococcus gallinarum and Enterococcus casseliflavus

show 99.8% homology in their 16S rDNA). Alternative methods have been

successfully applied using amplification of specific genes, for example, the ddl gene

with encodes D-alanine-D-alanine ligase (Ogier & Serror, 2008). Nowadays, the

genus Enterococcus is composed of forty-five species, with the most common

species studied being Enterocccus faecalis and Enterococcus faecium

(http://old.dsmz.de). Historically E. faecalis has been the most intensively studied

due to its prominence in the nosocomial setting.

The first sequenced genome available was that of E. faecalis V583 (Paulsen et al.,

2003), which was isolated from a patient suffering from a persistent bloodstream

infection and was the first reported vancomycin resistant clinical isolate in the United

States (Sahm et al., 1989). E. faecalis V583 has served as a model clinical strain

causing human infections. In 2008, the genome of another E. faecalis strain, OG1RF,

INTRODUCTION

13

Cha

pter

I

(Bourgogne et al., 2008) was reported and in 2010 the genome of 28 other

enterococcal strains (including E. faecalis, E. faecium, E. casseliflavus and E.

gallinarum species) became available (Palmer et al., 2010).

E. faecalis and E. faecium are natural members of the gastrointestinal microbiota in

humans, varying in abundance among individuals along the gastro-intestinal tract.

Enterococci are commonly isolated from foods, plants, water and soils, because of

their use in fermentations, and also as a result of dissemination from fecal sources

combined with their natural tolerance to adverse environmental conditions (Lopes et

al., 1999; Ogier & Serror, 2008). Unlike many other lactic acid bacteria, enterococci

are not considered as “Generally Recognized As Safe” (GRAS) and their detection in

water is regarded as an indicator of fecal contamination (Godfree et al., 1997).

Enterococci therefore have an ambiguous status concerning assessment of

enterococci food containing safety. On the one hand, enterococci are used in cheese

making, in the development of flavors, aroma and contributing to the ripening of

cheeses such Cheddar, Feta and Mozarella. On the other hand, their ability to

produce biogenic amines in cheese and fermented sausages and their propensity for

genetic exchange constitute negative aspects for their utilization as probiotic

(Foulquie Moreno et al., 2006; Giraffa, 2003; Ogier & Serror, 2008).

2.1 Enterococcus spp. - An Opportunistic Pathogen

Enterococci are commensal bacteria of the gastro-intestinal tracts of humans,

animals and insects. Although harmless in healthy individuals, enterococcal clinical

isolates become pathogenic in patients in intensive care units, in hospitalized

patients with impaired immune systems and elderly people. As opportunistic

pathogens, they are prevalent in the nosocomial environment, causing infections of

the urinary tract, bloodstream, intra-abdominal and pelvic regions, surgical sites, and

rarely the central nervous system (Foulquie Moreno et al., 2006). Recent data

Chapter I

14

indicate that E. faecalis is the third most commonly isolated nosocomial pathogen

(12% of all hospital infections) (Hollenbeck & Rice, 2012).

Currently, in the United States and Europe, infections caused by E. faecium are

much more frequently resistant to vancomycin and ampicillin than those caused

by E. faecalis. E. faecium is now almost as common a cause of nosocomial infection

as E. faecalis. This change in species is of paramount clinical importance, as E.

faecium is by far the more difficult of the two species to treat (Arias & Murray, 2012).

Antibiotics interrupt vital cellular functions through different modes of action.

Inhibition of growth is usually achieved by attacking the cell-wall and cell membrane

integrity, or by interfering with DNA, RNA or protein synthesis. Antibiotics can be

either bactericidal or bacteriostatic depending on their mechanism of action.

Bactericidal antibiotics effectively kill the target bacteria; and bacteriostatic halt cell

growth and replication. From a clinical perspective, infections caused by multidrug

resistant enterococci are difficult to treat due to limited therapeutic options.

Enterococci have been shown to possess a broad range of intrinsic antibiotic

resistances (Leclercq et al., 1992; Moellering, 1992; Murray, 1990) and are able to

acquire high-level drug resistance to certain antibiotics. Resistances may arise by

point mutations in the drug binding site, like in quinolones (Onodera et al., 2002) and

ampicillin, or by acquisition of resistance genes, as in the case of aminoglycosides,

macrolides, chloramphenicol, tetracycline and glycopeptides, of which vancomycin

resistance is the most relevant clinically (Leclercq et al., 1992; Moellering, 1992;

Murray, 1990; Onodera et al., 2002; Saurina et al., 1997). Enterococal success as

nosocomial pathogens is also related to their ability to survive for long periods on

environmental surfaces, including medical equipment, bed rails and doorknobs. They

are tolerant to heat, chlorine and some alcohol preparations (Arias & Murray, 2012;

Braga et al., 2011). Dissemination of resistance to different antibiotics is a problem

among clinical, dairy and veterinary Enterococcus strains (de Fatima Silva Lopes et

al., 2005; Lopes Mde et al., 2003). Enterococcal infections that result in human

disease can be fatal, particularly those caused by vancomycin-resistant enterococci

(VRE). In 1986, the first VRE strains appeared in Europe and, in 1989 the first case

INTRODUCTION

15

Cha

pter

I

of VRE was reported in the United States (Murray, 1990). The mechanism of

vancomycin resistance has been extensively studied. Vancomycin binds with high

affinity to the D-Ala-D-Ala C-terminus of peptidoglycan, blocking the addition of late

precursors by transglycosylation to nascent peptidoglycan chain and preventing

subsequent cross-linking by transpeptidation and stopping the peptidoglycan

production (Arthur & Courvalin, 1993; Hughes, 2003). Glycopeptide resistance

involves two pathways: replacement of the terminal D-Ala of peptidoglycan precursor

with D-lactate (D-lac), which produces high-level resistance, or with D-Ser, which

produces low level resistance (Arias & Murray, 2012). In the most common

mechanism of vancomycin resistance, the two component system VanR-VanS

regulates the expression of the vancomycin resistance operon (Figure 5).

Figure 5 – The two component regulatory system VanR-VanS. VanS is a membrane-associated sensor

(of vancomycin) that controls the level of phosphorylation of VanR. VanR is a transcriptional activator of the operon

encoding VanH, VanA and VanX. VanH is a dehydrogenase that reduces pyruvate to D-Lac, whereas VanA is a

ligase that catalyses the formation of an ester bond between D-Ala and D-Lac. Vancomycin does not bind to D-Ala-

D-Lac, which confers vancomycin resistance. VanX is a dipeptidase that hydrolyses the normal peptidoglycan

component D-Ala-D-Ala, which prevents it from causing vancomycin sensitivity. VanY is a D,D-carboxypeptidase that

hydrolyses the terminal D-Ala residue of late peptidoglycan precursors that are produced if elimination of D-Ala-D-Ala

by VanX is not complete. So, D-Ala-D-Lac replaces the normal dipeptide D-Ala-D-Ala in peptidoglycan synthesis

resulting in vancomycin resistance. VanZ confers resistance to teicoplanin by an unknown mechanism. (Hughes,

2003)

Chapter I

16


The Role of Fsr, Gelatinase and Serine Protease

For enterococci to act as pathogen they must first adhere to host tissues. During

infection of sterile tissues, enterococci encounter an environment vastly different than

the gut, with high redox potentials, limited nutrients, phagocytic leukocytes, and other

host defenses. Enterococci express factors – virulence factors - that permit

adherence to host cell and extracellular matrix, facilitate tissue invasion, effect

immunomodulation and cause toxin-mediated damage (Gilmore, 2002).

The first examination of enterococal virulence was reported in 1899, the same year

this organism was discovered. MacCalum and Hasting described a fatal case of

endocarditis caused by an organism that they termed Micrococcus zymogenes. The

bacteria expressed cytolitic (or hemolytic) and protease (gelatinase) activities and

likely represented E. feacalis (MacCallum & Hastings, 1899). Since then

Enterococcus virulence has been extensively studied. About a dozen putative

virulence factors have been reported from virulence analysis in various animal

models (Table 1). They are involved in attachment both to host cells and to

extracellular matrix proteins (AS, Esp, EfaA), in resistance to macrophages (AS,

HypR), in cell and tissue damage (Cyl, GelE, SprE) and in immune system evasion

(capsular polysaccharides) (Gilmore, 2002; Tendolkar et al., 2003).

Some of these virulence factors are encoded by conjugative plasmid genes (AS and

Cyl) or rearranged chromosomal regions such as i) the fsr locus (GelE, SprE and Fsr

(Nakayama et al., 2001a; Qin et al., 2000)), ii) the large chromosomal region

described as the pathogenicity island (Esp, Cyl, AS and Gls24-like (Shankar et al.,

2002)) and iii) the cps locus (Hancock & Gilmore, 2002). Plasmid encoded virulence

factors have been shown to be transmissible by gene transfer mechanisms (Chow et

al., 1993; Wirth, 1994) (Table 1).

INTRODUCTION

17

Cha

pter

I

Table 1 – E. faecalis virulence factors and their putative role (Arias & Murray, 2012; Jett et al., 1994;

Ogier & Serror, 2008).

Gene Name Putative role Reference(s)

Cell surface determinants AS protein Aggregation

substance

Adhesion, tissue colonization (Schlievert et al., 1998)

(Waters et al., 2004)

Esp Surface protein Biofilm formation (Shankar et al., 1999)

Ace Adhesion

to collagen

Adhesion to ECM (Nallapareddy et al., 2000)

(Nallapareddy et al., 2011b)

Bee Biofilm enhancer Biofilm formation (Tendolkar et al., 2006)

Ebp Endocarditis and

biofilm associated

pili

Biofilm formation and

adhesion to human platelets

(Nallapareddy et al., 2006)

(Nallapareddy et al., 2011a)

(Nallapareddy et al., 2011b)

ElrA Surface protein Role in experimental

peritonitis, resistance to host

defenses

(Brinster et al., 2007)

StrA Sortase Biofilm formation, role in

catheter-associated UTIs

(Guiton et al., 2009)

(Guiton et al., 2010)

Exopolysaccharides

cps cluster Capsular

polysaccharides

Resistance to host defenses (Hancock & Gilmore, 2002)

epa cluster Enterococcal

polysaccharide

antigen

Resistance to host defenses (Teng et al., 2002)

(Teng et al., 2009)

Secreted factors

GelE Gelatinase Tissue damage, formation of

biofilms, immune evasion

(Singh et al., 2005)

SprE Serine Protease Tissue damage, formation of

biofilms, immune evasion

(Kawalec et al., 2005)

CylA-M Cytolysin Tissue damage (Jett et al., 1992)

Regulators

FsrA Fsr System gelE, sprE and ace regulation (Nakayama et al., 2001a; Qin

et al., 2001)

CylR1-R2 Cyl operon

regulator

Cytolysin regulation (Jett et al., 1994)

Chapter I

18

E. faecalis is an example of an opportunistic pathogen that uses QS system to

produce virulence factors to succeed during infection. One of the most studied is the

fsr QS (see below) that regulates the virulence factors serine protease and

gelatinase. The serine protease has high similarity to the Staphylococcus glutamil-

endopeptidases but has not been purified or characterized. Some studies have

reported this protease to have some role in biofilm formation, but its exact role is still

unknown (Kawalec et al., 2005). The gelatinase has been largely described as an

important virulence factor. This protease was first described in 1975 by Gold et al.

who identified a protease in E. faecalis OG1-10 responsible for human gelatin oral

degradation, suggesting that it was a virulence factor (Gold et al., 1975). This protein

is secreted as a zinc metalloprotease (thermolysin-M4 protease) capable to

hydrolyze numerous subtracts, including gelatin, collagen, casein, fibrin, hemoglobin

and other small bioactive peptides. The protein gelatinase produced by E. faecalis

OG1-10 was isolated by Makinen et al. in 1989 (Makinen et al., 1989). The gene was

subsequently identified (gelE) and its sequence determined (Su et al., 1991).

Gelatinase activity was detected in enterococal clinical strains (Lopes Mde et al.,

2006; Singh et al., 2005).

Fsr is the only QS system known to contribute to E. faecalis biofilm formation

(Mohamed & Huang, 2007). Biofilms are important for enterococcal infections

because they protect bacteria against antibiotics and phagocytosis (Paganelli et al.,

2012). The formation of multilayer biofilms involves a complex process from

attachment of single cells to the development of a 3D biofilm structure. Under optimal

conditions a mature biofilm develops consisting of loosely packed microcolonies held

together with extracellular polymeric substances (EPS) interspersed with water

channels through which nutrients reach deeper parts of the biofilm. During biofilm

formation, autolysins contribute to different aspects. They can act as adhesins, but

when released by proteases they can lyse cells and thereby generate extracellular

(e)DNA, which is necessary to stabilize the EPS biofilm in microcolonies. Autolysis

regulation is very important for bacterial growth and division. Enzymes involved in

autolysis are peptidoglycan (PG) hydrolases which play a role in cell wall growth and

INTRODUCTION

19

Cha

pter

I

turnover, cell separation, recycling of muropeptides, lysis by cell-wall synthesis

inhibitors, competence, sporulation, flagellum formation and pathogenicity (Bayles,

2007; Mohamed & Huang, 2007). Autolysis control may also be involved in tolerance

to cell-wall active antibiotics, as previously demonstrated for the homologous Agr

system of Staphylococcus aureus (Antignac et al., 2007; Bayles, 2007). Knowing that

PG degradation products are also a major elicitor of the host immune response it is

obvious to assume/speculate a relation between autolysis and host immune

recognition and response. Therefore, autolysis control is crucial for virulence, stress

response and host immune system modulation (Antignac et al., 2007; Bayles, 2007;

Thomas et al., 2008).

Different studies described that gelatinase has a critical role in biofilm formation

(Hancock & Perego, 2004; Kristich et al., 2004; Mohamed & Murray, 2005; Mohamed

& Murray, 2006). In 2008, Thomas et al invoked the fratricidal model for E. faecalis

biofilm development. In this model, GelE activated the lysis of a subpopulation of

bacteria and thereby catalyzes the release of genomic DNA (e)DNA, as originally

proposed for S. pneumoniae autolysis (Gilmore & Haas, 2005). SprE negatively

affects autolysis, (e)DNA release and early biofilm maturation by negatively

regulating GelE activity, and thereby acts as an immunity protein against lysis. GelE

and SprE execute their characteristic effects following downstream interactions with

the primary autolysin, AtlA, by modifying the cell-wall affinity of proteolytically

processed AtlA. The interplay of the two secreted and co-regulated proteases seems

to be tightly regulated. A minority subpopulation of quorum non-responders (GelE–

SprE–) act as prey cells, for targeted fratricide mediated by the quorum-responsive

predator cells that form the majority in the biofilm. In response to the GBAP peptide,

predator cells secrete GelE and SprE proteases. Prey cells are susceptible cells that

have not (yet) responded to GBAP. If GelE reaches the cells before SprE, this results

in lysis via release of AtlA from their surface, and this in turn can also lyse

neighboring cells (Thomas et al., 2008; Thomas et al., 2009).

In 2011, Pinkston et al, demonstrated that Fsr modulates Ace surface levels through

its regulation of GelE which directly cleaves Ace, subsequently impacting on the

Chapter I

20

ability of cells to adhere to collagen. The bacterial surface protein has an important

role in E. faecalis virulence by mediating adherence and colonization to host tissue

which is an early step toward clinical infection (Pinkston et al., 2011). Another study

indicated that, the absence of gelatinase (in E. faecalis OG1RF) leads to high levels

of secreted antigenic SalB, in the exoproteome. The relation between GelE and SalB

it still not clear but it is known that the absence of SalB increases autolysis and cell

morphological changes (Shankar et al., 2012). In addition to these studies, GelE and

SprE have also been reported to have an important role in translocation across

intestinal T84 cells and in degradation of antimicrobial peptides (AMPs) from immune

system of Galleria mellonella (Cytrynska et al., 2007).

All these studies indicate that Fsr-GelE-SprE has an important role in E. faecalis

virulence and place these traits as promising targets to combat the E. faecalis

infection. Nakayama et al., discovered two secondary metabolites, siamycin and

ambuic acid, which act as QS inhibitors. Siamycin inhibits GBAP-induced

phosphorylation of receptor histidine kinase FsrC and ambuic acid inhibits the

proteolytic processing of FsrD, the propeptide of GBAP. However, none of these

compounds influence E. faecalis growth (Nakayama et al., 2007; Nakayama et al.,

2009).

3.1 Animal Models to Study Fsr and Proteases

Several studies provided evidence that both Fsr and the proteases independently

contribute to the pathogenicity of E. faecalis in different infection models, (Table 2)

but their exact contributions to E. faecalis infection are still unknown. The use of

animal models is important to elucidate the pathogen actions in the host.

INTRODUCTION

21

Cha

pter

I

Table 2 – Host models used to study virulence associated to the Fsr and/or gelatinase.

Animal model used E. faecalis mutants used for

the study

Enterococcus strains References

Rabbit endophthalmitis OG1RFΔfsrB2 E. faecalis OG1RF (Mylonakis et al., 2002)

Rat endocarditis

OG1RFΔfsrB1

OG1RFΔfsrB2

OG1RFΔgelE1

E. faecalis OG1RF (Singh et al., 2005)

Galleria mellonella

QA29bΔfsrB2

QA29bΔgelE2

LSE4aΔfsrB2

LSE4aΔgelE2

E. faecalis OG1RF

E. faecalis QA29B

E. faecalis LSE4a

E. faecalis LN68

E. faecium QSE32

E. durans QN1

E. faecalis ATCC 51299

(Gaspar et al., 2009;

Park et al., 2007)

Arabidopsis thaliana

OG1RFΔfsrA,

OG1RFΔfsrB1,

OG1RFΔfsrC1,

OG1RFΔgelE1,

OG1RFΔsprE1

E. faecalis FA-2-2,

E. faecalis V583,

E. faecalis OG1RF

(Jha et al., 2005)

Caenorhabditis elegans OG1RFΔfsrB1

OG1RFΔgelE1

E. faecalis OG1RF (Sifri et al., 2002)

Zebrafish OG1RFΔfsrB1

OG1RFΔgelE1

OG1RFΔsprE1

OG1RFΔgelEΔsprE1

E. faecalis OG1RF

(Prajsnar et al., 2013)

Different outcomes have been observed in different assays when fsrABC or gelE-

sprE mutants were compared with the parental strain. In rat endocarditis a greater

decrease in endocarditis severity was observed when the proteases were deleted

comparing with deletion of fsrB (Singh et al., 2005). In other studies the observation

was the opposite - in rabbit endophtalmitis (Engelbert et al., 2004; Mylonakis et al.,

2002), murine and C. elegans infection (Garsin et al., 2001; Sifri et al., 2002), G.

mellonella infection (Gaspar et al., 2009) - a greater attenuation was observed when

1 insertional mutant 2 in-frame deletion mutant

Chapter I

22

fsrB was deleted than when proteases were absent. These results highlight the

complexity of interaction between this system and the host, and the importance of

finding a highly tractable animal model that will allow precise determination of the

role of Fsr-GelE-SprE in the infection.

INTRODUCTION

23

Cha

pter

I

4. DROSOPHILA MELANOGASTER

A model to Study Host-pathogen Interaction

The use of invertebrate animal models has provided tremendous insights into

pathogen-host interaction of many human pathogens, and has revealed that many

aspects of these interactions in higher host organisms are conserved in

invertebrates. The fruit fly Drosophila melanogaster (Drosophila) is one of the most

used for studying host-pathogen interaction of bacteria, fungal and viral pathogens.

The life cycle of Drosophila has different stages: the embryo, 1st instar larva, 2nd

instar larva, 3rd instar larva, prepupa, pupa and adult (Igboin et al., 2012) (Figure 6).

Figure 6 – The life cycle of Drosophila. The life cycle is divided in six stages: embryo, 1st instar larva, 2nd

instar larva, 3rd instar larva, prepupa, pupa and adult. (http://www.immortalhumans.com/longevity-research-on-fruit-

flies-providing-promising-hope-for-longer-human-lifespan/).

Chapter I

24

Drosophila is a model organism with many advantages: small size, short generation

time (depending on the ambient temperature, from being an egg to become an adult

it takes 7 days), a fully sequenced genome and pre-existing libraries of genetic

mutants. Studies often use a clear endpoint (death), and this model host can be used

in large quantities to facilitate statistical analysis. Numerous studies have revealed

significant parallels between the Drosophila immune response and mammalian

innate response. The absence of an adaptive immune response permits the study of

interactions between pathogens and the host innate immune response in isolation.

Drosophila loss-of-function immune response mutants have been used to examine

the roles of the genes in the response to infection with various pathogens.

Transgenic Drosophila has been used to monitor the activation of immune response

pathways upon infection and to examine the effects of transgenically expressed

pathogen proteins on the host. Drosophila rely solely on an innate immune system to

combat infecting microbes and, like mammals, they detect the presence of invading

microbes using pattern recognition receptors, which recognize conserved microbial

motifs and activate a response that is specific for the type of invading microbes

(Igboin et al., 2012) (Figure 7).

Figure 7 – Scheme of humoral immune system

inside Drosophila. A systemic infection induces the

transcription of antimicrobial peptides, mainly in the fat

body of the fruit fly (blue), which is analogous to the liver.

These peptides are transported into the haemolymph

(blood), where they accumulate to high concentrations and

circulate throughout the body. Some tissues respond

directly to localized sites of infection, such the trachea

(orange) .The cellular immune response is characterized by

the presence of haemocytes (blood cells), which circulate

or attach themselves to organs. A systemic infection can be

instigated in the laboratory by puncture with a septic needle

(as indicated in the figure) or in nature by a septic wound.

In both cases, the site of wounding clots containing a

melanin- seal (Kimbrell & Beutler, 2001).

INTRODUCTION

25

Cha

pter

I

The innate immune system consists of both cellular and humoral components. The

cellular response involves specialized hemocytes (blood cells), which engage in

phagocytosis and encapsulation of foreign microbes. The body cavity of Drosophila

is filled with circulating hemolymph that contains free-floating hemocytes (Figure 7

and 8). Drosophila larvae contain several thousand hemocytes, which can be divided

into the following three cell types on the basis of their structural and functional

features: plasmocytes, crystal cells and lamellocytes. Plasmocytes represent 90%-

95% of all mature larval hemocytes and function in phagocytic removal of dead cells

and microbial pathogens. Lamellocytes are relatively large, flat, and adherent cells

that primarily function in encapsulation and neutralization of objects too large to be

phagocytized. Crystal cells constitute 5% of the larval hemocytes and are

nonphagocytic cells involved in the melanization process (Figure 8).

Figure 8 – Scheme of an overview of Drosophila host defense – cellular and humoral responses.

These overview demonstrated that the two response types are connected (Lemaitre & Hoffmann, 2007)

Melanization is characterized by the blackening reaction (deposition of melanin) at

the site of cuticular injury, or on surface of parasites invading the hemocoel, and

plays an important role in reactions such as wound healing, encapsulation,

Chapter I

26

sequestration of microorganisms and production of toxic intermediates that kill the

pathogens. Melanization requires the activation of proPhenoloxidase, an enzyme that

catalyzes the oxidation of phenols to quinones, which polymerize melanin (Figure 8

and 9) (Lemaitre & Hoffmann, 2007; Meister & Lagueux, 2003). During this process

reactive oxygen species are produced, which can harm the host in addition to

harming the pathogen (Chambers et al., 2012).

Figure 9 - Model for melanization activation upon microbial Infection. Upon the recognition of a

microorganism, a pattern recognition receptor (PRR) is presumed to trigger a protease cascade involving the

proteases MP1 and MP2/Sp7/PAE1, which culminates in the cleavage of prophenol oxidase (PPO) to phenol oxidase

(PO). The serpin Spn28D controls the release and availability of PO by inhibiting its activation, possibly in crystal

cells. Spn27A acts in the hemolymph to inhibit the MP1/MP2 cascade and prevent excessive melanization. Spn77Ba

regulates melanization in the tracheal epithelium by inhibiting the same protease cascade. Other studies revealed the

involvement of serine protease homologues (SPHs) in activating PO. PO inhibitors limit melanization by directly

inhibiting the enzymatic activity of PO. Melanization reaction it also involved in others immune responses such as

blood coagulation, AMP expression, wound healing and phagocytosis (Tang, 2009).

The humoral response is mediated by three signaling pathways: the Imd (immune

deficiency), Toll and JAK/STAT (janus kinase/signal transducer and activator of

INTRODUCTION

27

Cha

pter

I

transcription) pathways (Figure 8 and 10). The humoral response involves the

production of antimicrobial peptides (AMPs) through Toll or Imd pathway.

Figure 10 – Drosophila humoral Immune system model – Toll and Imd pathways. These models

represent the cascade of events for the activation of Toll and Imd pathways. The Toll pathway is activated by fungi

and Gram positive bacteria and Imd is activated only by Gram negative bacteria. Toll pathway: The Toll receptor is

activated upon binding with a cleaved form of Spätzle that is processed by proteolytic cascade activated by bacteria

secreted molecules. After the activation of Toll receptor the AMPs are produced through a cascade of events. Imd

Pathway: The bacteria components bind directly to receptor and are recruit the adaptor Imd. The Imd interacts with

dFADD and the cascade of events is activated and the AMPs are produced(Lemaitre & Hoffmann, 2007).

Chapter I

28

Produced AMPs can be classified in seven groups, with differential effectiveness,

against fungi (Drosomycin and Metchnikowin), Gram positive bacteria (Defensin) and

Gram negative bacteria (Diptericin, Drosocin, Attacin and Cecropin) (Lemaitre &

Hoffmann, 2007)The Imd signaling pathway is homologous to the mammalian tumor

necrosis factor receptor 1 signaling pathway, and only differs at the level of

detection/activation. This pathway regulates the production of AMPs by fat body cells

and gut epithelial cells, respectively, in response to primarily Gram negative bacterial

infections. The Imd pathway, activated by its receptor peptidoglycan recognition

protein (PGRP)-LC and the Imd protein, acts through TAK1, signaling the IkB kinase

complex to activate the NF-kB transcription factor Rel, which responds to infection by

Gram-negative bacteria (Figure 8 and 10) (Davis & Engstrom, 2012; Kounatidis &

Ligoxygakis, 2012; Lemaitre & Hoffmann, 2007).

The Toll signaling pathway is homologous to the mammalian Toll/IL-1 receptor

signaling pathway, although unlike the mammalian receptors Drosophila Toll does

not directly recognize bacterial components. Like Imd, this pathway regulates

systemic AMP expression in fat body, primarily in response to fungal and Gram-

positive bacterial infection. The Toll pathway relies on cleavage of the extracellular

ligand, Spätzle, followed by signaling through the Toll receptor and its intracellular

adaptor protein complex, which contains MyD88, Tube and the Pelle kinase. The Toll

pathway is activated in response to Gram positive bacteria, fungi and yeast (Figure

10) (Davis & Engstrom, 2012; Kounatidis & Ligoxygakis, 2012; Lemaitre & Hoffmann,

2007).

The Drosophila JAK-STAT signaling pathway comprises the same components as

the mammalian pathway, although they differ in the number of JAKs (one in

Drosophila and four in mammalians) and STATs (one in Drosophila and seven in

mammalians) they possess. The JAK-STAT pathway regulates numerous

physiological processes including immune response; however its contribution to the

immune response is not as well studied as Imd and Toll pathways. The JAK-STAT

pathway is involved in the immune response in the Drosophila gut, where it helps

INTRODUCTION

29

Cha

pter

I

maintain epithelial cell homeostasis by regulating stem cell proliferation (Igboin et al.,

2012; Lemaitre & Hoffmann, 2007).

In 2005, Cox and Gilmore characterized the Drosophila microflora and examined the

occurrence of enterococci in the gastrointestinal consortium of Drosophila (Cox &

Gilmore, 2007). They found that Drosophila was naturally colonized by

representatives of five bacterial phyla. Among these were several species of

enterococci, including E. faecalis, E. faecium, E. gallinaraum, and E. durans, as well

as a previously detected but uncultured Enterococcus species. These strains were

found only in the GI tract of Drosophila, as occurs normally in humans. In this study

they also proved that Drosophila is a good model to study the virulence factor

cytolysin (Cox & Gilmore, 2007).

Chapter I

30

5. AIMS AND SCOPE OF THESE THESIS

The discovery of communication between bacteria via quorum-sensing, which

orchestrate important temporal events during the infection process, provides a novel

opportunity to combat bacterial infection. E. faecalis infections constitute a serious

problem in the hospital environment and its ability to acquire/transfer antibiotic

resistance and virulence factors is limiting the use of antibiotics. New therapeutics

are urgently needed, and these may be based on a better understanding of the

factors that are important for E. faecalis infection.

Since the Fsr system was described, numerous studies have shown its importance in

the infections process. These studies have demonstrated that fsr is not only involved

during the E. faecalis infection, but also contributes to enterococcal survival in

different environments. However, the exact mechanism by which Fsr contributes to

virulence during infection is not entirely clear. Moreover, many strains have been

reported to carry the entire fsr and gelE-sprE operons, despite their inability to

phenotypically show gelatinase activity isolates (Eaton & Gasson, 2001; Galloway-

Pena et al., 2011; Lopes Mde et al., 2006; Nakayama et al., 2002).

This PhD thesis aims at clarifying the contribution Fsr regulon to E. faecalis biology

and to host injury using different approaches. Three main questions were addressed

in four chapters of this thesis:

- Under which conditions the Fsr system is shut down? (Chapters II and III)

- Which other genes, if any, do Fsr and/or GelE-SprE regulate? (Chapter IV)

- How does Fsr contribute to E. faecalis infection in Drosophila? (Chapters IV and V)

Chapters II and III describe two different conditions in which fsr is shutdown. Chapter

II focuses on a particular strain, E. faecalis LN68 (already described by (Lopes Mde

et al., 2006)), that has all fsr-gelE-sprE genes but does not exhibit the gelatinase

INTRODUCTION

31

Cha

pter

I

phenotype. In a previous transcriptomic study made in our laboratory, the VRE strain

V583 was subjected to a therapeutic vancomycin dose. fsr-gelE-sprE genes were

found to be affected by that cell wall active antibiotic. In Chapter III we looked for the

reason for vancomycin interference with Fsr activity.

In Chapter IV we looked for genes directly and indirectly regulated by Fsr and

attributed a role in E. faecalis virulence. To study these genes, we first established

Drosophila as a model to study Fsr virulence. In Chapter V we investigated the

influence that Fsr system has on Drosophila humoral and cellular immune system.

The final chapter of this thesis is a general discussion (Chapter VI) correlating all

chapters discussing the importance of the new findings presented, and proposing

future advances in controlling E. faecalis infection.

Chapter I

32

6. BLIBLYOGRAPHY

Antignac, A., Sieradzki, K. & Tomasz, A. (2007). Perturbation of cell wall synthesis

suppresses autolysis in Staphylococcus aureus: evidence for coregulation of cell wall

synthetic and hydrolytic enzymes. J Bacteriol 189, 7573-7580.

