From the Gene to the From the Gene to the GenomeGenome

Genetic Inheritance PatternsGenetic Inheritance Patterns

Observing Genetic Differences in Observing Genetic Differences in the DNAthe DNA

Each human has 46 chromosomes. Each human has 46 chromosomes. Each parent provides one member of a Each parent provides one member of a matched (homologous) chromosome pair. matched (homologous) chromosome pair.

Chromosomal Locations of GenesChromosomal Locations of Genes• Locus = area on chromosome where Locus = area on chromosome where

gene is located gene is located • Paired chromosomes have genes in Paired chromosomes have genes in

the same order, but may have the same order, but may have different forms of a gene at the same different forms of a gene at the same locuslocus

• Alleles = alternative forms of a geneAlleles = alternative forms of a gene– Dominant allele masks other Dominant allele masks other

allelesalleles– Recessive allele is masked Recessive allele is masked

• Gene = sequence of DNA that codes Gene = sequence of DNA that codes for a protein, gives rise to physical for a protein, gives rise to physical traittrait

Locus 1Locus 1Locus 2Locus 2

Locus 3Locus 3

Separation ofSeparation ofChromosome PairsChromosome Pairs

W w

ChromosomesChromosomesduplicateduplicate

Pairs separate

Duplicatesseparate

dominant allele

rec

ess

ive

alle

le

Each sex cell will Each sex cell will carry only one allele carry only one allele for each genefor each gene wwW W

wwW W

W wW w

Duplicatesseparate

Inheritance Pattern for One GeneInheritance Pattern for One Gene(for genes on pairs 1-22)(for genes on pairs 1-22)

TT or Tt = no diseaseTT or Tt = no diseasett = Tay-Sachs diseasett = Tay-Sachs disease

Donald, no diseaseDonald, no disease Darla, no diseaseDarla, no diseaseTtTt TtTt

TT

tt

T t T t

TTTT

TtTt

TtTt

tttt

Chances with each Chances with each pregnancy: pregnancy: 75% no disease75% no disease25% Tay-Sachs disease25% Tay-Sachs disease

phenotype = physical

characteristic

homozygous recessive

homozygous dominant

heterozygous(carrier)

genotype = set of alleles

Molecular Basis for Effects of Molecular Basis for Effects of Dominant and Recessive AllelesDominant and Recessive Alleles

• Dominant AlleleDominant Allele– codes for a functional proteincodes for a functional protein– eg. T allele gives instructions for making eg. T allele gives instructions for making

Hexosaminidase A (Hex A), an enzyme involved in Hexosaminidase A (Hex A), an enzyme involved in lipid metabolismlipid metabolism

• Recessive AlleleRecessive Allele– codes for a non-functional protein or prevents any codes for a non-functional protein or prevents any

protein product from being formedprotein product from being formed– eg. with the t allele, no functional Hex A is detectedeg. with the t allele, no functional Hex A is detected

Variations in Genetic Patterns: CodominanceVariations in Genetic Patterns: Codominance

Neither allele masks the other so that effects Neither allele masks the other so that effects of both alleles are observed in heterozygotes of both alleles are observed in heterozygotes without blendingwithout blending

Example: ABO Blood TypeExample: ABO Blood Type

Blood TypeBlood Type GenotypesGenotypes

Type AType A AA or AoAA or Ao

Type BType B BB or BoBB or Bo

Type ABType AB ABAB

Type OType O oooo

Alleles A and B are codominant.Alleles A and B are codominant.Alleles AAlleles A and B are completely dominant over o.and B are completely dominant over o.

Effects of both alleles observed

in phenotype

Type A

Type B

Type AB

Type O

Variations in Genetic Patterns: Multiple AllelesVariations in Genetic Patterns: Multiple AllelesThree or more alleles exist for one traitThree or more alleles exist for one trait[Note: A person can only carry any two[Note: A person can only carry any two of these alleles at once.] of these alleles at once.]

Examples: ABO Blood TypeExamples: ABO Blood Typeand also Rh Factorand also Rh Factor

PhenotypePhenotype Genotype*Genotype* Protein on Red Protein on Red Blood CellsBlood Cells

Rh PositiveRh Positive RR or RrRR or Rr Rhesus ProteinRhesus Protein

Rh NegativeRh Negative rrrr NoneNone

*Although there are multiple R alleles, R*Although there are multiple R alleles, R11, R, R22, R, R33, etc. all are, etc. all are

completely dominant over all of the r alleles, rcompletely dominant over all of the r alleles, r11, r, r22, r, r33, etc. , etc.

ABO Blood Type and Rh Factor are controlled by ABO Blood Type and Rh Factor are controlled by separate genes. They are inherited independently.separate genes. They are inherited independently.

Variations in Genetic Patterns: Polygenic InheritanceVariations in Genetic Patterns: Polygenic Inheritance

Many genes affect one traitMany genes affect one traitExample: Skin colorExample: Skin color

Number of Number of Dominant Dominant

AllelesAlleles

Skin Color*Skin Color*

(Phenotype)(Phenotype)

GenotypesGenotypes % Pigmentation*% Pigmentation*

00 WhiteWhite aabbaabb 0-11%0-11%

11 Light BlackLight Black Aabb or aaBbAabb or aaBb 12-25%12-25%

22 Medium BlackMedium Black AAbb or AaBb or AAbb or AaBb or aaBBaaBB

26-40%26-40%

33 Dark BlackDark Black AABb or AaBBAABb or AaBB 41-55%41-55%

44 Darkest BlackDarkest Black AABBAABB 56-78%56-78%

*Based on a study conducted in Jamaica. *Based on a study conducted in Jamaica.