Arias, C. A. & Murray, B. E. (2012). The rise of the Enterococcus: beyond

vancomycin resistance. Nat Rev Microbiol 10, 266-278.

Arthur, M. & Courvalin, P. (1993). Genetics and mechanisms of glycopeptide

resistance in enterococci. Antimicrob Agents Chemother 37, 1563-1571.

Bassler, B. & Vogel, J. (2013). Bacterial regulatory mechanisms: the gene and

beyond. Curr Opin Microbiol 16, 109-111.

Bassler, B. L. (1999). How bacteria talk to each other: regulation of gene expression

by quorum sensing. Curr Opin Microbiol 2, 582-587.

Bayles, K. W. (2007). The biological role of death and lysis in biofilm development.

Nat Rev Microbiol 5, 721-726.

Bourgogne, A., Hilsenbeck, S. G., Dunny, G. M. & Murray, B. E. (2006).

Comparison of OG1RF and an isogenic fsrB deletion mutant by transcriptional

analysis: the Fsr system of Enterococcus faecalis is more than the activator of

gelatinase and serine protease. J Bacteriol 188, 2875-2884.

Bourgogne, A., Garsin, D. A., Qin, X. & other authors (2008). Large scale

variation in Enterococcus faecalis illustrated by the genome analysis of strain

OG1RF. Genome Biol 9, R110.

INTRODUCTION

33

Cha

pter

I

Braga, T. M., Marujo, P. E., Pomba, C. & Lopes, M. F. (2011). Involvement, and

dissemination, of the enterococcal small multidrug resistance transporter QacZ in

resistance to quaternary ammonium compounds. J Antimicrob Chemother 66, 283-

286.

Brinster, S., Posteraro, B., Bierne, H., Alberti, A., Makhzami, S., Sanguinetti, M.

& Serror, P. (2007). Enterococcal leucine-rich repeat-containing protein involved in

virulence and host inflammatory response. Infect Immun 75, 4463-4471.

Chambers, M. C., Lightfield, K. L. & Schneider, D. S. (2012). How the fly balances

its ability to combat different pathogens. PLoS Pathog 8, e1002970.

Chow, J. W., Thal, L. A., Perri, M. B., Vazquez, J. A., Donabedian, S. M., Clewell,

D. B. & Zervos, M. J. (1993). Plasmid-associated hemolysin and aggregation

substance production contribute to virulence in experimental enterococcal

endocarditis. Antimicrob Agents Chemother 37, 2474-2477.

Cox, C. R. & Gilmore, M. S. (2007). Native microbial colonization of Drosophila

melanogaster and its use as a model of Enterococcus faecalis pathogenesis. Infect

Immun 75, 1565-1576.

Cytrynska, M., Mak, P., Zdybicka-Barabas, A., Suder, P. & Jakubowicz, T.

(2007). Purification and characterization of eight peptides from Galleria mellonella

immune hemolymph. Peptides 28, 533-546.

Davis, M. M. & Engstrom, Y. (2012). Immune response in the barrier epithelia:

lessons from the fruit fly Drosophila melanogaster. J Innate Immun 4, 273-283.

de Fatima Silva Lopes, M., Ribeiro, T., Abrantes, M., Figueiredo Marques, J. J.,

Tenreiro, R. & Crespo, M. T. (2005). Antimicrobial resistance profiles of dairy and

clinical isolates and type strains of enterococci. Int J Food Microbiol 103, 191-198.

Chapter I

34

Eaton, T. J. & Gasson, M. J. (2001). Molecular screening of Enterococcus virulence

determinants and potential for genetic exchange between food and medical isolates.

Appl Environ Microbiol 67, 1628-1635.

Engelbert, M., Mylonakis, E., Ausubel, F. M., Calderwood, S. B. & Gilmore, M. S.

(2004). Contribution of gelatinase, serine protease, and fsr to the pathogenesis of

Enterococcus faecalis endophthalmitis. Infect Immun 72, 3628-3633.

Foulquie Moreno, M. R., Sarantinopoulos, P., Tsakalidou, E. & De Vuyst, L.

(2006). The role and application of enterococci in food and health. Int J Food

Microbiol 106, 1-24.

Fuqua, W. C., Winans, S. C. & Greenberg, E. P. (1994). Quorum sensing in

bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators. J

Bacteriol 176, 269-275.

Galloway-Pena, J. R., Bourgogne, A., Qin, X. & Murray, B. E. (2011). Diversity of

the fsr-gelE region of the Enterococcus faecalis genome but conservation in strains

with partial deletions of the fsr operon. Appl Environ Microbiol 77, 442-451.

Garsin, D. A., Sifri, C. D., Mylonakis, E., Qin, X., Singh, K. V., Murray, B. E.,

Calderwood, S. B. & Ausubel, F. M. (2001). A simple model host for identifying

Gram-positive virulence factors. Proc Natl Acad Sci U S A 98, 10892-10897.

Gaspar, F., Teixeira, N., Rigottier-Gois, L., Marujo, P., Nielsen-LeRoux, C.,

Crespo, M. T., Lopes Mde, F. & Serror, P. (2009). Virulence of Enterococcus

faecalis dairy strains in an insect model: the role of fsrB and gelE. Microbiology 155,

3564-3571.

INTRODUCTION

35

Cha

pter

I

Gilmore, M. S. & Haas, W. (2005). The selective advantage of microbial fratricide.

Proc Natl Acad Sci U S A 102, 8401-8402.

Gilmore, M. S., Phillip S. Coburn, Sreedhar R. Nallapareddy, Barbara E. Murray

(2002). Enterococcal Virulence. In The Enterococci Pathogenesis, Molecular Biology,

and Antibiotic Resistance, pp. 301-354. Edited by M. S. Gilmore, Clewell DB,

Courvalin P, Dunny GM, Murray BE, Rice LB. Washington D.C.: American Society

for Microbiology.

Giraffa, G. (2003). Functionality of enterococci in dairy products. Int J Food Microbiol

88, 215-222.

Godfree, A. F., Kay, D. & Wyer, M. D. (1997). Faecal streptococci as indicators of

faecal contamination in water. Soc Appl Bacteriol Symp Ser 26, 110S-119S.

Gold, O. G., Jordan, H. V. & van Houte, J. (1975). The prevalence of enterococci in

the human mouth and their pathogenicity in animal models. Arch Oral Biol 20, 473-

477.

Guiton, P. S., Hung, C. S., Kline, K. A. & other authors (2009). Contribution of

autolysin and Sortase a during Enterococcus faecalis DNA-dependent biofilm

development. Infect Immun 77, 3626-3638.

Guiton, P. S., Hung, C. S., Hancock, L. E., Caparon, M. G. & Hultgren, S. J.

(2010). Enterococcal biofilm formation and virulence in an optimized murine model of

foreign body-associated urinary tract infections. Infect Immun 78, 4166-4175.

Hancock, L. E. & Gilmore, M. S. (2002). The capsular polysaccharide of

Enterococcus faecalis and its relationship to other polysaccharides in the cell wall.

Proc Natl Acad Sci U S A 99, 1574-1579.

Chapter I

36

Hancock, L. E. & Perego, M. (2004). The Enterococcus faecalis fsr two-component

system controls biofilm development through production of gelatinase. J Bacteriol

186, 5629-5639.

Hastings, J. W. & Greenberg, E. P. (1999). Quorum sensing: the explanation of a

curious phenomenon reveals a common characteristic of bacteria. J Bacteriol 181,

2667-2668.

Hollenbeck, B. L. & Rice, L. B. (2012). Intrinsic and acquired resistance

mechanisms in enterococcus. Virulence 3, 421-433.

Hughes, D. (2003). Exploiting genomics, genetics and chemistry to combat antibiotic

resistance. Nature reviews Genetics 4, 432-441.

Igboin, C. O., Griffen, A. L. & Leys, E. J. (2012). The Drosophila melanogaster host

model. J Oral Microbiol 4.

Jett, B. D., Jensen, H. G., Nordquist, R. E. & Gilmore, M. S. (1992). Contribution

of the pAD1-encoded cytolysin to the severity of experimental Enterococcus faecalis

endophthalmitis. Infect Immun 60, 2445-2452.

Jett, B. D., Huycke, M. M. & Gilmore, M. S. (1994). Virulence of enterococci. Clin

Microbiol Rev 7, 462-478.

Jha, A. K., Bais, H. P. & Vivanco, J. M. (2005). Enterococcus faecalis mammalian

virulence-related factors exhibit potent pathogenicity in the Arabidopsis thaliana plant

model. Infect Immun 73, 464-475.

Kawalec, M., Potempa, J., Moon, J. L., Travis, J. & Murray, B. E. (2005).

Molecular diversity of a putative virulence factor: purification and characterization of

INTRODUCTION

37

Cha

pter

I

isoforms of an extracellular serine glutamyl endopeptidase of Enterococcus faecalis

with different enzymatic activities. J Bacteriol 187, 266-275.

Kimbrell, D. A. & Beutler, B. (2001). The evolution and genetics of innate immunity.

Nature reviews Genetics 2, 256-267.

Kounatidis, I. & Ligoxygakis, P. (2012). Drosophila as a model system to unravel

the layers of innate immunity to infection. Open Biol 2, 120075.

Kristich, C. J., Li, Y. H., Cvitkovitch, D. G. & Dunny, G. M. (2004). Esp-

independent biofilm formation by Enterococcus faecalis. J Bacteriol 186, 154-163.

Leclercq, R., Dutka-Malen, S., Brisson-Noel, A., Molinas, C., Derlot, E., Arthur,

M., Duval, J. & Courvalin, P. (1992). Resistance of enterococci to aminoglycosides

and glycopeptides. Clin Infect Dis 15, 495-501.

Lemaitre, B. & Hoffmann, J. (2007). The host defense of Drosophila melanogaster.

Annu Rev Immunol 25, 697-743.

Li, Y. H. & Tian, X. (2012). Quorum sensing and bacterial social interactions in

biofilms. Sensors (Basel) 12, 2519-2538.

Lopes Mde, F., Ribeiro, T., Martins, M. P., Tenreiro, R. & Crespo, M. T. (2003).

Gentamicin resistance in dairy and clinical enterococcal isolates and in reference

strains. J Antimicrob Chemother 52, 214-219.

Lopes Mde, F., Simoes, A. P., Tenreiro, R., Marques, J. J. & Crespo, M. T.

(2006). Activity and expression of a virulence factor, gelatinase, in dairy enterococci.

Int J Food Microbiol 112, 208-214.

Chapter I

38

Lopes, M. F., Pereira, C. I., Rodrigues, F. M. & other authors (1999). Registered

designation of origin areas of fermented food products defined by microbial

phenotypes and artificial neural networks. Appl Environ Microbiol 65, 4484-4489.

MacCallum, W. G. & Hastings, T. W. (1899). A case of acute endocarditis caused

by Micrococcus Zymogenes (Nov. spec), with description of the microorganism

Journal of Experimental Medicine 4, 521-534.

Makinen, P. L., Clewell, D. B., An, F. & Makinen, K. K. (1989). Purification and

substrate specificity of a strongly hydrophobic extracellular metalloendopeptidase

("gelatinase") from Streptococcus faecalis (strain 0G1-10). J Biol Chem 264, 3325-

3334.

Meister, M. & Lagueux, M. (2003). Drosophila blood cells. Cell Microbiol 5, 573-580.

Moellering, R. C., Jr. (1992). Emergence of Enterococcus as a significant pathogen.

Clin Infect Dis 14, 1173-1176.

Mohamed, J. A. & Murray, B. E. (2005). Lack of correlation of gelatinase production

and biofilm formation in a large collection of Enterococcus faecalis isolates. J Clin

Microbiol 43, 5405-5407.

Mohamed, J. A. & Murray, B. E. (2006). Influence of the fsr locus on biofilm

formation by Enterococcus faecalis lacking gelE. J Med Microbiol 55, 1747-1750.

Mohamed, J. A. & Huang, D. B. (2007). Biofilm formation by enterococci. J Med

Microbiol 56, 1581-1588.

INTRODUCTION

39

Cha

pter

I

Mundt, J. O. (1986). Enterococci. In Bergey’s Manual of Systematic Bacteriology pp.

1063-1065. Edited by N. S. M. P. H. A. Sneath, M. E. Sharpe & J. G. Holt:

Baltimore:Williams & Wilkins.

Murray, B. E. (1990). The life and times of the Enterococcus. Clin Microbiol Rev 3,

46-65.

Mylonakis, E., Engelbert, M., Qin, X., Sifri, C. D., Murray, B. E., Ausubel, F. M.,

Gilmore, M. S. & Calderwood, S. B. (2002). The Enterococcus faecalis fsrB gene, a

key component of the fsr quorum-sensing system, is associated with virulence in the

rabbit endophthalmitis model. Infect Immun 70, 4678-4681.

Nakayama, J., Cao, Y., Horii, T., Sakuda, S., Akkermans, A. D., de Vos, W. M. &

Nagasawa, H. (2001a). Gelatinase biosynthesis-activating pheromone: a peptide

lactone that mediates a quorum sensing in Enterococcus faecalis. Mol Microbiol 41,

145-154.

Nakayama, J., Cao, Y., Horii, T., Sakuda, S. & Nagasawa, H. (2001b). Chemical

synthesis and biological activity of the gelatinase biosynthesis-activating pheromone

of Enterococcus faecalis and its analogs. Biosci Biotechnol Biochem 65, 2322-2325.

Nakayama, J., Kariyama, R. & Kumon, H. (2002). Description of a 23.9-kilobase

chromosomal deletion containing a region encoding fsr genes which mainly

determines the gelatinase-negative phenotype of clinical isolates of Enterococcus

faecalis in urine. Appl Environ Microbiol 68, 3152-3155.

Nakayama, J., Chen, S., Oyama, N., Nishiguchi, K., Azab, E. A., Tanaka, E.,

Kariyama, R. & Sonomoto, K. (2006). Revised model for Enterococcus faecalis fsr

quorum-sensing system: the small open reading frame fsrD encodes the gelatinase

Chapter I

40

biosynthesis-activating pheromone propeptide corresponding to staphylococcal agrd.

J Bacteriol 188, 8321-8326.

Nakayama, J., Tanaka, E., Kariyama, R. & other authors (2007). Siamycin

attenuates fsr quorum sensing mediated by a gelatinase biosynthesis-activating

pheromone in Enterococcus faecalis. J Bacteriol 189, 1358-1365.

Nakayama, J., Uemura, Y., Nishiguchi, K., Yoshimura, N., Igarashi, Y. &

Sonomoto, K. (2009). Ambuic acid inhibits the biosynthesis of cyclic peptide

quormones in gram-positive bacteria. Antimicrob Agents Chemother 53, 580-586.

Nallapareddy, S. R., Qin, X., Weinstock, G. M., Hook, M. & Murray, B. E. (2000).

Enterococcus faecalis adhesin, ace, mediates attachment to extracellular matrix

proteins collagen type IV and laminin as well as collagen type I. Infect Immun 68,

5218-5224.

Nallapareddy, S. R., Singh, K. V., Sillanpaa, J., Garsin, D. A., Hook, M.,

Erlandsen, S. L. & Murray, B. E. (2006). Endocarditis and biofilm-associated pili of

Enterococcus faecalis. J Clin Invest 116, 2799-2807.

Nallapareddy, S. R., Sillanpaa, J., Mitchell, J., Singh, K. V., Chowdhury, S. A.,

Weinstock, G. M., Sullam, P. M. & Murray, B. E. (2011a). Conservation of Ebp-type

pilus genes among Enterococci and demonstration of their role in adherence of

Enterococcus faecalis to human platelets. Infect Immun 79, 2911-2920.

Nallapareddy, S. R., Singh, K. V., Sillanpaa, J., Zhao, M. & Murray, B. E. (2011b).

Relative contributions of Ebp Pili and the collagen adhesin ace to host extracellular

matrix protein adherence and experimental urinary tract infection by Enterococcus

faecalis OG1RF. Infect Immun 79, 2901-2910.

INTRODUCTION

41

Cha

pter

I

Nealson, K. H. & Hastings, J. W. (1979). Bacterial bioluminescence: its control and

ecological significance. Microbiological reviews 43, 496-518.

Ogier, J. C. & Serror, P. (2008). Safety assessment of dairy microorganisms: the

Enterococcus genus. Int J Food Microbiol 126, 291-301.

Onodera, Y., Okuda, J., Tanaka, M. & Sato, K. (2002). Inhibitory activities of

quinolones against DNA gyrase and topoisomerase IV of Enterococcus faecalis.

Antimicrob Agents Chemother 46, 1800-1804.

Paganelli, F. L., Willems, R. J. & Leavis, H. L. (2012). Optimizing future treatment

of enterococcal infections: attacking the biofilm? Trends Microbiol 20, 40-49.

Palmer, K. L., Carniol, K., Manson, J. M. & other authors (2010). High-quality

draft genome sequences of 28 Enterococcus sp. isolates. J Bacteriol 192, 2469-

2470.

Park, S. Y., Kim, K. M., Lee, J. H., Seo, S. J. & Lee, I. H. (2007). Extracellular

gelatinase of Enterococcus faecalis destroys a defense system in insect hemolymph

and human serum. Infect Immun 75, 1861-1869.

Paulsen, I. T., Banerjei, L., Myers, G. S. & other authors (2003). Role of mobile

DNA in the evolution of vancomycin-resistant Enterococcus faecalis. Science 299,

2071-2074.

Pinkston, K. L., Gao, P., Diaz-Garcia, D., Sillanpaa, J., Nallapareddy, S. R.,

Murray, B. E. & Harvey, B. R. (2011). The Fsr quorum-sensing system of

Enterococcus faecalis modulates surface display of the collagen-binding MSCRAMM

Ace through regulation of gelE. J Bacteriol 193, 4317-4325.

Chapter I

42

Prajsnar, T. K., Renshaw, S. A., Ogryzko, N. V., Foster, S. J., Serror, P. &

Mesnage, S. (2013). Zebrafish as a novel vertebrate model to dissect enterococcal

pathogenesis. Infect Immun 81, 4271-4279.

Qin, X., Singh, K. V., Weinstock, G. M. & Murray, B. E. (2000). Effects of

Enterococcus faecalis fsr genes on production of gelatinase and a serine protease

and virulence. Infect Immun 68, 2579-2586.

Qin, X., Singh, K. V., Weinstock, G. M. & Murray, B. E. (2001). Characterization of

fsr, a regulator controlling expression of gelatinase and serine protease in

Enterococcus faecalis OG1RF. J Bacteriol 183, 3372-3382.

Raffa, R. B., Iannuzzo, J. R., Levine, D. R., Saeid, K. K., Schwartz, R. C., Sucic,

N. T., Terleckyj, O. D. & Young, J. M. (2005). Bacterial communication ("quorum

sensing") via ligands and receptors: a novel pharmacologic target for the design of

antibiotic drugs. The Journal of pharmacology and experimental therapeutics 312,

417-423.

Reading, N. C. & Sperandio, V. (2006). Quorum sensing: the many languages of

bacteria. FEMS Microbiol Lett 254, 1-11.

Rutherford, S. T. & Bassler, B. L. (2012). Bacterial quorum sensing: its role in

virulence and possibilities for its control. Cold Spring Harb Perspect Med 2.

Sahm, D. F., Kissinger, J., Gilmore, M. S., Murray, P. R., Mulder, R., Solliday, J.

& Clarke, B. (1989). In vitro susceptibility studies of vancomycin-resistant

Enterococcus faecalis. Antimicrob Agents Chemother 33, 1588-1591.

Saurina, G., Landman, D. & Quale, J. M. (1997). Activity of disinfectants against

vancomycin-resistant Enterococcus faecium. Infect Control Hosp Epidemiol 18, 345-

347.

INTRODUCTION

43

Cha

pter

I

Schlievert, P. M., Gahr, P. J., Assimacopoulos, A. P., Dinges, M. M., Stoehr, J.

A., Harmala, J. W., Hirt, H. & Dunny, G. M. (1998). Aggregation and binding

substances enhance pathogenicity in rabbit models of Enterococcus faecalis

endocarditis. Infect Immun 66, 218-223.

Shankar, J., Walker, R. G., Wilkinson, M. C., Ward, D. & Horsburgh, M. J. (2012).

SalB inactivation modulates culture supernatant exoproteins and affects autolysis

and viability in Enterococcus faecalis OG1RF. J Bacteriol 194, 3569-3578.

Shankar, N., Baghdayan, A. S. & Gilmore, M. S. (2002). Modulation of virulence

within a pathogenicity island in vancomycin-resistant Enterococcus faecalis. Nature

417, 746-750.

Shankar, V., Baghdayan, A. S., Huycke, M. M., Lindahl, G. & Gilmore, M. S.

(1999). Infection-derived Enterococcus faecalis strains are enriched in esp, a gene

encoding a novel surface protein. Infect Immun 67, 193-200.

Sifri, C. D., Mylonakis, E., Singh, K. V., Qin, X., Garsin, D. A., Murray, B. E.,

Ausubel, F. M. & Calderwood, S. B. (2002). Virulence effect of Enterococcus

faecalis protease genes and the quorum-sensing locus fsr in Caenorhabditis elegans

and mice. Infect Immun 70, 5647-5650.

Singh, K. V., Nallapareddy, S. R., Nannini, E. C. & Murray, B. E. (2005). Fsr-

independent production of protease(s) may explain the lack of attenuation of an

Enterococcus faecalis fsr mutant versus a gelE-sprE mutant in induction of


Skandamis, P. N. & Nychas, G. J. (2012). Quorum sensing in the context of food

microbiology. Appl Environ Microbiol 78, 5473-5482.

Chapter I

44

Su, Y. A., Sulavik, M. C., He, P., Makinen, K. K., Makinen, P. L., Fiedler, S.,

Wirth, R. & Clewell, D. B. (1991). Nucleotide sequence of the gelatinase gene

(gelE) from Enterococcus faecalis subsp. liquefaciens. Infect Immun 59, 415-420.

Tang, H. (2009). Regulation and function of the melanization reaction in Drosophila.

Fly 3, 105-111.

Tendolkar, P. M., Baghdayan, A. S. & Shankar, N. (2003). Pathogenic enterococci:

new developments in the 21st century. Cell Mol Life Sci 60, 2622-2636.

Tendolkar, P. M., Baghdayan, A. S. & Shankar, N. (2006). Putative surface

proteins encoded within a novel transferable locus confer a high-biofilm phenotype to

Enterococcus faecalis. J Bacteriol 188, 2063-2072.

Teng, F., Jacques-Palaz, K. D., Weinstock, G. M. & Murray, B. E. (2002).

Evidence that the enterococcal polysaccharide antigen gene (epa) cluster is

widespread in Enterococcus faecalis and influences resistance to phagocytic killing

of E. faecalis. Infect Immun 70, 2010-2015.

Teng, F., Singh, K. V., Bourgogne, A., Zeng, J. & Murray, B. E. (2009). Further

characterization of the epa gene cluster and Epa polysaccharides of Enterococcus

faecalis. Infect Immun 77, 3759-3767.

Thiercelin, M. E. (1899). Sur un diplocoque saprophyte de l'intestin susceptible de

devenir pathogen. C R Soc Biol 5, 269-271.

Thomas, V. C., Thurlow, L. R., Boyle, D. & Hancock, L. E. (2008). Regulation of

autolysis-dependent extracellular DNA release by Enterococcus faecalis extracellular

proteases influences biofilm development. J Bacteriol 190, 5690-5698.

INTRODUCTION

45

Cha

pter

I

Thomas, V. C., Hiromasa, Y., Harms, N., Thurlow, L., Tomich, J. & Hancock, L.

E. (2009). A fratricidal mechanism is responsible for eDNA release and contributes to

biofilm development of Enterococcus faecalis. Mol Microbiol 72, 1022-1036.

Vebo, H. C., Snipen, L., Nes, I. F. & Brede, D. A. (2009). The transcriptome of the

nosocomial pathogen Enterococcus faecalis V583 reveals adaptive responses to

growth in blood. PLoS One 4, e7660.

Vebo, H. C., Solheim, M., Snipen, L., Nes, I. F. & Brede, D. A. (2010).

Comparative genomic analysis of pathogenic and probiotic Enterococcus faecalis

isolates, and their transcriptional responses to growth in human urine. PLoS One 5,

e12489.

Waters, C. M., Hirt, H., McCormick, J. K., Schlievert, P. M., Wells, C. L. & Dunny,

G. M. (2004). An amino-terminal domain of Enterococcus faecalis aggregation

substance is required for aggregation, bacterial internalization by epithelial cells and

binding to lipoteichoic acid. Mol Microbiol 52, 1159-1171.

Waters, C. M. & Bassler, B. L. (2005). Quorum sensing: cell-to-cell communication

in bacteria. Annu Rev Cell Dev Biol 21, 319-346.

Wirth, R. (1994). The sex pheromone system of Enterococcus faecalis. More than

just a plasmid-collection mechanism? Eur J Biochem 222, 235-246.

Chapter I

46

SILENCING FSR SYSTEM:

A Way to Survive

This chapter is based on the following manuscript:

The incongruent gelatinase genotype and phenotype in Enterococcus faecalis are due to shutting off the ability to respond to the gelatinase biosynthesis-activating pheromone

(GBAP) quorum-sensing signal

Neuza Teixeira, Sofia Santos, Paulo Marujo, Ryoji Yokohata, Vijayalakshmi S. Lyer, Jiro Nakayama, Lynn E. Hancock,

Pascale Serror and Maria de Fátima Silva Lopes (2012), Microbiology, 158, 519-528.

CONTENTS

1. SUMMARY ........................................................................................................... 51

2. INTRODUCTION ................................................................................................... 52

3. MATERIAL AND METHODS ................................................................................ 55

3.1 Bacterial strains and plasmids ........................................................................ 55

3.2 General DNA techniques ................................................................................ 55

3.3 Sequence analysis of the fsr and gelE–sprE regions of LN68 ........................ 55

3.4 Mutant construction ........................................................................................ 56

3.5 E. faecalis LN68 complementation with the V583 fsrC gene .......................... 57

3.6 RNA extraction and semiquantitative RT-PCR ............................................... 57

4. RESULTS AND DISCUSSION .............................................................................. 59

5. ACKNOWLEDGEMENTS ..................................................................................... 67

6. BIBLIOGRAPHY ................................................................................................... 68

7. SUPPLEMENTARY DATA .................................................................................... 74

Chapter II

50

The author of this thesis performed the majority of the experiments. Experimental

design, data analysis and manuscript preparation were done by the author of this

thesis and the supervisor Maria de Fatima Silva Lopes. Sofia Santos and

Vijayalakshmi S. Iyer helped with mutant construction and Ryoji Yokohata produced

the GBAP.

Silencing Fsr System: A way to Survive

51

Cha

pter

II

1. SUMMARY

The concomitant presence of a complete fsr quorum-sensing system and gelE–sprE

operons in Enterococcus faecalis is known to be essential for the detection of

gelatinase activity. However, there are reports of the absence of gelatinase activity

despite the presence of complete fsr and gelE loci. In order to understand this

incongruence between genotype and phenotype we sequenced fsr and gelE loci of

the E. faecalis LN68 strain, which was previously found to carry both operons but to

lack gelatinase activity. Of the 59 nucleotide differences detected compared with the

gelatinase-positive V583 strain, we found a nonsense mutation (a premature STOP

codon) predicted to truncate the ATPase sensor domain of the FsrC protein,

responsible for sensing and transducing the signal from the quorum-sensing

molecule. Strain LN68 was highly affected in the expression of the gelE and sprE

genes, further supporting the lack of Fsr dependent gelE induction. When we

constructed a V583 mutant with the same premature stop mutation in the fsrC gene

the resulting strain was no longer able to degrade gelatin. We conclude that the

reduced ability to transduce the quorum-sensing signal of the prematurely truncated

FsrC protein is sufficient to explain the negative gelatinase phenotype. As the

incongruent genotype and phenotype is detected in natural isolates, we believe that

the silencing of the quorum-sensing system Fsr may be beneficial for some E.

faecalis strains.

Chapter II

52

2. INTRODUCTION

Enterococci are natural inhabitants of the oral cavity, intestinal tract and female

genital tract of both humans and animals, and are also among the predominant

microbiota of traditionally fermented dairy products (Lopes et al., 1999) In contrast to

their beneficial role in intestinal homeostasis, these micro-organisms are becoming

increasingly important to human health as leading causes of nosocomial infections,

namely of the urinary tract, bloodstream, intra-abdominal and pelvic regions, and

surgical sites. To do so, they rely on several mechanisms, including the fsr operon of

Enterococcus faecalis, the species most frequently associated with nosocomial

infections (Gilmore, 2002; Mundt, 1986; Ogier & Serror, 2008). The fsr (Enterococcus

faecalis Regulator) two-component system, a homologue of the agr system in

Staphylococcus aureus, is a quorum sensing dependent regulatory system. The fsr

operon comprises four genes: fsrA, fsrB, fsrC and fsrD. The last encodes an

autoinducing cyclic peptide named Gelatinase Biosynthesis Activating Pheromone

(GBAP) that is processed and exported out of the cell by the FsrB protein.

Accumulation of GBAP outside cells is sensed by the FsrC histidine kinase, leading

to the activation of the response regulator FsrA. Activated FsrA induces expression

of the fsrBDC genes. These genes are involved in an autoregulatory circuit that

results in a boost of GBAP signalling and in induction of the Fsr regulon, among

which the gelE–sprE operon is the most induced (Bourgogne et al., 2006). This

operon encodes gelatinase (GelE), an extracellular zinc metalloprotease (Makinen et

al., 1989; Su et al., 1991), and SprE, a serine protease (Nakayama et al., 2001a;

Nakayama et al., 2001b; Qin et al., 2000).

Although the secreted protease SprE has been implicated in disease in animal

models, the role of SprE is still unknown. GelE is known to contribute to biofilm

formation, and contributes also to virulence through degradation of a broad range of

host proteinaceous substrates (Hancock & Perego, 2004; Park et al., 2007; Steck et

al., 2011). The role of the gelE and fsr loci in E. faecalis virulence has been

demonstrated in different mammalian infection models (Mohamed & Murray, 2006),


53

Cha

pter

II

in the Caenorhabditis elegans nematode model (Gaspar et al., 2009; Sifri et al.,

2002) and in the Arabidopsis thaliana plant model (Jha et al., 2005). Gelatinase has

also been implicated in evasion of the immune system of the insect Galleria

mellonella (Park et al., 2007). Recent transcription studies have also shown that fsr

and gelE–sprE expression is modulated during some stress conditions, namely in

blood (Vebo et al., 2009) and urine (Vebo et al., 2010). Despite their evident

importance for E. faecalis virulence and stress responses inside the host, many

reports have shown that both loci are present in enterococcal isolates from different

environments. This suggests that both the Fsr system and the GelE and SprE

proteins may play a role, not associated with virulence, in the biology of E. faecalis

(Thomas et al., 2009). The presence of the gelE genetic locus has often been

complemented by the search for the phenotype, i.e. detection of gelatinase activity

on plates containing gelatin. Qin et al. (2000) reported that the gelatinase phenotype

requires the concomitant presence of the fsr and gelE genes. Soon after, Eaton &

Gasson (2001) reported the loss by subculturing of the gelatinase phenotype in 20%

of the analysed strains. Later, Nakayama et al. (2002) suggested that the loss of the

gelatinase phenotype after subculturing might be due to a 23.9 kb chromosomal

deletion, which was found in urine isolates with silent gelE genes. This deletion

included the fsrA, fsrB and partially the fsrC gene. However, it has recently been

shown that the 23.9 kb chromosomal deletion does not occur spontaneously by

subculturing strains in the laboratory, but likely results from horizontal transfer and

recombination (Galloway-Pena et al., 2011). We and others have reported the loss of

the gelatinase phenotype by subculturing, but also the existence of natural

gelatinase-negative strains carrying gelE and an apparently complete fsr operon

(Lopes Mde et al., 2006; Nakayama et al., 2002). Altogether, these reports indicate

that silent gelE genes, in the presence of an apparently complete fsr operon, occur

both in natural and laboratory subcultured E. faecalis isolates. However, no further

demonstration of the involvement of mutations in either the fsr or the gelE–sprE

operon in the absence of gelatinase activity has been reported or demonstrated so

far.

Chapter II

54

In the present study we investigated the reason for the incongruence between the fsr

and gelE genotype and the gelatinase phenotype in E. faecalis strain LN68 (Lopes

Mde et al., 2006). We demonstrate that this incongruence, in our strains with

apparently complete fsr and gelE loci, is correlated with a specific nonsense codon in

the FsrC protein. We further demonstrate that this codon change originates a

truncated FsrC protein, preventing E. faecalis from sensing GBAP.


55

Cha

pter

II

3. MATERIAL AND METHODS

3.1 Bacterial strains and plasmids Strains and plasmids used in this study are listed in Table 1. Enterococcal strains

were grown in BHI (brain heart infusion) medium at 37ºC, and Escherichia coli

strains were grown in LB medium at 37ºC with agitation.

3.2 General DNA techniques General molecular biology techniques were performed by standard methods

(Sambrook, 1989). Restriction enzymes, polymerases and T4 DNA ligase were used

according to manufacturers’ instructions. PCR amplification was performed using a

Biometra thermocycler. When necessary, PCR products and DNA restriction

fragments were purified with purification kits (Macherey-Nagel). Plasmids were

purified using the Miniprep kit (Macherey-Nagel). Electrotransformation of

Escherichia coli and E. faecalis was carried out as described by Dower et al. (1988)

and Dunny et al. (1991), using a Gene Pulser apparatus (Bio-Rad) (Dower et al.,

1988; Dunny et al., 1991). Plasmid inserts were sequenced at BaseClear (The

Netherlands).

3.3 Sequence analysis of the fsr and gelE–sprE regions of LN68 PCR amplification of overlapping fragments of the fsr and gelE–sprE regions was

carried out using Expand High FidelityPLUS DNA polymerase (Roche) and primers

from Gaspar et al. (2009) (Gaspar et al., 2009). Amplicons were sequenced by

BaseClear and DNA sequence analysis was accomplished using the Vector NTI

10.3.0 program (Invitrogen). The results were compared with the V583 genomic DNA

sequence available at the J. Craig Venter Institute website (http://www.jcvi.org/).

Chapter II

56

3.4 Mutant construction Markerless fsrC mutants of E. faecalis LN68 and of a derivative erythromycin-

susceptible V583 strain (kindly provided by Axel Hartke, Université de Caen, France)

were constructed essentially as described by Brinster et al. (2007) (Brinster et al.,

2007)(Figure 1). In this procedure we changed the nucleotide guanine for adenine

(position 1764864 in the V583 genome), which leads to the substitution of a

tryptophan by a STOP codon (in V583). In LN68, we did the opposite, i.e. we

substituted the STOP codon by a tryptophan at position 403. Briefly, flanking regions

of fsrC were amplified from chromosomal DNA by PCR with primers LN68_fsrC-

PGMT5 and LN68_mfsrC_M, LN68_fsrC_PGMT3 and LN68_fsrC_M, for strain

LN68; and primers V583_mfsrC_M and LN68_fsrC-PGMT5, LN68_fsrC_PGMT3 and

V583_fsrC_M, for strain V583 (Table 1). The two cognate PCR fragments were fused

by PCR using the external primers LN68_fsrCPGMT5 and LN68_fsrC_PGMT3, for

both strains, and the resulting products were cloned into pGEM-T (Promega). After

being checked by sequencing, the inserted PCR fragment was removed from its

cloning vector by restriction enzymes and subsequently cloned into plasmid

pG+host9 (Maguin et al., 1996), which was then electroporated into the respective E.

faecalis strain. The fsrC single- and double-crossover mutants were selected as

described by Brinster et al. (2007) (Brinster et al., 2007). Successful targeted

mutations of fsrC in strains LN68 and V583 were first identified by PCR screening

and then confirmed by sequencing. The cognate phenotypes were confirmed by

gelatinase activity assay. An isogenic in-frame deletion of fsrB in E. faecalis V583

was generated using an Escherichia coli–enterococcal temperature-sensitive cloning

vector, pLT06 (Thurlow et al., 2009). Upstream regions flanking fsrB (ef1821) in the

V583 genome were PCR-amplified using the primer pair FsrBP1 and FsrBP2, and

the downstream region of ef1821 was amplified using primers FsrBP3 and FsrBP4

(Table 1). The resultant PCR products were digested with BamHI followed by

ligation, and the resulting product was reamplified with primers FsrBP1 and FsrBP4.

For the construction of the fsrB deletion vector pVI02, the amplified product was


57

Cha

pter

II

digested with EcoRI and PstI, followed by ligation to similarly digested plasmid vector

pLT06. The ligated product was electroporated into Escherichia coli EC1000 for

propagation, and blue colonies were selected for by culture at 37 ºC on LB agar

containing chloramphenicol (10 mg ml-1) and X-Gal (80 mg ml-1). Positive clones

were identified by PCR using primers OriF and SeqR (Thurlow et al., 2009). Plasmid

pVI02 was confirmed by restriction mapping and electroporated into E. faecalis V583

cells. To generate E. faecalis strain VI13 possessing an in-frame deletion of fsrB, a

published protocol was used (Thurlow et al., 2009). Primers FsrAP1 and GelEP2

were employed to confirm the presence of the deletion.

3.5 E. faecalis LN68 complementation with the V583 fsrC gene

To complement strain LN68 with the fsrC gene from V583, a 1595 bp BamHI–PstI

fragment from V583 was recovered from the PCR amplicon obtained by using

primers fsrC39PstI and fsrC59BamHI (Gaspar et al., 2009). The fragment was

cloned into the vector pOri23 (Que et al., 2000) cut with BamHI and PstI, resulting in

plasmid pOri23–fsrC. Primers pOri23_fw and pOri23_rv (Braga et al., 2011) were

used to confirm cloning. pOri23–fsrC was then introduced into LN68 cells by

electroporation. Gelatinase activity was evaluated as described below, on gelatin

plates supplemented with 500 mg erythromycin ml-1.

3.6 RNA extraction and semi-quantitative RT-PCR

RNA was extracted from cells grown in BHI broth at 37 ºC. Briefly, overnight cultured

cells were diluted 1:100 and growth was monitored by following OD600. Following

exponential, early stationary and late stationary growth phases, cells were collected

for RNA isolation. Total RNA was extracted and purified with an RNeasy Mini kit

(Qiagen). RNA integrity was checked by electrophoresis on a 1% agarose gel

(RNase free), and DNA contamination was checked using primers for 23S

(Supplementary Table S1). The cDNA was synthesized using random primers

Chapter II

58

(Roche Diagnostics), 3 mg total RNA and a Transcriptor High Fidelity cDNA

Synthesis kit (Roche Diagnostics). Two serial dilutions (1:10 and 1:100) of cDNA

were used for PCR in order to amplify cDNA of fsrA (primers: mfsrA, fsrA), fsrB

(primers: fsrB, mfsrB), fsrC (primers: fsrC_2, mfsrC), gelE (primers: mgelE_2, gelE)

and sprE (primers: sprE_4, msrpE_4) transcripts (Supplementary Table S1). 23S

rRNA was used as a control.

Table 1 – Strains and plasmids used in this study.

Strains Relevant characteristics Reference

E. coli DH5α F- Ø80dlacZΔM15 Δ(lacZYA-argF)U169 deoR recA1 endA1

hsdR17(rK - mK- ) phoA supE44 λ- thi-1 gyrA96 relA1

(Grant et al., 1990)

E. coli TG1 supE hsdD5 thi (Δlac-proAB) F- (traD36 proAB-lacZΔM15)

repA

(Law et al., 1995)

E. faecalis V583 Clinical isolate, TIGR sequence strain; VanR (Sahm et al., 1989)

E. faecalis V583ermS derivative of E. faecalis V583, susceptible to erythromycin due

to deletion of the erm(B)

supplied by Axel

Hartke,Caen,France

E. faecalis LN68 Wild-type E. faecalis; isolated from milk, GelE- (Lopes Mde et al., 2006)

E. faecalis LN66 Wild-type E. faecalis; isolated from milk, GelE- This Study

E. faecalis QSE15 Wild-type E. faecalis isolated from cheese, GelE- This Study

E. durans QN8 Wild-type E. durans; isolated from cheese, GelE- This study

E. faecalis EF_SAVE3 E. faecalis V583ermS W403STOP, Gel- This Study

E.faecalis EF_SAVE 5 E. faecalis LN68 (pSAVE7), EryR, GelE+ This study

Plasmids

pORI23 E. coli – E. faecalis shuttle plasmid, EryR (Que et al., 2000)

pGEM-T E. coli replicating plasmid, AmpR Promega

pG+host9 E. faecalis thermosensitive plasmid, EryR (Maguin et al., 1996)

pSAVE3 pGEM-T derivative carrying fsrC_W403STOP from E. faecalis

V583

This study

pSAVE4 pGEM-T derivative carrying fsrC_W403STOP This study

pSAVE5 pGhost9 derivative carrying fsrC_W403STOP This study

pSAVE6 pGhost9 derivative carrying fsrC_STOP403W This study

pSAVE7 pORI23 derivative carrying a 1595 pb BamHI/PstI fsrC

fragment from E. faecalis V583

This study


59

Cha

pter

II

4. RESULTS AND DISCUSSION

The importance of E. faecalis gelatinase to virulence and biofilm-forming ability has

promoted the detection of the fsr and gelE–sprE operons as a presumption of

pathogenicity. However, an incongruent genotype and phenotype may lead to false-

positive assumptions on the virulence potential of strains, since the detection of the

gene does not necessarily equate to gelatinase activity (Eaton & Gasson, 2001). In a

previous study, the E. faecalis LN68 dairy strain was found to lack gelatinase activity

on plates, despite apparently carrying the entire fsr and gelE–sprE operons,

suggesting a defect in the functionality of the fsr and gelE– sprE operons or in their

expression (Lopes Mde et al., 2006).

We first sequenced 6106 bp, including the promoter and terminator regions, of both

the fsr and gelE–sprE operons of LN68 strain. Comparison of the LN68 sequence

with that of E. faecalis V583 strain revealed 59 differences. Thirty-one, 18 and one

corresponded to silent, missense and nonsense mutations, respectively. We found

also nine differences located in the intergenic regions (Table 2).

Table 2 - Mutations identified in E. faecalis LN68.

Mutation

type

Gene/IRa

IR

fsrA IR fsrB IR fsrC IR gelE IR sprE IR

Silent - 2 - 4 - 5 - 12 - 8 -

Missense - 2 - 3 - 5 - 6 - 3 -

Nonsense 3 - 4 - - 1 - - - - 1

Deletions - - - - - - - - - - -

Insertions - - 1 - - - - - - - -

a IR, intergenic region.

Chapter II

60

Even if all of these differences could potentially influence the gelatinase phenotype,

either by disturbing the regulation of gene expression through changed transcript

stability for silent mutations, or by promoting a change in protein structure for

missense mutations, the most drastic effect was predicted to result from the

nonsense codon in the fsrC gene responsible for the substitution of tryptophan 403

by a STOP codon (Figure 1). This leads to FsrC402, a truncated histidine kinase

shortened by the last 45 aa compared with the FsrC of V583 strain (447 aa).

Figure 1 -Schematic representation of fsr and gelE genetic loci in LN68 and V583 strains. The

nonsense mutation W423STOP is also identified.

To further investigate how the detected differences in the LN68 sequence would

affect the structure of FsrC we used TopPred software (http://mobyle.pasteur.fr/cgi-

bin/portal.py?#forms::toppred). FsrC proteins of both the V583 and the LN68 strain

are predicted to have six transmembrane segments and three extracellular loops

(Figure 2). The major difference in LN68 FsrC is a truncated kinase domain due to

the nonsense mutation in the C-terminal region. These results support our prediction

that substitution of tryptophan 403 by a STOP codon promotes a structural change in

the FsrC protein and most likely has an impact on its activity. Noticeably, the GXG

triplet highly conserved in the ATPase domain of many histidine kinases is

interrupted in LN68 FsrC (Figure 2). This triplet is important for nucleotide binding

and histidine phosphorylation of the cognate response regulators (Parkinson &

Kofoid, 1992; Zhu & Inouye, 2002). In response to GBAP, the ATPase domain of


61

Cha

pter

II

W G

COOH447

cytoplasmicmembrane

ES

IS

FV

I

LF

V

FS

S VL

L VN

T AL

L SL

I

WL

I

GY

S

YA

L TV

V IF

T GF

L LI

H

FS

V

YN

I

ML

L TF

V SL

F IA

K FI

S

IA

S

LL

W

NV

L LL

L IN

I WI

A LK

I

FV

F

SI

L

LL

L LI

L LL

L LC

G FF

I

LI

S

LE

L

VG

L FL

I LI

G LV

I EA

Y

22

2

53

73

98

78

116

136

173

153

192

212M

H2

N

1

RV

TLIKIE

CKIP

LL S

L LI

AA

VINL C

ML

FS

L

K K R F

TI

S

QE

Y

FQQI

Q

L

T KN

FV

NS

F

R

L

SN

LV

E

P

V

L R NR

I

P

F

EP

V

FG

VT

N

D

S

RM

SS

K

ECL-1

ECL-2ECL-3

RQEL E

I

H245

G402K385

Y 252

cytoplasmicmembrane

ES

IS

FV

I

LF

V

FS

S VL

L VN

T AL

L SL

I

SW

L

LG

C

IY

A LT

V VI

F TG

F LL

I

FS

V

YN

I

ML

L TF

V SL

F IA

K FI

S

IA

S

LL

W

NV

I LL

L IN

I WI

A LK

I

FV

F

SI

L

LL

L LI

L LL

L LC

G FF

I

LI

S

LE

L

VG

L FL

I LI

G LV

I EA

Y

22

2

52

72

98

78

116

136

173

153

192

212M

H2

N

1

RV

TLIKIE

CKIP

LL S

L LI

AA

VINLC

ML

FS

HK K R

F

TI

S

QE

Y

FQQI

Q

L

T KN

FV

NS

F

R

L

SN

LV

E

P

V

L R NR

I

P

F

EP

V

FG

VT

N

D

S

RM

SS

K

ECL-1

ECL-2ECL-3

RQEL E

I

H245

G402

COOH

R385

N 252

FsrC phosphorylates the FsrA response regulator, which activates transcription from

PfsrB and PgelE promoters, increasing expression of the fsrBDC, gelE and sprE

genes. If phosphorylation of FsrA does not occur, the response regulator will not

activate transcription, and expression of the proteases will not increase. Thus, we

hypothesize that a truncated ATPase domain of FsrC impairs its ability to transduce

GBAP signalling and consequently it cannot induce the expression of the GelE and

SprE proteases.

Figure 2 - Intramembrane

structures of FsrC proteins

from V583 and LN68,

predicted using TopPred

software. Mutations found in the

fsrC gene of LN68 are shown:

tyrosine (Y) 54 to cysteine (C);

leucine (L) 124 to isoleucine (I);

tyrosine 252 to asparagine (N);

lysine (K) 385 to arginine (R);

tryptophan (W) 403 to STOP. ES,

extracellular space; IS, intracellular

space; ECL, extracellular loop.

E. faecalis V583

E. faecalis LN68

Chapter II

62

The low transcript levels of the gelE and sprE genes, in LN68 strain (Supplementary

Figure S1), are in accordance with the absence of gelatinase activity on gelatin

plates. In order to prove that LN68 has a negative gelatinase phenotype because it is

a GBAP non-responder (derived from its functionally impaired FsrC) and not because

of any other mutation detected in the fsrA, fsrB and gelE genes (Table 2), we

constructed two mutants: EF_SAVE3 in V583, where tryptophan 403 was substituted

by a STOP codon, and EF_SAVE4 in LN68, where the 403STOP codon was

substituted by a tryptophan (Figure 1), and we checked for induction of gelatinase

activity of LN68, V583 and their derived mutants by exogenous GBAP. The activity of

FsrC was indirectly detected by testing gelatinase activity on plates. Compared with

the V583 wild-type strain, EF_SAVE3 showed no gelatinase activity, indicating that

the nonsense mutation is sufficient to explain loss of FsrC activity (Figure 3).

Unexpectedly, we observed that the E. faecalis EF_SAVE4 mutant was unstable, as

it reverted easily to the wild-type sequence of the LN68 fsrC gene. In fact, if

gelatinase activity was tested right after constructing and confirming strain

EF_SAVE4, the strain behaved as a gelatinase producer. However, if we repeated

the test with EF_SAVE4 subcultures, it behaved as a gelatinase non-producer, and

sequencing of fsrC showed that the strain reverted to the STOP codon of the wild-

type strain. We thus decided to complement strain LN68 with fsrC from strain V583,

using plasmid pORI23. The resulting strain, E. faecalis EF_SAVE5, exhibited

gelatinase activity, indicating that expression of fsrC from V583 was sufficient to

restore gelatinase expression in strain LN68 (Figure 3). Then, to investigate whether

LN68 and EF_SAVE3 were GBAP non-responders and GBAP producers, we

performed two experiments, whose results are presented in Figure 4. We observed

no gelatinase activity when purified GBAP was added to LN68 and EF_SAVE3 cells

(Figure 4a). These results indicate that neither LN68 nor EF_SAVE3 is a GBAP

responder, showing that the W403STOP mutation in the FsrC histidine kinase is

enough to turn E. faecalis into a GBAP non-responder. We then wondered whether

these two strains were still producing sufficient amounts of GBAP to induce

detectable gelatinase. The results are presented in Figure 4b.


63

Cha

pter

II

Figure 3 - Images from gelatin agar plates inoculated with the V583, EF_SAVE3, LN68 and

EF_SAVE5 strains. A transparent halo, indicative of gelatin degradation, is clearly seen around V583 and

EF_SAVE5 growth, demonstrating the presence of gelatinase activity in these two strains.

VI13 is an fsrB mutant of V583, which is not able to produce GBAP, but responds to

it. In the presence of another GBAP producer strain, it is possible to see a

transparent halo around VI13 cells, indicative of gelatinase activity and thus of Fsr

induction by GABP.

A B

Figure 4 - LN68 and EF_SAVE3 gelatinase activity on skimmed milk plates. (A) Demonstration of the

inability of LN68 and EF_SAVE3 to induce gelatinase upon addition of exogenous GBAP. Strain VI13 was used as a

proof of concept of this assay. This strain is able to sense GBAP, and induce gelatinase activity upon GBAP addition,

but it is not able to produce GBAP. (B) Demonstration of the ability of both LN68 and EF_SAVE3 to produce GBAP.

Proof came from the observation of a transparent halo around growth of the VI13 strain, which is not able to produce

GBAP and depends on exogenous GBAP to produce visible gelatinase activity.

Chapter II

64

When VI13 was allowed to grow in the proximity of either VT01 or VT03, GBAP

producer strains but with a negative gelatinase phenotype, the GBAP produced by

VT01 and VT03 was able to induce gelatinase activity in VI13. Similarly, both LN68

and EF_SAVE3 were able to induce gelatinase activity in VI13, although to different

extents, and at much lower levels than those seen with VT01 or VT03. This is

because both LN68 and EF_SAVE3 have a truncated FsrC, which allows these

strains to produce only basal levels of GBAP to which VI13 responded. Our results

thus demonstrate that both LN68 and EF_SAVE3 are GBAP producers.

Recently, Thomas et al. (2009) have reported the existence, among planktonic E.

faecalis cells, of GBAP non-responders, i.e. cheaters, which, at the end of stationary

phase, reach approximately 12% of the population (Thomas et al., 2009). In a

population where individuals work cooperatively, cheaters are individual cells that

benefit from the cooperation with others, but do not cooperate. In light of our data, it

is possible that E. faecalis strains accumulate mutations in the fsr locus, in particular

in fsrC, and upon selection, due to still unknown factors, the loss of the ability to

transduce the GBAP signal is selected, as if the strains no longer need high levels of

GelE and SprE for survival, and therefore do not require a fully efficient quorum-

sensing Fsr system. As fsr has also been suggested to regulate other genes in the

genome of E. faecalis (Bourgogne et al., 2006), it is also plausible that the advantage

of the loss of quorum sensing is selected by other functions in the cell which are

shutdown. This raises interesting future prospects for further investigating the role of

Fsr, GelE and SprE in the biology of E. faecalis.

In order to establish whether the GBAP non-responder behaviour in other E. faecalis

isolates was due to the same W403STOP mutation or to other codon variations, we

searched for this nonsense codon in seven genetically unrelated enterococcal

isolates from our culture collection, which also carried the apparently complete fsr

and gelE loci, but lacked gelatinase activity (Figure 5). The same nonsense codon

was detected in only two E. faecalis tested strains, suggesting that it is likely that

other variations in the FsrC sequence lead to the same GBAP non-responder

behaviour.


65

Cha

pter

II

Figure 5 - Enterococcal strains with an incongruent gelatinase genotype and phenotype. The fsrC

gene of these strains was sequenced and was found to carry the W403STOP mutation, indicated by a star.

The detection of this nonsense codon in Enterococcus durans suggests either an

ancient event that was disseminated in the genus or a mutation which frequently

occurs due to unknown specific conditions. We have also detected other codon

variations in the fsrC gene of strain LN68. It is possible that these, though not

responsible for the loss of FsrC activity, are needed for stabilization of the

STOP403W substitution that seems to be deleterious in the LN68 genetic

background. It is thus likely that different sets of fsrC codon variations will be

responsible for negative gelatinase phenotypes in different genomes. In fact, when

we searched the E. faecalis sequenced genomes

(http://www.broadinstitute.org/annotation/genome/enterococcus_faecalis/MultiHome.html), we found different

sets of codon variations in fsrC among strains with a negative gelatinase phenotype

and positive genotype (Galloway-Pena et al., 2011). This fact, together with the

inability of LN68 to displace the W403STOP mutation, suggests that each genome

may accommodate different sets of codon variations in fsrC in order to achieve a

gelatinase negative phenotype.

In summary, previous work suggested that, besides deletion, mutations in any of the

fsr or gelE genes could explain the negative gelatinase phenotype observed in

natural E. faecalis isolates. However, no proof was available. In the present work we

demonstrate that a single nonsense codon in fsrC is enough to explain the

incongruence between a gelE genotype and a gelatinase-negative phenotype. The

substitution of tryptophan 403 by a STOP codon in strain LN68 was shown to

generate a truncated FsrC that was most likely impaired in the ATPase activity

Chapter II

66

needed for GBAP signal transduction. By demonstrating the hypothesized cause–

effect relationship between codon variations in the fsr–gelE loci and the gelatinase-

negative phenotype, we came across interesting findings which may prove very

important for future research on E. faecalis biology and host–pathogen relationships.

First, it is clear that the missense mutations that we detected in other fsr genes and

in gelE were not important for the negative gelatinase phenotype, as strain

EF_SAVE5, despite still carrying those mutations, was able to produce gelatinase.

Therefore, E. faecalis achieves the gelatinase-negative phenotype by accumulating

mutations in the fsrC gene. Accordingly, and despite the fact that each isolate may

accumulate different sets of codon variations in fsrC, the important fact here is that

some E. faecalis isolates appear to stabilize a quorum-sensing non-responder

behaviour. This is worth studying in future research on E. faecalis, as it could shed

some light on the role of Fsr and gelatinase in the biology and pathogenicity of this

important nosocomial pathogen.


67

Cha

pter

II

5. ACKNOWLEDGEMENTS

The authors are grateful to Axel Hartke (Universite´ de Caen, France) for kindly

providing the E. faecalis V583ermS. This work was supported by Fundação para a

Ciência e a Tecnologia (FCT) through project grant PDC/CVT/67270/2006, co-

financed through FEDER, and grant PEst-OE/EQB/LA0004/2011, and by the bilateral

cooperation project Portugal/France (GRICES/EGIDE, Pessoa program, 2006/07). N.

T. is grateful to FCT for grant SFRH/BD/65750/2009. P. M. is grateful to FCT for

grant SFRH/BPD/14595/2003.

Chapter II

68

6. BIBLIOGRAPHY





Braga, T. M., Marujo, P. E., Pomba, C. & Lopes, M. F. (2011). Involvement, and

dissemination, of the enterococcal small multidrug resistance transporter QacZ in

resistance to quaternary ammonium compounds. J Antimicrob Chemother 66, 283-

286.

Brinster, S., Furlan, S. & Serror, P. (2007). C-terminal WxL domain mediates cell

wall binding in Enterococcus faecalis and other gram-positive bacteria. J Bacteriol

189, 1244-1253.

Dower, W. J., Miller, J. F. & Ragsdale, C. W. (1988). High efficiency transformation

of E. coli by high voltage electroporation. Nucleic Acids Res 16, 6127-6145.

Dunny, G. M., Lee, L. N. & LeBlanc, D. J. (1991). Improved electroporation and

cloning vector system for gram-positive bacteria. Appl Environ Microbiol 57, 1194-

1201.

Eaton, T. J. & Gasson, M. J. (2001). Molecular screening of Enterococcus virulence

determinants and potential for genetic exchange between food and medical isolates.

Appl Environ Microbiol 67, 1628-1635.


69

Cha

pter

II

Galloway-Pena, J. R., Bourgogne, A., Qin, X. & Murray, B. E. (2011). Diversity of

the fsr-gelE region of the Enterococcus faecalis genome but conservation in strains

with partial deletions of the fsr operon. Appl Environ Microbiol 77, 442-451.




3564-3571.





for Microbiology.

Grant, S. G., Jessee, J., Bloom, F. R. & Hanahan, D. (1990). Differential plasmid

rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction

mutants. Proc Natl Acad Sci U S A 87, 4645-4649.



186, 5629-5639.




Law, J., Buist, G., Haandrikman, A., Kok, J., Venema, G. & Leenhouts, K. (1995).

A system to generate chromosomal mutations in Lactococcus lactis which allows fast

analysis of targeted genes. J Bacteriol 177, 7011-7018.

Chapter II

70

Lopes Mde, F., Simoes, A. P., Tenreiro, R., Marques, J. J. & Crespo, M. T.

(2006). Activity and expression of a virulence factor, gelatinase, in dairy enterococci.

Int J Food Microbiol 112, 208-214.

Lopes, M. F., Pereira, C. I., Rodrigues, F. M. & other authors (1999). Registered

designation of origin areas of fermented food products defined by microbial

phenotypes and artificial neural networks. Appl Environ Microbiol 65, 4484-4489.

Maguin, E., Prevost, H., Ehrlich, S. D. & Gruss, A. (1996). Efficient insertional

mutagenesis in lactococci and other gram-positive bacteria. J Bacteriol 178, 931-935.

Makinen, P. L., Clewell, D. B., An, F. & Makinen, K. K. (1989). Purification and

substrate specificity of a strongly hydrophobic extracellular metalloendopeptidase

("gelatinase") from Streptococcus faecalis (strain 0G1-10). J Biol Chem 264, 3325-

3334.

Mohamed, J. A. & Murray, B. E. (2006). Influence of the fsr locus on biofilm

formation by Enterococcus faecalis lacking gelE. J Med Microbiol 55, 1747-1750.

Mundt, J. O. (1986). Enterococci. In Bergey’s Manual of Systematic Bacteriology pp.

1063-1065. Edited by N. S. M. P. H. A. Sneath, M. E. Sharpe & J. G. Holt:

Baltimore:Williams & Wilkins.




145-154.


71

Cha

pter

II








Ogier, J. C. & Serror, P. (2008). Safety assessment of dairy microorganisms: the

Enterococcus genus. Int J Food Microbiol 126, 291-301.




Parkinson, J. S. & Kofoid, E. C. (1992). Communication modules in bacterial

signaling proteins. Annu Rev Genet 26, 71-112.




Que, Y. A., Haefliger, J. A., Francioli, P. & Moreillon, P. (2000). Expression of

Staphylococcus aureus clumping factor A in Lactococcus lactis subsp. cremoris

using a new shuttle vector. Infect Immun 68, 3516-3522.




Chapter II

72

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory

Manual., Cold Spring Harbor Laboratory edn. New York: Cold Spring Harbor.





Steck, N., Hoffmann, M., Sava, I. G. & other authors (2011). Enterococcus faecalis

metalloprotease compromises epithelial barrier and contributes to intestinal

inflammation. Gastroenterology 141, 959-971.

Su, Y. A., Sulavik, M. C., He, P., Makinen, K. K., Makinen, P. L., Fiedler, S.,

Wirth, R. & Clewell, D. B. (1991). Nucleotide sequence of the gelatinase gene

(gelE) from Enterococcus faecalis subsp. liquefaciens. Infect Immun 59, 415-420.




Thurlow, L. R., Thomas, V. C. & Hancock, L. E. (2009). Capsular polysaccharide

production in Enterococcus faecalis and contribution of CpsF to capsule

serospecificity. J Bacteriol 191, 6203-6210.

Vebo, H. C., Snipen, L., Nes, I. F. & Brede, D. A. (2009). The transcriptome of the

nosocomial pathogen Enterococcus faecalis V583 reveals adaptive responses to

growth in blood. PLoS One 4, e7660.


73

Cha

pter

II

Vebo, H. C., Solheim, M., Snipen, L., Nes, I. F. & Brede, D. A. (2010).

Comparative genomic analysis of pathogenic and probiotic Enterococcus faecalis

isolates, and their transcriptional responses to growth in human urine. PLoS One 5,

e12489.

Zhu, Y. & Inouye, M. (2002). The role of the G2 box, a conserved motif in the

histidine kinase superfamily, in modulating the function of EnvZ. Mol Microbiol 45,

653-663.