Variations in Genetic Patterns: Variations in Genetic Patterns: Sex Influenced GenesSex Influenced Genes

Genes that have different dominance Genes that have different dominance patterns in males and femalespatterns in males and females

Example: Pattern BaldnessExample: Pattern BaldnessCaused by a dominant allele in males,Caused by a dominant allele in males,

but a recessive allele in femalesbut a recessive allele in females

bbbb

BB or BbBB or Bb bbbb

BB or BbBB or Bb

Inheritance for Sex-linked GenesInheritance for Sex-linked Genes(for genes on pair 23)(for genes on pair 23)

Hemophilic Male Non-hemophilic Hemophilic Male Non-hemophilic

FemaleFemale

XXhh

YY

XXHH X Xhh

XXHHXXhh XXhhXXhh

XXHHYY XXhhYY

Chance for each pregnancy:Chance for each pregnancy:¼ non-hemophilic females; ¼ hemophilic females ¼ non-hemophilic females; ¼ hemophilic females

¼ non-hemophilic males; ¼ hemophilic males ¼ non-hemophilic males; ¼ hemophilic males

x Xx XHHXXhh

Males carry only one copy of genes on the X chromosomeMales carry only one copy of genes on the X chromosomeFemales can be homozygous or heterozygous these genesFemales can be homozygous or heterozygous these genes

H = no hemophiliaH = no hemophiliah = hemophiliah = hemophilia

GrampsGrampsXXhhYY

(father is hemophilic)(father is hemophilic)

XXhhYY

The Human Genome Project: Genetic Differences at the DNA Level

Per 23 chromosomes

Now estimated at 30,000

genes

Studying DNAStudying DNA• Cut chromosomal DNA into smaller pieces Cut chromosomal DNA into smaller pieces

with restriction enzymeswith restriction enzymes

5’— A A G T C G G A T C C T G A C G T— 3’5’— A A G T C G G A T C C T G A C G T— 3’ 3’— T T C A G C C T A G G A C T G C A— 5’3’— T T C A G C C T A G G A C T G C A— 5’

sticky endsticky end

sticky endsticky end

G A T C C T G A C G T— 3’G A T C C T G A C G T— 3’ G A C T G C A— 5’G A C T G C A— 5’

5’— A A G T C G5’— A A G T C G3’— T T C A G C C T A G3’— T T C A G C C T A G

Bam H1Bam H1

Bam H1Bam H1Results inResults in

separate fragments separate fragments

Studying DNAStudying DNA

• Cut chromosomal DNA into smaller pieces Cut chromosomal DNA into smaller pieces with restriction enzymeswith restriction enzymes

• Separate DNA pieces by size using agarose Separate DNA pieces by size using agarose gel electrophoresisgel electrophoresis

Electric current is applied Electric current is applied to separate DNA by sizeto separate DNA by size

UV light is used to detect a UV light is used to detect a fluorescent dye attached to fluorescent dye attached to

the DNA fragmentsthe DNA fragments

Example of a gel patternExample of a gel pattern

DNA samples are placed DNA samples are placed in an agarose gelin an agarose gel

Agarose Gel ElectrophoresisAgarose Gel Electrophoresis

larger fragments

smaller fragments

Studying DNAStudying DNA

• Transfer DNA to filter for analysis with probe Transfer DNA to filter for analysis with probe that will bind to specific sequencethat will bind to specific sequence

DNA separated by sizeDNA separated by sizeis transferred from is transferred from agarose gel to filteragarose gel to filter

DNA pattern on filter will be identical to gel separation pattern.DNA pattern on filter will be identical to gel separation pattern.

Studying DNAStudying DNA

Probe: sequence of DNA that is Probe: sequence of DNA that is complementary to the sequence of complementary to the sequence of interest; Used to locate a copy of the interest; Used to locate a copy of the DNA sequence by hybridizationDNA sequence by hybridization

Add ProbeAdd ProbeProbe Binds to gene Probe Binds to gene

AGCTTAGCGATAGCTTAGCGATTCGAATCGCTATCGAATCGCTA

AATCGCAGCTTAGCGATAGCTTAGCGAT

TCGAATCGCTATCGAATCGCTA

Denature DNA by heatingDenature DNA by heating

DNA Pattern on Gel Pattern on Filter after probe binding

Studying DNAStudying DNA

• Allow probe to bind to DNA on filter, visualize Allow probe to bind to DNA on filter, visualize region of probe attachmentregion of probe attachment

DNA on filter is DNA on filter is exposed to probe exposed to probe to detect to detect complementary complementary sequences.sequences.

Studying DNAStudying DNA• Identify similarities and differences between Identify similarities and differences between

individuals– Paternity Testingindividuals– Paternity Testing

X

X

X

X

X

X

X

X

Testing for Sickle Cell Alleles

Studying DNAStudying DNA• Identify patterns that are unique to specific Identify patterns that are unique to specific

genes– Medical Genetic Testinggenes– Medical Genetic Testing

On the basis of this analysis, the genotype of the fetus is 1. AS 2. AA 3. SS 4. Unknown

Future Directions: Future Directions: Gene TherapyGene Therapy

Andrew Gobea

Ashanthi DeSilva

Treated for SCIDTreated for SCIDSevere Combined Immune DeficiencySevere Combined Immune Deficiency