Chapter II

74

7. SUPPLEMENTARY DATA

Figure S1 - (A) Growth curves of V583 (squares) and LN68 (lozenges) strains in BHI. 1, 2 and 3

mark the three time points for RNA extraction. (B) Analysis of transcription of fsr and gelE–sprE operon

genes by RT‐PCR for V583 and LN68 strains at three different growth stages.


75

Cha

pter

II

Table S1 - Primers used in this study.

primer Sequence (5´-3´) MT (ºC) Reference

fsrA5ÉcoRI GAA TCG AAT TCG TTT TTG TTT GCA GG 60,1 (Gaspar et al., 2009)

fsrA3´PstI GAA TCC TGC AGT TCG CTT AAC GTC CC 66,4 (Gaspar et al., 2009)

fsrB5ÉcoRI GAA TCG AAT TCT TAC TTA GGG AGG G 61,3 (Gaspar et al., 2009)

fsrB3´PstI GAA TCC TGC AGA ACA TTA ATG CCG C 63,0 (Gaspar et al., 2009)

fsrC5ÉcoRI GAA TCG AAT TCG ACA ATG GAT GGG AC 63,2 (Gaspar et al., 2009)

fsrC3´PstI GAA TCC TGC AGT TGC TTT ATC CTC CC 64,8 (Gaspar et al., 2009)

gelE5ÉcoRI GAA TCG AAT TCT TGA GTT ATG AGG GG 61,6 (Gaspar et al., 2009)

gelE3´PstI GAA TCC TGC AGC AAG CTA AAA CCG GC 66,4 (Gaspar et al., 2009)

sprE5ÉcoRI GAA TCG AAT TCT GAA TCT GTT CTG GTC 61,9 (Gaspar et al., 2009)

mfsrA ATG AGT GAA CAA ATG GC 47,9 (Gaspar et al., 2009)

T7fsrA T7 - GT AAG AAA TAG TGC C 65,9 (Gaspar et al., 2009)

fsrA_2 CTA GGA AAA AGA TAT TTA GTT GGG C 58,1 (Gaspar et al., 2009)

mfsrA_2 CAA GAA CAG TTT GGC GGT TG 57,3 (Gaspar et al., 2009)

mfsrB TTG AAG AGG AGG GCG 50,6 (Gaspar et al., 2009)

T7fsrB T7 - GT CCA AAT ATA TTG GGC 67,2 (Gaspar et al., 2009)

T7mfsrB T7 - GC AAT ACT TGA AGA GGA GGG 70,5 (Gaspar et al., 2009)

fsrB GTC CAA ATA TAT TGG GC 47,9 (Gaspar et al., 2009)

fsrC_2 TTT ATA ATC ATG ACG AAA CAT CGC 55,9 (Gaspar et al., 2009)

mfsrC_2 TGA AGA AAC GAT TGC ACC AAC C 58,4 (Gaspar et al., 2009)

fsrC_3 TTT CTT TTT ACA TAT AAC AAT CCC C 54,8 (Gaspar et al., 2009)

mfsrC_3 TTT TTG TGT TTT TGA TTT CGC C 52,8 (Gaspar et al., 2009)

mfsrC TTT GTT CGT TTG CGG C 49,2 (Gaspar et al., 2009)

T7fsrC T7 - GT TGA GTG ACC GCT CC 70,6 (Gaspar et al., 2009)

mgelE AAT ATT TAC GCA GGG 42,4 (Gaspar et al., 2009)

T7gelE T7 - GT TTA CCT GAA TGT CC 67,1 (Gaspar et al., 2009)

T7mgelE T7 -GC AAC AAA TAT TTA CGC AGG G 69,5 (Gaspar et al., 2009)

gelE TCA TTC ATT GAC CAG 42,4 (Gaspar et al., 2009)

gelE_2 GTG TAA AGC AAT TCC CG 50,4 (Gaspar et al., 2009)

mgelE_2 AAC GGA TAA CAC AGG GG 52,8 (Gaspar et al., 2009)

gelE_3 CAA CAC TCT GAG TAT CCG CAC C 62,1 (Gaspar et al., 2009)

mgelE_3 TCT TCG CCA ACT GGT GAC C 58,8 (Gaspar et al., 2009)

msprE TAA CTT TGA TCG CCG G 49,2 (Gaspar et al., 2009)

T7sprE T7 - GC TGC TGG CAC AGC GG 73,0 (Gaspar et al., 2009)

sprE_2 TCA AAC AAA CGA AAC TGG C 52,4 (Gaspar et al., 2009)

msprE_2 TTT GTT TAG TAA AAG TAC TCT GG 53,5 (Gaspar et al., 2009)

sprE_3 CAT TCT TAA AAC TTT CAG CCA C 54,7 (Gaspar et al., 2009)

T7mfsrD T7 GA AAT TTG GTA AAA A 62,2 (Gaspar et al., 2009)

sprE_4 TTT CCT GTT TGC TTA ATG CCG C 58,4 This study

Chapter II

76

msrpE_4 GGC TGA AAG TTT TAA GAA TGC CAA A 58,1 This study

LN68_fsrC-PGMT5 TTA TAA ACC AAT GAT ACG GG 51,2 This study

LN68_fsrC_PGMT3 AAA ATA AAT TAT TAT GGA TTG CC 50 This study

LN68_mfsrC_M CCC AGA A GAG CAC GGT TGG GGA TTG TTA TAT GTA AAA G 70,5 This study

LN68_fsrC_M CTT TTA CAT ATA ACA ATC CCC AAC CGT GCT CTT CTG GG 70,5 This study

V583_mfsrC_M CCA GAA GAG CAC GGT TGA GGA TTG TTA TAT GTA AAA G 68,4 This study

V583_fsrC_M CTT TTA CAT ATA ACA ATC CTC AAC CGT GCT CTT CTG G 68,4 This study

fsrC5´_BamHI GAA TCG GAT CCG ACA ATG GAT GGG AC 66,4 This study

pOri23_fw GGA TTG GAT TAG TTC TTG TGG 55,9 (Braga et al.)

Pori23_rv TTG AGT GAG CTG ATA CCG C 56,7 (Braga et al.)

FSR AND VANCOMYCIN:

The antagonistic relation

This chapter complements a previous PhD work and is published in the following manuscript:

Transcriptomic study Reveals new pathways and genes Involved in Enterococcus faecalis V583 response to a therapeutic dose of vancomycin

Tânia Ribeiro, Neuza Teixeira, Ryoji Yokohata, Jiro Nakayama, Michael S. Gilmore

and Maria de Fátima S. Lopes (2013), Archives of Clinical Microbiology, Vol. 4 (5:3).

CONTENTS

1. SUMMARY ........................................................................................................... 81

2. INTRODUCTION ................................................................................................... 82

3. MATERIALS AND METHODS .............................................................................. 84

3.1 Bacterial strains and RNA extraction conditions ............................................. 84

3.1 Semi-quantitative RT-PCR ............................................................................. 85

4. RESULTS AND DISCUSSION .............................................................................. 86

6. BIBLIOGRAPHY ................................................................................................... 90

Chapter III

80

Neuza Teixeira performed the experiments correlating vancomycin with the Fsr

system. Ryoji Yokohata produced the GBAP.

Fsr and Vancomycin: The antagonistic relation

81

Cha

pter

III

1. SUMMARY

An enterococcal strain carrying the VanB resistance type can become susceptible if

impaired in other genes unrelated to the vanB operon. This fact alone illustrates the

lack of knowledge on the vancomycin mode of action. This antibiotic is still usable to

treat serious infections caused by multi-resistant enterococcal strains, but may not be

so for long. In a previous PhD work from our lab, microarrays were used to detect the

genetic response of the VanB carrying strain Enterococcus faecalis V583 to a

therapeutic dose (10 µg/ ml) of vancomycin. This therapeutic dose of vancomycin

was found to act as an anti-virulence agent, by down-regulating fsr-gelE-sprE genes.

We wondered if vancomycin was playing a role in preventing FsrC from sensing

GBAP molecule. In order to elucidate on this E. faecalis V583 and its isogenic mutant

fsrB cells were collected 0 min, 10 min and 20 min after GBAP addition, in the

presence and absence of vancomycin. RNA was extracted and semi-quantitative RT-

PCR was performed. We concluded that E. faecalis V583 strain responds to

vancomycin therapy by becoming blind to the quorum sensing molecule GBAP.

Chapter III

82

2. INTRODUCTION

During the five decades of vancomycin usage, eight genotypes of resistance to this

antibiotic have been described in only one genus, Enterococcus. Vancomycin, a cell-

wall active glycopeptide antibiotic, was first introduced to clinical practice in the 60’s

and in 1986 the first resistant enterococcal strain was isolated (Leclercq et al., 1988).

Since then, vancomycin resistant enterococci (VRE) have been isolated from

endocarditis, bacteraemia, urinary tract infections and wound infections, and have

emerged as one of the major nosocomial agents in hospitals (Arias & Murray, 2012).

Among the eight resistance types, VanA and VanB constitute the two most widely

disseminated, both conferring resistance by the same mechanism and encoding

related enzymes (Reynolds et al., 1994). In both cases, resistance is due to

synthesis of peptidoglycan precursors ending in the depsipeptide D-alanyl–D-lactate

(D-Ala–D-Lac) that binds glycopeptides with reduced affinity (Evers & Courvalin,

1996). The vanB operon contains the vanYBWHBBXBV resistance genes (Ribeiro et

al., 2011), and vanH, vanB and vanX are essential for resistance phenotype. vanHB

encodes a dehydrogenase that reduces pyruvate to D-Lac; vanB encodes a ligase

that synthetizes the depsipeptide D-Ala-D-Lac; and VanXB hydrolyses the D-Ala-D-

Ala dipeptide synthetized by the native Enterococcus Ddl ligase. Expression of the

resistance genes is regulated by the vanRBSB two-component system, which is

composed of a membrane-associated sensor kinase (VanSB), and a cytoplasmic

response regulator (VanRB) that acts as a transcriptional activator (Arthur et al.,

1994; Evers & Courvalin, 1996). The regulatory and resistance genes are transcribed

from distinct promoters that appear to be co-ordinately regulated (Aslangul et al.,

1997).

The Fsr (Enterococcus faecalis sensor regulator) is a quorum sensing regulatory

system and is similar to agr. The Fsr operon comprises four genes: fsrA, fsrB, fsrC

and fsrD. The last encodes an auto-inducing cyclic peptide named gelatinase

biosynthesis- activating pheromone (GBAP) and this peptide is processed and

exported out of the cell by FsrB. Accumulation of GBAP outside cells is sensed by


83

Cha

pter

III

the FsrC histidine kinase, leading to the activation of the response regulator FsrA.

Activated FsrA induces expression of the fsrBDC genes, which are involved in an

auto regulatory circuit that results in a boost of GBAP signalling and the induction of

another operon, the gelE-sprE operon (Nakayama et al., 2001a; Nakayama et al.,

2001b; Nakayama et al., 2006; Qin et al., 2000; Qin et al., 2001). The proteases

have been shown to be involved in biofilm formation, in translocation across intestinal

T84 cells, in degradation of antimicrobial peptides (AMPs) from the immune system

of Galleria mellonella, in autolysis regulation and as regulators of Ace surface protein

exposure on the surface of E. faecalis cells (Hancock & Perego, 2004; Park et al.,

2007; Pinkston et al., 2011; Singh et al., 2010; Thomas et al., 2009; Zeng et al.,

2005).

However, in a recent work from our lab (PhD thesis), we found that Fsr quorum-

sensing system, and the genes directly regulated by it, are repressed by the cell-wall

active antibiotic. This result came from a transcriptomic study in which we subjected

E. faecalis V583, the first VRE genome to be sequenced, to vancomycin, and

examined the transcriptional response by microarray to identify the cellular pathways

affected. A therapeutic dose of vancomycin (10 µg/ml) was chosen to represent the

range between peak levels of 20-40 µg/ml and trough serum levels of 5-10 µg/ml

achieved in therapy (Rybak et al., 2009).

The purpose of the work presented in this chapter was thus to elucidate on the

reason/mechanism responsible for Fsr shutdown by vancomycin.

Chapter III

84


3.1 Bacterial strains and RNA extraction conditions

Strains used in this study are described in Table 1. The effect of vancomycin on the

ability of E. faecalis V583 to sense GBAP, was directly evaluated by measuring

changes in expression of fsr regulated genes gelE and sprE. To control the timing of

the response of this operon, we used a V583 fsrB mutant (Teixeira et al., 2013),

which is unable to produce GBAP by itself, but is able to sense and activate Fsr upon

GBAP addition. This strain, termed V583ΔfsrB, was grown in BHI to an OD ~0.4,

and the culture was then split. To half, only GBAP (10nM), which was chemically

synthesized (Nakayama et al., 2001b), was added. To the other portion, both GBAP

(10 nM) and vancomycin (10 µg/ml) were added, and after 10 or 20 minutes, cells

were collected for RNA extraction and expression levels of gelE, sprE and vanB

genes were evaluated. Total RNA was extracted and purified with an RNeasy Mini kit

(Qiagen).

Table 1 - Strains and primers used in this study.


V583 Clinical isolate, VaR, with VanB type of resistance (Aslangul et al., 1997)

VI13 E. faecalis V583 ∆fsrB, GelE-, GBAP- (Teixeira et al., 2012)

Primers

Gene Sequence (5´-3´)

gelE TCATTCATTGACCAG (forward)

AACGGATAACACAGGGG (reverse) (Gaspar et al., 2009)

sprE CATTCTTAAAACTTTCAGCCAC (forward)

TAACTTTGATCGCCGG (reverse) (Gaspar et al., 2009)

vanB CCTACCCTGTCTTTGTGAAGC (forward)

ATTGTCCTGCTGCTTCTATCG (reverse) This study


85

Cha

pter

III

3.1 Semi-quantitative RT-PCR

cDNA was synthesized using random primers (Roche Diagnostics), 3 mg total RNA

and a Transcriptor High Fidelity cDNA Synthesis kit (Roche Diagnostics). Three

serial dilutions (1:1; 1:10 and 1:100) of cDNA were used for PCR in order to amplify

cDNA of gelE, sprE and vanB transcripts (see the primers in Table 1). vanB RNA

was used as a control of vancomycin activity

Chapter III

86

4. RESULTS AND DISCUSSION

In a previous work from our lab (PhD Thesis), the expression profile of E. faecalis

V583 exposed to a therapeutic dose of vancomycin was compared with the

expression profile of V583 cells in the absence of the antibiotic. This allowed the

identification of genes which respond either to vancomycin, or to the changes

introduced by the induction of the vanB operon genes in response to the antibiotic. In

this study Fsr system was repressed following the addition of vancomycin (Table 2)

and message corresponding to genes known to be regulated by this system, namely

gelE and sprE, was less abundant. At the late exponential growth phase when the

cells were collected, we would have expected that GBAP was accumulating outside

the cells and thus activating the Fsr system (Nakayama et al., 2001a).

Table 2 - Fsr and vancomycin resistance genes differentially expressed at both time points (t10

and t30 min) under exposure to10 µg/ml of vancomycin, with fold-change values higher than 2.

Fold change values are given for each gene, as well as its putative function and role, according to NCBI.

Locus Gene Descriptions Role Fold change

t10 t30

EF1097 - putative bacteriocin Unknown function -7.1 -12.5

EF1817 sprE serine proteinase, V8 family Protein fate -5.0 -9.6

EF1818 gelE Coccolysin Cell envelope/Protein fate/Cellular

processes -3.6 -8.0

EF1820 fsrC histidine kinase, putative Signal transduction -2.7 -2.9

EF1821 fsrB agrBfs protein Unknown function -2.3 -2.9

EF2292 - hypothetical protein Unknown function 131.5 176.9

EF2293 vanX D-alanyl-D-alanine dipeptidase Protein fate 129.5 123.9

EF2294 vanB D-alanine-D-lactate ligase Protein fate 188.0 132.9

EF2295 vanH D-specific alpha-keto acid

dehydrogenase Cell envelope/Cellular processes 203.5 217.8

EF2296 vanW vancomycin B-type resistance protein

VanW Cellular processes/Signal transduction 219.1 241.1

EF2297 vanYB D-alanyl-D-alanine carboxypeptidase Cell envelope/Cellular processes 145.6 170.5

EF2298 vanSB sensor histidine kinase VanSB Signal transduction 2.8 3.0

EF2299 vanRB DNA-binding response regulator VanRB Regulatory functions/Signal transduction 3.0 3.2


87

Cha

pter

III

The reduction in mRNA for the Fsr system was unexpected. One explanation would

be that vancomycin affected the ability of FsrC to sense the external GBAP, and

interfering with Fsr auto-induction, resulting in down-regulation of the system and the

genes it controls. To test this hypothesis, we used the V583ΔfsrB strain, which can

sense GBAP and activate fsr and gelE-sprE transcription, but is unable to produce it

(Teixeira et al., 2012). We added chemically synthesized GBAP to cultures of this

strain, with and without vancomycin, and looked for induction of gelE and sprE gene

expression. As shown in Figure 1B, and as expected, expression of both genes was

increased upon GBAP addition to V583ΔfsrB cells. However, when vancomycin was

added, neither gelE nor sprE were induced (Figure 1), demonstrating that

vancomycin somehow prevents the Fsr system from responding to its quorum signal.

In this experiment, vanB gene was, as expected, induced by vancomycin,

corroborating the microarray data and also validating our results with GBAP and the

V583ΔfsrB strain.

Figure 1 - Effect of GBAP and vancomycin on the expression of gelE, sprE and vanB genes in

strain V583fsrB. A, vancomycin was added at T0, prior to addition of GBAP; B, GBAP was added alone at T0.

The immediate repression of the Fsr system upon exposure to vancomycin indicates

that for reasons unknown, FsrC becomes blind to the quorum signal GBAP. The

Chapter III

88

quorum-sensing disrupting activity of vancomycin would be predicted to limit the

contributions of GelE and SprE proteases to bacterial virulence. It is possible that

other cell-wall active antibiotics may produce the same effect. Possibly, vancomycin

prevents FsrC phosphorylation, as is the case for the antimicrobial peptide

antimicrobial siamycin I. Siamycin I, active against E. faecalis and previously found to

inhibit both gelatinase and GBAP production (Nakayama et al., 2007), directly inhibits

autophosphorylation of FsrC kinase (Ma et al., 2011).

The observed negative effect of vancomycin on Fsr induction may be related to the

fitness cost that Fsr activation can have on E. faecalis. When under antibiotic stress

bacteria need to reduce the energy waste in general ant that used for Fsr activation

in particular and apply this energy to other resources, namely the vancomycin

resistance operon activity, which helps the bacteria to survive. In Staphylococcus

aureus it was described that sub-inhibitory concentrations of antibiotics are known to

modulate virulence gene expression in a process likely involving a quorum sensing

called agr, that is similar to E. faecalis fsr (Joo et al., 2010). Agr-negative isolates

frequently arise in hospital infections (Traber et al., 2008). Even though virulence

gene expression is compromised in agr-deficient isolates, they still give rise to

concern. In terms of resistance to antimicrobials, agr-negative strains are known to

display intermediate resistance or heteroresistance to glycopeptides such as

vancomycin, glycopeptide intermediate-level resistant S. aureus [GISA] and hetero-

GISA) (Paulander et al., 2013). This fact can be correlated with the fitness cost of

carrying agr, which is enhanced by the presence of some antibiotics and that

treatment with those antibiotics will select for agr-deficient mutants. Like in S. aureus,

the fitness cost in E. faecalis can be one of the main reasons of the Fsr shutdown in

vancomycin presence.

When vancomycin is added to E. faecalis V583, it stops growing after 30 minutes

and enterers earlier into stationary phase (Figure S1). This drastic change on

bacterial growth phase could be also correlated with changes in cell autolysis trough

Fsr shutdown. As already described, the proteases GelE and SprE are correlated

with cell autolysis (Teixeira et al., 2013; Thomas et al., 2009). During bacterial growth


89

Cha

pter

III

autolysis plays a crucial role in cell-division and is important for peptidoglycan

construction and renovation. In 2009, Thomas et al, show that autolysin AtlA is a

target of both GelE and SprE and this interaction is critical to the regulation of

enterococcal fratricide and biofilm development (Thomas et al., 2009). Our results

indicated the hypothesis that in the absence of the proteases GelE-SprE autolysin is

repress and bacteria stop growing. More studies are needed to prove test these two

hypotheses.

This quorum-sensing disrupting ability of vancomycin found in this work, is an

important step to finding news targets to combat E. faecalis infections.

Chapter III

90

6. BIBLIOGRAPHY

Arias, C. A. & Murray, B. E. (2012). The rise of the Enterococcus: beyond

vancomycin resistance. Nat Rev Microbiol 10, 266-278.

Arthur, M., Depardieu, F., Snaith, H. A., Reynolds, P. E. & Courvalin, P. (1994).

Contribution of VanY D,D-carboxypeptidase to glycopeptide resistance in

Enterococcus faecalis by hydrolysis of peptidoglycan precursors. Antimicrob Agents

Chemother 38, 1899-1903.

Aslangul, E., Baptista, M., Fantin, B., Depardieu, F., Arthur, M., Courvalin, P. &

Carbon, C. (1997). Selection of glycopeptide-resistant mutants of VanB-type

Enterococcus faecalis BM4281 in vitro and in experimental endocarditis. J Infect Dis

175, 598-605.

Evers, S. & Courvalin, P. (1996). Regulation of VanB-type vancomycin resistance

gene expression by the VanS(B)-VanR (B) two-component regulatory system in

Enterococcus faecalis V583. J Bacteriol 178, 1302-1309.




3564-3571.



186, 5629-5639.

Joo, H. S., Chan, J. L., Cheung, G. Y. & Otto, M. (2010). Subinhibitory

concentrations of protein synthesis-inhibiting antibiotics promote increased


91

Cha

pter

III

expression of the agr virulence regulator and production of phenol-soluble modulin

cytolysins in community-associated methicillin-resistant Staphylococcus aureus.

Antimicrob Agents Chemother 54, 4942-4944.

Leclercq, R., Derlot, E., Duval, J. & Courvalin, P. (1988). Plasmid-mediated

resistance to vancomycin and teicoplanin in Enterococcus faecium. N Engl J Med

319, 157-161.

Ma, P., Nishiguchi, K., Yuille, H. M., Davis, L. M., Nakayama, J. & Phillips-Jones,

M. K. (2011). Anti-HIV siamycin I directly inhibits autophosphorylation activity of the

bacterial FsrC quorum sensor and other ATP-dependent enzyme activities. FEBS

Lett 585, 2660-2664.




145-154.




Nakayama, J., Chen, S., Oyama, N., Nishiguchi, K., Azab, E. A., Tanaka, E.,

Kariyama, R. & Sonomoto, K. (2006). Revised model for Enterococcus faecalis fsr

quorum-sensing system: the small open reading frame fsrD encodes the gelatinase

biosynthesis-activating pheromone propeptide corresponding to staphylococcal agrd.

J Bacteriol 188, 8321-8326.

Chapter III

92







Paulander, W., Nissen Varming, A., Baek, K. T., Haaber, J., Frees, D. & Ingmer,

H. (2013). Antibiotic-mediated selection of quorum-sensing-negative Staphylococcus

aureus. MBio 3, e00459-00412.











Reynolds, P. E., Snaith, H. A., Maguire, A. J., Dutka-Malen, S. & Courvalin, P.

(1994). Analysis of peptidoglycan precursors in vancomycin-resistant Enterococcus

gallinarum BM4174. Biochem J 301 ( Pt 1), 5-8.


93

Cha

pter

III

Ribeiro, T., Santos, S., Marques, M. I., Gilmore, M. & de Fatima Silva Lopes, M.

(2011). Identification of a new gene, vanV, in vanB operons of Enterococcus faecalis.

Int J Antimicrob Agents 37, 554-557.

Rybak, M. J., Lomaestro, B. M., Rotschafer, J. C., Moellering, R. C., Jr., Craig,

W. A., Billeter, M., Dalovisio, J. R. & Levine, D. P. (2009). Therapeutic monitoring

of vancomycin in adults summary of consensus recommendations from the American

Society of Health-System Pharmacists, the Infectious Diseases Society of America,

and the Society of Infectious Diseases Pharmacists. Pharmacotherapy 29, 1275-

1279.

Singh, K. V., Nallapareddy, S. R., Sillanpaa, J. & Murray, B. E. (2010). Importance

of the collagen adhesin ace in pathogenesis and protection against Enterococcus

faecalis experimental endocarditis. PLoS Pathog 6, e1000716.

Teixeira, N., Santos, S., Marujo, P., Yokohata, R., Iyer, V. S., Nakayama, J.,

Hancock, L. E., Serror, P. & Silva Lopes Mde, F. (2012). The incongruent

gelatinase genotype and phenotype in Enterococcus faecalis are due to shutting off

the ability to respond to the gelatinase biosynthesis-activating pheromone (GBAP)

quorum-sensing signal. Microbiology 158, 519-528.

Teixeira, N., Varahan, S., Gorman, M. J. & other authors (2013). Drosophila host

model reveals new enterococcus faecalis quorum-sensing associated virulence

factors. PLoS One 8, e64740.




Chapter III

94

Traber, K. E., Lee, E., Benson, S., Corrigan, R., Cantera, M., Shopsin, B. &

Novick, R. P. (2008). agr function in clinical Staphylococcus aureus isolates.

Microbiology 154, 2265-2274.

Zeng, J., Teng, F. & Murray, B. E. (2005). Gelatinase is important for translocation

of Enterococcus faecalis across polarized human enterocyte-like T84 cells. Infect

Immun 73, 1606-1612.

NEW FINDINGS ON FSR SYSTEM:

New virulence genes and their impact during Drosophila

infection


Drosophila Host Model Reveals New Enterococcus faecalis Quorum-Sensing Associated Virulence Factors

Neuza Teixeira, Sriram Varahan, Matthew J. Gorman, Kelli L. Palmer, Anna Zaidman-Remy,

Ryoji Yokohata, Jiro Nakayama, Lynn E. Hancock, António Jacinto, Michael S. Gilmore and

Maria de Fátima Silva Lopes (2013), PLoS One 8, e64740.

CONTENTS 1. SUMMARY ........................................................................................................... 99

2. INTRODUCTION ................................................................................................. 100

3. MATERIAL AND METHODS .............................................................................. 103

3.1 Bacterial Strains and Plasmids ..................................................................... 103

3.2 Antibiotic Resistance Assay ......................................................................... 103

3.3 General DNA Techniques ............................................................................. 103

3.4 Mutant Construction ..................................................................................... 105

3.5 RNA Extraction and cDNA Synthesis for Microarrays .................................. 107

3.6 Semiquantitative RT-PCR ............................................................................ 108

3.7 D. melanogaster Infection ............................................................................. 108

3.8 Percentage of Similarities between V583 Genome and Other Genomes

Published ............................................................................................................ 109

3.9 Statistical Analysis ........................................................................................ 109

4. RESULTS ............................................................................................................ 110

4.1 Fsr dependent genes .................................................................................... 110

4.2 Genes dependent on simultaneous Fsr and Proteases activation ................ 112

4.3 LytRS system is required for GBAP induction of lrgAB genes ...................... 113

4.4 Fsr and the proteases affect D. melanogaster tolerance to E. faecalis infection

........................................................................................................................... 114

4.5 ef1097 contributes to toxicity in D. melanogaster infection ........................... 115

4.6 LrgAB and LytRS contribute differently to death of D. melanogaster ........... 116

5. DISCUSSION ...................................................................................................... 118

6. ACKNOWLEDGEMENTS ................................................................................... 124

7. BIBLIOGRAPHY ................................................................................................. 125

8. SUPPLEMENTARY DATA .................................................................................. 135

Chapter IV

98

The author of this thesis performed the majority of the experiments. Experimental

design, data analysis and manuscript preparation were done by Neuza Teixeira and

the supervisor Maria de Fatima Silva Lopes. Matthew J. Gorman and Vijayalakshmi

S. Iyer did the Fsr mutants. Kelli L. Palmer did the microarray analysis. Anna

Zaidman-Remy helped with the Drosophila experiments and Ryoji Yokohata

produced the GBAP.

New Findings on Fsr System: New virulence genes and their impact during Drosophila infection

99

Cha

pter

IV

1. SUMMARY

Enterococcus faecalis V583 is a vancomycin-resistant clinical isolate which belongs

to the hospital-adapted clade, CC2. This strain harbours several factors that have

been associated with virulence, including the fsr quorum-sensing regulatory system

that is known to control the expression of GelE and SprE proteases. To discriminate

between genes directly regulated by Fsr, and those indirectly regulated as the result

of protease expression or activity, we compared gene expression in isogenic mutants

of V583 variously defective in either Fsr quorum sensing or protease expression.

Quorum sensing was artificially induced by addition of the quorum signal, GBAP,

exogenously in a controlled manner. The Fsr regulon was found to be restricted to

five genes, gelE, sprE, ef1097, ef1351 and ef1352. Twelve additional genes were

found to be dependent on the presence of GBAP-induced proteases. Induction of

GelE and SprE by GBAP via Fsr resulted in accumulation of mRNA encoding lrgAB,

and this induction was found to be lytRS dependent. Drosophila infection was used

to discern varying levels of toxicity stemming from mutations in the fsr quorum

regulatory system and the genes that it regulates, highlighting the contribution of

LrgAB and bacteriocin EF1097 to infection toxicity. A contribution of SprE to infection

toxicity was also detected. This work brought to light new players in E. faecalis

success as a pathogen and paves the way for future studies on host tolerance

mechanisms to infections caused by this important nosocomial pathogen.

Chapter IV

100

2. INTRODUCTION

Drosophila melanogaster is used increasingly as a model for identifying virulence

factors of pathogenic microbes, and for elucidating their effects on the host (Boyer et

al., 2012). The fruit fly presents several advantages, such as small size, short life

cycle, short generation time, a fully sequenced genome and pre-existing libraries of

genetic mutants. In addition, its immune system shares similarities with the

mammalian immune system, including genes and pathways. In particular, the Toll

and Imd pathways in D. melanogaster have parallels in the mammalian Toll-like

(TLR) and interlleukin-1 (IL-1) receptor families, and the mammalian tumour necrosis

factor signalling pathway (Glavis-Bloom et al., 2012). In 2007, Cox and Gilmore

characterized the microbiome of this host and showed that Enterococcus sp. and

naturally colonize its alimentary canal; and that cytolysin, a toxin expressed by some

strains of Enterococcus faecalis, contributes to death of the flies when colonized

(Cox & Gilmore, 2007). It is also known that E. faecalis are able to kill the flies and

induce the Toll pathway after infection by septic injury, and that haemocytes

(Drosophila circulating cells that function as phagocytes) also play a role in fly’s

defense against these bacteria (Nehme et al., 2011; Schneider et al., 2007).

Enterococci are Gram-positive bacteria commonly found in gastrointestinal tract

consortia, but are also adapted to survive and persist in the environment. In contrast

to their benign role as members of the gut flora, select lineages of several

enterococcal species have become leading causes of antibiotic resistant nosocomial

infection, causing infections of the urinary tract, bloodstream, intra-abdominal and

pelvic regions, and surgical sites (Gilmore, 2002). E. faecalis, the species most

frequently associated with nosocomial infections (Qin et al., 2000), possesses a

number of traits that exacerbate the effects of infection. Fsr (Enterococcus faecalis

sensor regulator) a two-component, quorum sensing regulatory system, was first

described in 2000 by Qin et al. as a paralog of the Agr system in Staphylococcus

aureus (Qin et al., 2000). Despite similarities, Agr is functionally distinct from Fsr as it

uses the RNAIII riboregulator (Novick et al., 1993). The fsr operon comprises four


101

Cha

pter

IV

genes: fsrA, fsrB, fsrC and fsrD (Nakayama et al., 2001a). The last encodes an auto-

inducing cyclic peptide named gelatinase biosynthesis-activating pheromone

(GBAP), and this peptide is processed and exported out of the cell by FsrB.

Accumulation of GBAP outside cells is sensed by the FsrC histidine kinase, leading

to the activation of the response regulator FsrA. Activated FsrA induces expression

of the fsrBDC genes forming an auto regulatory circuit that results in a rapid,

exponential increase in GBAP signalling. Expression of a second operon is induced

by FsrA consisting of two cistrons gelE-sprE. The first cistron, gelE, encodes

gelatinase, an extracellular zinc metalloprotease, and the second, sprE, encodes a

serine protease (Qin et al., 2000; Qin et al., 2001). Several studies provided

evidence that both Fsr and the proteases independently contribute to the

pathogenicity of E. faecalis in different infection models (Engelbert et al., 2004;

Garsin et al., 2001; Gaspar et al., 2009; Jha et al., 2005; Mylonakis et al., 2002; Sifri

et al., 2002; Singh et al., 2005). The proteases have also been shown to be involved

in biofilm formation (Hancock & Perego, 2004), in translocation across intestinal T84

cells (Zeng et al., 2005), in degradation of antimicrobial peptides (AMPs) from the

immune system of Galleria mellonella (Park et al., 2007), in autolysis regulation

(Thomas et al., 2009) and as regulators of Ace surface protein exposure on the

surface of E. faecalis cells (Pinkston et al., 2011; Singh et al., 2010). The exact

mechanisms by which Fsr and its regulated proteases contribute to toxicity of

infection are not known. This has been confounded in part by unexplained variation

in experimental results. In 2005, Singh et al. tested fsrB and gelE mutants in E.

faecalis strain OG1RF in a rat endocarditis model. Deletion of the proteases led to a

greater decrease in endocarditis severity than deletion of fsrB. In the absence of

fsrB, the gelE expression was reduced, and the authors postulated that was the

reason for the smaller attenuation of fsrB mutant (Singh et al., 2005). In contrast,

studies examining the role of these traits in rabbit endophtalmitis (Engelbert et al.,

2004; Mylonakis et al., 2002), murine and C. elegans infection (Garsin et al., 2001;

Sifri et al., 2002), and in a G. mellonella infection model (Gaspar et al., 2009) all

found that fsrB deletion led to a greater attenuation than deletion of the proteases.

Chapter IV

102

These last results raised the possibility that Fsr could be affecting directly or

indirectly more genes or their products than just the proteases. Bourgogne et al.

compared gene expression in OG1RF with an isogenic fsrB deletion mutant, and

provided some evidence that Fsr regulates more than gelE and sprE protease genes

(Bourgogne et al., 2006). While it is known that host substrates, such as complement

components C3, C3a and C5a are targeted by GelE (Park et al., 2007; Park et al.,

2008; Thurlow et al., 2010), little is known regarding a functional role for SprE in

production of host injury and death. To decipher the role of Fsr-regulated genes in

virulence, we used a clonal-complex (CC) 2 strain (McBride et al., 2007), E. faecalis

V583, the first vancomycin-resistant enterococcal isolate in the US, which was

obtained from a chronic bloodstream infection (Sahm et al., 1989). E. faecalis CC2 is

the leading multidrug resistant hospital adapted clade (McBride et al., 2007; Willems

et al., 2011). To rigorously characterize the Fsr regulon, we compared gene

expression in isogenic mutants in Fsr genes and each of the Fsr-regulated protease

genes using microarrays and purified GBAP. D. melanogaster was used to examine

the individual contribution to virulence of SprE protease and other genes found to be

part of the Fsr regulon (or related to it, including EF1097, LrgAB and the two-

component system LytRS).


103

Cha

pter

IV


3.1 Bacterial Strains and Plasmids

Strains and plasmids used in this study are listed in Table 1. E. faecalis strains were

grown either in BHI, M17 broth/agar (Oxoid) or Enterococcel Agar (Quilaban) at

37ºC, unless a different growth temperature is specified. Escherichia coli strains

were grown in LB medium (Sigma) at 37ºC with agitation. The following antibiotic

concentrations were used: with E. faecalis, tetracycline 30 mg/ml; with E. coli,

ampicillin 150 mg/ml and tetracycline 150 mg/ml.

3.2 Antibiotic Resistance Assay

Resistance to different antibiotics (Ciprofloxacin, Penicillin, Sulphamethoxazole,

Vancomycin, Nitrofurantoin, Ofloxacin, Ampicillin, and Ceftriaxone) was determined

according to the recommendations of the disk providers (Oxoid) (Lopes Mde et al.,

2003), and results were interpreted according to the recommendations of the Clinical

and Laboratory Standards Institute (CLSI, formerly NCCLS) (http: //www.clsi.org/).

3.3 General DNA Techniques

General molecular biology techniques were performed by standard methods.

Restriction enzymes, polymerases and T4 DNA ligase were used according to

manufacturers’ instructions. PCR amplification was performed using a Biometra

thermocycler. When necessary, PCR products and DNA restriction fragments were

purified with purification kits (Macherey-Nagel). Plasmids were purified using the

Miniprep kit (Macherey-Nagel). Electro- transformation of E. coli and E. faecalis was

carried out as described by Dower et al. (1988) and Dunny et al. (1991), using a

Gene Pulser apparatus (Bio-Rad) (Dower et al., 1988; Dunny et al., 1991). Plasmid

inserts and mutant sequence were confirmed by sequencing at StabVida (Portugal).


104

Table 1 - Strains, plasmids and primers used in this study.


E. coli

DH5α F- Ø80dlacZΔM15 Δ(lacZYA-argF)U169 deoR recA1 endA1 hsdR17(rK - mK- ) phoA supE44 λ- thi-1 gyrA96 relA1

(Grant et al., 1990)

TG1 RepA supE hsdD5 thi (Δlac-proAB) F- (traD36 proAB-lacZΔM15) repA

(Law et al., 1995)

VE14188 GM1674 (dam- dcm- repA+) (Rigottier-Gois et al., 2011)

E. faecalis

V583 Clinical isolate, TIGR sequence strain; VnR (Sahm et al., 1989)

VE14089 V583 free of replicating plasmids

(Rigottier-Gois et al., 2011)

VI13 E. faecalis V583∆fsrB, GelE-, SprE-, GBAP-

(Teixeira et al., 2012)

MG01 E. faecalis V583ΔfsrB∆gelE; GelE-, SprE-, GBAP-

This study

MG02 E. faecalis V583ΔfsrB∆sprE; GelE-,SprE-, GBAP- This Study

MG03 E. faecalis V583ΔfsrB∆gelEΔsprE ; GelE-, SprE-, GBAP-

This Study

VT01 E. faecalis V583∆gelE, GelE-, GBAP+

(Thomas et al., 2008)

VT02 E. faecalis V583∆sprE, SprE-, GBAP+

(Thomas et al., 2008)

VT03

E. faecalis V583∆gelE∆sprE, GelE-, SprE-, GBAP+ (Thomas et al., 2008)

KS17 E. faecalis V583∆lytRS, GelE+, SprE+, GBAP+

This study

KS18 E. faecalis V583∆lrgAB, GelE+, SprE+, GBAP+

This study

KS19 E. faecalis V583∆fsrB∆lytRS, GelE-, SprE-, GBAP- This study

SAVE38 E. faecalis VE14089∆ef1097, GelE+, SprE+, GBAP+ This study

Plasmids

pGEM-T High copy plasmid, AmpR Promega

pG+host9 E. faecalis thermosensitive plasmid, EryR

(Maguin et al., 1996)

pLT06 Temperature-sensitive cloning vector, CmR

(Thurlow et al., 2009a)

pVI02 pLT06 containing engineered fsrB deletion (Teixeira et al., 2012)

pVT01

pLT06 containing engineered gelE deletion (Thomas et al., 2008)

pVT02

pLT06 containing engineered sprE deletion (Thomas et al., 2008)

pVT03

pLT06 containing engineered gelEsprE deletion (Thomas et al., 2008)

pKS103

pLT06 containing engineered lytSR deletion This study

pKS104 pLT06 containing engineered lrgAB deletion

This study


105

Cha

pter

VI

pSAVE37 pGEM-T containing engineered EF1097 deletion This study

pSAVE38 pG+host9 containing engineered EF1097 deletion This study

Primers

EF1097_1 AAG ACA ACA CGGGATAACACTCG

This study

EF1097_2 GCTTAGCCCACATTGAACTGCTGTCATTAGTAATGCCATCGCC

This study

EF1097_3 GCAGTTCAATGTGGGCTAAGC This study

EF1097_4 CTGAGTTACGGTCCATCCTTCTTCC This study

LytP1

GAGAGAATTCGCTTGGGAACTTCATTGC

This study

LytP2

CTCTGGATCCGACCACACCGGCACCTCC

This study

LytP3

GAGAGGATCCGTTAGCCGTTCATACGTC

This study

LytP4

CTCTCTGCAGGGTACGGCAATCGCTGTTG

This study

LytUp

GTATCAACGGTATGAATACGG

This study

LytDown

AATGCAATTCGACCCAAGGC

This study

LrgP1 GAGAGAATTCGGAAAGACGACAGTGACTTC This study

LrgP2

CTCTGGATCCTTCCATTCTTCTTCGCTCCCT

This study

LrgP3

GAGAGGATCCGCAACGGTCATTGGTCTATAA

This study

LrgP4

CTCTCTGCAGGCCTGCGAATAACTGGTTGA

This study

LrgUp

CCATCAAGCATGCATTTGGC

This study

LrgDown

TGGTACCGCTTGTTTTGACG

This study

mgelE_2 AAC GGA TAA CAC AGG GG

(Gaspar et al., 2009)

gelE TCA TTC ATT GAC CAG

(Gaspar et al., 2009)

lrgA_fw GGGCTTGTTCATTTCCCC

This study

lrgA_rv AAGGCGCCCGTCCAACCAG

This study

lrgB TTCTATGCCAACTGCCACAC

This study

mlrgB AAGGTTTCTTCTTATTTACGCC

This study

gls24_f TGCGTGGTAGAATACGGCAAAG

This study

gls24_rv GTCCATATGTCGCATGTTGC This study

3.4 Mutant Construction

E. faecalis V583 mutants (MG01[V583ΔfsrBΔgelE]; MG02 [V583ΔfsrBΔsprE]; and

MG03[V583ΔfsrBΔgelEΔsprE] were constructed by introducing pVT01(ΔgelE),

Chapter IV

106

pVT02(ΔsprE), and pVT03(ΔgelEΔsprE), respectively into the VI13[V583ΔfsrB] strain

and selecting for protease gene deletions essentially as described by Thomas et al.

2009 (Thomas et al., 2009). These strains are still responsive to external GBAP, but

are not able to produce the QS molecule, as is the case of VI13[V583ΔfsrB] (Teixeira

et al., 2012). Construction of KS17 [V583ΔlytSR] and KS18 [V583ΔlrgAB] mutants

was done similarly to the method described by Thurlow et al. using the marker less

deletion vector pLT06 (Thurlow et al., 2009b). In brief, flanking regions of lytSR and

lrgAB were amplified from E. faecalis V583 chromosomal DNA by PCR with primers

LytP1, LytP2, LytP3, LytP4 and LrgP1, LrgP2, LrgP3, LrgP4 respectively (Table 1).

The flanking PCR fragments were ligated together following BamHI digestion and

reamplified by PCR using the external primers P1 and P4, for both the lytSR and

lrgAB deletion constructs. The resulting amplicons were digested with EcoRI and PstI

and cloned into similarly digested pLT06 to create pKS103 (ΔlytSR) and pKS104

(ΔlrgAB). The resulting plasmids were confirmed by restriction analysis and

sequenced. Plasmids were introduced into E. faecalis V583 by electroporation and

selection of the desired mutant was performed as described (Thurlow et al., 2009b).

To create KS19 [V583ΔfsrBΔlytSR], VI13 was transformed with pKS103 (ΔlytSR)

and selection for deletion of lytSR was performed as described (Thurlow et al.,

2009b). E. faecalis V583Δef1097 was constructed essentially as described by

Brinster et al. (2007) (Brinster et al., 2007) in strain VE14089 (Rigottier-Gois et al.,

2011). Briefly, flanking regions of EF1097 were amplified from chromosomal DNA of

V583 by PCR with primers EF1097_1, EF1097_2, EF1097_3 and EF1097_4

respectively (Table 1). The two cognate PCR fragments were fused by PCR using

the external primers EF1097_1 and EF1097_4 for EF1097, respectively, and the

resulting product was cloned into pGEM-T (Promega). The inserted PCR fragment

was removed from its cloning vector by restriction enzymes and subsequently cloned

into pG+host9 plasmid (Maguin et al., 1996), which was then electroporated into E.

faecalis VE14089. The ef1097 single- and double crossover mutants were selected

as described by Brinster et al. (2007) (Brinster et al., 2007; Maguin et al., 1996).

Successful targeted mutations of ef1097 were first identified by PCR screening and


107

Cha

pter

VI

were confirmed by sequencing (StabVida, Portugal), and analysed by Vector NTI

program (Invitrogen).

3.5 RNA Extraction and cDNA Synthesis for Microarrays

E. faecalis strains were grown in BHI, at 37ºC, until 0.4 OD (600 nm). At this point,

purified GBAP, prepared as previously described (Nakayama et al., 2001b), was

added to a final concentration of 10 nM in the culture. This concentration was

previously shown to be able to induce the Fsr system (Nakayama et al., 2001a;

Nakayama et al., 2001b). In order to determine the effect of GBAP induction at a time

in growth when we knew, from previous work (Nakayama et al., 2001b), that the Fsr

system was not yet fully activated, we chose 0.4 OD to add GBAP. The quorum-

sensing molecule was added to induce the Fsr quorum-sensing system in strains

which lack the ability to produce the GBAP molecule, but are still able to sense it. At

time zero (immediately after GBAP addition) and after 10 min post-GBAP addition,

RNA was extracted from cells and used to synthesize cDNA and perform microarray

transcriptional analysis. Experiments without GBAP were also performed. To prepare

samples for Affymetrix GeneChip analysis, a previously published protocol was used

with few modifications (Schuster et al., 2003). Briefly, RNA was stabilized with RNA

protect (Qiagen) and RNA was isolated with RNeasy columns per the manufacturer’s

instructions (Qiagen). Samples were treated with RNase-free DNase I (Roche) to

remove contaminating DNA, and the absence of contaminating DNA was confirmed

by PCR. RNA integrity was verified using agarose gel electrophoresis of glyoxylated

samples (Ambion). cDNA was prepared from RNA using Superscript II Reverse

Transcriptase (Invitrogen) with random (N6) priming. cDNA was fragmented with

dilute DNase I (Roche) and fragments were biotinylated with the BioArray Terminal

Labeling Kit (Enzo Life Sciences) prior to hybridization. Affymetrix GeneChip

Analysis Samples were hybridized to a previously described custom E. faecalis

Affymetrix GeneChip (McBride et al., 2007) and scanned at the University of Iowa

DNA Core Facility. All microarray experiments were performed in duplicate. Data was

Chapter IV

108

analysed using Affymetrix GeneChip Operating Software, which identifies probe sets

with statistically significant hybridization over background (i.e. presence versus

absence calls) and among those, identifies probe sets for which hybridization is

significantly increased or decreased in pairwise comparisons of microarray

experiments. Signal log ratios for differentially expressed probe sets were averaged

and converted to fold change values. Only genes with ≥3-fold differential expression

were considered. The data discussed in this publication have been deposited in

NCBI’s Gene Expression Omnibus (Edgar et al., 2002) and are accessible through

GEO Series accession number GSE42036 (http:

//www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc =GSE42036).

3.6 Semiquantitative RT-PCR

RNA was extracted from strains V583ΔlytRS and V583ΔfsrB grown in BHI broth at

37ºC. Briefly, overnight cultured cells were diluted 1:100 and growth was monitored

by following OD600. Cells were collected in the same conditions as those used for

RNA extraction for microarrays. Total RNA was extracted and purified with an

RNeasy Mini kit (Qiagen). RNA integrity was checked by electrophoresis on a 1%

agarose gel (RNase free). cDNA was synthesized using random primers (Roche

Diagnostics), 3 mg total RNA and a Transcriptor High Fidelity cDNA Synthesis kit

(Roche Diagnostics). Serial dilutions of V583ΔlytRS and V583ΔfsrB cDNA were used

for PCR in order to amplify cDNA of lrgA (primers: lrgA, mlrgA), lrgB (primers: lrgB,

mlrgB) and gelE (primers: mgel_2, gelE) (Table 1).

3.7 D. melanogaster Infection

Oregon R male flies were injected with 50 nl of bacteria at 0.02 OD (600 nm) from

one of the strains: V583, V583ΔfsrBΔgelE, V583ΔfsrBΔsprE,

V583ΔfsrBΔgelEΔsprE, V583ΔlytRS, V583ΔlrgAB, VE14089 and VE14089Δef1097.

As control, flies were injected with the same volume of BHI medium. Male flies were

anesthetized with CO2 and the injections were carried out with a pulled glass


109

Cha

pter

VI

capillary needle using a nano-injector (Nanoliter 2000, World Precision Instruments).

Reproducibility was measured by determining the number of bacteria injected at time

zero. Injected flies were placed at 29ºC, 65% humidity. Seventy-five flies were

assayed for each survival curve, and they were placed in three vials of 25 flies each.

Each experiment was repeated three times, making a total of 225 flies tested per

strain in each set of three replicates, to ensure high confidence results. Death was

recorded at 0, 4, 6, 8, 10, 12, 14 and 24 h hours post-injection. All experiments were

performed at least three times. Following challenge with bacteria, six individual flies

were collected (at 0 h, 4 h, 8 h, 12 h and 24 h), homogenized, diluted serially, and

plated onto Enterococcel agar (Quilaban). E. faecalis CFUs (colony forming units)

were determined by testing three groups of six flies for each time point.

3.8 Percentage of Similarities between V583 Genome and Other Genomes

Published

The percentage of similarities was made with blast program (http:

//blast.ncbi.nlm.nih.gov/). The genomes that were used on this analysis were from Broad

Institute page (http: //www.broadinstitute.org/annotation/genome/enterococcus_faecalis/Multi

Home.html) and compared with V583 genome (http://www.ncbi.

nlm.nih.gov/nuccore/NC_004668.1).

3.9 Statistical Analysis

Statistical analysis of Drosophila survival was performed using GraphPad Prism

software version 5.03. Survival curves were compared using Log-rank and Gehan-

Breslow-Wilcoxon tests. Statistical analysis of Drosophila survival was performed

using t-test.

Chapter IV

110

4. RESULTS

In order to precisely identify genes for which expression is altered when GBAP

reaches effective quorum sensing concentration, we used a fsrB mutant, which is

unable to produce GBAP, but is able to sense it (Teixeira et al., 2012). We also used

single and double protease mutants in the fsrB mutant background in order to identify

any genes for which expression is indirectly controlled by Fsr through its regulation of

protease levels. Table 2 shows key changes in gene expression in V583ΔfsrB,

V583ΔfsrBΔgelE, V583ΔfsrBΔsprE and V583ΔfsrBΔgelEΔsprE after 10 min of GBAP

exposure. Besides genes previously known, or predicted, to be regulated by Fsr

through GBAP (gelE, sprE and ef1097) (Bourgogne et al., 2006; Qin et al., 2000; Qin

et al., 2001), 15 additional genes were differentially regulated by GBAP addition

collectively in all four mutants (Table 2). In contrast to previous results using oligo-

array study (Bourgogne et al., 2006), the current approach employed a statistically

more robust technology (Woo et al., 2004) and isolated the effects of only Fsr

quorum sensing through the use of mutants and the exogenous quorum molecule.

4.1 Fsr dependent genes

As expected, V583ΔfsrB responded to GBAP by substantially increasing the

expression of gelE (ef1818) (fold change 63) and sprE (ef1817) (fold change 59). To

a lesser extent, fsrC (ef1820) (fold change 3) transcript abundance was also

increased. As shown in Table 2, mutation of each protease gene did not affect the

expression of the other genes in the fsr or gelE-sprE operons, showing that the

presence of the deletions in these operons did not have polar effects on transcript

abundance of the remaining protease gene (V583ΔfsrBΔgelE expresses wild type

levels of sprE, and V583ΔfsrBΔsprE expresses wild type levels of gelE). In

accordance to previous results by others (Bourgogne et al., 2006), fsrA expression

was not affected by GBAP.


111

Cha

pter

VI

Table 1- Genes differentially expressed upon addition of GBAP to V583ΔfsrB, V583ΔfsrBΔgelE,

V583ΔfsrBΔsprE and V583ΔfsrBΔgelEΔsprE strains. Fold-change values were obtained by comparing

gene expression at 10 min against 0 min post-GBAP addition, by microarray analysis.

Locus Putative function Fold Change1

V583ΔfsrB V583ΔfsrBΔgelE V583ΔfsrBΔsprE V583ΔfsrBΔgelEΔsprE

EF04113 PTS system mannitol-specific IIBC - - - - 3

EF04684 LemA family protein - + 3 - -

EF05635 Hypothetical protein - - - + 3

EF07766 Hypothetical protein - + 11 - - EF08917 Aspartate aminotransferase

putative - - - - 4

EF0892 Aminoacid ABC transporter ,ATP-binding protein

- - - - 3

EF0893 Aminoacid ABC transporter/ permease

- 3 - 3 - 3

EF1097 Putative Bacteriocin + 31 + 23 + 30 + 47

EF12188 spermidine/putrescine ABC transporter,permease

- - - - 3

EF1351 Hypothetical protein - + 6 + 8 + 4 EF1352 Magnesium-translocating, P-type

ATPase + 5 + 7 + 5 + 3

EF18159 Transcriptional regulator, LysR family putative

- - + 12 + 11

EF1816 Hypothetical protein , with domain β-lactamase

- - + 4

+ 3

EF1817 Serine protease – SprE + 60 + 90 - -

EF1818 Gelatinase – GelE + 63 - + 42 -

EF1820 Histidine Kinase – FsrC + 3 + 4 + 3 + 4 EF31932 Antiholin-like protein LrgB + 34 - - - EF31942 Murein hydrolase regulator LrgA + 79 - - -

1 (+) up-regulated (-) down-regulated; 2 These two genes were up-regulated in the experiments done without GBAP, only in

the V583ΔfsrB strain with a fold change of + 7 for E3193 and + 6 for EF3194; 3 ef0411 is part of the predicted operon

ef0411-0412-0413, which encodes a mannitol specific PTS-system; 4 LemA-like protein likely involved in cell wall

metabolism. LemA proteins contain a predicted amino terminal transmembrane helix and a short extracellular amino

terminus. The exact molecular function of this protein is uncertain; 5 Has two predicted transmembrane helixes and a Blast

search does not reveal similarity to proteins of known function. Upstream is a putative operon encoding the potassium-

transporting ATPase KdpABC (EF0567-EF0569) and the two-component system KdpED (EF0570-EF0571) (TCS12)

(Hancock & Perego, 2002); 6 It has a predicted transmembrane domain at its N-terminus (residues 4 to 20) and the rest of

the protein is located outside the cell. It has a predicted thioredoxin fold domain similar to bacteriocin accessory proteins

((http://www.genome.jp/dbget-bin/www_bget?efa:EF0776); 7 Predicted to facilitate the conversion of aspartate and alpha-

ketoglutarate to oxaloacetate and glutamate; 8 Part of the predicted operon ef1218-ef1224, which codes for a

spermidine/putrescine ABC transporter; 9 EF1815 has 25% amino acid sequence similarity to CidR from S. aureus

(http://blast.ncbi.nlm.nih.gov/); EF1816 is a hypothetical protein with a -lactamase domain, has no transmembrane domain,

and is orthologous to PhnP, which is involved in phosphonate metabolism. EF1815 and EF1816 are located upstream of

SprE (EF1817), but only EF1816 is located in the positive DNA strand.

Chapter IV

112

Genes for which expression was affected by GBAP in all the four mutants are

therefore under the direct control of FsrA and not influenced by indirect activities of

the proteases on secondary regulators. In addition to Fsr and protease genes,

ef1097 was induced by GBAP addition showing transcript abundance changes (fold

change 31) similar to those observed for the protease genes. Transcripts of the

ef1352 gene where more abundant upon GBAP induction, but exhibited an increase

of a lower magnitude (fold change 5).

To determine whether a specific promoter motif could be identified upstream of

genes found to be regulated by Fsr through its quorum sensing, we compared known

(Del Papa & Perego, 2011) and putative promoter regions. The V583 promotor

regions of ef1097, gelE and fsrB possess a predicted FsrA binding motif (Del Papa &

Perego, 2011). However, this motif does not occur upstream of ef1351. This raises

the possibility that induction of ef1351-ef1352 in our experiments may be related to

increased expression of the only gene which was also induced in the four mutants,

but not independently controlled, ef1097. Alternatively, direct FsrA regulation

mechanisms may be more complex than previously suspected.

4.2 Genes dependent on simultaneous Fsr and Proteases activation

Some genes were found to be affected by the presence or absence of proteases,

indicating an indirect regulatory pathway. Those only affected if sprE was absent

(ef1815, ef1816); those affected only if either one of the proteases was absent

(ef0893); those for which mRNA levels were altered only when both proteases were

absent (ef0411, ef0563, ef0891, ef0892, ef1218); those for which mRNA

accumulated only in the presence of both proteases (ef3193 and ef3194) and those

affected in the absence of only the gelE gene (ef0468, ef0776). These last two genes

might respond to the high expression levels of sprE in a way yet to be determined.

Overall, the twelve genes affected by the combined activation of Fsr and the

proteases are putatively involved in different cellular processes, such as regulation,

cell-wall metabolism and transport, and some are even of unknown function.


113

Cha

pter

VI

Currently available data does not allow us to further clarify the connection between

these genes and the Fsr-GelE-SprE system.

4.3 LytRS system is required for GBAP induction of lrgAB genes

EF3193-EF3194 correspond to the lrgAB genes which, in S. aureus, are described to

be involved in repression of murein hydrolase activity, decreased autolysis and

increased tolerance to penicillin (Groicher et al., 2000). In S. aureus these genes are

regulated by the LytRS two-component regulatory system, located immediately

upstream of the lrgAB genes (Sharma-Kuinkel et al., 2009). There is no data about

the function of lrgAB genes in E. faecalis but it is known that they are also located

downstream of lytRS homologs, which suggests that in V583 lrgAB are regulated by

LytRS. In our experiments, ef3193-3194 mRNA was more abundant upon GBAP

induction only in the fsrB mutant, suggesting that these genes are not responding

directly to FsrA activation, but probably to increased protease GelE and SprE

expression, which only occurs when GBAP is added to the fsrB mutant. In order to

test the hypothesis that the large increase in lrgAB abundance was the result of

GBAP induction via the LytRS system, we deleted this two-component system from

the fsrB mutant strain and compared the expression of lrgAB genes in the

ΔfsrBΔlytRS and fsrB mutants (Figure 1). We found that GBAP is only able to induce

lrgAB genes if LytRS is functional. These results were not observed in previous

studies of fsr regulation in OG1RF (Bourgogne et al., 2006). None of the E. faecalis

∆lytRS or ∆lrgAB mutant strains showed different antibiotic resistance profiles (Table

S1) nor gelatinase activities when compared to the wild-type strain (data not shown).

Low level expression of lrgAB genes was observed in the ΔfsrBΔlytRS mutant

(Figure S1), which points either to a low constitutive expression of those genes or to

the existence of another regulator(s) able to modulate their expression.

Chapter IV

114

4.4 Fsr and the proteases affect D. melanogaster tolerance to E. faecalis

infection

To test the functional importance of genes found to be directly and indirectly

dependent on Fsr, we then tested the virulence of the fsr-related mutants in a D.

melanogaster injection model. We first compared the ability of the triple mutant

V583ΔfsrBΔgelEΔsprE, to the single V583ΔfsrB mutant, and the V583 parental

strain, to kill Drosophila. The fate of both the host (percentage of survival) and the

bacteria (number of CFU) was followed for 24 h. In our assay, 50% of the flies were

killed by the wild type strain 10 hours post-injection and after 14 h nearly all flies

were dead (Figure 2A). For the same period of infection, the triple mutant

V583ΔfsrBΔgelEΔsprE strain only killed 15% of the infected flies. 24 h post-injection,

the triple mutant V583ΔfsrBΔgelEΔsprE was significantly attenuated (see Table S2

for detailed statistical analysis). These results show that the Fsr system and the

proteases it regulates contribute measurably to toxicity in this model.

Figure 1 - LytRS is required for GBAP induction of lrgAB genes. The semi-quantitative RT-PCR shows

expression of lrgAB genes in the VI13 (∆fsrB mutant) and KS19 (∆fsrB∆lytRS mutant), in the presence of GBAP.

Expression of gelE and gdh were used as positive and negative controls, respectively, of Fsr induction by GBAP and

of RNA concentration, respectively. The RNA used for this analysis was previously treated with RNase-free DNase I

to remove contaminating DNA.


115

Cha

pter

VI

The survival curve of flies infected with the wild type strain shows two different killing

rates: until 8h, V583 strain is able to kill around 3 flies/ hour; after this time, and until

12h, V583 kills flies at a much higher rate, 15 flies/ hour. At 8h post infection, V583

cells reach the cell density considered to be able to induce the activation of the Fsr

system in broth culture (Nakayama et al., 2001a; Nakayama et al., 2001b). Although

there is no data on the in vivo Fsr expression during E. faecalis growth inside the

host, we cannot exclude the possibility that the increased killing rate after 8h is due

to induced expression of the proteases.

In order to dissect the contribution of fsr-regulated genes to the lethality of infection,

we tested these genes separately by infecting the flies with single deletion mutants

(Figure 2B). Deletion of both proteases, either in the double protease mutant or in the

triple mutant, led to a greater attenuation of virulence then deletion of fsrB

(p0.0001, Table S2). Consistent with previous demonstrations that in an fsrB

mutant strain, proteases are still expressed (Singh et al., 2005), we observed an

attenuation of the virulence in the triple mutant over that of the fsrB mutant,

suggesting that low level expression of both proteases is enough to induce increased

killing of the flies by the fsrB mutant. Absence of gelE alone produced the lowest

attenuation of E. faecalis virulence, differing significantly (pable S2) from

the effect of the absence of sprE gene alone, which was attenuated to a similar level

achieved by deletion of fsrB (Table S2). This result points to SprE as having a major

role in E. faecalis virulence in the Drosophila model. All strains grew similarly inside

Drosophila (Figure S2).

4.5 ef1097 contributes to toxicity in D. melanogaster infection

The large increase in ef1097 mRNA abundance upon GABP addition, and the fact

that it has been previously associated with Fsr system in another E. faecalis strain

(Bourgogne et al., 2006), led us to delete this gene to test its role in E. faecalis

virulence. This mutant was constructed in VE14089, a plasmid cured derivative strain

of V583, previously reported in G. mellonella to be less virulent than parental V583

Chapter IV

116

strain (Rigottier-Gois et al., 2011). Our results confirm that strain VE14089 is less

virulent than V583 in the D. melanogaster model as well (compare control in Figure

2A and 2C). Previously, we compared the toxicity of V583ΔfsrBΔgelEΔsprE and

V583ΔgelEΔsprE strains in the fly (Figure 2A and 2B). Both strains express ef1097,

and therefore, the role of this protein was not assessed. Figure 2C clearly shows that

deletion of ef1097 reduces killing of the flies by E. faecalis, therefore providing

evidence for a role of this bacteriocin in E. faecalis toxicity in the fly. As deletion of

ef1097 did not affect the gelatinase production ability of V583 strain (results not

shown), the reduction of toxicity does not appear to be due to an effect on expression

of fsr or the proteases it regulates.

4.6 LrgAB and LytRS contribute differently to death of D. melanogaster

LytRS appears to induce lrgAB expression upon addition of GBAP to the fsrB mutant

strain (Figure 1). Interestingly, lytRS was previously found to be strongly induced

during infection of G. mellonella, and proposed to contribute to E. faecalis VE14089

virulence in the same model (Hanin et al., 2010). The importance of LytRS was

therefore tested in Drosophila infection. Our results (Figure 2D) did not show a

significant difference in the fly survival (Table S2) following infection with the lytRS

mutant as compared to wild type. Our results cannot be compared to those of Hanin

et al. (Hanin et al., 2010) as both the strains and the infection protocols used were

different.

lgrAB are still expressed in the lytRS mutant. We thus wondered if complete

abolishment of its expression would have a more pronounced effect on D.

melanogaster toxicity than that of its regulator LytRS. The lrgAB mutant strain was

significantly reduced in toxicity for D. melanogaster (Figure 2D, Table S2). This result

highlights the relevance of the lrgAB operon in infection by E. faecalis and constitutes

the first report on such a role for this operon in this species.


117

Cha

pter

VI

Figure 2 - Drosophila survival

rates upon infection with E.

faecalis strains. 75 Oregon R (5-

to 7-day-old) male adult flies,

raised at 25°C, were divided in

tubes of 25 flies each, and

infected, by septic injury onto the

thorax with a thin needle, with

V583 (A, B, D) and VE14089

derived strains (C). Data is

representative of three

independent experiments (225 flies

per strain). Curves assigned with

an are significantly different (p<

0.0001) from the respective wild-

type -infected curve, as

determined by log-rank analysis

(Table S2).

Chapter IV

118

5. DISCUSSION

Assessing the basis for virulence of an opportunistic pathogen, such as E. faecalis, is

difficult because it is invariably subtle and multifactorial. Research on this topic in

recent years has concluded that the sole presence of a gene predicted to induce

virulence in a strain does not necessarily imply that the same gene may lead to the

same host fate in a different E. faecalis strains (Gaspar et al., 2009; Gaspar et al.,

2012). Besides the genome background and the host, the manner in which the

microbe is introduced also play a roles in determining whether or not a factor

contributes to toxicity. D. melanogaster has been used as a model host to study

pathogenesis because it provides easy handling, fast results, a fully sequenced

genome, pre-existing libraries of genetic mutants, the possibility to play on the host

side and similarities with the mammal immune system. In this work, we show that it

can be used to discern varying levels of toxicity stemming from mutations in the fsr

quorum regulatory system and the genes that it regulates.

In a representative of the hospital endemic lineage CC2, V583, the Fsr regulon is

largely restricted to the five genes, namely gelE, sprE, ef1097, ef1351 and ef1352

found to be directly dependent on GBAP-induced Fsr activation, and twelve

additional genes found to be dependent on GBAP induction of the proteases. Among

these are genes coding for proteins involved in cell-wall, transport and regulatory

functions. These genes are thus candidates to link the Fsr-proteases activity with the

phenotypes known to be associated to their impairment, namely biofilm formation,

adhesion and translocation to/in host-cells, autolysis and host damage and death.

This contrasts with previous findings in the more commensal background, OG1RF,

which was tested using an X-mer based oligonucleotide array with fewer controls and

less redundancy than the Affymetrix microarrays used here. Our experiment assayed

the first ten minutes after a burst of GBAP aiming to get clear, measurable and

immediate changes in expression, whereas the study by Bourgogne et al (Bourgogne

et al., 2006) followed the changes in expression of an fsrB mutant spanning different

growth stages. Their experimental design likely allowed for further events of


119

Cha

pter

VI

differential expression to take place. Whether the differences in results stem from

differences in strains, or differences in techniques and experimental approaches

used, is not currently known.

In the present study, we found that induction of GelE and SprE by GBAP via the fsr

regulator resulted in accumulation of mRNA encoding lrgAB, and that this induction

was lytRS dependent, indicating a functional relationship between Fsr and LytRS

regulons. In S. aureus, autolysis is positively regulated by Agr, a paralog of Fsr, that

positively regulates LrgAB (Fujimoto et al., 2000). Unlike S. aureus, in E. faecalis

FsrA does not regulate lrgAB genes directly, but does so indirectly. Both GelE and

SprE have previously been shown to play a role in autolysis regulation in E. faecalis,

respectively promoting and repressing it (Thomas et al., 2008). GelE is known to

proteolytically activate AtlA (Thomas et al., 2009), a major autolysin. Recently, GelE

was also found to control the levels of SalB, a protein with no evident peptidoglycan

hydrolytic activity, but affecting the levels of proteins involved in cell-wall synthesis

and cell division (Shankar et al., 2012). A salB mutant in OG1-RF strain showed

anomalous cell-division and increased autolysis (Shankar et al., 2012). Given the

current knowledge, we could speculate that autolysis regulation could constitute the

functional link, found in this study, between Fsr and LytRS. Future studies should

address the mechanism behind GelE-SprE regulation of autolytic activities in E.

faecalis and how they affect the expression of lrgAB operon through LytRS

regulation.

EF1097 protein, found by Bourgogne et al. 2006 (Bourgogne et al., 2006) to be

dependent on Fsr regulation in E. faecalis OG1RF, was here confirmed to be true

also for the V583 strain. In 2007, Swe et al. (Swe et al., 2007) suggested that ef1097

gene encodes a precursor of antimicrobial proteins with similarities to the

streptococcin SA-M57 in S. aureus. EF1097 is conserved in all E. faecalis strains

(Supplementary Table S3). Finding this bacteriocin to be similarly regulated in

distinct E. faecalis strains, namely OG1RF and V583, suggests this is a common

feature in the species. QS-activated bacteriocin production may constitute a means

to kill surrounding and competing bacteria thus providing competitive advantage to E.

Chapter IV

120

faecalis when colonizing or infecting a host. The Fsr homologue in S. aureus, Agr, is

known to regulate the expression of pro-inflammatory peptides, the phenol-soluble

modulins (PSM), in a RNAIII independent way (Queck et al., 2008). Several roles in

pathogenesis have been attributed to these amphipathic peptides (Periasamy et al.,

2012a), including antimicrobial activity (Joo et al., 2011), biofilm formation,

maturation and detachment (Periasamy et al., 2012b), and cytolytic ability to

neutrophils and other human cells (Kretschmer et al., 2012). Although the role of

EF1097 is not as extensively studied as that of PSMs, their shared features, namely

quorum-sensing induction and role in virulence, should direct further studies on

EF1097 role in E. faecalis biology and interaction with the host.

Despite the inexistence of clues on the EF1097 mechanism of action, bacteriocins

have been shown to produce changes in membrane potential and affect transport of

magnesium and amino acids (Uratani & Hoshino, 1984). EF1352, which codes for a

putative magnesium-translocating P-type ATPase, was induced in all strains used in

the microarrays. However, this operon lacks the previously described FsrA binding

motif in its promoter region. It is thus licit to speculate that expression of this operon

may be dependent on expression of ef1097, as this is the only Fsr dependent gene

with the FsrA motif not deleted and tested in the microarrays assays. Further studies

are needed to understand the link between bacteriocin production and induction of

an MgtA transporter, although we could hypothesise that EF1097 could induce ion

leakage, which in turn, would induce MgtA.

Despite different mortality curves were produced upon infection of Drosophila with

the tested mutants, they all grew similarly inside the host. Hosts have two ways to

deal with an infection: resistance and tolerance (Hanin et al., 2010; Rigottier-Gois et

al., 2011). Resistance is related with pathogen load and with mechanisms used to kill

the pathogens: more resistant hosts have fewer pathogens. Tolerance is a

consequence of the host ability to overcome the fitness cost imposed upon infection

and induction of the immune system and is related to the ability of the host to remain

healthy. Tolerance can be defined and measured from the slope of the health-by

microbe curve. We plotted the fly´s survival against pathogen load, assuming host


121

Cha

pter

VI

population survival as a measure of its health (Figure 3), and confirmed that

inactivation of Fsr and the two proteases increased fly´s tolerance to E. faecalis,

whereas flies showed similar resistance towards all studied E. faecalis strains.

Mechanisms involved both in tolerance (Leendertse et al., 2008; Rakoff-Nahoum et

al., 2004) and resistance (Brun et al., 2006; Lemaitre et al., 1997; Nehme et al.,

2011) of Drosophila towards enterococcal infections have been identified. If we

understand how the E. faecalis virulence factors studied in this work affect the fly´s

tolerance mechanisms and responses, we can postulate that future approaches to

fight enterococci can be through improving host tolerance, providing an alternative,

or complementary, approach to bacterial killing by use of antibiotics.

Figure 3. Drosophila-health by E. faecalis load curve. Source data used to construct this figure was obtained from

results on Figure 2, only considering time points at which enough flies alive were available. All strains show two

different slopes corresponding to different tolerance values, revealing that at some point (pathogen load value) there

is a huge decrease in tolerance to E. faecalis. This inflection point corresponds to a lower pathogen load for the wild

type strain (105), when compared to the mutant strains (106). For 106 value of pathogen load, the wild type induced

only 10% survival in the Drosophila population, as opposed to 90% survival of the Drosophila population infected with

the triple mutant.

GelE is known to be able to degrade several host proteins. Therefore, besides its

ability to degrade host immune factors, this protease may be involved in host tissue

Chapter IV

122

injury. Recently, GelE has also been implicated in release of Ace protein from the

surface of E. faecalis cells in OG1RF strain (Pinkston et al., 2011). In that study,

authors showed that deletion of gelE gene increased the number of Ace proteins

bound to the surface of the bacterial cells, increasing adherence to collagen. In the

insect model G. mellonella, collagen adherence has been shown to be required for

invasion and virulence (Abranches et al., 2011). Although this remains to be proven

true for Drosophila, it is licit to speculate that the lower attenuation of the gelE mutant

in this insect host model could be due to increased adherence to host cells and

proteins. Despite considered to be cell-bound, SprE is also able to degrade host

proteins, such as insulin and fibrinogen, but not immune system elements, such as

complement from human serum or Cecropin from insect hemolymph (Park et al.,

2007). Its major contribution to host death proven in this work needs thus urgent

clarification.

This work brought to light new players (Figure 4) in Fsr role in E. faecalis, namely

LrgAB operon, which will help unravel the bacterial programmed cell death which, in

turn, may help discover new approaches to control this important nosocomial

pathogen. Moreover, Drosophila was successfully established as a model to study

virulence associated genes in E. faecalis, highlighting LrgAB and EF1097 as novel

virulence factors induced by QS. Using Drosophila as a model also allowed us to

show that SprE is, per se, a relevant player in host injury and to suggest that E.

faecalis success during septic injury is not due to GelE acting as a bacterial defence

against the flies AMPs, but that it could rather be through host injury.


123

Cha

pter

VI

Figure 4 - GBAP-dependent regulatory network. Once the GBAP (black disks) concentration outside cells reaches

a certain threshold (upper part of the cell), the Fsr system is activated, and the FsrA regulator induces expression of

gelE, sprE and ef1097 genes. Both produce proteins which will be located to the cell membrane and cell wall.

Although GelE is loosely bound to the cell, it will also be released from it. The induced expression of ef1352, which

encodes a putative MgtA protein, by GBAP is likely due to increased amounts of EF1097, predicted to be a

bacteriocin. EF1352 could function as an auto-immunity factor against EF1097. The increased level of GelE and

SprE proteins in the cell-wall in response to GBAP are proposed to induce changes sensed by LytS protein, which in

turn, activates LytR, responsible for induction of lrgAB genes. When no GBAP is produced (lower part of the cell)

ef1097 is not expressed, but both GelE and SprE are still produced, although in lower amounts (dotted line). In this

situation, lrgAB genes are still expressed, but the increment in their expression during growth in the exponential

phase (assayed during microarrays performed without GBAP) is not due to the QS molecule. As we found that lrgAB

can still be expressed in a lytRS mutant, we propose that this is not the only regulator able to induce expression of

that operon.

Chapter IV

124

6. ACKNOWLEDGEMENTS

The authors are grateful to Isabel Marques, from IGC, for her help in enterococcal

genome comparison regarding genes directly regulated by Fsr.


125

Cha

pter

VI

7. BIBLIOGRAPHY

Abranches, J., Miller, J. H., Martinez, A. R., Simpson-Haidaris, P. J., Burne, R.

A. & Lemos, J. A. (2011). The collagen-binding protein Cnm is required for

Streptococcus mutans adherence to and intracellular invasion of human coronary

artery endothelial cells. Infect Immun 79, 2277-2284.





Boyer, L., Paquette, N., Silverman, N. & Stuart, L. M. (2012). Bacterial effectors:

learning on the fly. Adv Exp Med Biol 710, 29-36.

Brinster, S., Furlan, S. & Serror, P. (2007). C-terminal WxL domain mediates cell

wall binding in Enterococcus faecalis and other gram-positive bacteria. J Bacteriol

189, 1244-1253.

Brun, S., Vidal, S., Spellman, P., Takahashi, K., Tricoire, H. & Lemaitre, B.

(2006). The MAPKKK Mekk1 regulates the expression of Turandot stress genes in

response to septic injury in Drosophila. Genes Cells 11, 397-407.

Cox, C. R. & Gilmore, M. S. (2007). Native microbial colonization of Drosophila

melanogaster and its use as a model of Enterococcus faecalis pathogenesis. Infect

Immun 75, 1565-1576.

Del Papa, M. F. & Perego, M. (2011). Enterococcus faecalis virulence regulator

FsrA binding to target promoters. J Bacteriol 193, 1527-1532.

Chapter IV

126

Dower, W. J., Miller, J. F. & Ragsdale, C. W. (1988). High efficiency transformation

of E. coli by high voltage electroporation. Nucleic Acids Res 16, 6127-6145.

Dunny, G. M., Lee, L. N. & LeBlanc, D. J. (1991). Improved electroporation and

cloning vector system for gram-positive bacteria. Appl Environ Microbiol 57, 1194-

1201.

Edgar, R., Domrachev, M. & Lash, A. E. (2002). Gene Expression Omnibus: NCBI

gene expression and hybridization array data repository. Nucleic Acids Res 30, 207-

210.

Engelbert, M., Mylonakis, E., Ausubel, F. M., Calderwood, S. B. & Gilmore, M. S.

(2004). Contribution of gelatinase, serine protease, and fsr to the pathogenesis of

Enterococcus faecalis endophthalmitis. Infect Immun 72, 3628-3633.

Fujimoto, D. F., Brunskill, E. W. & Bayles, K. W. (2000). Analysis of genetic

elements controlling Staphylococcus aureus lrgAB expression: potential role of DNA

topology in SarA regulation. J Bacteriol 182, 4822-4828.

Garsin, D. A., Sifri, C. D., Mylonakis, E., Qin, X., Singh, K. V., Murray, B. E.,

Calderwood, S. B. & Ausubel, F. M. (2001). A simple model host for identifying

Gram-positive virulence factors. Proc Natl Acad Sci U S A 98, 10892-10897.




3564-3571.


127

Cha

pter

VI

Gaspar, F. B., Montero, N., Akary, E., Teixeira, N., Matos, R., Gonzalez-Zorn, B.,

Barreto Crespo, M. T., Serror, P. & Silva Lopes Mde, F. (2012). Incongruence

between the cps type 2 genotype and host-related phenotypes of an Enterococcus

faecalis food isolate. Int J Food Microbiol 158, 120-125.





for Microbiology.

Glavis-Bloom, J., Muhammed, M. & Mylonakis, E. (2012). Of model hosts and

man: using Caenorhabditis elegans, Drosophila melanogaster and Galleria

mellonella as model hosts for infectious disease research. Adv Exp Med Biol 710,

11-17.

Grant, S. G., Jessee, J., Bloom, F. R. & Hanahan, D. (1990). Differential plasmid

rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction

mutants. Proc Natl Acad Sci U S A 87, 4645-4649.

Groicher, K. H., Firek, B. A., Fujimoto, D. F. & Bayles, K. W. (2000). The

Staphylococcus aureus lrgAB operon modulates murein hydrolase activity and

penicillin tolerance. J Bacteriol 182, 1794-1801.

Hancock, L. & Perego, M. (2002). Two-component signal transduction in

Enterococcus faecalis. J Bacteriol 184, 5819-5825.



186, 5629-5639.

Chapter IV

128

Hanin, A., Sava, I., Bao, Y., Huebner, J., Hartke, A., Auffray, Y. & Sauvageot, N.

(2010). Screening of in vivo activated genes in Enterococcus faecalis during insect

and mouse infections and growth in urine. PLoS One 5, e11879.




Joo, H. S., Cheung, G. Y. & Otto, M. (2011). Antimicrobial activity of community-

associated methicillin-resistant Staphylococcus aureus is caused by phenol-soluble

modulin derivatives. J Biol Chem 286, 8933-8940.

Kretschmer, D., Nikola, N., Durr, M., Otto, M. & Peschel, A. (2012). The virulence

regulator Agr controls the staphylococcal capacity to activate human neutrophils via

the formyl peptide receptor 2. J Innate Immun 4, 201-212.

Law, J., Buist, G., Haandrikman, A., Kok, J., Venema, G. & Leenhouts, K. (1995).

A system to generate chromosomal mutations in Lactococcus lactis which allows fast

analysis of targeted genes. J Bacteriol 177, 7011-7018.

Leendertse, M., Willems, R. J., Giebelen, I. A., van den Pangaart, P. S.,

Wiersinga, W. J., de Vos, A. F., Florquin, S., Bonten, M. J. & van der Poll, T.

(2008). TLR2-dependent MyD88 signaling contributes to early host defense in

murine Enterococcus faecium peritonitis. J Immunol 180, 4865-4874.

Lemaitre, B., Reichhart, J. M. & Hoffmann, J. A. (1997). Drosophila host defense:

differential induction of antimicrobial peptide genes after infection by various classes

of microorganisms. Proc Natl Acad Sci U S A 94, 14614-14619.


129

Cha

pter

VI

Lopes Mde, F., Ribeiro, T., Martins, M. P., Tenreiro, R. & Crespo, M. T. (2003).

Gentamicin resistance in dairy and clinical enterococcal isolates and in reference

strains. J Antimicrob Chemother 52, 214-219.

Maguin, E., Prevost, H., Ehrlich, S. D. & Gruss, A. (1996). Efficient insertional

mutagenesis in lactococci and other gram-positive bacteria. J Bacteriol 178, 931-935.

McBride, S. M., Fischetti, V. A., Leblanc, D. J., Moellering, R. C., Jr. & Gilmore,

M. S. (2007). Genetic diversity among Enterococcus faecalis. PLoS ONE 2, e582.

Mylonakis, E., Engelbert, M., Qin, X., Sifri, C. D., Murray, B. E., Ausubel, F. M.,

Gilmore, M. S. & Calderwood, S. B. (2002). The Enterococcus faecalis fsrB gene, a

key component of the fsr quorum-sensing system, is associated with virulence in the

rabbit endophthalmitis model. Infect Immun 70, 4678-4681.




145-154.




Nehme, N. T., Quintin, J., Cho, J. H., Lee, J., Lafarge, M. C., Kocks, C. &

Ferrandon, D. (2011). Relative roles of the cellular and humoral responses in the

Drosophila host defense against three gram-positive bacterial infections. PLoS One

6, e14743.

Chapter IV

130

Novick, R. P., Ross, H. F., Projan, S. J., Kornblum, J., Kreiswirth, B. &

Moghazeh, S. (1993). Synthesis of staphylococcal virulence factors is controlled by

a regulatory RNA molecule. Embo J 12, 3967-3975.




Park, S. Y., Shin, Y. P., Kim, C. H., Park, H. J., Seong, Y. S., Kim, B. S., Seo, S. J.

& Lee, I. H. (2008). Immune evasion of Enterococcus faecalis by an extracellular

gelatinase that cleaves C3 and iC3b. J Immunol 181, 6328-6336.

Periasamy, S., Chatterjee, S. S., Cheung, G. Y. & Otto, M. (2012a). Phenol-soluble

modulins in staphylococci: What are they originally for? Commun Integr Biol 5, 275-

277.

Periasamy, S., Joo, H. S., Duong, A. C., Bach, T. H., Tan, V. Y., Chatterjee, S. S.,

Cheung, G. Y. & Otto, M. (2012b). How Staphylococcus aureus biofilms develop

their characteristic structure. Proc Natl Acad Sci U S A 109, 1281-1286.









131

Cha

pter

VI




Queck, S. Y., Jameson-Lee, M., Villaruz, A. E., Bach, T. H., Khan, B. A.,

Sturdevant, D. E., Ricklefs, S. M., Li, M. & Otto, M. (2008). RNAIII-independent

target gene control by the agr quorum-sensing system: insight into the evolution of

virulence regulation in Staphylococcus aureus. Mol Cell 32, 150-158.

Rakoff-Nahoum, S., Paglino, J., Eslami-Varzaneh, F., Edberg, S. & Medzhitov,

R. (2004). Recognition of commensal microflora by toll-like receptors is required for

intestinal homeostasis. Cell 118, 229-241.

Rigottier-Gois, L., Alberti, A., Houel, A. & other authors (2011). Large-scale

screening of a targeted Enterococcus faecalis mutant library identifies envelope

fitness factors. PLoS One 6, e29023.




Schneider, D. S., Ayres, J. S., Brandt, S. M. & other authors (2007). Drosophila

eiger mutants are sensitive to extracellular pathogens. PLoS Pathog 3, e41.

Schuster, M., Lostroh, C. P., Ogi, T. & Greenberg, E. P. (2003). Identification,

timing, and signal specificity of Pseudomonas aeruginosa quorum-controlled genes:

a transcriptome analysis. J Bacteriol 185, 2066-2079.

Chapter IV

132

Shankar, J., Walker, R. G., Wilkinson, M. C., Ward, D. & Horsburgh, M. J. (2012).

SalB inactivation modulates culture supernatant exoproteins and affects autolysis

and viability in Enterococcus faecalis OG1RF. J Bacteriol 194, 3569-3578.

Sharma-Kuinkel, B. K., Mann, E. E., Ahn, J. S., Kuechenmeister, L. J., Dunman,

P. M. & Bayles, K. W. (2009). The Staphylococcus aureus LytSR two-component

regulatory system affects biofilm formation. J Bacteriol 191, 4767-4775.









Singh, K. V., Nallapareddy, S. R., Sillanpaa, J. & Murray, B. E. (2010). Importance

of the collagen adhesin ace in pathogenesis and protection against Enterococcus

faecalis experimental endocarditis. PLoS Pathog 6, e1000716.

Swe, P. M., Heng, N. C., Ting, Y. T., Baird, H. J., Carne, A., Tauch, A., Tagg, J. R.

& Jack, R. W. (2007). ef1097 and ypkK encode enterococcin V583 and corynicin JK,

members of a new family of antimicrobial proteins (bacteriocins) with modular

structure from Gram-positive bacteria. Microbiology 153, 3218-3227.


133

Cha

pter

VI

Teixeira, N., Santos, S., Marujo, P., Yokohata, R., Iyer, V. S., Nakayama, J.,

Hancock, L. E., Serror, P. & Silva Lopes Mde, F. (2012). The incongruent

gelatinase genotype and phenotype in Enterococcus faecalis are due to shutting off

the ability to respond to the gelatinase biosynthesis-activating pheromone (GBAP)

quorum-sensing signal. Microbiology 158, 519-528.







Thurlow, L. R., Thomas, V. C., Fleming, S. D. & Hancock, L. E. (2009a).

Enterococcus faecalis capsular polysaccharide serotypes C and D and their

contributions to host innate immune evasion. Infect Immun 77, 5551-5557.

Thurlow, L. R., Thomas, V. C. & Hancock, L. E. (2009b). Capsular polysaccharide

production in Enterococcus faecalis and contribution of CpsF to capsule

serospecificity. J Bacteriol 191, 6203-6210.

Thurlow, L. R., Thomas, V. C., Narayanan, S., Olson, S., Fleming, S. D. &

Hancock, L. E. (2010). Gelatinase contributes to the pathogenesis of endocarditis

caused by Enterococcus faecalis. Infect Immun 78, 4936-4943.

Uratani, Y. & Hoshino, T. (1984). Pyocin R1 inhibits active transport in

Pseudomonas aeruginosa and depolarizes membrane potential. J Bacteriol 157,

632-636.

Chapter IV

134

Willems, R. J., Hanage, W. P., Bessen, D. E. & Feil, E. J. (2011). Population

biology of Gram-positive pathogens: high-risk clones for dissemination of antibiotic

resistance. FEMS Microbiol Rev 35, 872-900.

Woo, Y., Affourtit, J., Daigle, S., Viale, A., Johnson, K., Naggert, J. & Churchill,

G. (2004). A comparison of cDNA, oligonucleotide, and Affymetrix GeneChip gene

expression microarray platforms. J Biomol Tech 15, 276-284.

Zeng, J., Teng, F. & Murray, B. E. (2005). Gelatinase is important for translocation

of Enterococcus faecalis across polarized human enterocyte-like T84 cells. Infect

Immun 73, 1606-1612.


135

Cha

pter

VI

8. SUPPLEMENTARY DATA

Figure S1. lrgAB expression in the absence of GBAP. The semi-quantitative RT-PCR shows expression of lrgAB

genes in the VI13 (∆fsrB mutant) and KS19 (∆fsrB∆lytRS mutant) strains, in the absence of GBAP. Expression of

gelE and gdh were used as negative and positive controls, respectively. The RNA used for this analysis was

previously treated with RNase-free DNase I to remove contaminating DNA and PCR was done in order to confirm

absence of DNA from the RNA samples analysed.

Chapter IV

136

Figure S2. E. faecalis growth curves in injected flies. Oregon R (5- to 7-day-old) male adult flies, raised at 25°C,

were divided in tubes of 25 flies each, and infected, by septic injury onto the thorax with a thin needle, with V583

mutants. Flies were collected at 0, 4, 8, 12, and 24 h. Three groups of six flies for each time point were homogenized

and plated in Enterococcel agar and E. faecalis CFUs were determined.


137

Cha

pter

VI

Table S1 – Antibiotic resistance profiles of E. faecalis V583 derivative mutants. Values correspond to diameter

of halos (µm) around antibiotic disks.

Strain Ciprofloxacin Penicillin Sulphamethoxazole Vancomycin Nitrofuratoin Ofloxacin Ampicilin Ceftriaxone

V583 24,03 22,02 30,09 10,06 22,09 20,08 28,05 15,02

V583∆lrgAB 24,01 21,08 29,06 10,06 23,03 20,08 28,09 16,04

V583∆lytRS 23.03 21,03 30,08 10,02 21,07 20,08 27,04 11,09

V583∆fsrB 24,09 21,03 30,00 10,04 20,06 20,01 28,04 15,0

Table S2 – Statistical analysis of figure 2 using Kaplan-Myer curves. Experimental and control populations are

compared using Log-Rank and Wilcoxon tests (ChiSquare and p-values). Analysis was performed using GraphPad

Prism statistical software.

Strain 1

Strain 2

ChiSquare Log Rank Wilcoxon

p-value Log Rank Wilcoxon

V583wt

V583∆fsrB

112,5

83,09

<0,0001

<0,0001

V583∆fsrB∆gelE∆sprE

272,0 237,9 <0,0001 <0,0001

V583∆gelE 41.32 25.85 <0,0001 <0,0001 V583∆sprE 162.9 136.1 <0,0001 <0,0001 V583∆gelE∆sprE 286.4 252.0 <0,0001 <0,0001

V583∆lytRS V583∆lrgAB

0.389 120.1

0.013 107.7

ns

<0,0001

ns

<0,0001

V583∆fsrB V583∆gelE

V583∆sprE

V583∆gelE∆sprE


24.38

0,2742

36.26

28.73

19.12

1.163

39.45

32.80

<0,0001

ns

<0,0001

<0,0001

<0,0001

ns

<0,0001

<0,0001

V583∆gelE

V583∆sprE V583∆gelE∆sprE V583∆fsrB∆gelE∆sprE

40.56 128.5

120.1

39.85 126.5

119.5

<0,0001 <0,0001

<0,0001

<0,0001 <0,0001

<0,0001

V583∆sprE

V583∆gelE∆sprE V583∆fsrB∆gelE∆sprE

38.30

31.46

36.28

31.10

<0,0001

<0,0001

<0,0001

<0,0001

V583∆gelE∆sprE

V583∆fsrB∆gelE∆sprE 0,6964 0,5534 ns ns

V583∆lytRS V583∆lrgAB

95.58 95.15 <0,0001 <0,0001

V583∆ABC V583∆ABC∆ef1097 30.00 32.61 <0,0001 <0,0001

Chapter IV

138

Table S3 – Similarity (%) between E. faecalis V583 proteins (found to have their genes differentially expressed in the microarray

experiments) and sequenced genomes from Pubmed and Enterococcus group Sequencing Project, Broad Institute of Harvard and MIT

(http://www.broadinstitute.org/). Grey shade represents absence of gene coding for the protein.

Fsr-dependent proteins Fsr proteins

Genomes EF0411 EF0412 EF0413 EF1097 EF1351 EF1352 EF3193 EF3194 EF1817 EF1818 EF1820 EF1821 EF1822

E. faecalis

OG1RF 99 99 99 99 99 99 99 99 98 99 99 99 99

dg1 98 98 97 98 98 99 98 100 98 98 98 97 99

atcc_4200 98 98 97 98 98 99 98 99 98 98 98

ch188_1 98 98 97 98 100 99 99 99 98 98 98 98 98

d6_1 98 98 96 98 100 99 98 99

ds5 98 98 98 98 100 99 98 99

e1sol_1 98 98 97 97 97 99 97 99 98 98 98 97 99

fly1_1 98 98 97 97 97 99 98 99 98 97 98 97 99

hip11704_1 98 98 98 98 100 99 98 99 98 98 98

jh1_1 98 98 98 98 100 99 98 99 98 97 98 97 98

merz96_1 98 98 97 97 98 99 98 98 100 99 98 97 100

t11_1 99 97 98 98 100 100 98 99 99 98 98 97 99

t1_1 98 98 98 98 98 99 98 99 98 98 98 97 99


139

t2_1 98 97 98 98 100 99 98 98 98 98 98

t3_1 98 98 98 98 100 99 98 99 99 98 98 97 99

t8_1 98 98 98 98 97 99 98 99 98 98 98

x98_1 98 98 98 98 98 99 98 99 98 98 98 97 98

62 99 99 99 99 100 99 99 99 99 99 99

E. faecium

1,141,733_1 80 81

1,230,933_1 79 82 81

1,231,408_1 79 82 81

1,231,410_1 79 82 81

1,231,501_1 79 82 79

1,231,502_1 79 82 81

com12_1 80 81

com15 79 81

E. gallinarum_eg2_1

80 79 81 78

E. Casseliflavus_ec30_1

80 83 86 80

Chapter IV

140

FSR SYSTEM AND DROSOPHILA:

The collapse of the immune system


Contribution of melanization to Drosophila survival changes with E. faecalis V583 genomic content

Neuza Teixeira, António Jacinto and Maria de Fátima Silva Lopes,

In preparation.

CONTENTS 1. SUMMARY ......................................................................................................... 145

2. INTRODUCTION ................................................................................................. 146

3. MATERIAL AND METHODS ............................................................................... 149

3.1 Bacterial Strains ........................................................................................... 149

3.2 RNA extraction and Real-Time PCR for AMP expression ............................ 149

3.3 Drosophila Infection ...................................................................................... 150

3.4 Drosophila Melanization Assay .................................................................... 151

3.5 Statistical Analysis ........................................................................................ 151

4. RESULTS ............................................................................................................ 152

4.1 Drosomycin expression is similar during Drosophila infection with either V583

or V583ΔfsrBΔgelEΔsprE strains ....................................................................... 152

4.2 E. faecalis Fsr, GelE and SprE do not interfere with Drosophila phagocytosis

........................................................................................................................... 153

4.3 Fsr-GelE-SprE leads to increased melanization ........................................... 155

5. DISCUSSION ...................................................................................................... 159

6. ACKNOWLEDGEMENTS ................................................................................... 162

7. BIBLIOGRAPHY ................................................................................................. 163

The author of this thesis performed all the experimental work. Neuza Teixeira also

participated in the experimental design, data analysis and manuscript preparation.

FSR System and Drosophila: The collapse of the immune system

145

Cha

pter

V

1. SUMMARY

Enterococcus faecalis is a human opportunist pathogen able to infect Drosophila,

leading to its death within 24 hours. Previous studies proved that E. faecalis carrying

the Fsr quorum sensing system are extremely virulent. Fsr is the regulator of two

important virulence factors, gelatinase and serine protease, which cause death of

Drosophila adult flies by decreasing its tolerance to infection. The exact mechanism

underlying the toxicity of these E. faecalis virulence factors is nevertheless not

known, in particular the way they interfere with the host immune response. In the

present study, we investigated the influence of Fsr-GelE-SprE bacterial factors on

different immunity responses, namely antimicrobial peptide production, phagocytosis

and melanization. Using E. faecalis V583 wild type and E. faecalis V583

ΔfsrBΔgelEΔsprE mutant we showed that both drosomycin production and

phagocytosis were activated to similar levels by the two bacterial strains. However,

fly pupae infected with the mutant strain showed less melanization and higher

survival rates when compared to pupae infected with wild type bacteria. Moreover,

Drosophila mutants in the melanization pathway infected with the mutant bacteria

showed substantially increased survival rates (80%) compared to Drosophila infected

with wild type bacteria (20%). These results suggest that the bacterial factors studied

contribute to fly death by interfering with the melanization pathway.

As melanization is involved both in resistance and tolerance to infections, this study

thus provides new insights into the mechanisms whereby the Fsr system and the

proteases it regulates in E. faecalis contribute to disease and death of the host.

Chapter V

146

2. INTRODUCTION

In order to cause disease and death, pathogens must overcome the host´s immune

defenses. Understanding how the host immune defense mechanisms react to

pathogens and how pathogens inflict disease on the host can therefore provide us

with clues to fight those more efficiently. Among the most challenging pathogens are

the opportunistic ones, namely Enterococcus faecalis, which are commensal to

humans but can cause disease in patients with impaired immune systems.

Enterococci are natural inhabitants of the oral cavity, intestinal tract and female

genital tract of both human and animals. In contrast to the beneficial role they play in

intestinal homeostasis, these organisms are becoming increasingly important to

human health as leading causes of nosocomial infections. They are prevalent in the

nosocomial environment, causing infections of the urinary tract, bloodstream, intra-

abdominal and pelvic regions, surgical sites and central nervous system (Gilmore,

2002). To do so, they rely on several mechanisms including the fsr operon in the

case of E. faecalis. The fsr (Enterococcus faecalis regulator) two component system,

a homologue of the agr system in Staphylococcus aureus, is a quorum sensing-

dependent regulatory system that regulates the expression of two other important

virulence factors, gelE and sprE. These genes encode, respectively, gelatinase

(GelE), an extracellular zinc metalloprotease, and SprE, a serine protease

(Nakayama et al., 2001; Nakayama et al., 2002; Qin et al., 2000).

Recently, our Lab provided evidence for their role, and also for Fsr function, in

Drosophila melanogaster mortality (Teixeira et al., 2013). D. melanogaster (fruit fly) is

a powerful model organism to understand both the molecular mechanisms regulating

the activation of innate immune response and to screen for bacterial effectors

involved in virulence (Lemaitre & Hoffmann, 2007). The fruit fly has a multilayered

immune system consisting of at least seven defensive mechanisms: regulation of the

native microbiota in the gut through antimicrobial peptides (AMPs) and reactive

oxygen species; the barrier epithelial response, which recognizes infections and

wounds, produces local AMPs and sends signals to the rest of the body; the clotting


147

Cha

pter

V

response, which not only seals wounds and prevents bleeding, but can physically

trap bacteria; the phenoloxidase response, which deposits melanin at the site of an

immune reaction, releasing potentially antimicrobial reactive oxygen species; the

phagocytic response, through which phagocytes can kill microbes directly by either

encapsulation or phagocytosis, or indirectly by releasing systemic signals; the

systemic AMP response, which involves the release of massive quantities of AMPs

from the fat body (the liver analog) into the circulation (Meister et al., 1997); and the

RNAi response, which is required to fight viral infections.

The expression of AMPs, regulated by the Toll and Imd pathways (Dionne &

Schneider, 2008), can take a few hours to a few days to occur. In contrast, a more

immediate immune response, induced within a few minutes after infection, is

melanization (Tang, 2009). This is considered to be the earliest and most acute

reaction of insects against pathogens upon injury (Tang, 2009) and is used to

encapsulate and sequester pathogens too large to be phagocytized (Kounatidis &

Ligoxygakis, 2012). During melanization reaction, phenols are oxidized to

quinolones, which then polymerize to form melanin that is deposited around intruding

microorganisms to help sequester them at the wound site. The quinolone substances

and other reactive oxygen intermediates are thought to be directly toxic to

microorganisms. Melanin synthesis is the final product of the proteolytic cascade

leading to the cleavage of prophenoloxidase (proPO) to phenoloxidase (PO).

We have shown that the E. faecalis virulence factors Fsr, GelE and SprE are

necessary to cause Drosophila mortality upon infection (Teixeira et al., 2013).

However, it remains unclear how these factors control this process. In the present

study we asked how different aspects of the immune response in Drosophila were

affected upon infection with E. faecalis and how that depends on the Fsr, GelE and

SprE machinery. We found that important resistance mechanisms, such as

drosomycin expression and phagocytosis, were not altered in the absence of Fsr and

the proteases. In contrast, the melanization response was severely affected in flies

infected with wild type but not with Fsr mutant bacteria. Furthermore, we show that

the impairment in the melanization reaction seems to be a critical event for the death

Chapter V

148

of infected flies, leading us to propose this pathway as one of the key targets of the

Fsr system.


149

Cha

pter

V


3.1 Bacterial Strains

Strains used in this study are listed in Table 1. Enterococcal strains were grown in

BHI (Brain Heart Infusion) medium at 37ºC, and Micrococcus luteus strain was grown

in LB medium at 37ºC with agitation.

Table 1 – Bacterial strains and primers used in this study.

Strains Relevant Characteristics References

E. faecalis V583 Clinical Isolate, TIGR sequenced strain;

VaR

(Sahm et al., 1989)

MG03 E. faecalis V583ΔfsrBΔgelEΔsprE;

GelE-, SprE-, GBAP-

(Teixeira et al., 2013)

Micrococcus luteus Gram positive bacteria (#)

Primers for RT-PCR Sequence (5´-3´)

Drosomycin R TCCCAGGACCACCAGCAT (Pili-Floury et al., 2004)

Drosomycin F CGTGAGAACCTTTTCCAATATGATG (Pili-Floury et al., 2004)

Ribosomal protein 49 F GACGCTTCAAGGGACAGTATCTG (Pili-Floury et al., 2004)

Ribosomal protein 49 R AAACGCGGTTCTGCATGAG (Pili-Floury et al., 2004)

(#) strain provided by Luís Teixeira laboratory, IGC.

3.2 RNA extraction and Real-Time PCR for AMP expression

E. faecalis and M. luteus strains were grown in BHI and LB, at 37ºC, until OD

(600nm) 0,02. The bacterial strains were injected into W1118 flies. At 6h and 24h after

W1118 flies infections 10 flies were collected and homogenized to proceed to RNA

extraction. Total RNA extraction was prepared using a TRIzol (Life Technologies)

extraction protocol and purified with RNA Clean-up & Concentration from Zymo

Research Company. SYBR Green quantitative real-time PCR analysis was

performed using 1st Strand cDNA Synthesis kit RT-PCR (AMV) and LightCycler® 96

System from Roche Company. The primers used are listed in Table 1. The amount of

mRNA detected was normalized to control rp49 mRNA values. Normalized data were

used to quantify the relative levels of a given mRNA according to cycling threshold

Chapter V

150

analysis (ΔCt). Relative ΔCt gene/ΔCt rp49 ratios of unchallenged wild-type controls

were anchored in 1 to indicate fold induction. Graphs represent the mean and SD of

relative ratios detected in 3 independent biological repetitions.

3.3 Drosophila Infection

Drosophila male flies (Table 2) were injected with 50 nl of bacteria at OD (600 nm)

0.02 from one of the strains: V583, V583ΔfsrBΔgelEΔsprE and M. luteus. As control,

flies were injected with the same volume of BHI medium. Male flies were

anesthetized with CO2 and injections were carried out with a pulled glass capillary

needle using a nano-injector (Nanoliter 2000, World Precision Instruments).

Reproducibility was measured by determining the number of bacteria injected at time

zero. Injected flies were placed at 29ºC, 65% humidity. 75 flies were assayed for

each survival curve, and they were placed in three vials of 25 flies each. Each

experiment was repeated three times, making a total of 75 flies tested per strain in

each set of three replicates, to ensure high confidence results. Death was recorded

at 0, 4, 6, 8, 10, 12, and 24 h hours post-injection. All experiments were performed at

least three times. Following challenge with bacteria, six individual flies were collected

(at 0 h, 6 h, 12 h and 24 h), homogenized, diluted serially, and plated onto

Enterococcel agar (Quilaban). E. faecalis CFUs (colony forming units) were

determined by testing three groups of six flies for each time point.

Table 2 – Flies used in this study.

Fly’s Relevant Characteristics

W1118 Wild type fly

W1118PPO1ΔPPO2Δ Flies without PPO1 and PPO2 (*)

W1118HmlΔ>GFP/UAS W1118 flies with hemocytes labeled with GFP

W1118HmlΔ>GFP/UAS-Bax W1118 flies without hemocytes

(*)Drosophila line provided by Bruno Lemaitre.


151

Cha

pter

V

3.4 Drosophila Melanization Assay

Drosophila W1118, in pre-pupa stage, was injected with 50 nl of bacteria at OD (600

nm) 0.02 from one of the strains: V583, V583ΔfsrBΔgelEΔsprE and M. luteus. As

control, flies were injected with the same volume of BHI medium. Injections were

carried out with a pulled glass capillary needle using a nano-injector (Nanoliter 2000,

World Precision Instruments). The melanization process was recorded at 0, 6, 24

and 48 h hour’s post-injection using the stereoscope Zeiss Lumar V12. All

experiments were performed at least three times.

3.5 Statistical Analysis

Statistical analysis of Drosophila survival was performed using GraphPad Prism

software version 5.03. Survival curves were compared using Log-rank and Gehan-

Breslow-Wilcoxon tests. Statistical analysis of Drosophila survival was performed

using Student's t-test.

Chapter V

152

4. RESULTS

In order to understand the mechanisms by which the Fsr-GelE-SprE factors in E.

faecalis induce fast death of Drosophila upon infection, we tested whether known

innate immune system pathways are differentially regulated in two E. faecalis strains,

V583 (wild type) and its isogenic mutant devoid of fsr, gelE and sprE genes.

4.1 Drosomycin expression is similar during Drosophila infection with either

V583 or V583ΔfsrBΔgelEΔsprE strains

It is known that Gram positive bacteria activate the Toll pathway and that Drosomycin

is one of the AMPs produced to kill this group of bacteria (Lemaitre & Hoffmann,

2007). One way bacteria use to hamper the immune system of the host is by

inhibiting these peptides. Indeed, Park et al demonstrated that gelatinase from E.

faecalis is able to degrade Gm cecropin, an inducible AMP in the insect Galleria

mellonela (Park et al., 2007). We were therefore interested to know whether the

presence of Fsr-GelE-SprE influenced the expression levels of AMPs. For that we

measured the expression of Drosomycin by qRT-PCR at 6h and 24h post-infection in

both V583 and V583ΔfsrBΔgelEΔsprE strains and in the control strain M. luteus.

Interestingly, we found that all strains induced Drosomycin expression to similar

levels in both time points analyzed, over the period of 24h (Figure 1). These results

suggest that the E. faecalis virulence factors tested do not regulate AMP production

in Drosophila.


153

Cha

pter

V

Figure 1- Drosomycin relative expression (scale log10) measured by qRT-PCR. W1118 flies (wild type)

were challenged with septic injury with Gram positive bacteria: M. luteus (black), E. faecalis V583 (white) and E.

faecalis V583ΔfsrBΔgelEΔsprE (grey). Total RNAs were extracted at 6h and 24h post-infection. Results were

normalized to rp49 expression levels. M. luteus was used as a positive control of drosomycin expression and of the

Toll pathway activation. Normalized data were used to quantify the relative levels of a drosomycin according to

cycling threshold analysis (ΔCt).

4.2 E. faecalis Fsr, GelE and SprE do not interfere with Drosophila

phagocytosis

Phagocytosis is an important defense mechanism that has been conserved during

evolution. In Drosophila the circulating phagocytic cells are the plasmocytes, which

are part of the innate immune system. This complex cellular process is initiated by

the recognition of the particles or pathogens to be ingested, followed by cytoskeletal

remodeling and signaling events leading to their engulfment and destruction (Ulvila et

al., 2011). It is known that E. faecalis can survive for a prolonged period in mouse

peritoneal, human and zebrafish macrophages after being phagocyted (Gentry-

Weeks et al., 2003; Prajsnar et al., 2013; Sussmuth et al., 2000). To investigate

whether E. faecalis Fsr-GelE-SprE perturb phagocytosis in the fruit fly, we used a

1

10

6h 24h

Drosomycin

Realtive

Expression

log 1

0

hours after infection

M.luteus

V583


Chapter V

154

Drosophila line genetically modified to lack all hemocytes (W1118HmlΔ>GFP/UAS-

Bax). We found that flies without hemocytes (HmlΔ>GFP/UAS-Bax) show only

slightly increased survival rates upon infection with V583 when compared with

control flies (W1118HmlΔ>GFP/UAS) (Figure 2A). The same was observed when the

two Drosophila lines were infected with the E. faecalis mutant strain

V583ΔfsrBΔgelEΔsprE (Figure 2B). The flies died at the same rate with or without

hemocytes and regardless of the presence of the E. faecalis virulence factors

studied. These data suggest that the role of the E. faecalis virulence factors tested in

host death does not seem to occur through changes in phagocytosis by the

hemocytes.

Figure 2 – Survival curves of

Drosophila, with and without

phagocytes, infected with E.

faecalis V583 and

V583ΔfsrBΔgelEΔsprE.

(A) W1118HmlΔ>GFP/UAS-Bax survival

to septic injury with V583.

(B) W1118HmlΔ>GFP/UAS-Bax survival

to septic injury with

V583ΔfsrBΔgelEΔsprE. As a control

Drosophila W1118HmlΔ>GFP/UAS flies

were used. For each survival curve, 75

male adult flies, raised at 25ºC, were

divided in tubes 25 flies each, and

infected, by septic injury onto the thorax

with a thin needle. Data are

representative of three independent

experiments (making a total of 75 flies

tested per strain). Statistical analysis

was performed using GraphPad Prism

software version 5.03. Survival curves

were compared using Log-rank and

Gehan-Breslow-Wilcoxon tests and they

were not statistically different.


155

Cha

pter

V

4.3 Fsr-GelE-SprE leads to increased melanization

One of the key immune reactions in Drosophila is the activation of tyrosinase-type

phenoloxidases (POs), which catalyze several reactions leading to the crosslinking of

proteins, the production of reactive intermediates with potential cytotoxic activity and

ultimately to the production of melanin (Bidla et al., 2009). Melanization is the earliest

reaction against the evasion of pathogen and it is visible by the blackening of wound

site. To determine if melanization is affected by the presence of Fsr-GelE-SprE in

infecting E. faecalis, we injected wild type pre-pupae, a stage that allows the easy

detection of melanized dark spots, with E. faecalis V583 and E. faecalis

V583ΔfsrBΔgelEΔsprE strains. At 6h post-infection, melanized spots are only around

the site of injection in all strains analyzed (Figure 3).

Figure 3 – Melanization in wild type fly pre-pupae after infection. W1118 pre-pupae were infected by

septic injury with 50nl of M. luteus at 0, 02 OD; V583 and V583ΔfsrBΔgelEΔsprE at 0, 02 OD, and placed at 29ºC.

Injection with BHI medium and M. luteus are controls of this experiment. Pictures were taken with stereoscope Zeiss

Lumar V12 at 0h, 6h, 24h and 48h post-infection. This procedure was made at least in 10 pre-pupae and the results

were always the same. After 24h hours an exacerbated melanization in the pre-pupae infected with V583 was

observed. All the other pre-pupae had only the normal black dots around the injection site (indicated with an arrow).

Chapter V

156

After 24h it is clear that the pre-pupae infected with V583 strain have an exacerbated

melanization, which is observed all over the body. In pre-pupae infected with E.

faecalis triple mutant, however, melanization remains restricted to the wound site,

similar to pre-pupae infected with the M. luteus control strain. Moreover, pre-pupae

infected with wild type bacteria were dead after 24h whereas those infected with the

mutant bacteria were still alive after 48h. These results indicate that the presence of

the Fsr-GelE-SprE E. faecalis virulence factors interferes with the melanization

process during infection through which it contributes to host death.

We thus asked if the excessive melanization was responsible for the fast and

massive death of the infected hosts. To answer this, we infected flies mutant for two

prophenoloxidases (PPO1 and PPO2), which makes them unable to produce

melanin (Tang, 2009). Figure 4 shows the survival rates of W1118PPO1ΔPPO2Δ

mutant and wild type flies infected with V583 and mutant strains. When we compare

PPO mutant and control flies infected with the same wild type bacteria, survival rates

are similar. However, they have different shapes: while control flies die massively

only after 12h of infection, PPO mutant flies steadily die during the time course of the

assay (Figure 4A). Although the overall bacterial growth inside the two flies was

similar after 24h, V583 grew faster in the PPO mutant flies (Figure 5). This result

suggests that melanization may not play a role as a resistance mechanism against E.

faecalis. It also means that, in flies unable to perform the melanization reaction, and

during the first 12 hours of infection a lower number of V583 cells can cause a higher

host death rate, i.e., PPO mutants show decreased tolerance to E. faecalis. The two

bacterial proteases present in V583, GelE and SprE, are able to degrade host

structural proteins, thus causing tissue damage, which must be healed in order for

the fly to maintain its healthy status. In the absence of melanization, which

contributes to tissue healing, it is possible that the flies tolerate less the presence of

V583 carrying Fsr-GelE-SprE factors.


157

Cha

pter

V

Figure 4 –Survival curves of

Drosophila with and without

melanization. (A) W1118 and

W1118PPO1ΔPPO2Δ survival to septic

injury with V583 strain (B) W1118 and

W1118PPO1ΔPPO2Δ survival to septic

injury with V583ΔfsrBΔgelEΔsprE. For

each survival curve, 75 male adult

flies, raised at 25ºC, were divided in

tubes 25 flies each, and infected by

septic injury onto the thorax with a thin

needle. Data are representative of

three independent experiments

(making a total of 75 flies tested per

strain). Drosophila survival was

performed using GraphPad Prism

software version 5.03. For statistical

analysis was used Student's t-test.

Asterisks (*) indicate the level of

statistical significance (*p < 0.05; **p <

0.005).

When we compare the survival rates of PPO mutant and control flies infected with

the mutant bacteria major differences were observed. 24 hours after infection, 80%

of the W1118PPO1ΔPPO2Δ mutant flies infected with V583ΔfsrBΔgelEΔsprE triple

mutant were still alive (Figure 4B). In contrast, all wild type flies were dead when

infected with the wild type bacteria (Figure 4A).

* *

**

* *

Chapter V

158

Figure 5 - E. faecalis

growth curves in injected

flies. A – E. faecalis V583

growth rates in injected fly W1118

and W1118PPO1ΔPPO2Δ. B- E.

faecalis V583ΔfsrBΔgelEΔsprE

growth rates in injected fly W1118

and W1118PPO1ΔPPO2Δ Male

adult flies (5- to 7-day-old),

raised at 25°C, were divided in

tubes of 25 flies each, and

infected, by septic injury onto the

thorax with a thin needle, with

V583 strains. Flies were

collected at 0, 6, 12, and 24 h.

Three groups of six flies for each

time point were homogenized

and plated in Enterococcel agar

and E. faecalis CFUs were

determined. Student's t-test was

used for statistical analysis.

Asterisks (*) indicate the

statistical significance (*p < 0.05;

**p < 0.005).

These results clearly indicate that when both melanization and Fsr-GelE-SprE are

absent almost all flies survive infection and further support the hypothesis of

extensive melanization as the cause of intensive fly death. Moreover, these results

reveal that Fsr-GelE-SprE virulence factors kill the flies indirectly through increasing

melanization over the fly body.

1,00E+00

1,00E+01

1,00E+02

1,00E+03

1,00E+04

1,00E+05

1,00E+06

1,00E+07

1,00E+08

0 10 20 30

log10 CFU

s

Time after infection (hours)

B

1,00E+00

1,00E+01

1,00E+02

1,00E+03

1,00E+04

1,00E+05

1,00E+06

1,00E+07

1,00E+08

0 10 20 30

log10 CFU

s

Time after infection (hours)

A

PPO mutant

W118 wild type

W1118 W1118PPO1ΔPPO2Δ * *


159

Cha

pter

V

5. DISCUSSION

The fly mechanisms responsible for protection against bacterial infections are not

clearly understood yet. Drosophila has four distinct pathways implicated in regulation

of genes induced upon septic injury, namely Toll, Imd, JNK and JAK-STAT (Brun et

al., 2006). Previous studies have shown that E. faecalis induces both cellular and

humoral immune response mechanisms in Drosophila. Toll seems to be the crucial

pathway in the defense against E. faecalis (Nehme et al., 2011): whereas Toll

pathway mutants are susceptible to E. faecalis, Imd mutants are not (Brun et al.,

2006). The Toll pathway is responsible for production of several AMPs: diptericin,

cecropin, drosocin and attacin are active against Gram-negative bacteria and

drosomycin, metchnikowin and defensin to fungi and Gram-positive bacteria. Except

for defensin, E. faecalis is resistant to the bactericidal activity of all AMPs produced

by Drosophila, and even from G. mellonella (Smeianov et al., 2000). It is thus not

clear how the Toll pathway confers protection against Gram-positive bacteria, as it is

known that defensin is not necessary to mediate protection (Nehme et al., 2011).

Previous in vitro studies showing that the proteases GelE and/or SprE may degrade

insect AMPs, have led researchers suggest that E. faecalis success in insect species

could be attributed to the degradation of the host innate immune AMPs by the

proteases. However, in a previous study, our findings suggest otherwise (Teixeira et

al., 2013). In fact, as we observed no difference in growth inside the host between

any of the mutants and wild type V583, we conclude that neither the Fsr system nor

the proteases it controls affect bactericidal action by the fly. This implies that none of

the proteases provides self-protection against any AMP in the fly immune system

(Teixeira et al., 2013). In the present study we showed that the presence of Fsr-

GelE-SprE does not affect the levels of drosomycin expression, further supporting

the likely irrelevant role of Drosophila AMPs on E. faecalis infection progression.

However, this does not exclude the possibility that the presence of these proteases

in high amounts may turn the host more fragile to other bacteria due to AMPs

degradation. In fact, previous work has shown that GelE is able to degrade host

Chapter V

160

AMP´s and that this is responsible for insects getting less able to deal with

Escherichia coli strains (Park et al., 2007).

The way the fly is able to fight invading microorganisms also includes a cellular

immune response that can result in the phagocytosis of relatively small organisms

like bacteria or the encapsulation of larger parasites (Khush & Lemaitre, 2000).

However, little is known about how Drosophila phagocytes affect the course of

infections (Brandt et al., 2004). On the other hand, bacteria that are specialized in

growing inside phagocytes have developed ways to fight these cells from within.

Moreover, previous studies have demonstrated that the pathogenesis mechanisms

developed by Mycobacterium marinum and Listeria monocytogenes to fight

vertebrate phagocytes also function in the fly (Dionne et al., 2003; Mansfield et al.,

2003). In the case of extracellular pathogens, such as E. faecalis, it is known that

these bacteria are able to stand macrophages defense mechanisms for hours and

days (Gentry-Weeks et al., 1999). Although some E. faecalis defense mechanisms

have been implicated in its prolonged life inside macrophages (Abrantes et al., 2013;

Verneuil et al., 2005; Waters & Dunny, 2001), neither Fsr nor the two proteases it

regulates seem to play a role in bacterial survival inside these defensive cells.

Recently, macrophages in zebrafish were shown to phagocytize bacteria in blood

circulation being only able to engulf surface-associated microbes (Prajsnar et al.,

2013). It is also known that homolog of tumor necrosis factor (TNF) encoded by eiger

is required for innate immune responses that are effective at fighting extracellular

pathogens but are wasteful or simply ineffective when fighting intracellular pathogens

(Schneider et al., 2007). In our model, despite being phagocytized by Drosophila

hemocytes (results not shown), neither Fsr nor GelE or SprE were found to affect the

cellular immune response of Drosophila.

Melanization is another Drosophila immune response. It is visible by the blackening

of a wound site or the surface of pathogens, which results from the synthesis and

deposition of melanin. In addition to being important for wound healing, melanin can

encapsulate and sequester pathogens, and the reaction intermediates appear to be

directly toxic to microbes as well (Tang et al., 2006). Here, we evaluated/investigated


161

Cha

pter

V

the effect of Fsr-GelE-SprE presence in melanization in pre-pupa infected with either

V83 or V583ΔfsrBΔgelEΔsprE strains. Pre-pupa infected with the mutant strain not

only survived longer but also showed normal melanization around the injection site,

suggesting an association between the extent of melanization and death and the

presence of the proteases and the Fsr. This was confirmed by measuring survival

rates of Drosophila without PPO1 and PPO2, two prophenoloxidases important for

the melanization reaction. After 24h, flies without PPOs and infected with

V583ΔfsrBΔgelEΔsprE showed 80% higher survival providing evidence that Fsr-

GelE-SprE decrease Drosophila tolerance to E. faecalis infection through

melanization and promoting the fly death. It is known the melanization reaction

produces toxic intermediates, namely reactive oxygen species that can kill the host

(Tang, 2009). If uncontrolled melanization occurs an overproduction of these toxic

intermediates can cause collateral damage in the host (Ayres & Schneider, 2012).

Our result leads us to hypothesize that Fsr-GelE-SprE interfere with melanization,

possibly by activating the proteolytic cascade responsible for the tight control of this

pathway. Host death by exacerbated immune response to infections has also been

observed for other bacteria. For example, after Drosophila infection with Salmonella

typhimurium bacterial secreted effectors cause an immune response that is

damaging both to the bacteria and to the host (Brandt et al., 2004).

In summary, the present study reveals that E. faecalis Fsr system does not interfere

with AMP expression or phagocytosis but leads to excessive melanization. Our

results constitute an important step towards the discovery of the Fsr role during E.

faecalis infection. Further studies should determine which step(s) of the melanization

cascade is/are affected by the Fsr-proteases.

Chapter V

162

6. ACKNOWLEDGEMENTS

The authors are grateful to Bruno Lemaitre from Global Health Institute, School of

Life Sciences, École Polytechnique Fédérale Lausanne (EPFL) - Switzerland for the

W1118PPO1ΔPPO2Δ Drosophila lines; and to Luis Teixeira, from Instituto Gulbenkian

de Ciência, for the M. luteus strain.

We are also grateful to Anabela Bensimon-Brito for the technical support in qRT-

PCR experiment, to Carolina Moreira and Ana Sofia Brandão for the technical

support in Drosophila phagocytosis experiments and Lara Carvalho for the

comments and revision of this paper.


163

Cha

pter

V

7. BIBLIOGRAPHY

Abrantes, M. C., Kok, J. & Lopes Mde, F. (2013). EfaR is a major regulator of

Enterococcus faecalis manganese transporters and influences processes involved in

host colonization and infection. Infect Immun 81, 935-944.

Ayres, J. S. & Schneider, D. S. (2012). Tolerance of infections. Annu Rev Immunol

30, 271-294.

Bidla, G., Hauling, T., Dushay, M. S. & Theopold, U. (2009). Activation of insect

phenoloxidase after injury: endogenous versus foreign elicitors. J Innate Immun 1,

301-308.

Brandt, S. M., Dionne, M. S., Khush, R. S., Pham, L. N., Vigdal, T. J. &

Schneider, D. S. (2004). Secreted Bacterial Effectors and Host-Produced Eiger/TNF

Drive Death in aSalmonella-Infected Fruit Fly. PLoS Biol 2, e418.

Brun, S., Vidal, S., Spellman, P., Takahashi, K., Tricoire, H. & Lemaitre, B.

(2006). The MAPKKK Mekk1 regulates the expression of Turandot stress genes in

response to septic injury in Drosophila. Genes Cells 11, 397-407.

Dionne, M. S., Ghori, N. & Schneider, D. S. (2003). Drosophila melanogaster is a

genetically tractable model host for Mycobacterium marinum. Infect Immun 71, 3540-

3550.

Dionne, M. S. & Schneider, D. S. (2008). Models of infectious diseases in the fruit

fly Drosophila melanogaster. Disease models & mechanisms 1, 43-49.

Chapter V

164

Gentry-Weeks, C., Estay, M., Loui, C. & Baker, D. (2003). Intravenous mouse

infection model for studying the pathology of Enterococcus faecalis infections. Infect

Immun 71, 1434-1441.

Gentry-Weeks, C. R., Karkhoff-Schweizer, R., Pikis, A., Estay, M. & Keith, J. M.

(1999). Survival of Enterococcus faecalis in mouse peritoneal macrophages. Infect

Immun 67, 2160-2165.





for Microbiology.

Khush, R. S. & Lemaitre, B. (2000). Stop press: genes that fight infections: what the

drosophila genome says about animal immunity. Trends in genetics : TIG 16, 468.

Kounatidis, I. & Ligoxygakis, P. (2012). Drosophila as a model system to unravel

the layers of innate immunity to infection. Open Biol 2, 120075.



Mansfield, B. E., Dionne, M. S., Schneider, D. S. & Freitag, N. E. (2003).

Exploration of host-pathogen interactions using Listeria monocytogenes and

Drosophila melanogaster. Cell Microbiol 5, 901-911.

Meister, M., Lemaitre, B. & Hoffmann, J. A. (1997). Antimicrobial peptide defense

in Drosophila. Bioessays 19, 1019-1026.


165

Cha

pter

V


Nagasawa, H. (2001). Gelatinase biosynthesis-activating pheromone: a peptide


145-154.





Nehme, N. T., Quintin, J., Cho, J. H., Lee, J., Lafarge, M. C., Kocks, C. &

Ferrandon, D. (2011). Relative roles of the cellular and humoral responses in the

Drosophila host defense against three gram-positive bacterial infections. PLoS One

6, e14743.




Pili-Floury, S., Leulier, F., Takahashi, K., Saigo, K., Samain, E., Ueda, R. &

Lemaitre, B. (2004). In vivo RNA interference analysis reveals an unexpected role

for GNBP1 in the defense against Gram-positive bacterial infection in Drosophila

adults. J Biol Chem 279, 12848-12853.

Prajsnar, T. K., Renshaw, S. A., Ogryzko, N. V., Foster, S. J., Serror, P. &

Mesnage, S. (2013). Zebrafish as a novel vertebrate model to dissect enterococcal

pathogenesis. Infect Immun 81, 4271-4279.

Chapter V

166







Schneider, D. S., Ayres, J. S., Brandt, S. M. & other authors (2007). Drosophila

eiger mutants are sensitive to extracellular pathogens. PLoS Pathog 3, e41.

Smeianov, V., Scott, K. & Reid, G. (2000). Activity of cecropin P1 and FA-LL-37

against urogenital microflora. Microbes Infect 2, 773-777.

Sussmuth, S. D., Muscholl-Silberhorn, A., Wirth, R., Susa, M., Marre, R. &

Rozdzinski, E. (2000). Aggregation substance promotes adherence, phagocytosis,

and intracellular survival of Enterococcus faecalis within human macrophages and

suppresses respiratory burst. Infect Immun 68, 4900-4906.

Tang, H., Kambris, Z., Lemaitre, B. & Hashimoto, C. (2006). Two proteases

defining a melanization cascade in the immune system of Drosophila. J Biol Chem

281, 28097-28104.


Fly 3, 105-111.





167

Cha

pter

V

Ulvila, J., Vanha-Aho, L. M. & Ramet, M. (2011). Drosophila phagocytosis - still

many unknowns under the surface. APMIS : acta pathologica, microbiologica, et

immunologica Scandinavica 119, 651-662.

Verneuil, N., Rince, A., Sanguinetti, M., Auffray, Y., Hartke, A. & Giard, J. C.

(2005). Implication of hypR in the virulence and oxidative stress response of

Enterococcus faecalis. FEMS Microbiol Lett 252, 137-141.

Waters, C. M. & Dunny, G. M. (2001). Analysis of functional domains of the

Enterococcus faecalis pheromone-induced surface protein aggregation substance. J

Bacteriol 183, 5659-5667.

Chapter V

168

GENERAL DISCUSSION

CONTENTS


- Different environments lead to different ways to persist ................................ 173

2. FSR REGULON

- New genes and potential virulence factors ...................................................... 177


- Fsr system can be a future target for therapy .................................................. 184

4. BIBLYOGRAPHY ............................................................................................... 186

Chapter VI

172

GENERAL DISCUSSION

173

Cha

pter

VI

Among the complex molecular processes involved in the development of bacteria-

borne disease is Quorum sensing (QS), the way bacteria communicate and

coordinate collective behaviours. The study of how to inhibit QS may provide

important clues to create antibacterial pharmaceuticals.

Bacteria use QS to control a wide variety of processes, which include the

synchronized expression of genes involved in colonization, symbiosis and virulence

in host–bacterial infections. Activation of virulence genes at bacterial low population

density would result in the generation of host defence responses, thus providing the

host an early lead over the invading bacteria. A certain threshold of bacterial cell

density, and therefore autoinducer concentration, has to be accomplished in order for

the pathogen to overpower the host defence mechanisms hence, in order to

guarantee their survival and the synthesis of virulence factors until the success of the

infection process is guaranteed (Raina et al., 2009).


- Different environments lead to different ways to persist

In this thesis we presented two examples in which Fsr QS is silenced: by mutation in

the fsrC gene (chapter II); and by the presence of a therapeutic dose of vancomycin

(chapter III). Despite the difference between these studies they share a common

feature, the Fsr repression through the same target, the histidine kinase FsrC. In

both studies we associated the QS silencing with fitness cost of activating the Fsr.

When the conditions are not favourable for growth, E. faecalis reduces the energy

costs by shutting down the genes not relevant in that specific situation.

The phenotypes regulated by QS (for example, extracellular factors) are typically

relevant and beneficial only when expressed in a concerted manner by large

populations of cells (Chong et al., 2013). When in high concentrations the QS signal

producer cells are achieved, the QS activated genes are induced, and cells work in

Chapter VI

174

a cooperative way producing the “public goods” (factors that are beneficial for the

population). At low cell densities, the action of extracellular factors would be

relatively inefficient, since they would disperse away before they could be used. Cells

that produce extracellular factors can be exploited by ‘free-riders’ or cheaters, which

avoid the costs of producing QS-regulated factors themselves by benefiting from

those produced by others in order to grow and prevail (Rumbaugh et al., 2012)

(Figure 1).

The question then is, under which conditions cheating strains will increase to such an

extent that QS breaks down as a regulatory system of cooperative behaviour – with

the consequence that the cooperative behaviour itself cannot be maintained (Czaran

& Hoekstra, 2009). Our studies presented in chapters II and III provide two examples

of cheating. In both cases, E. faecalis silence the Fsr through the modification of

histidine kinase FsrC, but maintaining the virulence factors genes intact. This can be

related with the fact that the extracellular factors regulated by Fsr can produce some

benefit for the cell itself and the Fsr genes only provide benefit for cell-

communication/cooperation.

In Chapter III, we propose that the negative effect of vancomycin on Fsr induction

may function as a survival strategy that E. faecalis developed. By decreasing the

fitness cost of Fsr activation saves energy to be used in the vancomycin resistance

operon expression and activity. In VRE, it is known that vancomycin binds to

bacteria cell-wall and replaces the terminal D-Ala of peptidoglycan precursor with D-

Lac producing a high-level of resistance (Chapter I). The cell-wall modification by

vancomycin changes the levels of autolysis and consequently the cell-division and

growth (Bisicchia et al., 2011; Sieradzki & Tomasz, 1997). When vancomycin was

added to E. faecalis V583, cells entered rapidly into the stationary phase (Chapter

III). Recent publications indicates that autolysis is also correlated with proteases

GelE and SprE (Teixeira et al., 2013; Thomas et al., 2008).

GENERAL DISCUSSION

175

Cha

pter

VI

Figure 1 – E. faecalis QS model under changing environmental conditions. Among the population

able to sense the quorum signal, there are cells that participate in the cross-talk (the “talk” cells) and cells that

do not participate (the “silence” cells). The “talk” cells are cooperators that produce GBAP, sense the GBAP and

activate the QS. Through the QS activation “public goods” such as GelE and SprE are produced and promote host

damage. This cooperation is associated with fitness cost and it is depend of cell density. The “silence” cells are non-

cooperators, do not produce GBAP, do not sense GBAP and do not activate the QS. The cell cheaters use the

effects of the public goods (from the “talk” cells) in the host to grow and proliferate, overcoming/avoiding the fitness

cost. This phenomenon is called selfishness. The “talk” cells can develop to “silence” cells and vice versa under

environmental pressure.

Altogether, these results lead us to hypothesize that this peptidoglycan alteration

promotes a conformational change of the histidine kinase FsrC and, consequently,

fsr repression. Furthermore, the cell wall modification promotes the silencing of fsr

and decreased production of GelE and SprE, reducing cell autolysis and

consequently stopping growth (Figure 2).

Chapter VI

176

Figure 2 – Model for vancomycin effect on the Fsr system. A - Without stress. When E. faecalis cells

activate the fsr, FsrC senses the GBAP signal and, through the quorum sensing, the proteases are produced. GelE

and SprE are involved in autolysis regulation (Teixeira et al., 2013; Thomas et al., 2008). The cells divide normally. B

– Under vancomycin stress. Vancomycin modifies the cell wall and the FsrC cannot sense the GBAP signal.

Production of GelE and SprE is decreased, which has an impact on autolysis. The vancomycin also interferes with

autolysis (Bisicchia et al., 2011; Sieradzki & Tomasz, 1997). E. faecalis stop growth and cell division.

Opportunist bacteria such as E. faecalis have numerous ways to survive and persist

in the different environments and these two examples of QS silencing are an

evidence of this characteristic. These two studies are important to understand why

and when E. faecalis needs to becomes a cheater, activating/silencing the QS.

However, more studies are necessary to prove our hypothesis and reveal the relation

between vancomycin and the Fsr system.

GENERAL DISCUSSION

177

Cha

pter

VI

2. FSR REGULON

- New genes and potential virulence factors

The E. faecalis Fsr QS system is known to regulate the virulence factors GelE and

SprE and a putative bacteriocin EF1097. The expression of these three genes was

found to be exponentially increased by activation of the Fsr system by GBAP in two

genetically unrelated E. faecalis strains (Bourgogne et al., 2006; Teixeira et al.,

2013). The concomitant presence of these three genes with Fsr is 98% in the 18

sequenced enterococcal genomes (Teixeira et al., 2013). These observations

suggest a mechanistic association between the proteases and the bacteriocin that

needs clarification. EF1097 was found to be important during infection in Drosophila.

When ef1097 and the genes encoding the two proteases are expressed, as a

response to high cell density, they may be seen as public goods, expected to be

produced in a cooperative population for the benefit of the entire population. We

speculate that the putative bacteriocin can have some function helping the QS to be

more efficient in killing the non-cooperators. As already referred, public goods are

sent outside the cells. Among the genes found to be up-regulated by GBAP are

ef1351 and ef1352, which are in operon and encode a putative (Mg2+)-magnesium-

translocating P-type ATPase. Mg2+ is a modulator of virulence in many bacteria and

its concentration allows bacteria to sense their surroundings. EF1352 is orthologous

to mgtA gene from S. typhimurium, MgtA is a Mg2+ transporter that, together with

MgtB, pumps Mg2+ into the cell (Tao et al., 1995). It is possible that EF1351-EF1352,

that it is not exported from the cell, constitutes an immunity factor against self-

produced EF1097 (Figure 3). In fact, it is known that bacteriocins can affect

magnesium transport (Uratani & Hoshino, 1984). More studies are needed to

investigate this correlation.

We found twelve additional genes dependent on the presence of GBAP-induced

proteases. Among these genes, lrgAB were highly induced when both protease

genes were induced in response to the quorum-sensing molecule. lrgAB were found

to be under the control of the LytRS two-component system, similar to what has been

Chapter VI

178

described in S. aureus. In this bacterium, LytRS and Agr are two important players in

the tight regulation of cell autolysis; the first positively regulates the lrgAB expression

and the second reduces the rate of autolysis. In E. faecalis, GelE was found to

proteolitically activate AtlA autolysin (Thomas et al., 2009). Altogether, these

findings suggest that, in E. faecalis, LytRS through LrgAB, and Fsr, through GelE

and SprE, are also key players in autolysis regulation (Figure 3). lrgAB genes were

highly induced only when the protease genes were induced in response to GBAP.

Assuming that both play an opposite role in autolysis, it is possible that lrgAB were

induced to protect cells form huge production of the proteases. In addition, it is

possible that those additional genes induced indirectly by the QS activation of the Fsr

system are playing a role in preventing cell damage by self or by the neighbour cells.

Once new genes were found to be part of the Fsr regulon in V583 strain, their role in

the virulence of this strain was assessed. Different infection models have been used

to study E. faecalis virulence, but with some limitations. In our study, we used the

fruit fly Drosophila to test virulence of the Fsr system and the newly identified genes.

According to our in vivo tests, we can conclude that ef1097 and lrgAB are important

to E. faecalis virulence (Chapter IV), demonstrating that Fsr virulence is not only

through the proteases. We also observed that in the absence of Fsr, the fly´s

tolerance to E. faecalis increases and the flies have a higher survival rate.

GENERAL DISCUSSION

179

Cha

pter

VI

Figure 3 – New scheme of Fsr regulatory system and possible correlations. GBAP (orange disks)

concentration outside cells reaches a certain threshold, the Fsr system is activated, and the FsrA regulator induces

expression of gelE, sprE and ef1097 genes. The induced expression of ef1352 by GBAP is likely due to increased

amounts of EF1097. The increased level of GelE and SprE proteins in the cell-wall in response to GBAP are

proposed to induce changes sensed by LytS protein, which in turn, activates LytR, responsible for induction of lrgAB

genes.

Innate immunity in the fruit fly protects the organism from overwhelming infections in

a life rich in interactions with microorganisms. The signal transduction cascade

underlying this system is under intense investigation, as the immune system of

Drosophila revealed striking similarities to the mammalian innate immune

response(Lemaitre & Hoffmann, 2007). Here we showed that the presence of Fsr

system does not affect the expression of drosomycin or phagocytosis, two important

mechanisms in Drosophila defence. The interplay between the enterococcal

proteases and the host AMPs have been a subject of some studies recently. Despite

some reports suggesting that the proteases contribute to host death through AMP

degradation (Park et al., 2007), which implies decreased resistance, our findings do

not support this mechanism. Instead, our results suggest that decreased tolerance,

Chapter VI

180

rather than decreased resistance, leads to fly´s death by E. faecalis carrying Fsr and

the proteases. After 24h of infection with E. faecalis wild type or with Fsr mutants,

Drosophila had the same E. faecalis CFUs inside its body but presented different

survival rates. This result indicates that Fsr system influences the fly´s tolerance but

not its resistance to infection. Fly´s resistance/tolerance can also be altered by the

immune system as a way to survive to the pathogen. One obvious mechanism

affecting tolerance is the intensity of an immune response; an overly exuberant

immune response can cause collateral damage through immune effectors and

because of the energy allocated away from other physiological functions (Ayres &

Schneider, 2012). We thus investigated some of the immunity functions of Drosophila

by measuring the survival rates of flies without haemocytes and without melanization

during infection with V583wt and V583 ΔfsrBΔgelEΔsprE strains (chapter V). We

found that haemocytes are able to identify and phagocyte the bacteria, but ddo not

play a role in combating E. faecalis infection (Table 1 and Figure 4). From Table 1,

we also observed that flies without melanization and infected with E. faecalis without

Fsr system have a survival rate near to 100 % (Table 1).

Table 1 – Drosophila survival results 24h after E. faecalis infection. The survival (percentage) is

identified with: (+++) more than 80%; (+) less than 30% and (-) less than 5% (Data from chapter V).

E. faecalis V583

Drosophila lines Wild type ΔfsrBΔgelEΔsprE

Wild type W1118 + +

Without haemocytes (hmlΔ>bax) - +

Without melanization (PPO1PPO2) - + + +

From the results of table 1 and visual analysis, allow us to say that, in the presence

of Fsr and proteases, an uncontrolled melanization occurs forcing pupa death (dead

pupas were completely black). Activation of melanization is strictly regulated.

Uncontrolled melanization generates excessive toxic intermediates that can kill the

host (Tang, 2009). Recognition of pathogens and injury leads to the activation of a

GENERAL DISCUSSION

181

Cha

pter

VI

serine protease cascade that culminates in proteolytic cleavage of inactive PPO to

active PO. Serine protease inhibitors, called serpins, are responsible for keeping the

melanization strictly localized at the site of injury or infection (Tang, 2009). Some

specific pathogens have developed means to prevent PPO activation by producing

serpin-type inhibitors or other factors specifically interfering with proteolytic activation

of PPO or upstream components (Cerenius et al., 2008). We therefore hypothesized

that during E. faecalis infection; one of the factors regulated by Fsr inhibits the

serpins that control the melanization. In response to infection by injury, the fly

activates melanization and, with no control of melanization reaction, an excess of

melanin and toxic intermediates are produced, promoting host death. This hypothesis

would explain the high percentage of fly survival when flies without melanization are

infected with E. faecalis ΔfsrBΔgelEΔsprE. The reactive oxygen species (ROS)

generated during melanin production cause host damage and, in high concentration

the death of the host (Ayres & Schneider, 2012). ROS affect several biological

processes such as cellular signalling and aging, and play an important role in host

defence against invading microorganisms; however, an overproduction of ROS is

cytotoxic and carcinogenic (Strickertsson et al., 2013). Recent work in human cells

found that infection by E. faecalis induces an intracellular production of ROS

suggesting that E. faecalis is associated with gastric pathogenicity by promoting the

appearance of gastric cancer cells (Strickertsson et al., 2013). They propose a

common link in bacterial induced pathogenicity by which the infection stimulates a

general activation of pro-inflammatory cytokines and ROS by the cells themselves,

making the epithelial cells harmful to themselves (Strickertsson et al., 2013). In our

study we also suspect that E. faecalis infection block the melanization control,

promoting the ROS overproduction, cell damage and inevitable death.

GelE has an important role in the development of endocarditis (Singh et al., 2005).

We also suspect that during infection, the proteases GelE and SprE cause tissue

damage in Drosophila body. This would explain the reduced survival in V583wt

infected flies mutant for PPOs.

Chapter VI

182

Melanization is an important mechanism in insects and possibly in other

invertebrates (Cerenius et al., 2008). In humans melanization does not occur,

however PPO activation mediated by a serine protease cascade is somewhat

analogous to the coagulation pathway and complement system (CS) in human

plasma (Jiang et al., 2003). Like the melanization, the fast activation of the

complement system after a microorganism infection of a potential host is a crucial

step in clearance of many pathogens. For example, anaphylatoxins like C3a and

C5a, products of the CS cascade, are commonly involved in exacerbated

inflammatory reactions that can cause direct harm to the host following infections

(Garcia et al., 2013). We know that GelE destroys the C3a complement of human

cells and AMPs of G. mellonella (Park et al., 2007; Park et al., 2008). Taking into

account that the serine protease cascade during melanization is analogous to the

complement system, we hypothesize that in humans, Fsr regulated components

promote an exacerbated complement response. Future studies should investigate

this hypothesis.

The study presented in this thesis is important for the understanding the E. faecalis

Fsr system biology and how it interferes with Drosophila innate immune system. The

conservation between the innate immune system of humans and Drosophila, it will

allow us/future studies to develop new targets to control E. faecalis infections in

humans.

GENERAL DISCUSSION

183

Cha

pter

VI

Figure 4 – Drosophila Immune response upon infection with E. faecalis V583. When Drosophila is

infected by E. faecalis, three immune responses are activated: Phagocytosis (orange panel), the melanization (green

panel) and the Toll pathway (blue panel). Orange panel: After an E. faecalis V583 infection, the haemocytes (green)

capture the bacteria (blue dots in the picture) but do not kill the bacteria. Green panel: The melanization is the first

immune response activated when Drosophila is infected. Recognition of E. faecalis V583 triggers a serine protease

cascade that activates phenol oxidase (PPO), a key enzyme in the melanin biosynthetic pathway. During this

process reactive oxygen species (ROS) are produced which are toxic to the bacteria (pathogen killing) and, in

excess, to the host (wound healing and tissue damage). Serpin-type protease inhibitors are involved in the control of

this cascade. Our results suggest that the Fsr interferes with the control of melanization and promotes an excess of

ROS and consequent death. Blue panel: Drosomycin is an AMP produced when Drosophila is infected by Gram

positive bacteria, such as E. faecalis. Toll pathway is activated and drosomycin is produced by the fatbody. It is

known that melanization and production of drosomycin are connected (Tang, 2009).

Chapter VI

184


- Fsr system can be a future target for therapy

The QS system allows bacteria to produce, detect, and exchange signalling

molecules. This process is crucial to disease development because it ultimately

controls the way that bacteria express “virulence factors” — the molecules that

enable the bacteria to colonize, evade and compromise the host's immune response,

exit and enter cells, and obtain nutrients. Activation of virulence genes at low

population density would result in the generation of host defence responses, thus

providing the host an early lead over the invading bacteria. Therefore, in order to

guarantee their survival, bacteria synthesized virulence factors until their number

make certain their success in the infection process. The discovery of new therapeutic

approaches to target bacterial virulence is essential, owing to the increasing

emergence of bacterial strains that are acquiring resistance to antibiotics (Defoirdt et

al., 2013; Raina et al., 2009).

Blocking the Fsr QS and inhibiting virulence seems to be one of the most appealing

uses of the knowledge acquired about cell to-cell communication in E. faecalis. Jiro

Nakayama laboratory already proposed peptide antagonists of GBAP that inhibit the

Fsr QS. However, the peptides effectiveness in the host has not been tested yet

(Nakayama et al., 2007; Nakayama et al., 2009; Nakayama et al., 2013).

Our study gives us new clues on the Fsr contribution to E. faecalis biology and during

infection. Through transcription studies we discovered new genes regulated by Fsr

and involved in E. faecalis virulence. Altogether, we propose that inhibition of Fsr can

interfere with different cell processes in bacteria and in the host but does not kill the

bacteria. Adding to this, blocking the Fsr QS does not give us an immediate

decrease of E. faecalis virulence, because even though inhibition of GBAP signalling

is effective, we still have a basal expression and production of GelE and SprE. Even

in small concentration, the virulence factors regulated by Fsr are powerful. We only

had a significant decrease on virulence when we infected the host with the mutant for

GENERAL DISCUSSION

185

Cha

pter

VI

fsrB, gelE and sprE genes. A target that blocks Fsr needs to ensure that QS is shut

down and that the basal production of virulence factors is eliminated.

But the use of new therapeutics based in QS blocking is not straightforward. Studies

in S. aureus and P. aeruginosa, relevant pathogenic bacteria in hospital environment,

showed that QS-cheaters are frequently isolated during colonization of untreated

colonized patients (Kohler et al., 2010; Paulander et al., 2013). The most likely

explanation for this advantage is that the mutants exploit the wild type public goods,

without paying the metabolic cost of their production; although other direct costs of

QS in clinical contexts cannot be ruled out (Kohler et al., 2010). When QS-gene

expression is reduced by the QS inhibiting drug, this advantage of QS-cheater is lost

and virulent isolates predominate both in colonized patients and during in vitro

experiments. These results suggest that QS-blockage may increase the prevalence

of more virulent QS-responders among colonizing isolates in the hospital

environment (Kohler et al., 2010). Recently, the antibiotic azithromycin, that blocks

the QS of P. aeruginosa, was proposed for the prevention of ventilator-associated

pneumonia in patients with prolonged colonization and the results suggest that

virulence inhibition is a promising anti-microbial strategy (van Delden et al., 2012).

Taking into account these recent studies, the use of QS-blockers needs to be

carefully studied but can be a powerful tool for the control or prevention of E. faecalis

infection in the hospital environment.

Altogether, the work developed in this thesis leads us to propose a novel therapeutic

strategy against E. faecalis based on the Fsr system, by mediating the prevention or

elimination of cell communication and virulence factors that cause host damage.

Nevertheless, the Fsr role during melanization process needs to be further explored

in order to understand which part of the cascade is blocked. It will be interesting to

elucidate the role of each gene regulated by Fsr during infection and in the

melanization control. Concerning the effect of vancomycin on the Fsr QS, it would be

interesting to further exploit the possibility of using this knowledge to produce a new

and effective therapeutic strategy.

Chapter VI

186

4. BIBLYOGRAPHY

Ayres, J. S. & Schneider, D. S. (2012). Tolerance of infections. Annu Rev Immunol

30, 271-294.

Bisicchia, P., Bui, N. K., Aldridge, C., Vollmer, W. & Devine, K. M. (2011).

Acquisition of VanB-type vancomycin resistance by Bacillus subtilis: the impact on

gene expression, cell wall composition and morphology. Mol Microbiol 81, 157-178.





Cerenius, L., Lee, B. L. & Soderhall, K. (2008). The proPO-system: pros and cons

for its role in invertebrate immunity. Trends in immunology 29, 263-271.

Chong, G., Kimyon, O. & Manefield, M. (2013). Quorum Sensing Signal Synthesis

May Represent a Selective Advantage Independent of Its Role in Regulation of

Bioluminescence in. PLoS One 8, e67443.

Czaran, T. & Hoekstra, R. F. (2009). Microbial communication, cooperation and

cheating: quorum sensing drives the evolution of cooperation in bacteria. PLoS One

4, e6655.

Defoirdt, T., Brackman, G. & Coenye, T. (2013). Quorum sensing inhibitors: how

strong is the evidence? Trends Microbiol 21, 619-624.

GENERAL DISCUSSION

187

Cha

pter

VI

Garcia, C. C., Weston-Davies, W., Russo, R. C. & other authors (2013).

Complement C5 activation during influenza A infection in mice contributes to

neutrophil recruitment and lung injury. PLoS One 8, e64443.

Jiang, H., Wang, Y., Yu, X. Q., Zhu, Y. & Kanost, M. (2003). Prophenoloxidase-

activating proteinase-3 (PAP-3) from Manduca sexta hemolymph: a clip-domain

serine proteinase regulated by serpin-1J and serine proteinase homologs. Insect

Biochem Mol Biol 33, 1049-1060.

Kohler, T., Perron, G. G., Buckling, A. & van Delden, C. (2010). Quorum sensing

inhibition selects for virulence and cooperation in Pseudomonas aeruginosa. PLoS

Pathog 6, e1000883.






Nakayama, J., Uemura, Y., Nishiguchi, K., Yoshimura, N., Igarashi, Y. &

Sonomoto, K. (2009). Ambuic acid inhibits the biosynthesis of cyclic peptide

quormones in gram-positive bacteria. Antimicrob Agents Chemother 53, 580-586.

Nakayama, J., Yokohata, R., Sato, M. & other authors (2013). Development of a

peptide antagonist against fsr quorum sensing of Enterococcus faecalis. ACS Chem

Biol 8, 804-811.

Chapter VI

188




Park, S. Y., Shin, Y. P., Kim, C. H., Park, H. J., Seong, Y. S., Kim, B. S., Seo, S. J.

& Lee, I. H. (2008). Immune evasion of Enterococcus faecalis by an extracellular

gelatinase that cleaves C3 and iC3b. J Immunol 181, 6328-6336.

Paulander, W., Nissen Varming, A., Baek, K. T., Haaber, J., Frees, D. & Ingmer,

H. (2013). Antibiotic-mediated selection of quorum-sensing-negative Staphylococcus

aureus. MBio 3, e00459-00412.

Raina, S., De Vizio, D., Odell, M., Clements, M., Vanhulle, S. & Keshavarz, T.

(2009). Microbial quorum sensing: a tool or a target for antimicrobial therapy?

Biotechnology and applied biochemistry 54, 65-84.

Rumbaugh, K. P., Trivedi, U., Watters, C., Burton-Chellew, M. N., Diggle, S. P. &

West, S. A. (2012). Kin selection, quorum sensing and virulence in pathogenic

bacteria. Proc Biol Sci 279, 3584-3588.

Sieradzki, K. & Tomasz, A. (1997). Inhibition of cell wall turnover and autolysis by

vancomycin in a highly vancomycin-resistant mutant of Staphylococcus aureus. J

Bacteriol 179, 2557-2566.





GENERAL DISCUSSION

189

Cha

pter

VI

Strickertsson, J. A., Desler, C., Martin-Bertelsen, T., Machado, A. M., Wadstrom,

T., Winther, O., Rasmussen, L. J. & Friis-Hansen, L. (2013). Enterococcus

faecalis infection causes inflammation, intracellular oxphos-independent ROS

production, and DNA damage in human gastric cancer cells. PLoS One 8, e63147.


Fly 3, 105-111.

Tao, T., Snavely, M. D., Farr, S. G. & Maguire, M. E. (1995). Magnesium transport

in Salmonella typhimurium: mgtA encodes a P-type ATPase and is regulated by

Mg2+ in a manner similar to that of the mgtB P-type ATPase. J Bacteriol 177, 2654-

2662.










Uratani, Y. & Hoshino, T. (1984). Pyocin R1 inhibits active transport in

Pseudomonas aeruginosa and depolarizes membrane potential. J Bacteriol 157,

632-636.

Chapter VI

190

van Delden, C., Kohler, T., Brunner-Ferber, F., Francois, B., Carlet, J. &

Pechere, J. C. (2012). Azithromycin to prevent Pseudomonas aeruginosa ventilator-

associated pneumonia by inhibition of quorum sensing: a randomized controlled trial.

Intensive Care Med 38, 1118-1125.

GENERAL DISCUSSION

191

Cha

pter

VI

Documents

FSR QUORUM SENSING - Universidade NOVA de Lisboa · When Quorum Sensing (QS) was discovered it was realized that bacteria have a kind of “social life” and they cooperate and coordinate